CLINICAL AND DIAGNOSTIC LABORATORY IMMUNOLOGY,1071-412X/99/$04.0010

May 1999, p. 336–340 Vol. 6, No. 3

Copyright © 1999, American Society for Microbiology. All Rights Reserved.

Detection of Cryptdin in Mouse SkinYOSHINORI SHIRAFUJI, TAKASHI OONO, HIROKO KANZAKI,

SATOSHI HIRAKAWA, AND JIRO ARATA*

Department of Dermatology, Okayama University Medical School,Shikata-cho 2-5-1, Okayama 700-8558, Japan

Received 17 August 1998/Returned for modification 27 October 1998/Accepted 22 January 1999

Defensins are widely distributed and broad-spectrum antimicrobial peptides with activities against bacteria,fungi, and enveloped viruses. Defensins have been isolated from granules of neutrophils from humans, rabbits,rats, and guinea pigs. They have also been found in lung macrophages as well as in Paneth cells of the human,rabbit, and mouse small intestine. The human b-defensin-2 was recently isolated from human skin. In thisstudy, we detected the expression of mRNA for the defensin cryptdin in BALB/c mouse skin by means of reversetranscriptase PCR amplification. Expression was also detected in dispase-separated epidermis and culturedkeratinocytes, but expression was not detected in fibroblasts. The expression of cryptdin mRNA was found tobegin on embryonic day 17.5. As determined with specific primers, the cDNA sequence cloned from the skin wasfound to be identical to that previously reported for cryptdin-5. cDNA derived from cultured keratinocytesdemonstrated the sequences of the cryptdin-6 and cryptdin-1 isoforms. In situ hybridization analysis showedthat the mRNA of cryptdin was expressed in the suprabasal keratinocytes of the skin in embryonic andneonatal days and then shifted to the hair bulbs in the skin of adult mice.

Antimicrobial polypeptides are widely distributed within an-imal tissues and cells that frequently encounter microorgan-isms (4). Some antimicrobial peptides are stabilized by disul-fide bonds, which may increase their resistance to proteolysisor loss of conformation. Antimicrobial peptides that containsix cysteines have been classified as defensins (7). They arecationic, 3- to 4-kDa peptides characterized by nine highlyconserved amino acids, including six invariant cysteine residuesin a unique disulfide motif (21). They are divided into thea-defensins, the b-defensins, and the insect defensins. Thethree defensin groups differ from each other in the spacing andconnectivity of their six cysteine residues (7). These peptidesexhibit broad-range activities against gram-negative and gram-positive bacteria, many fungi, and some enveloped viruses (11,13, 17), including the human immunodeficiency virus (16).

Mammalian defensins were first identified in phagocytic leu-kocytes from humans, rabbits, guinea pigs, and rats (12). Sub-sequently, they were found in certain epithelial cells (3) andhuman and murine Paneth cells of the small intestine (10, 18).The defensin cryptdin is a Paneth cell corticostatin and defen-sin found in the mouse small bowel. The mRNA of cryptdin isone of many highly abundant mRNAs of low molecular weightthat appear during postnatal intestinal development (18).

Some antimicrobial peptides have been isolated from animaland human skin, e.g., LL-37 (5), a class of peptides known asmagainins (24), and dermaseptin (15). Recently, b-defensin-2was isolated from human skin (9). However, defensins have notyet been reported in the skin of rodents. In this study, wedetected mRNA expression of the defensin cryptdin in the skinof BALB/c mice using reverse transcriptase (RT) PCR (RT-PCR) amplification and subsequent sequence analysis. We alsoexamined the developmental expression pattern of cryptdinmRNA in the embryonic mouse skin and performed in situhybridization analysis to localize cryptdin.

MATERIALS AND METHODS

Preparation of tissues and cell cultures. The strain of BALB/c mice used inthis study was purchased from the mouse colony of Okayama University. Skinsamples were taken from adult (6-week-old) female mice, neonatal mice, andmouse embryos on embryonic days 15.5 (E15.5 mice) and 17.5 (E17.5 mice). Theintestines of adult mice were used as positive controls. For in situ hybridization,the skin samples from E17.5, neonatal, and adult mice and the intestines of adultmice were fixed in 4% paraformaldehyde in 0.1 M phosphate-buffered saline at4°C for 5 h. The fixed tissues were dehydrated through a series of ethanol washes,immersed in xylene, and embedded in paraffin wax.

Primary cultures of keratinocytes and fibroblasts were obtained from the backskin of neonatal mice. Skin samples were minced and incubated in phosphate-buffered saline containing 1000 pU of dispase (Goudou Shusei, Tokyo, Japan)per ml at 4°C for 24 h. The specimen was separated into the epidermis and thedermis, and the epidermis was trypsinized (0.25% trypsin, 0.02% EDTA) at 37°Cfor 20 min. Keratinocytes were cultured in Keratinocyte Basal Medium (Bio-whittaker, Walkersville, Md.) containing 30 mg of bovine pituitary extract per ml,0.1 ng of epidermal growth factor per ml, 0.25 mg of hydrocortisone per ml, 5 ngof insulin per ml, 50 mg of gentamicin per ml, and 50 ng of amphotericin B perml. Fibroblasts were cultured in Dulbecco’s modified Eagle’s medium containing10% fetal bovine serum (GIBCO, Grand Island, N.Y.). Cells were maintained at37°C in a humidified atmosphere of 5% CO2. Keratinocytes that were passagedthree times and fibroblasts that were passaged twice were used.

RT-PCR. Total RNA from tissue samples and cultured cells was extracted withthe TRIzol Reagent (Life Technologies, Gaithersburg, Md.), according to themanufacturer’s instructions. RNA was reverse transcribed with Ready to go Youprime First-Strand Beads (Pharmacia Biotech, Grand Island, N.Y.), according tothe manufacturer’s instructions. Briefly, total RNA (5 mg) from each sample wasreverse transcribed with 5 mg of oligo(dT) primer.

Amplification by PCR was conducted in a 30-ml reaction volume containing103 PCR Buffer II, 0.5 mM each primer, 1.7 mM MgCl2 solution, each de-oxynucleoside triphosphate at a concentration of 0.2 mM, and 1.5 U of Taqpolymerase (AmpliTaq Gold; Perkin-Elmer Corporation, Foster City, Calif.).One microliter of each cDNA mixture was used as a template. The PCR mixturewas overlaid with mineral oil. Amplification of cryptdin was conducted in athermocycler (PC-700; ASTEC, Fukuoka, Japan) with the following profiles:95°C for 9 min (1 cycle) and 94°C for 1 min, 60°C for 1 min, and 72°C for 2 min(35 cycles). Amplification of b-actin was conducted with the following profiles:95°C for 9 min (1 cycle) and 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min(35 cycles). The products of PCR were analyzed by gel electrophoresis on 2%agarose gels. Amplification by PCR of cryptdin from cDNA was accomplishedwith primers Defcrp130 (AAGAGACTAAAACTGAGGAGCAGC) and Defcrm380(GGTGATCATCAGACCCCAGCATCAGT) (2). The primer Defcrp130 corre-sponds to nucleotides 80 to 103 in cryptdin-1 cDNA. It is an exact match withcryptdin-1 and -4 cDNAs and has a single mismatch at primer nucleotide 11(A3T) with the cryptdin-5 mRNA sequence. The primer Defcrm380 hybridizesto the sequence 39 of the termination codon on the sense strand and primes allknown cryptdin mRNAs. Amplification by PCR of mouse b-actin from cDNAincluded a commercial amplimer set (CLONTECH Laboratories, Palo Alto,

* Corresponding author. Mailing address: Department of Derma-tology, Okayama University Medical School, Shikata-cho 2-5-1,Okayama 700, Japan. Phone: 81-86-235-7282. Fax: 81-86-235-7283.E-mail: ropin@cc.okayama-u.ac.jp.

336

on March 26, 2020 by guest

http://cvi.asm.org/

Dow

nloaded from

Calif.) both to confirm the integrity of the cDNA transcripts and to check for thepresence of contaminating genomic DNA.

Clone construction and selection. Cryptdin PCR products were ligated directlyinto PCR-Script Amp SK(1) cloning vectors with a PCR-Script Amp SK(1)cloning kit (Stratagene, La Jolla, Calif.) according to the manufacturer’s instruc-tions. Constructs were transformed into Escherichia coli XL1-Blue MRF9 Kansupercompetent cells (Stratagene). Transformants were selected on laked bloodagar containing ampicillin (50 mg/ml).

DNA sequencing. Double-stranded plasmid DNA bearing an appropriate in-sert was isolated for further use as a sequencing template. Cycle sequencing wasaccomplished with an ABI Prism Dye Terminator Cycle Sequencing ReadyReaction Kit (PE Applied Biosystems, Warrington, Great Britain), in accor-dance with the manufacturer’s instructions. M13 universal and reverse primerswere used for sequencing. Sequence homologies were determined by using theBLAST server of the National Center for Biotechnology Information.

In situ hybridization. (i) Preparation of DIG-labeled RNA probes. Digoxige-nin (DIG)-11-UTP-labeled single-stranded RNA probes were prepared with theDIG RNA Labeling Kit (Boehringer Mannheim, Mannheim, Germany), accord-ing to the manufacturer’s instructions. Briefly, plasmid DNA bearing cryptdinwas linearized with appropriate restriction enzymes, and DIG-labeled sense andantisense probes were obtained by in vitro transcription with T3 and T7 RNApolymerases (Stratagene) together with 103 transcription buffer, a DIG-RNAlabeling mixture, and an excess of RNase inhibitor (Stratagene). After digestionof the original linearized template cDNA with DNase and several ethanol pre-cipitation steps, the probes were dissolved in water and used for hybridization.

(ii) Hybridization procedure. In situ hybridization was performed by the meth-ods previously reported by Senboshi et al. (23). Deparaffinized sections weretreated with 1 mg of proteinase K (Boehringer Mannheim) per ml, acetylated inacetic anhydride solution, and then dehydrated. Hybridization with freshly de-natured sense or antisense RNA probes was performed in humidified chambersat 50°C for 15 h. Sections were washed after hybridization at 50°C under highlystringent conditions. Prior to immunodetection of the in situ hybridization signal,the sections were incubated in blocking solution (DIG Nucleic Acid DetectionKit; Boehringer Mannheim). Incubation with polyclonal sheep anti-DIG Fabfragments conjugated to alkaline phosphatase (Boehringer Mannheim) was per-formed for 30 min in humidified chambers at room temperature. The sectionswere stained by incubation in nitroblue tetrazolium and b-chloroindolyl phos-phate solution (Boehringer Mannheim) in darkness at room temperature. Thetime required for color development was dependent on the probes used.

RESULTS

PCR amplification of cryptdin. The amplification productsof murine small intestine, whole skin, epidermis, and keratin-ocyte demonstrated the same single band of 272 bp (Fig. 1).However, the cDNA produced from cultured fibroblasts didnot yield the band, indicating that mesenchymal cells such asfibroblasts may not be involved in cryptdin mRNA production.An amplification product of 500 bp was also synthesized fromall cDNA templates with the b-actin primer set (Fig. 1).

Cryptdin gene expression in skin development. The bandcorresponding to b-actin was detected from all samples by

PCR amplification with specific primers. Cryptdin gene expres-sion was detected in the skin of E17.5, neonatal, and adult mice(Fig. 2). Each of these samples produced a clear, single, 272-bpband. Those bands from samples from E17.5 and neonatalmice were more intense than those from samples from adultmice. No band was detected in the skin of E15.5 mice.

Sequence analysis. The primer pair used amplifies approxi-mately half of exon 1 (nucleotides 80 to 172) and all of exon 2of cryptdin cDNA. We performed sequence analysis in theseregions of cryptdin cDNA with PCR-Script Amp SK(1)-cloned PCR products obtained from samples from the smallintestine, whole skin, epidermis, and keratinocytes (Fig. 3).The sequence of cDNA derived from whole skin demonstratednearly perfect identity with the previously reported cryptdin-5sequence except for a single mismatch at cryptdin nucleotide90 (T3A; primer nucleotide 11). The DNA sequence ampli-fied from the epidermis was also aligned with the sequence ofcryptdin-5. The cDNA sequences amplified from cultured ker-atinocytes perfectly corresponded to exon 1 of cryptdin-6 andshowed mismatches only at cryptdin nucleotides 183 (T3G)and 200 (G3T). The transition at position 183 resulted in amissense mutation that changed a tyrosine codon to one foraspartic acid, and the transition at position 200 resulted in amissense mutation that changed an arginine codon to one forisoleucine. Another clone derived from keratinocytes demon-strated the sequence of a cryptdin-1-like peptide, cryptdin-11.Exon 1 of the clone correlated with that of cryptdin-1 com-pletely, and only one substitution was found at nucleotide 237(A3G) in codon 79, resulting in a silent mutation.

Developmental appearance of cryptdin mRNA in murineskin. The expression of cryptdin mRNA was clearly detected insuprabasal keratinocytes of the epidermis of the skin of E17.5and neonatal mice when a DIG-labeled antisense cRNA probewas used (left-hand panels of Fig. 4A and B, respectively). Nosignal was detected in the dermis. In the skin of adult mice, theepidermis did not have a detectable signal for cryptdin, but asignal was localized to keratinocytes of the hair bulbs (left-handpanel of Fig. 4C). No signal was observed in the skin when thesense probe was used (Fig. 4A, B, and C, right-hand panels).

DISCUSSION

Understanding of the mechanism by which the body natu-rally defends itself against bacterial invasion through the skinmay lead to a new approach to the control of bacterial infec-tions. In this context, defensins and similar antimicrobial pep-

FIG. 1. PCR amplification of cryptdin. RNA samples isolated from wholeskin, dispase-separated epidermis, cultured keratinocytes, and cultured fibro-blasts were reverse transcribed and amplified with the cryptdin primer set andthe b-actin primer set as described in Materials and Methods. PCR productswere analyzed by electrophoresis.

FIG. 2. Cryptdin gene expression in skin development. RNA samples ex-tracted from the skin of E15.5, E17.5, neonatal, and adult mice were reversetranscribed and amplified with the cryptdin primer set and the b-actin primer setas described in Materials and Methods. PCR products were analyzed by elec-trophoresis.

VOL. 6, 1999 CRYPTDIN IN MOUSE SKIN 337

on March 26, 2020 by guest

http://cvi.asm.org/

Dow

nloaded from

tides have become the objects of research. Recently, defensinshave been detected in Paneth cells of human and murineintestines, in tracheal epithelial cells, as well as in phagocytes,where it is presumed that they are involved in the inhibition ofbacterial colonization in the mucosa. The report of humanb-defensin-2 expression in human keratinocytes by Harder etal. (9) in 1997 has stimulated interest in the function of thedefensin system in the skin. Further investigation of this systemrequires experimental models, but such models have yet to bereported. The present study investigated antimicrobial peptideexpression in mouse skin by using murine Paneth cell defensin(cryptdin)-specific primers.

Amplification by RT-PCR with a cryptdin-specific primer setdemonstrated the expression of cryptdin mRNA in whole skin,epidermis, and cultured keratinocytes but detected no cryptdinmessage in cultured fibroblasts. Our data suggest that epithe-lial cells are the primary source of murine skin cryptdin.

Cryptdin message expression during the development of mu-

rine skin was also examined. The intensity of the band identi-fied with cryptdin increased drastically from embryonic day17.5. This suggests that the expression of cryptdin in the skinmay not require contact with microorganisms. Ouellette et al.(18) reported that enteric cryptdin mRNAs were equally abun-dant in germ-free adult mice and naturally reared adult mice.During embryonic development, murine skin differentiatesrapidly: on embryonic day 14, an intermediate layer formsabove the basal layer; on embryonic days 15 and 16, kerato-hyaline granules appear in the uppermost layer, known as thegranular layer, and hair bulbs begin to form. A cornified layerforms above the granular layer on embryonic days 16 to 18.Finally, on neonatal day 2, the epidermis is fully developed andconsists of four histologically distinct cell layers: the basal,spinous, granular, and cornified layers (14). The expression ofcryptdin appears to correlate with the maturity and the differ-entiation of the skin. In an experiment with athymic nude mice,enteric defensin mRNA was found to be abundant, indicating

FIG. 3. Murine cDNA sequences obtained from whole skin, dispase-separated epidermis, and cultured keratinocytes were compared with established cDNAsequences from the consensus cryptdin gene and the cryptdin-1, -2, -3, -5, and -6 isoforms. Nucleotides are numbered from the first residue of the initiating methioninecodon. An X in the consensus sequence indicates a position at which at least two sequences contain nucleotide substitutions. Coding sequences are indicated withuppercase letters, while untranslated sequences are indicated with lowercase letters. The junction between exon 1 and exon 2 is also indicated.

338 SHIRAFUJI ET AL. CLIN. DIAGN. LAB. IMMUNOL.

on March 26, 2020 by guest

http://cvi.asm.org/

Dow

nloaded from

FIG. 4. Developmental appearance of cryptdin mRNA in murine skin. The expression of cryptdin mRNA was determined in the skin of E17.5 (A), neonatal (B),and adult (C) mice. Antisense probe was used for samples in the left-hand panels. Sense probe was used for samples in the right-hand panels. DIG-labeled probe wasdetected with sheep antibody to DIG.

VOL. 6, 1999 CRYPTDIN IN MOUSE SKIN 339

on March 26, 2020 by guest

http://cvi.asm.org/

Dow

nloaded from

that cellular immunity has no influence on cryptdin expression(18). The neonatal immune system is functionally immature;shortly after birth, the counts of mature T cells in the spleenare 1,000-fold lower than those in the spleens of adults (20).During the neonatal period, cryptdin may compensate for thisimmature immune system by acting as a biochemical shield.

Sequence analysis showed that all clones derived from thewhole skin and epidermis demonstrated nearly perfect identitywith cryptdin-5. This suggests that the skin of BALB/c miceprimarily expresses the cryptdin-5 isoform in vivo. However,cDNA derived from cultured keratinocytes corresponded tocryptdin-6 and cryptdin-11. The sequence of cryptdin-11 thatwe isolated had one mismatch at position 237 in the exon 2coding the mature peptide. Thus, it appears that keratinocytesmay produce some forms of cryptdin. Darmoul et al. (1) re-ported that intestinal mRNAs coding for cryptdin-1-like iso-forms were chiefly detected in adult mice but that cryptdin-6was the most abundant enteric defensin mRNA in the newborn.The expression of cryptdin isoforms may be influenced by thedegree of development and differentiation. More than 20 cryptdinisoform mRNAs have been found in the full-length mouse smallintestine, and 17 of these cryptdin-coding mRNAs were clonedfrom a single jejunum crypt (19). Further examination may revealthat other forms of cryptdin are expressed by keratinocytes.

Whether the expression of cryptdin-5 is species specific ororgan specific remains unclear. Compared to myeloid de-fensins, intestinal defensins have variably extended NH2 ter-mini that contain from three amino acids (as in cryptdin-4) tosix amino acids (as in cryptdin-5) preceding the first cysteine(22). Because such variations in defensin amino termini havebeen shown to correlate with relative antimicrobial potency invitro (8), the structure of cryptdin-5 may be appropriate for thecontainment of bacterial colonization and invasion of the skin.When the activities of cryptdins 1 through 6 against E. coliML35 were compared by a plate diffusion assay, cryptdin-4 andcryptdin-5 were substantially more active than the other fourintestinal cryptdins (19).

In situ hybridization analysis showed that cryptdin tran-scripts were expressed within the keratinocytes of the supra-basal layer from the embryonic to the neonatal days. Fulton etal. (6) showed that human b-defensin-1 transcripts localizewithin the suprabasal keratinocytes of the skin. This pattern ofcryptdin distribution appears to be efficient for protectionagainst pathogens from the outside of skin with few hairs.However, in this study, we showed that in the skin of adultmice, the mRNA of cryptdin localized to the keratinocytes ofhair bulbs. Because the body surface of most animals is cov-ered with hair, this localization pattern may be favorable. Thechange in the distribution pattern of cryptdin in the smallintestine during development was reported by Darmoul et al.(1). Unlike in adult mice, where only Paneth cells are immu-nopositive for cryptdin, cryptdin-containing cells were distrib-uted throughout the developing intestinal epithelium of thenewborn and not in association with rudimentary crypts (1).These facts suggest that cryptdin localization in the skin maychange during development and differentiation.

In this study, we detected cryptdin-5 mRNA expression inmouse skin, we determined that the expression of cryptdinmRNA began between embryonic days 15.5 and 17.5, and wediscovered that cryptdin transcripts were initially expressedwithin the keratinocytes of the suprabasal layer from the em-bryonic to the neonatal days and then shifted to the hair bulbs.We speculate that cryptdin-5 is a more efficient protector thanany other isoform of cryptdin in limiting bacterial colonizationand invasion of the skin.

ACKNOWLEDGMENT

This work was supported by Grant-in-Aid for Scientific Research09877159 (to H.K. and T.O.) from the Ministry of Education, Scienceand Culture of Japan.

REFERENCES

1. Darmoul, D., D. Brown, M. E. Selsted, and A. J. Ouellette. 1997. Cryptdingene expression in developing mouse small intestine. Am. J. Physiol. 272:G197–G206.

2. Darmoul, D., K. M. Huttner, D. M. Frederick, and A. J. Ouelette. 1996.Positional specificity of defensin gene expression reveals Paneth cell hetero-geneity in mouse small intestine. Am. J. Physiol. 271:G68–G74.

3. Diamond, G., M. Zasloff, H. Eck, M. Brasseur, W. L. Maloy, and C. L.Bevins. 1991. Tracheal antimicrobial peptide, a novel cysteine-rich peptidefrom mammalian tracheal mucosa: isolation and cloning of a cDNA. Proc.Natl. Acad. Sci. USA 88:3952–3956.

4. Eisenhauer, P. B., S. S. Harwig, and R. I. Lehrer. 1992. Cryptdins: antimi-crobial defensins of the murine small intestine. Infect. Immun. 60:3556–3565.

5. Frohm, M., B. Agerberth, G. Ahangari, M. Stahle-Backdahl, S. Liden, H.Wigzell, and G. H. Gudmundsson. 1997. The expression of the gene codingfor the antibacterial peptide LL-37 is induced in human keratinocytes duringinflammatory disorders. J. Biol. Chem. 272:15258–15263.

6. Fulton, C., G. M. Anderson, M. Zasloff, R. Bull, and A. J. Quinn. 1997.Expression of natural peptide antibiotics in human skin. Lancet 350:1750–1751.

7. Ganz, T., and R. I. Lehrer. 1994. Defensins. Curr. Opin. Immunol. 6:584–589.

8. Ganz, T., M. E. Selsted, D. Szklarek, S. S. Harwig, K. Daher, D. F. Bainton,and R. I. Lehrer. 1985. Defensins: natural peptide antibiotics of humanneutrophils. J. Clin. Invest. 76:1427–1435.

9. Harder, J., J. Bartels, E. Christophers, and J. M. Schroder. 1997. A peptideantibiotic from human skin. Nature 387:861.

10. Jones, D. E., and C. L. Bevins. 1992. Paneth cells of the human smallintestine express an antimicrobial peptide gene. J. Biol. Chem. 267:23216–23225.

11. Kohashi, O., T. Ono, K. Ohki, T. Soejima, T. Moriya, A. Umeda, Y. Meno,K. Amako, S. Funakosi, and M. Masuda. 1992. Bactericidal activities of ratdefensins and synthetic rabbit defensins on staphylococci, Klebsiella pneu-moniae (Chedid, 277, and 8N3), Pseudomonas aeruginosa (mucoid and non-mucoid strains), Salmonella typhimurium (Ra, Rc, Rd, and Re of LPS Mu-tants) and Escherichia coli. Microb. Immunol. 36:369–380.

12. Lehrer, R. I., T. Ganz, and M. E. Selsted. 1991. Defensins: endogenousantibiotic peptides of animal cells. Cell 64:229–230.

13. Lehrer, R. I., A. K. Lichtenstein, and T. Ganz. 1993. Defensins: antimicrobialand cytotoxic peptides of mammalian cells. Annu. Rev. Immunol. 11:105–128.

14. Makino, E., M. Namba, and J. Arata. 1996. Are anionic sites involved inchanges in cell layer susceptibility to exfoliative toxin during epidermaldevelopment? Eur. J. Dermatol. 6:191–195.

15. Mor, A., V. H. Nguyen, A. Delfour, D. Migliore-Samour, and P. Nicolas.1991. Isolation, amino acid sequence and synthesis of dermaseptin, a novelantimicrobial peptide of amphibian skin. Biochemistry 30:8824–3017.

16. Nakashima, H., N. Yamamoto, M. Masuda, and N. Fujii. 1993. Defensinsinhibit HIV replication in vitro. AIDS 7:1129. (Letter.)

17. Ogata, K., B. A. Linzer, R. I. Zuberi, T. Ganz, R. I. Lehrer, and A. Catan-zaro. 1992. Activity of defensins from human neutrophilic granulocytesagainst Mycobacterium avium and Mycobacterium intracellulare. Infect. Im-mun. 60:4720–4725.

18. Ouellette, A. J., R. M. Greco, M. James, D. Frederick, J. Naftilan, and J. T.Fallon. 1989. Developmental regulation of cryptdin, a corticostatin/defensinprecursor mRNA in mouse small intestinal crypt epithelium. J. Cell Biol.108:1687–1695.

19. Ouellette, A. J., M. M. Hsieh, M. T. Nosek, D. F. Cano-Gauci, K. M. Huttner,R. N. Buick, and M. E. Selsted. 1994. Mouse Paneth cell defensins: primarystructures and antimicrobial activities of numerous cryptdin isoforms. Infect.Immun. 62:5040–5047.

20. Ridge, J. P., E. J. Fuchs, and P. Matzinger. 1996. Neonatal tolerance revis-ited: turning on newborn T cells with dendritic cells. Science 271:1723–1726.

21. Selsted, M. E., and S. S. Harwig. 1989. Determination of the disulfide arrayin the human defensin HNP-2: a covalently cyclized peptide. J. Biol. Chem.264:4003–4007.

22. Selsted, M. E., S. I. Miller, A. H. Henschen, and A. J. Ouellette. 1992. Entericdefensins: antibiotic peptide components of intestinal host defense. J. CellBiol. 118:929–936.

23. Senboshi, Y., T. Oono, and J. Arata. 1996. Prolidase gene expression in scartissue using in situ hybridization. J. Dermatol. Sci. 12:163–171.

24. Zasloff, M. 1987. Magainins, a class of antimicrobial peptides from Xenopusskin: isolation, characterization of two active forms, and partial cDNA se-quence of a precursor. Proc. Natl. Acad. Sci. USA 84:5449–5453.

340 SHIRAFUJI ET AL. CLIN. DIAGN. LAB. IMMUNOL.

on March 26, 2020 by guest

http://cvi.asm.org/

Dow

nloaded from