Upload
others
View
19
Download
0
Embed Size (px)
Citation preview
DETECTION AND MANAGEMENT OF TOMATO
LEAF CURL VIRUS IN JAMMU REGION
BY
DECHAN CHOSKIT
J-14-M-385
Thesis submitted to Faculty of Postgraduate Studies
in partial fulfilment of requirements
for the degree of
MASTER OF SCIENCE IN AGRICULTURE
PLANT PATHOLOGY
DIVISION OF PLANT PATHOLOGY Sher-e-Kashmir University of Agricultural Sciences & Technology of Jammu,
Main Campus, Chatha, Jammu-180009
2017
Plate No. Particulars
After
Page No.
I. Tomato leaf curl disease of tomato in field
Condition
23
II. Puckering of leaves due to tomato leaf curl
Virus
23
III. Insect vector whitefly (Bemisia tabaci) on
tomato plant
22
IV. Research Field Trial 22
V. Surveying of tomato field. 22
LIST OF PLATES
Table
No. Particulars Page No.
1. Percent disease incidence of tomato leaf curl virus of
tomato at different location of Jammu and
Udhampur district.
23
2. PCR detection of ToLCV in the tomato samples
collected from different locations of Jammu and
Udhampur.
24
3.
Sequence of Tomato leaf curl Jammu and Udhampur
virus.
25-27
4. Screening of different germplasm of tomato against
tomato leaf curl virus under field conditions.
29
5. Summary of disease reaction of different germplasm
against tomato leaf curl virus under field conditions.
29
6. Evaluation of different Insecticides against tomato
leaf curl virus (ToLCV) under field conditions in
variety Pusa Ruby.
31
LIST OF TABLES
Figure
No. Particulars
After
Page No.
1. Percent disease incidence (PDI) of tomato leaf curl
virus at different locations surveyed.
23
2. Gel photograph showing DNA from Jammu and
Udhampur samples.
27
3. Gel photograph showing the positive amplification of
ToLCV leaf samples from Jammu and Udhampur
locations.
27
4. Blast based sequence alignment of ToLCV - Jammu 27
5. Blast based sequence alignment of ToLCV
– Udhampur.
27
6. Homologous alignment of ToLCV, Jammu isolte. 27
7. Homologous alignment of ToLCV, Jammu isolte. 27
8. Screening of tomato germplasm against tomato leaf
curl virus at different dates of transplanting.
29
9. Evaluation of different Insecticides against tomato leaf
curl virus (TLCV) under field conditions.
31
LIST OF FIGURES
CHAPTER TOPIC PAGE(S)
I INTRODUCTION 1-2
II REVIEW OF LITERATURE 3-10
III MATERIAL AND METHODS 11-21
IV RESULTS 22-31
V DISCUSSION 32-35
VI SUMMARY & CONCLUSION 36-37
REFERENCES 38-47
VITA
CONTENTS
Acknowledgement
Introduction
1
CHAPTER-1
INTRODUCTION
Tomato (Lycopersicon esculentum Mill.) is a herbaceous fruiting plant
belonging to the family Solanaceae. It originated in Latin America and has become
one of the most popular and widely cultivated vegetable crops of the world with
ability to survive in diverse environmental conditions. It is grown for its edible fruit,
which can be consumed, either raw or cooked or in the form of various processed
products like juice, ketchup, sauce, pickle, pastes, puree and powder. It is universally
treated as “protective food” and provides almost all types of vitamins and minerals in
quite fair amount. In the world, tomato is cultivated over an area of 46.15 lakh
hectares with an annual production of 1279.9 lakh tonnes and the productivity of
27.73 tonnes per hectare. In India, it occupies an area of about 5.35 lakh hectares
producing over 93.62 lakh tonnes with the productivity of 17.5 tonnes per hectare
(Anonymous, 2006), while in Jammu region of Jammu & Kashmir the area under
tomato cultivation is 1,280 hectare with the production of 23,550 metric tonnes and
productivity of 18.40 tonnes per hectare (Anonymous, 2011).
Although area under tomato cultivation is high, the crop is suffering from
large number of diseases caused by fungi, bacteria and viruses. Among the different
viral diseases tomato leaf curl disease caused by tomato leaf curl virus (ToLCV) is a
major limiting factor in tomato cultivation. In India the virus caused 100 % infection
and yield losses upto 90 % (Sastry and Singh, 1973; Muniyappa and Veeresh, 1984;
Saikia and Muniyappa, 1989; Harrison et al., 1991; Muniyappa, 2003, Reddy et al.,
2011 and Shankarappa et al., 2008).
Tomato leaf curl virus disease (ToLCVD) is characterized by yellowing of
leaf edges, upward leaf cupping, puckering, twisting of leaves, followed by marked
reduction in leaf size. The diseased plants look pale and stunted due to shortening of
internodal length with more lateral branches resulting in a bushy appearance
(Vasudeva and Sam Raj, 1948). The disease is transmitted by whitefly (Bemisia
tabaci) of the Family Aleyrodidae (Cohen and Nitzany, 1966) in a persistent and
circulative manner and not mechanically or seed transmissible (Green et al., 1987).
The vector life period is shortest during May to September than December to
2
February due to variation in temperature. The incidence and rate of spread of the
disease are directly proportional to the whitefly population present in the environment
(Mansour and Almousa, 1992; Mehta et al., 1994). Both adults and larvae can acquire
the virus by feeding on infected plants with a minimum access and acquisition period
of 15 minutes. Under the north Indian conditions minimum temperature and minimum
relative humidity has been shown to influence the whitefly population (Krishnareddy,
1989), but under the south Indian condition maximum temperature and rainfall have
been found to be more important for the build-up of vector population and
transmission of virus (Murugesan et al., 1977).
Tomato leaf curl virus belongs to genus Begomovirus which have a circular,
single-stranded DNA genome encapsicated in a paired particle (Navot et al., 1991).
The begomo-viruses usually posses either monopartite genome designated as DNA-A
or bipartite genome designated as DNA-A and DNA-B (Stanley, 1983 and Fauquet et
al., 2008). Among different isolates of tomato leaf curl viruses, ToLCBV-Banglore,
ToLCNDV-New Delhi and ToLCV-Karnataka are important which limit the tomato
production to a greater extent (Reddy et al., 2011). The virus is ranked third among
„top ten viruses‟ (Scholthof et al., 2011).
Information regarding the status and molecular detection of the tomato leaf
curl virus is scanty in the Jammu region of Jammu and Kashmir as no work regarding
the detection of the virus through PCR is done so far. As early detection is very
important for the management of the disease, so considering this aspect and the yield
losses caused by the virus to the farming community, the present study was proposed
with the following objectives.
1. Detection of tomato leaf curl virus through Polymerase Chain Reaction.
2. Integrated disease management of tomato leaf curl disease.
Review of Literature
3
CHAPTER-2
REVIEW OF LITERATURE
Tomato (Lycopersicon esculentum Mill.) is an important and most widely
grown vegetable crop in India. Tomato production in India is under constant threat of
tomato leaf curl disease caused by tomato leaf curl virus (ToLCV). Tomato leaf curl
virus is a begomovirus (family Geminiviridae, genus Begomovirus) and is transmitted
by whitefly (Bemisia tabaci). A lot of work has been done on various aspects of
ToLCV in India and abroad and is reviewed as under:
2.1 Geographical Distribution
Tomato leaf curl virus was reported from Sudan (Cowland, 1932), Srilanka
(Shivanathan, 1963), Israel (Cohen and Nitzany,1966), Egypt (Nour Eldin et al.,
1969), Philippines (Retuerma et al., 1971), Jordan (Makkouk, 1978), Lebanon
(Makkouk et al., 1979), Saudi Arabia (Mazyad et al., 1979), Thailand (Alathom and
Sutabutra,1986) and Taiwan (Green et al., 1987).
In India, the natural occurrence of tomato leaf curl virus was reported by
Pruthi and Samuel (1939), while its serious nature was reported in Northern India by
Vasudeva and Samraj (1948). Similarly ToLCV was reported from Coimbatore
(Ramkrishnan et al., 1964), Delhi (Vasudeva, 1959 and Nariani, 1968), Hisar (Varma
and Poonam, 1977 ; Varma et al., 1986), Karnataka ( Sastry and Singh, 1971 ;
Muniyappa and Veeresh, 1984), Kanpur (Singh and Lal, 1964), Kerala (Nair and
Wilson, 1969), Lucknow (Srivastava et al., 1975), Maharashtra (Varma, 1959 ; Mote,
1976 and Datar, 1981), Punjab (Butter and Rataul, 1973) and Pantnagar (Saklani and
Mathai, 1978).
Moriones and Navas (2000) reported that the tomato yellow leaf curl (TYLC)
is one of the most devastating viral disease of cultivated tomato (Lycopersicon
esculentum ) in tropical and subtropical regions of worldwide causing the losses up to
100 per cent.
4
2.2 Symptomatology
The various prominent symptoms of tomato leaf curl virus such as upward
curling of leaf margins, stunting, reduction of leaf size, corrugated leaf, shortening of
internodes and severe reduction in fruit yield, had been observed from Middle East
(Makkouk and Laterrot, 1983). Similar symptoms have been recorded in north and
central Africa, South East Asia, Taiwan, Mexico, Italy (Sardinia), Spain, Australia,
Dominican Republic and Jamaica (Brown and Nelson, 1988 and Czosnek et al.,
1990). However the symptoms like reduction in leaf size, stunted plant growth,
deformation of leaflets, vein clearing, curling and puckering of leaflets were also
reported by Vasudeva and Samraj (1948) ; Sastry and Singh (1973), Saklani and
Mathai (1977) ; Raychoudhari and Nariani (1977) ; Capoor (1981) and Saikia and
Muniyappa, 1989. Zhang et al. (2008) also reported the upward leaf curling and
interveinal and marginal chlorosis in tomato plants due to tomato leaf curl virus.
2.3 Incidence and Yield losses
Datar (1984) found that the yield losses caused by tomato leaf curl virus in
tomato ranged from 50 to 75% and incidence was 100% which resulted in
unprofitable production of tomato.
Saikia and Muniyappa (1989) studied the incidence of ToLCV in Karnataka
and reported that the incidence of disease ranged from 17-53 per cent in July-
November to 100 per cent during February – May resulting in heavy yield loss.
Ajlan et al. (2007) also reported 96.90 % yield loss of tomato plant due to
ToLCV in autum season.
Reddy et al. (2011) reported that ToLCV was present in almost all fields of
Belgaum, Dharward, Haveri districts of Karnataka with percent disease incidence of 4
to 100 % in rabi and 60 to 100 % during summer season.
2.4 Causal virus
Tomato leaf curl virus (ToLCV) is a group of whitefly-transmitted
geminiviruses (Cohen and Harpaz, 1964; Czosnek et al., 1988), causing an extensive
yield loss to tomato crops in many tropical and subtropical regions worldwide
(Czosnek and Laterrot, 1997). The virus belongs to genus Begomovirus and have a
5
single-stranded DNA (ssDNA). The genomes are encapsidated in about 20X30 nm
geminate particles (Goodman, 1977).
2.5 Screening
Zakay et al. (1991) screened twenty three tomato accessions for resistance to
tomato leaf curl virus under field conditions and examined that accessions of the wild
species Lycopersicon pimpinellifolium, Lycopersicon hirsutum, and Lycopersicon
peruvianum showed variance in their response to infection, however Lycopersicon
chilense showed highest degree of resistance against the disease.
Rai et al. (2001) screened twenty tomato genotypes for resistance against
tomato leaf curl virus (ToLCV) in Madhya Pradesh, India and reported that the
cultivars Hisar Anmol and Hisar Gaurav were resistant to tomato leaf curl disease.
Sajeed et al. (2002) screened ten tomato cultivars against ToLCV at 45 days
after planting and observed that among all the cultivars Punjab Chhuhara showed
higher degree of resistance against tomato leaf curl virus.
Maruthi et al. (2003) screened a total of 34 tomato genotypes for resistance to
TYLCV under glasshouse and field conditions and found that Lycopersicon hirsutum
LA1777 and PI 390659 were best sources of resistance to the virus.
Yadav and Awasthi (2009) screened 22 cultivars of tomato against ToLCV in
Faizabad and out of 22 cultivars screened, none of the cultivars was found resistant
against the disease. However Hisar Anmol was found moderately resistant to the
virus, while three cultivars were categorized as moderately susceptible and 18 were
found susceptible to tomato leaf curl virus.
The screening of tomato germplasm against ToLCV was done in Ghana by
Osei et al. (2012). They evaluated 30 accessions against the disease under field
conditions at 30, 45 and 60 days after transplanting and found that no accession
provided complete resistance to tomato leaf curl virus.
Thirty two tomato genotypes were screened for resistance against tomato leaf
curl disease during rabi season at Institute of Agricultural Sciences, Banaras Hindu
University, Varanasi and Vegetable research farm, Varanasi, Uttar Pradesh. It was
observed that one wild accession, H-88-78-1 showed immune reaction against
6
ToLCV, three genotypes viz., Hissar Lalima, TLBRH-6 and NS-515 showed resistant
reaction and eight genotypes viz., Hissar Anmol, Kishi Vishesh, Kashi Amrit, Kashi
Sharad, KS-17, KS-118, Avinash-2 and US-1008 were found moderately resistant
against tomato leaf curl virus (Singh, 2014).
Zeshan et al. (2016) screened twenty seven tomato varieties/lines for the
source of resistance against tomato leaf curl virus disease (TLCVD) under field
conditions and found that three varieties were highly susceptible, six were susceptible,
four were moderately susceptible, six were moderately resistant and eight were
resistant. No variety/line was highly resistant or immune against tomato leaf curl virus
disease.
2.6 Molecular Detection of Tomato Leaf Curl Virus
Navot et al. (1992) detected tomato yellow leaf curl virus in infected tomato
plant by polymerase chain reaction (PCR) by using synthetic oligonucleotides
complimentary to different regions of the viral genome as primers. Whereas, Rojas et
al. (1993) detected whitefly transmitted ToLCV through PCR method using
degenerate primers.
Muniyappa et al. (2000) detected tomato leaf curl virus from Bangalore
through polymerase chain reaction (PCR) and found that ToLCV isolates from
Southern India (Bangalore) seemed to had a DNA-A like monopartite genome.
Valverde et al. (2001) carried out PCR of ToLCV infected tomato samples
from Louisiana using degenerate primers AV494/AC1048 that amplify the core coat
protein region of most begomoviruses. PCR yielded a DNA fragment of
approximately 550 bp, suggesting that a begomovirus was associated with the disease.
Anfoka et al. (2005) studied molecular identification of species of the tomato
yellow leaf curl virus through molecular tools from Jordan by using the primer pairs
MAI4/MA15 and PTYIRv21/PTYIRc287.
Ajlan et al. (2007) isolated tomato yellow leaf curl virus-Saudia Arabian
isolate from infected samples of tomato in different locations of Saudia Arabia. The
DNA extracted from these infected samples were analysed by polymerase chain
7
reaction (PCR) using degenerate primers PALIv1978/PARIc496. The PCR fragment
of 1.1kb for the common region (CR) was obtained from infected samples.
Dennis and Narceo (2007) detected ToLCV from Philippines by polymerase
chain reaction (PCR) by using 3 sets of degenerate primers that amplify different
regions of the genomic DNA of the virus. The coat protein primer pair gave the
amplicon of 560 bp.
Tiwari et al. (2010) detected tomato leaf curl New Delhi virus isolate causing
yellow mosaic disease in bitter gourd in Eastern Uttar Pradesh. They carried out PCR
using a pair of begomovirus specific primers (AV1 forward and AV1 reverse) which
resulted in the expected size of 800 bp amplicon.
Asmaa et al. (2011) reported tomato yellow leaf curl virus from whiteflies-
infected tomato plants growing in Nubaria and El-Behera regions of Saudi Arab using
degenerate oligonucleotide primers. The viral coat protein gene was amplified
successfully by PCR, producing 500 bp fragments.
Reddy et al. (2011) detected tomato leaf curl virus infecting tomato in
Northern Karnataka through polymerase chain reaction (PCR) by using specific
primers and it was found that all the representative symptomatic samples collected
from different regions were positive for tomato leaf curl virus disease.
Samarakoon et al. (2012) studied molecular detection and partial
characterization of tomato yellow leaf curl virus in Sri Lanka through PCR by using
oligonucleotide primers. The degenerate primers yielded 520 bp amplified product
suggesting the presence of Begomovirus in the sample.
Thakuria et al. (2012) detected tomato leaf curl virus from Jorhat district of
Assam through Polymerase Chain Reaction (PCR) by using DNA-A specific primer
which yielded a 348 bp PCR product.
2.7 Sequencing
Muniyappa et al. (2000) detected the ToLCV isolate from Bangalore by using
the degenerate DNA-A-specific PCR primers. The full-length of 2759 nucleotide long
viral genome was sequenced and comparisons indicated that nucleotide of ToLCV-
Bangalore isolate (ToLCV-Ban1) was 91% related to ToLCV-Ban2 isolate.
8
Yin et al. (2001) sequenced the complete DNA sequence (2734 nucleotides) of
tomato yellow leaf curl China virus (TYLCCNV), and the sequence comparisons
showed that the virus belongs to Begomovirus from the Old World.
Anfoka et al. (2005) sequenced the amplified product of the ToLCV genome
from Jordan valley and the BLAST analysis showed maximum homology with the
spain isolates TYLCSV-ES[1] and TYLCSV-ES[2].
Reddy et al. (2011) detected and sequenced ToLCV infecting tomato in
Northern Karnataka. They generated phylogenetic tree for four coat protein (CP)
sequences with the representative sequences present in the gene bank and the isolates
were clustered into two groups. The Dharward isolate and Belgaum-2 isolate showed
99.4% nucleotide similarity (one cluster) while Haveri and Belgaum-1 isolates
showed 97.30% homology (second cluster). The isolates under study had lowest
homology of 53.50-53.90% with ToLCV-Patna and highest homology of 92.40-
96.00% with ToLCBV-AVT1. The result also showed that the isolates were entirely
different from North Indian isolates.
Yang et al. (2011) reported a novel tomato- infecting begomovirus from
Guangxi province of China through PCR using the degenerate primer pairs.
Phylogenetic and recombination analyses of the viral genomic sequences suggested
that tomato leaf curl China virus may have arisen by recombination among tomato
leaf curl Vietnam virus (ToLCVV), tomato leaf curl Gujarat virus (ToLCGV) and an
unknown virus.
Thakuria et al. (2012) sequenced ToLCV from Jorhat (Assam) and the
BLAST analysis showed that the nucleotide sequence exhibited maximum, 90%
similarity to ToLCPV- Pakistan (Accession No. FM164938.1) followed by 88% to
ToLCGV-Gujarat (Accession No. EU573714.1), ToLCKV- Karanataka (Accession
No. FJ514798.1) and ToLCBV- Bangalore II (Accession No. U38239.1) respectively.
2.8 Management of Tomato Leaf Curl Virus
Sastry and Singh (1971) reported that seven foliar applications of dimethoate
(0.05 %), ekalax (0.02 %), metasystox (0.02 %) and dimecron (0.05 %) or thimmet
(15 kg/ha) applied to the soil at the time of transplanting regularly from the nursery
9
stage, resulted not only in reduction of whitefly population, but also in the reduction
of disease incidence of tomato leaf curl virus and increase in yield.
Manson et al. (2000) conducted an experiment on inhibition of transmissions
of TYLCV by using thiamethoxam as soil drench and foliar spray and found that a
good level of protection against the disease was given by soil drenching (upto 22
days) than foliar spray. Further, they also reported that the thiamethoxam activity in
preventing TYLCV transmission by B. tabaci was simply due to killing action, and
not by antifeedant/repellent action.
Ahmed et al. (2001) studied the effect of imidacloprid on incidence of tomato
yellow leaf curl virus by using two applications at four different rates (47.6, 71.4,
95.2, and 119 g a.i./ha) under field conditions and found that the repeated rates of
imidacloprid reduced disease incidence at all the dosage and the disease incidence
was reduced to 2.2 to 17% and the treated plots consistently had higher yields than
control plots.
Naik (2002) reported high mortality of B. tabaci which is the main vector of
tomato leaf curl virus in imidacloprid and triazophos sprayed plots. However they
also found that five sprays of imidacloprid (0.05%) in main field at 10 days interval
reduced the ToLCV incidence to a greater extent
Gajanana et al. (2006) demonstrated that root dipping of tomato seedlings in
imidacloprid just before transplanting followed by spraying at 15 days after planting,
and uprooting the infected plants gave greater reduction in incidence of tomato leaf
curl virus.
Rajasri et al. (2009) studied efficacy of different insecticides against ToLCV
incidence under field condition and found that profenophos (500 g a.i/ha) and
thiamethoxam (25 g a.i./ha ) reduced the ToLCV incidence and improved the tomato
yield.
Singh and Prajapati (2014) used different treatment combinations of
imidacloprid 200 SL @ 0.3 ml/l, thiomethoxam 25 WP @ 0.3 g/l + neem cake 250
kg/ha at the time of preparing land and seedlings dip with imidacloprid 200 SL @ 0.3
ml/l or thiomethoxam 25 WP @ 0.3 g/l for 5 minutes + sprayed imidacloprid 200 SL
@ 0.4ml/l or thiomethoxam 25 WP @ 0.3g/l and found that all the treatment
10
combinations were effective in checking the spread of the disease under field
conditions.
Smith and Giurcanu (2014) evaluated cyazypyr, flupyradifurone,
pyrafluquinazon, and sulfoxaflor against ToLCV and compared them with two
established insecticides, pymetrozine and a zeta-cypermethrin/bifenthrin combination.
They also found that the percentage of disease incidence was lowest in seedlings
treated with flupyradifurone and highest in the seedlings treated with pymetrozine.
Material and Methods
LIST OF ABBREVIATIONS USED IN THE MANUSCRIPT
viz. videlicet (namely)
Cm centimeter
Kg Kilogram
q Quintal
ha. hectare
et al et alibi (and others)
MT metric ton
Mt million ton
% Per cent
@ at the rate
μl Micro litre
CD(p=0.05)
critical difference at 5% level of
significance
11
CHAPTER-3
MATERIAL AND METHODS
Tomato leaf curl disease caused by tomato leaf curl virus (ToLCV) of the
genus Begomovirus of the family Geminiviridae is one of the most devastating disease
in many tropical and subtropical regions in the world and yield losses exceeds 90.00%
when infection occurs at three to four weeks after transplanting. The present
investigations were carried out under field as well as laboratory condition during
2015-16 to ascertain the incidence, intensity, performance of selected insecticides and
molecular detection of ToLCV in the Division of Plant Pathology, Sher-e-Kashmir
University of Agricultural Sciences and Technology, Chatha, Jammu. The material
used and techniques adopted during the investigation are being summerized here
under.
3.1 Survey
A survey was conducted in different tomato growing areas of Jammu and
Udhampur district viz. Bishna, R.S.Pura, Akhnoor, Marh, Chennani, Basht, Ramnagar
and Udhampur to ascertain the status of tomato leaf curl virus in farmer’s field. The
disease incidence was recorded starting from the appearance of the disease symptom
and subsequently at 15 days interval till the crop was harvested. The disease incidence
was calculated by using the formula:
Per cent disease incidence = No. of infected plants ×100 Total No. of Plants observed
12
Table 3.1: Locations selected for survey
District Location
Jammu
Bishnah
R S Pura
Akhnoor
Marh
Udhampur
Chennani
Basht
Ramnagar
Udhampur
3.2 Symptomatology
During survey to the different farmer’s field the typical symptoms of tomato
leaf curl disease which were taken into consideration were yellowing of leaf edges,
premature flower drop, upward leaf cupping, leathery appearance of leaf, puckering
and short internodes.
3.3 Molecular Detection of Tomato leaf curl virus
Samples of tomato plants infected with ToLCV were collected during survey
from different locations of Jammu region. The samples were used as experimental
material for molecular analysis which was carried out at molecular laboratory,
Division of Plant Pathology Sher-e-Kashmir University of Agricultural Science and
Technology, Jammu.
3.3.1 Reagents and Buffers used in the study:
Extraction Buffer: 1.86g Na EDTA (20 mM) and 3.03g Tris HCl(100nM)
were dissolved in small quantity of water, mixed and the pH was adjusted to
8.0, then 2% w/w CTAB (5g) and 1.4Mm NaCl (20.45g) were added by
heating to 600C and the volume was made upto 250 ml and 0.2% β-mercapto
ethanol was added just before use.
13
TAE (Tris base, acetic acid and EDTA ) buffer 50X: For preparation of
50X TAE buffer, 242gm of tris base was dissolved in 800 ml distilled water
then 57.1 ml glacial acetic acid and 0.5 M EDTA (100 ml) were added and
the volume was made up to one litre.
TE (Tris, EDTA) buffer: For preparation of TE buffer 1.211 Tris HCl
(10mM) and 0.372g Na EDTA (1mM) were dissolved separately, mixed and
the volume made up to 1 litre. The pH was adjusted to 8.0 and sterilized.
NaCl: 5 M (146.1g in 500 ml and sterilized).
Chloroform isoamyl Alcohol: 24:1 v/v
Ammonium Acetate: 7.5 M (the pH was adjusted to 7.7 and sterilized).
RNase: 10 mg/ml
Wash solution: 75% ethanol v/v, chilled
Absolute alcohol: Chilled 99% Ethanol.
Bromo phenol Blue-gel loading dye: 6X
Ethidium Bromide-staining chemical: 10 mg/ml
DNA ladder: 100 bp
3.3.2 Genomic DNA extraction:
For the extraction of total genomic DNA, the diseased samples were collected
from different locations and the plants were rinsed with water and extraction of DNA
was carried out by CTAB method (Sambrook and Russel, 2001). The procedure for
extraction of Genomic DNA from the infected tomato plants was followed as under.
10 ml extraction buffer was preheated with 2ml of 0.5%-mercapto ethanol at
600 C.
Two grams of leaf tissue was homogenised in a pre-chilled pestle and mortar
by adding liquid nitrogen.
14
The contents were transferred into centrifuge tube containing pre-heated 10ml
CTAB extraction buffer and shaken gently.
Then it was incubated at 600 C in water bath for 30 mins. by mixing gently at
regular intervals. After 10 minutes of incubation 20 micro litres of proteinase-
k was added to the mixture and incubated for another 20 minutes at 600 C.
The mixture was then centrifuged at 12000 rpm for 5 minutes at room
temperature.
The supernatant was transferred to a clean centrifuge tube and equal volume of
chloroform isoamyl alcohol (24:1) was added and mixed gently.
Again the content was centrifuged at 13000 rpm for 1 minute. The upper
aqueous layer formed in the tube was tipped out into another new tube to
which 1ml of 7.5 M Ammonium acetate and equal volume of chilled ethanol
(99%) was added.
The tube was inverted several times to facilitate the precipitation of DNA.
Then precipitated DNA was pooled out by using cut end tip into 2ml
Eppendorf tube and washed twice with 70% ethanol by centrifuging at 13,000
rpm for 5 minutes.
Excess ethanol was removed and pellets were air dried. Air dried pellet was
re- suspended in 80 micro litre TE buffer. RNA was removed by adding 2
micro litre of RNase and the DNA was stored at -200 C for further use.
3.3.3 Quality determination of genomic DNA:
The quality of DNA samples were checked by electrophoresis method using
1% agarose gel with 1X TAE buffer and the gel was stained with Ethidium bromide
(5 micro litre per ml). Two micro litres of each DNA sample was mixed with 2 micro
litres of loading dye, loaded in different wells of gel. The electrophoresis was carried
out at 120 V for 20 minutes and viewed under UV transilluminator to ascertain
homogeneity of samples. The samples were further used for PCR analysis.
15
3.4 PCR Detection
3.4.1 PCR Reaction Component:
The reaction mixture for DNA amplification consisted of 1X PCR buffer,
primer AV1F (5’ATGGCGAAGCGACCAG3’) and AV1R (5’TTAATTTGTGAC
CGAATCAT 3’), MgCl2, dNTPs, Taq DNA polymerase and genomic DNA. The total
reaction volume was 17 μl.
10X PCR buffer 2.5 μl
1.5 Mm Mgcl2 1.5 μl
dNTPs (0.2mM) 1.00 μl
Primer (forward) 1.00 μl
Primer (reverse) 1.00 μl
Taq DNA Polymerase 0.5 μl
Genomic DNA 1.00 μl
Sterile distilled Water 8.50 μl
All the reactions were carried out under aseptic conditions to avoid
contamination for false amplifications.
3.4.2 Procedure:
The thermal-cycler was switched on 10-15 minutes prior to the experiment.
The reaction mixture each 17 μl was dispensed in PCR tubes (0.2ml) using micro
pipette and PCR amplification was performed with thermal profile as listed below:
Cycle 1: 95oC for 5 minutes (Initial denaturation)
Cycle 2: 95oC for 1 minute (Denaturation)
50oC for 40 seconds (Primer annealing)
72oC for 1 minute (Polymerization)
Cycle 3 72oC for 5 minutes (Final elongation)
After completion the amplified PCR products were stored at 4oC till gel
electrophoresis.
16
3.4.3 Agarose gel electrophoresis of PCR product:
1.2 % agarose gel (100 ml) was prepared using 1X TAE buffer. It was
properly homogenised by heating it in microwave oven. Ethidium bromide (5 micro
litres) was added as a stain. The agarose solution was then poured in the gel casting
tray with the combs attached to form wells. After solidification, the combs were
removed and the gel was transferred in electrophoresis unit in such a way that the
wells were at negative poles. The tank was filled with 1X TAE buffer till the surface
of the gel was covered. 5μl of each PCR product mixed with 2 μl of gel loading dye
was slowly loaded into the wells using disposable micropipette tips. A 100bp
molecular ladder was also loaded to estimate product sizes in base pairs (bp). The
electrophoresis was then carried out at 120 volts till the dye migrated to the end of
gel. After the completion of this process the gel was visualised and photographed in
gel documentation system. The size of the PCR product was determined by
comparing with 100 bp molecular ladder.
3.5 DNA Sequencing
The PCR products obtained from the infected ToLCV samples were
sequenced from Chromous Biotech India Limited, Bangalore. The sequenced product
were then compared with known ToLCV isolates using bioinformatics tool (BLAST)
to compare the nucleotide identity with other known isolates.
3.6 Location of the field experiment
The field experiment was conducted in the sandy loam soil at the research
field Division of Plant Pathology, Chatha, SKUAST Jammu which is located at 320N
latitude, 740E longitude and at an altitude of 426.7m above the mean sea level during
rabi season of the year 2015-16.
3.6.1 Raising of nursery:
The soil was first turned to a fine tilth and then mixed with 3kg of farm yard
manure. The bed was levelled and the seeds of selected tomato germplasm collected
from different sources were sown in lines on the bed. The bed was watered and
17
mulched with dry straw, followed by transplanting of the healthy seedlings to the
main experimental plot.
3.6.2 Layout of experiment
3.6.2.1 Land preparation, Design, fertilization:
The field selected for experimental trial was ploughed three times till fine tilth.
Stubbles and weeds were removed from the land. Plots of 3 m × 3 m dimensions were
made and seedlings were transplanted at recommended spacing of 45 × 60 cm. Well
decomposed farmyard manure (FYM) @ 25 tones ha–1
was thoroughly mixed in the
soil at the time of field preparation and supplemented with inorganic N: P2O5: K2O
fertilizers at a proportion of (120:60:60) kg ha–1
. 1/3 of N was applied along with
other fertilizers as basal application and the remaining half dose of nitrogen was
applied in two split doses at one month interval after transplanting as top dressing.
The experiments were laid out in randomized block design (RBD) with three
replications of each treatment.
3.7 Screening of tomato germplasm
Fifteen germplasm of tomato (Samrudhi F-1, Heem Sohna, Sonali, Rupali,
Mahaveer, NS 812, NS 816, Pusa ruby, Avinash-2, Indus 1030, Namdhari
82535, Arti, DVRT-2, Hybrid no 15 and local variety) collected from various
sources (Table 3.2) were used as the experimental material and were screened against
virus under natural epiphytotic conditions for determining resistance against tomato
leaf curl virus. The seedlings were transplanted in a line with a spacing of 60×45 cm.
No plant protection measures were adopted.
Observations on disease incidence were recorded at 15 days interval starting
from 40 days after transplanting by using the scale given by Sharma and Sharma
(1984).
18
Table 3.2: Tomato germplasm and their sources
Genotype Sources
Samrudhi F1 Department of Agriculture, Talab Tillo,
Jammu
Heem sohna Division of Vegetable Sciences,
SKUAST-Jammu
Sonali Division of Vegetable Sciences,
SKUAST-Jammu
NS 812 Department of Agriculture, Talab Tillo,
Jammu
Pusa ruby Department of Agriculture, Talab Tillo,
Jammu
Mahaveer Department of Agriculture, Talab Tillo,
Jammu
Rupali Local market, Jammu
Indus 1030 Local market, Jammu
Namdhari 82535 Local market, Jammu
DVRT- 2 Division of Vegetable, SKUAST- Jammu
N.S.-816 Local market, Jammu
Avinash-2 Department of Agriculture, Talab Tillo,
Jammu
Arti Local market, Jammu
Hybrid no 15 Local market, Jammu
Local Local market, Jammu
19
3.7.1 Disease Scoring:
Percent disease incidence was recorded and calculated by using the following
formula:
Percentage of Disease Incidence =a Number of plants infected
100 Total number of plants observed
Table 3.3: Scale for grading varietal response of tomato germplasm against
tomato leaf curl disease.
Percent disease incidence Grade Reaction group
0-10% Resistant R
>10-30 % Moderately resistant MR
> 30-70 % Susceptible S
>70-100 % Highly susceptible HS
(Sharma and Sharma, 1984)
3.8 Chemical control
The field experiment was conducted at research farm, Division of Plant
Pathology, Sher-e-Kashmir Agricultural Sciences and Technology, Jammu in a
Randomized Block Design with nine treatments and three replication including
untreated control with a susceptible variety (Pusa Ruby).Three sprays were done for
management of the disease under field conditions. The first spray was given at the
appearance of the disease symptoms followed by two sprays at 15 days interval. In
case of control only water was sprayed.
The different schedule of insecticides used in the study is given as under.
20
Table 3.4: Schedule of insecticides used in the study
S.No Chemical Name Schedule and Dosage
1. Imidacloprid
Foliar application @ 0.3ml/l of
water (3 sprays at 15 days interval)
Seed treatment @ 5g/kg of seed at
the time of sowing
Seed treatment @ 5g/kg of seed +
seedling dip @ 0.03 ml/l for 30
minutes (before transplanting) + 3
sprays @ 0.3ml/l of water
2 Profenophos Foliar application @ 0.25ml/l of water
(3 sprays at 15 days interval)
3. Dimethoate Foliar application @ 2ml/l of water (3
sprays at 15 days interval)
4. Methyl-o-demeton Foliar application @ 1ml/l of water (3
sprays at 15 days interval)
5. Thiamethoxam Foliar application @ 0.3 gm/ l of water
(3 sprays at 15 days interval)
6. Acetamiprid Foliar application @ 0.2 gm/l of water (3
sprays at 15 days interval)
7. Control Water spray only
Percent disease intensity was calculated by using 0-4 scale (Lapidot and
Friedmann, 2002) (Table- 3.5).
21
Table 3.5 Disease Severity Index
0 No visible symptoms.
1 Slight yellowing of leaflet margins on apical leaf.
2 Some yellowing and minor curling of leaflet ends.
3 Curling and cupping, with some reduction in leaf size of plant.
4 Severe stunting and yellowing of plant with pronounced leaf cupping
and curling.
3.5.1 Observations:
Percentage of disease intensity of tomato leaf curl virus in treated and
untreated plots was calculated by using standard formula (McKinney, 1923).
3.5.2 Statistical analyses:
The experiment data was analyzed by using standard methods to test the
significance (Gomez and Gomez, 1984).
Percentage of Disease Index (PDI) =
Sum of all numerical rating
100
Maximum disease grade Total
number of plants observed
Results
22
CHAPTER 4
RESULTS
Tomato (Lycopersicon esculentum Mill.) is one of the most important
economical crop for many small and large scale producers worldwide and ranks
second next only to potato in the world acreage. Among many viral diseases affecting
tomato, tomato leaf curl virus (ToLCV) is the most important one causing great loss
to the crop. Today, ToLCV has become the major limiting factor for tomato
production in many tropical and subtropical regions. An investigation was carried out
on various aspects of the disease viz., survey, incidence, intensity, symptomology,
molecular detection, screening and management practices under both laboratory and
field conditions. The results observed during the study have been discussed as under.
4.1 Survey
Extensive survey was undertaken in selected locations of Jammu (Bishnah,
Akhnoor, R. S. Pura and Marh) and Udhampur (Chennani, Ramnagar, Basht and
Udhampur) districts to record the disease incidence in farmer’s field. The disease was
recorded on the basis of symptomology and then confirmed under laboratory
conditions by using Polymerase Chain Reaction (PCR).
In Jammu district, the maximum disease incidence of 24.00 per cent was
recorded from Akhnoor followed by Marh (22.25%), Bishnah (20.50%) and R.S.Pura
(19.75%) with the mean of 21.62 per cent. In Udhampur, the maximum percentage of
tomato leaf curl incidence was recorded from Udhampur (23.75%), while minimum
18.75 per cent was recorded from Ramnagar. In Basht, the percentage of disease
incidence was 21.25 per cent and in Chennani it was 22.50 per cent, respectively.
However, the mean percentage of disease incidence recorded was 21.56 per cent
(Table: 4.1 and Figure: 4.1).
23
Table 4.1: Percent disease incidence of tomato leaf curl virus of tomato at
different location of Jammu and Udhampur district.
District Location PDI (%)
Jammu
Bishnah 20.50
Akhnoor 24.00
RS Pura 19.75
Marh 22.25
Range 19.75-24.00
Mean 21.62
Udhampur
Chennani 22.50
Ramnagar 18.75
Basht 21.25
Udhampur 23.75
Range 18.75-23.75
Mean 21.56
Overall Range 18.75-24.00
Overall Mean 21.59
4.2 Symptomatology
The symptoms were observed at 40 days after transplanting under natural
epiphytotic conditions. The leaves were small in size followed by upward leaf curling
and yellowing. Puckering of leaflets was a common symptom of the disease and was
observed in almost all the ToLCV infected tomato plants. Some of the affected plants
showed bushy appearance due to shortening of internodes and stunted lateral branches
(Plates I and II).
24
4.3 Molecular detection of tomato leaf curl virus through PCR
Samples from different locations of Jammu and Udhampur districts were
collected for the detection of tomato leaf curl virus. PCR amplification of genomic
DNA extracted from diseased sample using AV1 F and AV1 R primer generated
700bp fragment (Figure: 4.3). It was revealed from the present analysis that samples
collected from these locations shows positive result (Table: 4.2) indicating that the
samples were infected with ToLCV and the virus was present in all the locations
surveyed.
Table 4.2: PCR detection of ToLCV in the tomato samples collected from
different locations of Jammu and Udhampur.
S.No. Code Location Presence(+)/Absence (-) of
virus
1 A1 Bishnah +
2 A2 Akhnoor +
3 A3 RS Pura +
4 A4 Marh +
5 A5 Chennani +
6 A6 Ramnagar +
7 A7 Basht +
8 A8 Udhampur +
4.3.1 Sequencing and sequence analysis:
The tomato leaf curl coat protein gene of different isolates collected from
different locations of Jammu and Udhampur was sequenced from Chromous Biotech
India Limited Banaglore by using AV1 primer pairs and generated a sequence of
700bp (Table: 4.3). The sequence was then analysed for similarities from other known
ToLCV isolates by using Bioinformatic tool (BLAST) and the result showed that the
isolates under study had 99.00 per cent nucleotide sequence identity with tomato leaf
curl New Delhi virus ( Figure: 4.4 & 4.5 ).
25
Table 4.3: Sequence of Tomato leaf curl Jammu and Udhampur virus
Name of virus Nucleotide sequences Base
pairs
ToLCV isolate
from Akhnoor
ATTTACTTTTGGTGAAGCGACCAGCAGATATCATCATTTCAAC
TCCCGCATCGAAAGTACGCCGACGTCTCAACTTCGACAGCCCC
TATGGAGCTCGTGCAGTTGTCCCCATTGCCCGCGTCACAAAAG
CAAAGGCCTGGGCCAACAGGCCGATGAACAGAAAACCCAGAA
TGTACAGAATGTATAGAAGTCCCGACGTGCCAAGGGGTTGTG
AAGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGGCACGATGT
ATCTCATATTGGTAAAGTCATGTGTGTTAGTGATGTTACCCGA
GGAACCGGACTCACACATCGCGTAGGGAAGCGATTCTGTGTG
AAATCTGTCTACGTCCTGGGAAAGATATGGATGGATGAAAAC
ATCAAGACGAAAAACCATACTAACAGTGTTATGTTTTTTTTAG
TTCGTGACCGTCGTCCTACAGGAACCCCGCAAGATTTCGGGGA
AGTGTTTAATATGTTTGACAATGAACCGAGCACAGCAACGGTG
AAGAACATGCATCGTGATCGTTATCAAGTCTTACGGAAGTGGC
ATGCAACTGTGACCGGAGGAACATACGCATCTAAGGAGCAAG
CATTAGTTAGGAAGTTTGTTAGGGTTAATAATTATGTTGT
700bp
ToLCV isolate
from Udhampur
ATAGAATCTATGGCGAAGCGACCAGCAGATATCATCATTTCAA
CTCCCGCATCGAAAGTACGCCGACGTCTCAACTTCGACAGCCC
CTATGGAGCTCGTGCAGTTGTCCCCATTGCCCGCGTCACAAAA
GCAAAGGCCTGGGCCAACAGGCCGATGAACAGAAAACCCAGA
ATGTACAGAATGTATAGAAGTCCCGACGTGCCAAGGGGTTGT
GAAGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGGCACGATG
TATCTCATATTGGTAAAGTCATGTGTGTTAGTGATGTTACCCG
AGGAACCGGACTCACACATCGCGTAGGGAAGCGATTCTGTGT
GAAATCTGTCTACGTCCTGGGAAAGATATGGATGGATGAAAA
CATCAAGACGAAAAACCATACTAACAGTGTTATGTTTTTTTTA
GTTCGTGACCGTCGTCCTACAGGAACCCCGCAAGATTTCGGGG
AAGTGTTTAATATGTTTGACAATCCGGATCTACTTTTATGATTC
GGCCAC
700bp
ToLCV isolate
from Bishnah
ATTTACTTTTGGTGAAGCGACCAGCAGATATCATCATTTCAAC
TCCGCACGAAAGTACGCCGACGTCTCAACTTCGACAGCCCCTA
TGGAGCTCGTGCAGTTGTCCCCTATTGCCCGCGTCACAAAAGC
AAAGGCCTGGGCCAACAGGCCGATGAACAGAAAACCCAGAAT
GTACAGAATGTATAGAAGTCCCGACGTGCCAAGGGGTTGTGA
AGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGGCACGATGTA
TCTCATATTGGTAAAGTCATGTGTGTTAGTGATGTTACCCGAG
GAACCGGACTCACACATCGGTAGGGAAGCGATTCTGTGTGAA
ATCTGTCTACGTCCTGGGAAAGATATGGATGGATGAAAACATC
AAGACGAAAAACCATACTAACAGTGTTATGTTTTTTTTAGTTC
GTGACCGTCGTCCTACAGGAACCCCGCAAGATTTCGGGGAAG
TGTTTAATATGTTTGACAATGAACCGAGCACAGCAACGGTGAA
GAACATGCATCGTGATCGTTATCAAGTCTTACGGAAGTGGCAT
GCAACTGTGACCGGAGGAACATACGCATCTAAGGAGCAAGCA
TTAGTTAGGAAGTTTGTTAGGGTTAATAATTATGTTGTTTACA
ATCAACAAGAGGCCGGCAAGTATGAGAATCATACTGAAAACG
700 bp
26
CATTAATGTTGTATATGGCGTGTACTCACGCATCGAATCCTGT
ATATGCTACTTTGAAAATCCGGATCTACTTTTATGATTCGGCC
AC
ToLCV isolate
from R.S. Pura
CCTGCCTAGTTACTTATGGGGAAGCGACCAGCAGATATCATCA
TTTCAACTCCCGCATCGAAAGTACGCCGACGTCTCAACTTCGA
CAGCCCCTATGGAGCTCGTGCAGTTGTCCCCATTGCCCGCGTC
ACAAAAGCAAAGGCCTGGGCCAACAGGCCGATGAACAGAAA
ACCCAGAATGTACAGAATGTATAGAAGTCCCGACGTGCCAAG
GGGTTGTGAAGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGG
CACGATGTATCTCGGGATTGGTAAAGTCATGTGTGTTAGTGAT
GTTACCCGAGGAACCGGACTCACACATCGCGTAGGGAAGCGA
TTCTGTGTGAAATCTGTCTACGTCCTGGGAAAGATATGGATGG
ATGAAAACATCAAGACGAAAAACCATACTAACAGTGTTATGT
TTTTTTTAGTTGCTGACCGTCGTCCTACAGGAACCCCGCAAGA
TTTCGGGGAAGTGTTTAATATGTTTGACAATGAACCGAGCACA
GCAACGGTGAAGAACATGCATCGTGATCGTTATCAAGTCTTAC
GGAAGTGGCATGCAACTGTGACCGGAGGAACATACGCATCTA
AGGAGCAAGCATTAGTTAGGAAGTTTGTTAGGGTTAATAATTA
TGTTGTTTACAATCAACAAGAGGCCGGCAAGTATGAGAATCAT
ACTGAAAACGCATTAATGTTGTATATGGCGTGTACTCACGCAT
CGAATCCTGTATATGCTACTTTGAAAATCCGGATCTACTTTTAT
GATTCGGCCACAA
700 bp
ToLCV isolate
from Marh
TCTTATTATACTAATGGCGAAGCGACCAGCAGATATCATCATT
TCAAACTCCCGCATCGAAAGTACGCCGACGTCTCAACTTCGAC
AGCCCCTATGGAGCTCGTGCAGTTGTCCCCATTGCCCGCGTCA
CAAAAGCAAAGGCCTGGGCCAACAGGCCGATGAACAGAAAA
CCCAGAATGTACAGAATGTATAGAAGTCCCGACGTGCCAAGG
GGTTGTGAAGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGGC
ACGATGTATCGCAGATTGGTAAAGTCATGTGTGTTAGTGATGT
TACCCGAGGAACCGGACTCACACATCGCGTAGGGAAGCGATT
CTGTGTGAAATCTGTCTACGTCCTGGGAAAGATATGGATGGAT
GAAAACATCAAGACGAAAAACCATACTAACAGTGTTATGTTTT
TTTTAGTTCGTGACCGTCGTCCTACAGGAACCCCGCAAGATTT
CGGGGAAGTGTTTAATATGTTTGACAATGAACCGAGCACAGC
AACGGTGAAGAACATGCATCGTGATCGTTATCAAGTCTTACGG
AAGTGG CATGCAACTGTGACCGGAGGAACATACGCATCTAA
GGAGCAAGCATTAGTTAGGAAGTTTGTTAGGGTTAATAATTAT
GTTGTTTACAATCAACAAGAGGCCGGCAAGTATGAGA ATCAT
ACTGAAAACG CATTAATGTA GTATATGGCGTGTACTCACGCA
TCGAATCC TGTATATGCT ACTTTGAAAA TCCGGATCTACTTT
TTATGA TTCGGCCAC
700 bp
ToLCV isolate
from Chennani
AGATCTATGGCGAAGCGACCAGCAGATATCATCATTTCAACTC
CCGCATCGAAAGTACGCCGACGTCTCAACTTCGACAGCCCCTA
TGGAGCTCGTGCAGTGCCCGCGTCACAAAAGCAAAGGCCTGG
GCCAACAGGCCGATGAACAGAAAACCCAGAATGTACAGAATG
TATAGAAGTCCCGACGTGCCAAGGGGTTGTGAAGGCCCTTGTA
AGGTGCAATCCTTTGAATCCAGGCACGATGTATCTCATATTGG
700 bp
27
TAAAGTCATGTGTGTTAGTGATGTTACCCGAGGAACCGGACTC
ACACATCGCGTAGGGAAGCGATTCTGTGTGAAATCTGTCTACG
TCCTGGGAAAGATATGGATGGATGAAAACATCAAGACGAAAA
ACCATACTAACAGTGTTATGTTTTTTTTAGTTCGTGACCGTCGT
CCTACAGGAACCCCGCAAGATTTCGGGGAAGTGTTTAATATGT
TTGACAATGAACCGAGCACAGCAACGGTGAAGAACATGCATC
GTGATCGTTATCAAGTCTTACGGAAGTGGCATGCAACTGTGAC
CGGAGGAACATACGCATCTAAGGAGCAAGCATTAGTTAGGAA
GTTTGTTAGGGTTAATAATTATGTTGTTTACAATCAACAAGAG
GCCGGCAAGTATGAGAATCATACTGAAAACGCATTAATGTTG
TATATGG
ToLCV isolate
from Basht
TGAAGCGACCAGCAGATATCATCATTTCAACTCCGCACGAAA
GTACGCCGACGTCTCAACTTCGACAGCCCCTATGGAGCTCGTG
CAGTTGTCCCCTATTGCCCGCGTCACAAAAGCAAAGGCCTGGG
CCAACAGGCCGATGAACAGAAAACCCAGAATGTACAGAATGT
ATAGAAGTCCCGACGTGCCAAGGGGTTGTGAAGGCCCTTGTA
AGGTGCAATCCTTTGAATCCAGGCACGATGTATCTCATATTGG
TAAAGTCATGTGTGTTAGTGATGTTACCCGAGGAACCGGACTC
ACACATCGGTAGGGAAGCGATTCTGTGTGAAATCTGTCTACGT
CCTGGGAAAGATATGGATGGATGAAAACATCAAGACGAAAAA
CCATACTAACAGTGTTATGTTTTTTTTAGTTCGTGACCGTCGTC
CTACAGGAACCCCGCAAGATTTCGGGGAAGTGTTTAATATGTT
TGACAATGAACCGAGCACAGCAACGGTGAAGAACATGCATCG
TGATCGTTATCAAGTCTTACGGAAGTGGCATGCAACTGTGACC
GGAGGAACATACGCATCTAAGGAGCAAGCATTAGTTAGGAAG
TTTGTTAGGGTTAATAATTATGTTGTTTACAATCAACAAGAGG
CCGGCAAGTATGAGAATCATACTGAAAACGCATTAATGTTGTA
TATGGCGTGTACTCACGCATCGAATCCTGTATATGCTACTTTG
AAAATCCGGATCTACTTTTATGATTCGGCCAC
700 bp
ToLCV isolate
from Ramnagar
CCTGCCTAGTTACTTATGGGGAAGCGACCAGCAGATATCATCA
TTTCAACTCCCGCATCGAAAGTACGCCGACGTCTCAACTTCGA
CAGCCCCTATGGAGCTCGTGCAGTTGTCCCCATTGCCCGCGTC
ACAAAAGCAAAGGCCTGGGCCAACAGGCCGATGAACAGAAA
ACCCAGAATGTACAGAATGTATAGAAGTCCCGACGTGCCAAG
GGGTTGTGAAGGCCCTTGTAAGGTGCAATCCTTTGAATCCAGG
CACGATGTATCTCGGGATTGGTAAAGTCATGTGTGTTAGTGAT
GTTACCCGAGGAACCGGACTCACACATCGCGTAGGGAAGCGA
TTCTGTGTGAAATCTGTCTACGTCCTGGGAAAGATATGGATGG
ATGAAAACATCAAGACGAAAAACCATACTAACAGTGTTATGT
TTTTTTTAGTTGCTGACCGTCGTCCTACAGGAACCCCGCAAGA
TTTCGGGGAAGTGTTTAATATGTTTGACAATGAACCGAGCACA
GCAACGGTGAAGAACATGCATCGTGATCGTTATCAAGTCTTAC
GGAAGTGGCATGCAACTGTGACCGGAGGAACATACGCATCTA
AGGAGCAAGCATTAGTTAGGAAGTTTGTTAGGGTTAATAATTA
TGTTGTTTACAATCAACAAGAGGCCGGCAAGTATGAGAATCAT
ACTGAAAACGCATTAATGTTGTATATGGCGTGTACTCACGCAT
CGAATCCTGTATATGCTAC
700 bp
28
4.4 Disease Management
4.4.1 Screening:
Fifteen germplasm of tomato obtained from different sources were screened
under field conditions against tomato leaf curl virus and the results are presented in
Table: 4.4 and Figure: 4.8. Out of fifteen germplasm ( Samrudhi F-1, Heem Sohna,
Sonali, Rupali, Mahaveer, NS 812, NS 816, Pusa ruby, Avinash-2, Indus 1030,
Namdhari 82535, Arti, DVRT-2, Hybrid no 15 and local variety ), except two all the
germplasm were found infected by ToLCV under field conditions. At 40 DAT the
percentage of disease incidence was maximum in Pusa Ruby (59.25 %) followed by
local variety (50.00 %), Arti (48.14 %), Rupali (48.14 %), NS 816 (44.44 %), NS 812
(40.74%), DVRT-2 (37.03 %), Sonali (33.33 %), Indus 1030 (33.33 %), Heem Sohna
(29.62 %), Hybrid No. 15 (25.92%), Samrudhi F1 (22.22 %), Mahaveer (0.00 %) and
Avinash-2 (0.00%). While at 55 DAT the variety Pusa Ruby showed highest disease
incidence of 62.96 % followed by local variety (59.25 %), Arti (51.85 %), Rupali
(51.85 %), NS 816 (48.14 %), NS 812 (48.14 %), DVRT-2 (44.44 %), Sonali
(40.74%), Indus 1030 (37.03 %), Heem Sohna (33.33 %), Hybrid No. 15 (29.62 %),
Samrudhi F1 (25.92 %), Namdhari 82535 (23.33 %), Mahaveer (0.00 %) and
Avinash-2 (0.00 %). Similarly observations recorded at 70 DAT as the highest disease
incidence was recorded in Pusa Ruby (66.66 %) followed by local variety (62.96 %),
Arti (59.25 %), Rupali (55.55 %), NS 816 (50.00 %), NS 812 (48.14 %), DVRT-2
(44.44 %), Indus 1030 (40.74 %), Sonali (40.74 %), Heem Sohna (37.03 %), Hybrid
No. 15 (33.33 %), Samrudhi F1 (29.62 %), Namdhari 82535 (25.92 %), Mahaveer
(0.00 %) and Avinash-2 (0.00 %).
It was observed that two germplasm viz. Mahaveer and Avinash-2 were found
resistant, Samrudhi F1 and Namdhari 82535 were found moderately resistant while
eleven germplasms viz.Heem Sohna, Sonali, Rupali, NS 816, NS 812, Pusa Ruby,
Indus 1030, Arti, DVRT-2, Hybrid no. 15 and local showed susceptible reaction
against tomato leaf curl virus (Table: 4.5).
29
Table 4.4: Screening of different germplasm of tomato against tomato leaf curl
virus under field conditions.
S.No Germplasm Disease Incidence (%)
Grade 40 DAT 55DAT 70DAT
1 Samrudhi F1 22.22 25.92 29.62 MR
2 Heem sohna 29.62 33.33 37.03 S
3 Sonali 33.33 40.74 40.74 S
4 NS 812 40.74 48.14 48.14 S
5 Pusa ruby 59.25 62.96 66.66 S
6 Mahaveer 0 0 0 R
7 Rupali 48.14 51.85 55.55 S
8 Indus 1030 33.33 37.03 40.74 S
9 Namdhari 82535 22.22 23.33 25.92 MR
10 DVRT-2 37.03 44.44 44.44 S
11 N.S.-816 44.44 48.14 50.00 S
12 Avinash-2 0 0 0 R
13 Arti 48.14 51.85 59.25 S
14 Hybrid no 15 25.92 29.62 33.33 S
15 Local 50.00 59.25 62.96 S
Table 4.5: Summary of disease reaction of different germplasm against tomato
leaf curl virus under field conditions.
Reaction Disease Incidence
(%) No. of entries Germplasm
Resistant 0 2 Avinash-2, Mahaveer
Moderately
resistant 1-30 2
Samrudhi F1, Namdhari
82535
Susceptible >30- 70 11
Heem Sohna, Sonali,
Rupali, NS 812, NS 816,
Pusa Ruby, Indus 1030,
Arti, DVRT-2, Hybrid
no 15 and local variety
Highly Susceptible >70- 100 0 ----
30
4.4.2 Evaluation of insecticides against tomato leaf curl virus (ToLCV) under
field conditions:
The various effect of different insecticide (imidacloprid, thiamethoxam,
dimethoate, acetamiprid, profenofos and methyl-o-demeton) was studied in Pusa
Ruby variety against tomato leaf curl disease under field condition and the results are
presented in Table: 4.6. and Figure: 4.9. The intensity of disease was recorded at
fifteen days interval starting from 40 days after transplanting and it was observed that
in all the treatments the per cent disease intensity showed slight increase with the age
of plants.
At 40 DAT the lowest disease intensity (4.44 %) was recorded in seed
treatment + seedling dip+ foliar application with imidacloprid followed by foliar
applicaton of imidacloprid (5.92 %), seed treatment with imidacloprid (6.66 %), foliar
application of thiamethoxam (6.66 %), foliar application of dimethoate (7.40 %),
foliar application of profenofos (7.40 %), foliar application of methyl-o-demeton
(9.62 %) and foliar application of acetamiprid (10.36 %) as compared to 24.07 % in
untreated control plot. At 55 DAT the lowest disease intensity 5.18 % was recorded in
seed treatment + seedling dip + foliar application with imidacloprid followed by foliar
application of thiamethoxam (7.40 %), foliar application of imidacloprid (8.14 %),
seed treatment with imidacloprid (8.33 %), foliar application of methyl-o-demeton
(11.10 %), foliar application of dimethoate (11.10 %), foliar application of
acetamiprid (11.11 %) and foliar application of profenofos (11.85 %) while in
untreated control plots the percent disease intensity recorded was 27.40 %. Same
trend was observed when treatments were given at 70 DAT.
The overall view of the table suggest that at 40 DAT and 70 DAT there was no
significant variation in disease intensity in the plots treated with seed treatment +
seedling dip + foliar application of imidacloprid, foliar application of imidacloprid
and seed treatment of imidacloprid.
31
Table 4.6: Evaluation of different Insecticides against tomato leaf curl virus
(ToLCV) under field conditions in variety Pusa Ruby.
Treatment Percent Disease Intensity
40 DAT 55 DAT 70 DAT
Foliar appilicaton of Profenofos 7.40
(15.74)
11.85
(20.11)
14.07
(22.00)
Foliar application of Methyl-o-demeton 9.62
(18.04)
11.10
(19.39)
13.33
(21.40)
Foliar application of Dimethoate 7.40
(15.74)
11.10
(19.39)
12.59
(20.75)
Foliar application of Thiamethoxam 6.66
(14.81)
7.40
(15.74)
11.84
(20.04)
Foliar application of Imidacloprid 5.92
(14.01)
8.14
(16.53)
9.62
(17.89)
Foliar application of Acetamiprid 10.36
(18.75)
11.11
(19.46)
13.33
(21.40)
Seed treatment with Imidacloprid 6.66
(14.81)
8.33
(17.24)
11.10
(19.39)
Seed treatment+Seedling dip +foliar application
with Imidacloprid
4.44
(11.89)
5.18
(13.08)
8.14
(16.53)
Control 24.07
(29.36)
27.40
(31.51)
30.73
(33.63)
SE (m) 0.98 0.95 1.02
CD (P=0.05) 2.99 2.88 3.08
Discussion
32
CHAPTER-5
DISCUSSION
Tomato (Lycopersicon esculentum Mill.) is an important and most widely
vegetable crop grown in India. The crop suffers from many fungal, viral, bacterial and
nematode diseases which causes reduction in the yield and quality of produce. Among
the viral diseases, tomato leaf curl virus (ToLCV) is the most important
begomoviruses which limits the tomato production to a great extent. In recent years,
the disease has caused a serious loss in tomato production in Jammu division.
Therefore, an investigation was carried out on various aspects to know the status,
detection and management of the disease. The data generated during the course of
investigation is discussed here under:
Extensive survey was conducted in different locations of Jammu districts viz.
Bishnah, Akhnoor, R. S. Pura, Marh and Udhampur districts viz. Chennani,
Ramnagar, Basht and Udhampur to record the incidence of tomato leaf curl virus. The
result showed that the per cent disease incidence varied from different locations
surveyed. However the disease was prevalent in almost all the locations surveyed. In
Jammu district the incidence of disease ranged from 19.75 to 24.00 per cent and the
maximum disease incidence of 24.00 per cent was recorded from Akhnoor and
minimum from R.S.Pura (19.75 %). While in Udhampur district the per cent disease
incidence ranged from 18.75 to 23.7 per cent with maximum incidence of 23.75 per
cent from Udhampur while minimum 18.75 per cent from Ramnagar The difference
in the incidence of disease in different location may be due to source of virus
inoculum, population of whitefly responsible for transmission of the virus and
environmental conditions. Our findings are in agreement with Saikia and Muniyappa
(1989) who recorded 17-53 per cent disease incidence in July-November and 100 per
cent during February – May in Karnataka. Reddy (1978) also observed 6-38 per cent
ToLCV incidence during winter months and 25-86 per cent during summer months.
Similar observations were also made by Datar (1984) and Reddy et al. (2011).
Detection of the tomato leaf curl virus was done by Polymerase Chain
Reaction which amplifies a specific DNA sequence, present between two regions of
known nucleotide sequence. The samples were collected from the different tomato
33
growing areas surveyed and brought to the laboratory for detection of the virus by
polymerase chain reaction (PCR). The tomato leaf curl viral DNA was amplified in
PCR using ToLCV specific primer AV1 F (5’ ATGGCGAAGCGACCAG 3’) and
AV1 R (5’ TTAATTTGTGACCGAATCAT 3’). The virus was detected in almost all
the samples collected from different locations. Similar techniques was used by
different workers for detection of tomato leaf curl virus, Anfoka et al. (2005) detected
tomato yellow leaf curl virus through PCR from Jordan valley by using the primer
pairs MAI4/MA15 and PTYIRv21/PTYIRc287, while Dennis and Narceo (2007)
detected ToLCV from Philippines by PCR using 3 sets of degenerate primers that
amplify different regions of the genomic DNA of the virus. Thakuria et al. (2012) also
detected tomato leaf curl virus from Jorhat by Polymerase Chain Reaction (PCR)
using DNA-A specific primer which yielded a 348 bp PCR product. The detection of
ToLCV through PCR has been also successfully done by Rojas et al. (1993); Mehta et
al. (1994); Muniyappan et al. (2000); Tiwari et al. (2010) and Asmaa et al. (2011).
Tomato leaf curl virus coat protein gene was sequenced and compared with
other sequences with respect to nucleotide polymorphism and it was observed that the
virus showed 99.00 % similarity with tomato leaf curl New Delhi virus. Padidam et
al. (1995), sequenced the genomes of tomato leaf curl geminivirus from India
(ToLCNDV-Mild and ToLCNDV-severe) and found that the two isolates have 94.00
per cent sequence identity. Similar results were also reported by Srivastava et al.
(1975). Yang et al. (2011), reported ToLCV from China through PCR using the
degenerate primer pairs. Phylogenetic and recombination analyses of the virus
genomic sequences suggested that tomato leaf curl China virus may have arisen by
recombination among tomato leaf curl Vietnam virus (ToLCVV), tomato leaf curl
Gujarat virus (ToLCGV) and an unknown virus. Gaikwad et al. (2011), also detected
tomato leaf curl virus from Punjab by using begomovirus specific primers and found
that tomato leaf curl Palampur virus (ToLCPMV) was the most prevalent virus
followed by tomato leaf curl New Delhi virus (ToLCNDV).
Identification of resistant genotype is one of the important aspect in
management of ToLCV disease. In the present study screening experiment was taken
up to access the incidence of the disease in different germplasm (Samrudhi F-1, Heem
Sohna, Sonali, Rupali, Mahaveer, NS 812, NS 816, Pusa ruby, Avinash-2, Indus
1030, Namdhari 82535, Arti, DVRT-2, Hybrid no 15 and local variety) under field
34
conditions. It was observed that disease incidence ranged from 0.00 to 66.66 per cent
at 70 days after transplanting. Further it was found that out of 15 germplasm, two
germplasm viz. Mahaveer, Avinash-2 were found resistant (R), Samrudhi F1 and
Namdhari 82535 were found moderately resistant (MR) while Heem Sohna, Sonali,
Rupali, NS 812, NS 816, Pusa ruby, Indus 1030, Arti, DVRT-2, Hybrid no 15 and
local were found susceptible (S).The screening of different genotypes of tomato for
managing the tomato leaf curl disease has been also reported by Hassan et al. (1984);
Banerjee and Kalloo (1987); Pilowsky and Cohen (1990); Zakay et al. (1991);
Muniyappa et al. (2000); Sajeed Ali et al. (2002); Maruthi et al. (2003); Singh (2014)
and Zeshan et al. (2016).
Attempts were also made to develop management strategies using different
chemicals such as imidacloprid, thiamethoxam, dimethoate, acetamiprid, profenofos
and methyl-o-demeton to manage the disease intensity under field conditions. The
different insecticides were evaluated to know their efficacy by controlling the vector
Bemesia tabaci which is responsible for spread of the disease. From the results, the
application of imidacloprid (seed treatment+ seedling dip+ foliar application) at 70
DAT was found most effective treatment in maintaining the disease intensity of 8.14
%. The other combinations of imidacloprid were also effective in reducing the disease
intensity at different days after transplanting. The other chemical viz. thiamethoxam,
dimethoate, acetamiprid, profenofos and oxy-demeton methyl were also found
effective in reducing the disease intensity as compared to untreated plots. The
minimum disease intensity of 8.14 % was recorded in seed treatment + seedling dip +
foliar application of imidacloprid followed by foliar application of imidacloprid (9.62
%), seed treatment with imidacloprid (11.10 %), foliar application of thiamethoxam
(11.84%), foliar application of dimethoate (12.59 %), foliar application of
acetameprid (13.33 %), foliar application of methyl-o-demeton (13.33 %) and foliar
application of profenofos (14.07 %), whereas per cent disease intensity in control was
(30.73%). Yassin et al. (1975), also reported that the application of insecticidal spray
delayed the development of leaf curl disease on transplanted tomato and slow down
the progress of disease. The application of different insecticides to reduce the
incidence of tomato leaf curl disease by checking the whitefly population was also
reported by Sastry and Singh (1973); Butter and Rataul (1973); Rajasri et al. (2009);
Singh and Prajapati (2014) . Manson et al. (2000), conducted an experiment on
35
inhibition of transmissions of ToLCV by using thiamethoxam as soil drench and foliar
spray and found that a good level of protection against the disease was given by soil
drenching (upto 22 days) than foliar spray. Further, they also reported that the
thiamethoxam activity in preventing ToLCV transmission by B. tabaci was simply
due to killing action and not by antifeedant/repellent action. Efficacy of imidacloprid
to check tomato leaf curl virus under field conditions was also reported by Ahmed et
al. (2001), who found that the repeated sprays of imidacloprid reduced disease
incidence and the treated plots consistently had higher yields than control plots.
Gajanana et al. (2006) also reported that root dipping of tomato seedlings in
imidacloprid just before transplanting followed by spraying at 15 days after planting
gave greater reduction in incidence of tomato leaf curl virus.
During the course of present studies it was observed that tomato leaf curl
disease was considered one of the major diseases of tomato. During field survey the
disease was prevalent in all the locations surveyed and while screening except two
germplasm all were found infected with the virus from seedling to maturity stage of
the crop. To have good crop with minimum disease, a proper attention on control
measures is most important. Early detection of the virus through molecular tools is
very important if the virus is detected in early stage, the farmers can remove the virus
infected plants and spray the crop with effective insecticide which will control the
insect vector responsible for transmission of tomato leaf curl virus under field
conditions.
Summary and Conclusion
36
CHAPTER-6
SUMMARY AND CONCLUSIONS
Tomato (Lycopersicon esculentum Mill.) is a herbaceous fruiting plant
belonging to the family Solanaceae. It originated in Latin America and has become
one of the most popular and widely cultivated vegetable crops of the world with
ability to survive in diverse environmental conditions. It is grown for its edible fruit,
which can be consumed, either raw or cooked or in the form of various processed
products like juice, ketchup, sauce, pickle, pastes, puree and powder. It is universally
treated as “protective food” and provides almost all types of vitamins and minerals in
quite fair amount. Tomato-based products are used as a preventive strategy against
cancer and cardiovascular diseases. Tomato crop is attacked by large number of
pathogens that infect various plant parts of the crop and greatly affect the production.
Among the different viral diseases tomato leaf curl disease caused by tomato leaf curl
virus (ToLCV) is a major limiting factor in tomato cultivation. In India the virus
caused 100 per cent infection and yield losses up to 90 per cent (Reddy et al., 2011
and Shankarappa et al., 2008). In Jammu region of Jammu & Kashmir the area under
tomato cultivation is 1,280 hectare with the production of 23,550 metric tonnes and
productivity of 18.40 tonnes per hectare (Anonymous, 2011). But, the main
constraints for low productivity in tomato crop in Jammu is due to the attack of
tomato leaf curl disease. So, considering the importance of the crop a systematic study
was conducted with the objectives to identify the virus responsible for the disease and
its management.
Extensive survey was conducted in Jammu and Udhampur districts to
ascertain the incidence of the disease and it was observed that in Jammu
district the maximum disease incidence of 24.00 per cent was recorded from
Akhnoor followed by Marh (22.25 %), Bishnah (20.50 %) and R.S.Pura
(19.75 %) with the mean of 21.62 per cent. In Udhampur, the maximum
percentage of tomato leaf curl incidence was recorded from Udhampur
(23.75%), while minimum 18.75 per cent was recorded from Ramnagar with
the mean percentage of disease incidence of 21.56 per cent.
37
The identification of tomato leaf curl virus through molecular tools which
showed the amplification of size 700 bp after gel electrophoresis indicating the
presence of the virus.
Alignment analysis of the amplified- PCR fragments by using Bioinformatics
tool (BLAST) showed that the virus shared 99.00 per cent nucleotide sequence
identity with tomato leaf curl New Delhi virus.
Screening of different germplasm collected from different sources showed that
out of fifteen germplasm (Samrudhi F-1, Heem Sohna, Sonali, Rupali,
Mahaveer, NS 812, NS 816, Pusa ruby, Avinash-2, Indus 1030, Namdhari
82535, Arti, DVRT-2, Hybrid no 15 and local variety) except Mahaveer and
Avinash-2 all the germplasm were found infected by ToLCV under field
conditions.
It was also observed that germplasm viz. Mahaveer and Avinash-2 were found
resistant, Samrudhi F1 and Namdhari 82535 were found moderately resistant
while eleven germplasms viz. Heem Sohna, Sonali, Rupali, NS 816, NS 812,
Pusa Ruby, Indus 1030, Arti, DVRT-2, Hybrid no. 15 and local showed
susceptible reaction against tomato leaf curl virus.
The various effect of different insecticide (imidacloprid, thiamethoxam,
dimethoate, acetamiprid, profenofos and oxy-demeton methyl) was studied on
Pusa Ruby variety against tomato leaf curl disease under field condition and it
was found that at 70 DAT seed treatment + seedling dip + foliar application of
Imidacloprid showed lowest disease intensity of 8.14% followed by foliar
application of imidacloprid, seed treatment with imidacloprid, foliar
application of thiamethoxam, foliar application of dimethoate, foliar
application of acetamiprid, foliar application of methyl-o-demeton and foliar
application of profenofos and their percent disease intensity was 9.62%,
11.10%, 11.84%, 12.59%, 13.33%, 13.33% and 14.07% respectively, whereas
in untreated control plot the disease intensity was recorded at 30.73%. It was
also observed that at 40 DAT and 70 DAT there was no significant variation in
disease intensity in the plots treated with seed treatment + seedling dip + foliar
application of imidacloprid, foliar application of imidacloprid and seed
treatment of imidacloprid.
References
38
REFERENCES
Ahmed, N. E., Kanan, H. O., Sugimoto, Y., Ma, Y. Q. and Inanaga, S. 2001. Effect of
imidacloprid on incidence of Tomato yellow leaf curl virus. Plant-Disease,
85(1): 84-87.
Ajlan, A. M., Ghanem, G. A. M. and Abdulsalam, K. S. 2007. Tomato yellow leaf
curl virus (TYLCV) in Saudi Arabia: Identification, partial characterization
and virus vector relationship. Arab Journal of Biotechnology, 10(1): 179-192.
Alathom, D. T. S. and Sutabutra, T. 1986. Tomato yellow leaf curl virus in Thailand,
In Plant virus diseases of horticultural crops in the tropics and subtropics ,
Taipei, Thaiwan, Food and technology can be for the Asian and Pacific
Region, pp 63-66.
Anfoka, G. H., Abhary, M. and Nakhla, M. K. 2005. Molecular identification of
species of the tomato yellow leaf curl virus complex in Jordan. Journal of
Plant Pathology, 87 (1): 65-70
Anonymous, 2006. Indian Horticulture Database, Chapter 02, Tomato, pp 177-185
Anonymous, 2011. Vegetable production in India: Technical Bulletin, IIVR,
Varanasi, 51: 250.
Asmaa, F., Kh, A., Ibtisam, A., Entsar, A. and Hayam, S. 2011. Identification and
molecular characterization of tomato yellow leaf curl virus- EG. Emirates
journal of food and agriculture. 23 (4): 355-367.
Banerjee, M. K. and Kalloo, G. 1987. Inheritance of tomato leaf curl virus resistance
in Lycopersicon hirsutum, f. glabratum . Euphytica , 36 : 581-584.
Brown, J. K. and Nelson, M. R. 1988. Transmission, host range and virus vector
relationships of chinodel tomato virus, a whitefly transmitted gemini virus
from Sinaloa, Mexico. Plant Disease, 72 : 866-869.
Butter, N. S. and Rataul, H. S. 1973. Control of tomato leaf curl virus (TLCV) in
tomatoes by controlling the vector whitefly Bemisia tabaci Gen. by mineral oil
sprays. Current Science, 42 (24): 864-865.
39
Capoor, S.P. 1981. Important virus diseases of field and garden crops in India and
their control. ICAR, New Delhi, pp.44.
Cohen, S. and Harpaz, I. 1964. Periodic rather than continual acquisition of a new
tomato virus by its vector, the tobacco whitefly (Bemisia tabaci Gennadius).
Entomologia Experimentalis et Applicata, 7: 155-166.
Cohen, S. and Nitzany, F. E. 1966. Transmission and host range of the tomato yellow
leaf curl virus. Phytopathology, 56:1127-1131.
Cowland, J.W. 1932. Rep. Gez. Ent. Sect. Rep . In Gezira Agriculture Research
Service, Sudan.
Czosnek, H., Ber, R., Antignus, Y., Cohen, S., Navot, N. and Zamir, D. 1988.
Isolation of the tomato yellow leaf curl virus (geminivirus). Phytopathology,
78: 508-512.
Czosnek, H. and Laterrot, H. 1997. A worldwide survey of tomato yellow leaf curl
viruses. Archives of Virology, 142 (7): 1391-1406.
Czosnek, H., Navot, N. and Laterrot, H. 1990. Geographical distribution of tomato
yellow leaf curl virus. A first survey using a specific DNA probe.
Phytopathologia Mediterranea, 29 : 16.
Datar, V.V. 1981. Epidemiology of leaf curl in three varieties of tomato. Third
international symposium in Plant Pathology , (New Delhi), pp. 235.
Datar, V. V. 1984. Seasonal incidence of leaf curl in three varieties of tomato. Indian
Phytopathol, 37: 540-543.
Dennis, D. and Narceo, B. 2007. Molecular detection of white fly transmissible
Geminiviruses (Family Geminiviridae, Genus Begomovirus) in the
Philippines. PhilippineJournal of Science,136 (2): 87-101.
Fauquet, C. M., Briddon, R. W., Brown, J. K., Moriones, E., Stanley, J., Zerbini, M.
and Zhou, X. 2008. Geminivirus strain demarcation and nomenclature.
Archieve of Virology, 153: 783-821.
40
Gaikwad, K.A., Sharma, A. and Cheema, D.S. 2011. Molecular detection and
characterization of leaf curl virus infecting tomato in Punjab, India. Acta
Horticulturae, 914: 153-156
Gajanana, T. M., Krishna Moorthy, P. N., Anupama, H. L., Raghunatha, R. and
Prasanna Kumar, G. T. 2006. Integrated pest and disease management in
Tomato: An Economic Analysis. Agricultural Economics Research Review,
19: 269- 280.
Goodman, R. M. 1977. Single stranded-DNA genome in a whitefly transmitted plant
virus. Virology, 83: 171-179.
Gomez, K. A. and Gomez, A. A. 1984. Statistical Procedures for Agricultural
Research. pp 95-109.
Green, S. K., Sulyo, Y. and Lesemann, D. E. 1987. Outbreaks and new records of leaf
curl virus on tomato in Thaiwan province. FAO Plant Protection Bullettin, 35:
62.
Harrison, B. D., Muniyappa, V., Swanson, M. M., Roberts, I. M. and Robinson, D. J.
1991. Recognition and differentiation of seven whitefly transmitted Gemini
viruses from India and their relationships to African cassava mosaic and
Thailand mungbean yellow mosaic viruses. Annuals of Applied Biology,118 :
299-308.
Hassan, A.A., Mayzed, H.M., Mustafa, S.E.Nassar, S.H., Nakhle, M.K. and Sims,
W.F. 1984. Inheritance of resistance to tomato yellow leaf curl virus derived
from Lycopersicon cheesmani and L. hirsutum. Horticulture Science, 19: 574-
575.
Krishnareddy, M. 1989. Studies on yellow mosaic and leaf crinkle diseases of
blackgram. Ph.D. Thesis, IARI. New Delhi. pp.263.
Lapidot, M. and Friedmann, M. 2002. Breeding for resistance to whitefly-transmitted
geminiviruses. Ann. Appl. Biol, 140: 109–127
Makkouk, K.M. 1978. A study of tomato viruses in the Jordan valley with special
emphasis on tomato yellow leaf curl. Plant Disease Reporter, 62: 259-262.
41
Makkouk, K.M. and Laterrot, H. 1983. Epidemiology and control of tomato yellow
leaf curl virus. Blackwell Scientific Publications, Oxford, pp. 315-21.
Makkouk, K. M., Shehab, S. and Majdalani, S.E. 1979. Tomato yellow leaf curl:
incidence, yield and losses and transmission in Lebanon. Phytopathologische
Zeitschrift, 96 (3): 263-267.
Manson, G. Rancati, M. and Basco, D. 2000. The effect of thiomethaxam, a second
generation neonicotinoid insecticide in preventing transmission of tomato
yellow leaf curl Gemini virus (TYLCV) by the whitefly, Bemisia tabaci
(Gennadius). Crop Protection, 19 (7): 473-479.
Mansour, A. and Almousa, A. 1992. Tomato yellow leaf curl virus; host range and
virus vector relationships. Plant Pathology, 41:122-125.
Maruthi, M. N., Czosnek, H., Vidavski, F., Tarba, S.Y., Milo, J., Leviatov, S.,
Venkatesh, H.M., Padmaja, A.S., Kulkarni, R.S., Venkataramappa, and
Mohanty, A.K. and Basu, A.N. 1986. Effect of host plant and seasonal factors
on intraspecific variation in pupal morphology of whitefly vector, B. Tabaci
(Genn.) (Homoptera: Aleyrodidae). Journal of Entomological Research, 10:
19-26.
Maruthi, M. N., Czosnek, H., Vidavski, F., Tarba, S.Y., Milo, J., Leviatov, S.,
Venkatesh, H.M., Padmaja, A.S., Kulkarni, R.S., Venkataramappa, and
Muniyappa,V. 2003. Comparison of resistance to tomato leaf curl virus (India)
and tomato yellow leaf curl virus (Israel) among Lycopersicon wild species,
breeding lines and hybrids. European Journal of Plant Pathology, 109: 1-11.
Mazyad, H.M., Omar, F., Altaher, K. and Salha, M. 1979. Observations on the leaf
curl virus. Phytopathology, 56: 1127-1131.
McKinney, H. H. 1923. A new system of grading plant diseases. Journal of
Agriculture Research, 26:195-218.
Mehta, P., Jeffrey, A., Wayman, M. K., Nakhla and Maxwell, D. P. 1994. Polymerase
chain reaction detection of of viruliferous Bemisia tabaci with two tomato
infecting geminiviruses. Indian Journal of Economic Entomology, 87: 1285-
1290.
42
Moriones E, and Navas C. J. 2000. Tomato yellow leaf curl virus, an emerging virus
complex causing epidemics worldwide. Virus Research, 71: 123-134.
Mote, V.N. 1976. Effect of different insecticides on the control of Whitefly, Bemisia
tabaci, (Gennadius) population in tomato crop and the incidence of tomato
leaf curl virus. Journal of Maharashtra Agricultural Universities, 1: 42-45.
Muniyappa,V. 2003. Comparison of resistance to tomato leaf curl virus (India) and
tomato yellow leaf curl virus (Israel) among Lycopersicon wild species,
breeding lines and hybrids. European Journal of Plant Pathology, 109: 1-11.
Muniyappa, V. and Veeresh, G. K. 1984. Plant virus diseases transmitted by
whiteflies in Karnataka. Proceedings of Indian Academy of Sciences, 93 : 397-
406.
Muniyappa, V., Venkatesh, H. M., Ramappa, H. K, Kulkarni, R. S., Zeidan, M.,
Tarba, C.Y., Ghanim, M. and Czosnek H. 2000. Tomato leaf curl virus from
Bangalore (ToLCV-Ban4): sequence comparison with Indian ToLCV isolates,
detection in plants and insects, and vector relationships. Archives of Virology,
145 (8):1583-98.
Murugesan, S., Chelliah, S. and Murugesan, M. 1977. Prediction of whitefly vector
Bemisia tabaci (Genn.) and yellow mosaic incidence in green gram. Madras
Agricultural Journal, 64: 22-28.
Naik, G. 2002. Studies on host preference of Bemisia Tabaci (Gennadius) and
management of Tomato leaf curl virus disease. Ph.D. thesis. UAS, GKVK,
Banglore, India.
Nair, R.R. and Wilson, K.I. 1969. Studies on some whitefly transmitted plant virus
disease from Kerala. Agriculture Research Journal of Kerala, 7:123-126.
Nariani, T.K. 1968. Enation leaf curl of tomato. Plant Disease Reporter, 52 : 529-536.
Navot, N., Pichersky, E., Zeidan, M., Zamir, D. and Czosnek, H. 1991. Tomato
Yellow Leaf Curl Virus: A Whitefly- Transmitted Geminivirus with a single
Genomic Component. Virology, 185: 151-161.
43
Navot, N., Pichersky, E., Zamer, D. And Czosnek, H. 1992. Use of polymerase chain
reaction to amplify tomato leaf curl virus DNA from infected plants and
viruliferous whiteflies. Phytopathology, 82: 1199-1202.
Nitzany, F.E. 1975. Tomato yellow leaf curl virus. Phytopathologia Mediterrania,
14 : 127-129.
Nour-Eldin, F., Mazyd, H. and Hassan, M.S. 1969. Tomato leaf curl virus disease.
Agriculture Research Review, Cairo, 47: 49-54.
Osei, M. K., Akromah, R., Lamptey, J. N. L. and Quain, M. D. 2012. Phenotypic and
molecular screening of some tomato germplasm for resistance to tomato
yellow leaf curl virus disease in Ghana. African Journal of Agricultural
Research, 7 (33): 4675-4684.
Padidam, M., Beachy, R. N. and Fauquet, C.M. 1995. Tomato leaf curl geminivirus
from India has a bipartite genome and coat protein is not essential for
infectivity. Journal of General Virology, 76: 249–263.
Pilowsky, M. and Cohen, S. 1990. Tolerance to tomato yellow leaf curl virus derived
from Lycopersicon peruvianum . Plant Disease, 74: 248-250.
Pruthi, H . S. and Samuel, C. K. 1939. Entomological investigation on the leaf curl
disease of tobacco in Northern India III. The transmission of leaf curl by
whitefly, Bemisia gossypipedra, to tobacco, sunhemp and a new alternate host
of the leaf curl virus. Indian Journal of Agricultural Sciences, 9: 223-275.
Rai, N., Rajeev, P., Tirkey, T. and Pathak, R. 2001. Studies on relationship between
environmental conditions on tomato leaf curl virus (TLCV) incidence. II.
Screening of tomato genotypes and their stability against TLCV. Progressive
Horticulture, 33 (2): 184-189.
Rajasri, M., Lakshmi, K. V., Rao, R. D. V. J. P. and Reddy, K. L. 2009. Management
of whitefly transmitted Tomato leaf curl virus using guard crops in tomato.
Indian Journal of Plant Protection, 37 (1/2): 101-103.
Ramkrishnan, K., Janaki, J. P. and Seellammal, S. 1964. The tomato leaf curl virus.
Madras Agricultural Journal, 51: 94.
44
Raychaudhary, S. P. and Nariani, T. K. 1977. Virus and mycoplasma diseases in
India. Oxford and IBH publishing Company, New Delhi, 102 pp.
Reddy, B. A., Patti, M. S., Reddy, K. M. and Venkataravanappa,V. 2011. Detection
and diagnosis of Tomato leaf curl virus infecting tomato in Northern
Karnataka. African Journal of Agricultural Research, 6 (5): 1051-1057.
Reddy, S. K. 1978. Studies on leaf curl disease of tomato (Lycopersicon esculentum
Mill.). Ph.D Thesis, UAS, Bangalore, India, pp. 134
Retuerma, M.L., Pableo, G.O. and Price, W.C. 1971. Preliminary study of the
transmission of Philippine tomato leaf curl virus by Bemisia tabaci.
Philippines Phytopathology, 7: 27-34.
Rojas, M.R., Gilbertson, R.L., Russell, D.R. and Maxwell, D.P. 1993.Use of
degenerate primers in the polymerase chain reaction to detect whitefly
transmitted gemini viruses. Plant Disease, 77: 340-347.
Saikia, A. K. and Muniyappa, V. 1989. Epidemiology and control of tomato leaf curl
virus in southern India. Tropical Agriculture, 66 (4): 350-354
Sajeed, A., Nath, B. K., Yadav,P. S., Wangchu, V. B., L. and Ali, S. 2002 Tomato
leaf curl virus disease on different tomato cultivars in the New Alluvial Zone
of West Bengal. Environment and Ecology, 20: 908-911.
Saklani, A.U.D. and Mathai , P.J. 1977. Effect of date of planting on leaf curl disease
of tomato. Indian Journal of Horticulture, 34: 64-68.
Saklani, A.U.D. and Mathai, P.J. 1978. Effect of insecticides on leaf curl incidence in
tomato pesticide. 12: 17-20.
Samarakoon, S. A. M. C., Balasuriya, A., Rajapaksha, R. G. A. S. and
Wickramarachchi, W. A. R. T. 2012. Molecular detection and partial
characterization of Tomato Leaf Curl Virus in Sri Lanka. Pakistan Journal of
Biological Sciences, 15(18): 863-870.
Sambrook, J. And Russel, D., 2001. Molecular Cloning: A laboratory manual, 3rd
Edn. Cold Spring Harbor, Ny, USA, Cold spring Harbor Laboratory Press.
45
Sastry, K. M. S. and Singh, S. J. 1971. Effect of different insecticides on the control
of white fly ( B tabaci gen ) population in tomato and the incidence of tomato
leaf curl virus. Indian Journal of Horticulture, 28:304-309.
Sastry, K. M. S. and Singh, S. J. 1973. Assessment of losses in tomato caused by
tomato leaf curl virus. Indian Journal of Mycology, Plant, Pathology, 3: 50-
54.
Scholthof, K. G., Adkins, S., Czosnek, H., Palukaitis, P. and Jacquot, E. 2011. Top 10
plant viruses in molecular plant pathology. Molecular Plant Pathology, 12 :
938-954.
Shankarappa, K. S., Sriharsha, R. K. T., Aswathanarayana, D. S., Prameela, H. A.,
Kulkarni, R. S., Muniyappa, V., Mohan, R. A. and Maruthi, M. N. 2008.
Development of tomato hybrids resistant to tomato leaf curl disease in South
India. Euphytica, 164: 531-539.
Sharma, B. R. and Sharma, O.P. 1984. Field reaction of some root-knot resistant
tomato varieties and hybrids to tobacco mosaic and tobacco leaf curl viruses.
Indian Journal of Mycology and Plant Pathology, 14: 148-150.
Shivanathan, P. 1963. The epidemiology of three diseases caused by whitefly borne
pathogens. In: Plant Virus Epidemiology , Eds. Plumb, R.T. and Thresh, J.M.,
Blackwell Scientific Publication, Oxford, pp.232.-330.
Singh, D. V. and Lal, S. B. 1964. Occurrence of viruses of tomato and their probable
strains at Kanpur. Proceedings of the National Academy of Science, India,
34:179- 187.
Singh, K. 2014. Evaluation of tomato genotypes and its reaction against ToLCV
causing leaf curl disease in tomato (Lycopersicon esculetum L.). Journal of
experimental biology and agricultural sciences, 2(15).
Singh, S.J., Sastry, K.S.M. and Sastry, K.S., 1973. Effect of oil sprays on the control
of tomato leaf curl virus in the field. Indian Journal of Agricultural Sciences,
43: 669-672.
46
Singh, S.R. and Prajapati, R. K. 2014. Assessment of integrated management of leaf
curl virus in tomato on farmers’ fields at Mahamaya Nagar district of Uttar
Pradesh. Agriways 2 (2): 119-125.
Smith, H. A. and Giurcanu, M. C., 2014. New Insecticides for Management of
Tomato Yellow Leaf Curl, a Virus Vectored by the Silverleaf
Whitefly, Bemisia tabaci. Journal of Insect Science, 14 (1): 183.
Somashekhara, Y.M., Nateshan, H. M. and Muniyappa,V., 1997. Evaluation of neem
products and insecticides against whitefly ( Bemisia tabaci ), a vector of
tomato leaf curl virus. Current Science, 44: 716p.
Srivastava, K.M., Mathur, A.K., Varma, H.N. and Varma, G.S. 1975. Complex
infection of tomato ( Lycopersicon esculentum ) with cucumber mosaic and
tomato leaf curl virus. Current Science, 44 : 716.
Stanley, J. 1983. Infectivity of the cloned geminivirus genome requires sequences
from both DNAs. Nature, 305: 643-645.
Thakuria, B., Baruah, A. R. and Nath, P. D. 2012. Detection of tomato leaf curl virus
from Jorhat using PCR. J Mycol Plant Pathology, 42(2): 230-233.
Tiwari, A. K., Sharma, P. K., Khan, M. S., Snehi, S. K., Raj, S. K. and Rao, G. P.
2010. Molecular detection and identification of Tomato leaf curl New Delhi
isolate causing Yellow mosaic disease in Bitter gourd (Momordica charantia),
a medicinally important plant in India. Medicinal Plants, 2 (2): 117-123.
Valverde, R. A., Lotrakul, P. and Landry, A. D. 2001. First report of tomato yellow
leaf curl virus in Louisiana. American Phytological Society,85 (2): 230.
Varma, J.P. 1959. Seminar on diseases of horticultural plants (Simla,) Tomato leaf
curl ICAR Proceedings, pp. 182-200.
Varma, J.P. and Poonam. 1977. Effect of 8 azagaunine on tomato leaf curl virus
infection and protein constituents of leaves of two varieties of tomato
(Lycopersicon esculentum Mill.). Indian Journal of Experimental Biology, 15:
408-409.
47
Varma, J.P., Hayati, J. and Poonam. 1986. Resistance in Lycopersicon species to
tomato leaf curl disease in India. Zeitschrift far Pflanzen krankheiteni und
pflanzenschtz, 87: 137-144.
Vasudeva, R.S. 1959. Control of tomato leaf curl. A scientific Report, IARI (New
Delhi), 1958-59, p.144.
Vasudeva, R.S. and Samraj. 1948. Leaf curl disease of tomato. Phytopathology, 18:
364-369.
Yadav, C. P. and Awasthi, L. P. 2009. Response of tomato cultivars against tomato
leaf curl virus (TLCV) under natural field conditions. Internationl journal of
plant protection, 2 : 234-236.
Yang, X., Guo, W., Ma, X., An, Q. And Zhou, X. 2011.Molecular Characterization
of Tomato Leaf Curl China Virus, Infecting Tomato Plants in China, and
Functional Analyses of Its Associated Betasatellite. Applied and
Environmental microbiology, 77 (9): 3092-3101.
Yassin, A.M. 1975. Epidemics and chemical control of leaf curl disease of tomato in
Sudan. Experimental Agriculture, 11: 161-165.
Yin,Q., Yang, H., Gong, Q., Wang, H., Liu, Y., Hong, Y. and Tien, P. 2001. Tomato
yellow leaf curl China virus: Monopartitegenome organisation and
agroinfection of plants. Virus Research, 81: 69-76.
Zakay, Z., Navot, N., Zeidan, M., Kedar, N., Rabinowitch, H., Czosnek, H. and
Zamir, D. 1991. Screening Lycopersicon accessions for resistance to tomato
yellow leaf curl virus: Presence of Viral DNA and Symptom Development.
Plant Disease, 75 : 279-281.
Zeshan, M. A., Khan, M. A., Ali, S. and Arshad, M. 2016. Phenotypic evaluation of
tomato germplasm for the source of resistance against tomato leaf curl virus
disease. The journal of animal and plant sciences, 26 (1): 194-200.
Zhang, Y.P., Zhu, W.M., Cui, H.M., Qiu, Y., Sha, K., Wan, Y.H., Zhu, L.Y., Yu, L.
and Hui, Z. 2008. Molecular identification and the complete nucleotide
sequence of TLCV isolate from Shanghai of China. Virus Genes, 36: 547-551.
Vita
VITA
Name of the student : Dechan Choskit
Father’s name : Sh. Chering Phunchok
Mother’s name : Smt. Tsetan Yangdol
Nationality : Indian
Date of birth : 18- 10- 1990
Permanent home address : Napishu, Lower Tukcha, Leh, 194101
EDUCATIONAL QUALIFICATION
Bachelors’ degree : B.Sc. Agriculture
University and year of award : Sher-e- Kashmir University of
Agricultural Sciences and Technology,
Jammu (2014)
OGPA : 7.26/ 10.00
Master’s degree : M.Sc. Agriculture (Plant Pathology)
OGPA : 7.47/ 10.00
Title of Master’s Thesis : “Detection and Management of
Tomato Leaf Curl Virus in Jammu
Region”