Upload
lenhi
View
214
Download
0
Embed Size (px)
Citation preview
DESIGN OF ENGINEERED BACTERIA FOR REGULATED PHAGE RELEASE: PROGRESS TOWARDS TARGETED
ELIMINATION OF PATHOGENS
by
A thesis submitted in conformity with the requirements for the degree of Master of Science
Graduate Department of Cell and Systems Biology University of Toronto
Ursula Alexandra Florjanczyk
© Copyright by Ursula Alexandra Florjanczyk (2014)
ii
Abstract
Thesis Title: Design of engineered bacteria for regulated phage release: Progress towards targeted elimination of pathogens
Degree: Masters of Science
Year of Convocation: 2014
Author: Ursula Florjanczyk
Graduate Department: Cell and Systems Biology
University: University of Toronto
Cholera outbreaks, caused by surges in pathogenic Vibrio cholerae, recur frequently in
areas with water reservoirs around unsanitary living conditions. Phage therapy is being pursued
as a possible alternative treatment to antibiotics. A seek-and-destroy circuit was designed for
implementation in probiotic E.coli so that they could be used as a controlled delivery system for
the phages. These engineered bacteria (EB) were designed to fulfill two functions: to regulate
their own population growth and to respond to V.cholerae by lysing to release phages. In this
study, it was confirmed that the lysogenic E.coli strain K-12 could represent EB, since it could
be induced to produce lambda phage virions. Construction of the seek-and-destroy circuit was
begun by characterizing a lytic cassette, which showed promise as a population growth regulator
and a prophage inducer. Finally, numerical simulations of a mathematical model representing the
circuit implied that EB can successfully eradicate a V.cholerae population.
iii
Acknowledgments
I express my warm thanks to my supervisor Dr. David McMillen for his support and
guidance, without which this work could not have come together. I would also like to thank
current and past members of the McMillen lab for their encouragement and patience. To Grand
Challenges Canada for giving us the opportunity to explore this exciting project. To Dr. Sergio
Peisajovich and Dr. George Espie for their invaluable insights. Finally, I am sincerely grateful to
my friends and family whose unwavering support has buoyed me through this degree.
iv
Table of Contents Introduction 1
Methods and Materials 10
Results 20
Discussion 34
Conclusion 43
References 45
Supplementary Material 49
Reagents and Buffers 10
Induction of E.coli K-12 lysis with exposure to ultraviolet light 10
Infectivity Assay 11
Phage Plaque Assay 11
Transformations and other plasmid making techniques 11
Making the pZe12-K112808 plasmid 12
Mathematical Model 14
Inducible lambda phage production in E.coli K-12 20
BioBrick Lytic Cassette 24
Mathematical Model 29
List of Supplementary Figures 48
v
List of Figures
Figure 1: V.cholerae quorum-sensing architecture 4
Figure 2: Population growth controller 4
Figure 3: Seek-and-destroy circuit 8
Figure 7. UV induction of lambda prophage 21
Figure 8. Phage Plaque Assay for UV induced K-12 23
Figure 9. Fitting infection model to infectivity assay data 23
Figure 10. Expressing the lytic cassette 26
Figure 11. Phage Plaque Assay for the lytic cassette constructs 28
Figure 12. Numerical simulations of full mathematical model 30
Figure 13. Numerical simulations of reduced mathematical model 32
Figure 14. Numerical simulations of 3-ODE model 33
Figure 4. Diagram of plasmid pZe12-luc 12
Figure 5. Diagram of Long and Short constructs 13
Figure 6.Diagram of seek-and-destroy mathematical model 15
Figure 15. Lysis/Lysogeny switch in lambda phage 38
1
Introduction
Cholera outbreaks continue to plague areas with high human population density and poor
water treatment systems, and are among the leading global causes of death for children under the
age of 5 [1,2]. The etiological agents responsible are Vibrio cholerae, gram-negative bacteria
which propagate in environmental aquatic reservoirs. V.cholerae persist in a predator-prey
equilibrium with lytic phages, called vibriophages, which specifically target the pathogens.
Cholera outbreaks can be instigated through external or internal factors that result in a sudden
surge of bacterial population or a decrease in predation by the vibriophages. Once the V.cholerae
acquire pathogenicity via gene transfer from certain vibriophages, and begin colonizing human
hosts, progress through the outbreak cycle is hastened via the shedding of pathogenic bacteria
into aquatic reservoirs where they can be uptaken by non-infected individuals. A surge in the
extrinsic concentration of vibriophages precipitates the end of each outbreak. It has been
suggested that predation from these vibriophages could drastically shorten the length of each
cholera outbreak as well as serve as a novel treatment option for suffering patients [2].
Furthermore, treatment with vibriophages would avoid damaging the native gut flora of the
patient, which can lead to further complications involving digestive issues and further infections
[3].
The hunt for alternative treatments to antibiotics is increasingly gaining urgency as the
rise in antibiotic resistance is poised to become the next global crisis [4]. Phage therapy has been
a known alternative to antibiotics for decades, even becoming a clinical treatment in the Soviet
Union in the 1960s [5]. However, lack of accessible scientific literature and the increasing
popularity of antibiotics shunted phage therapy into obscurity and it has only recently been re-
examined as a viable treatment option in light of the impending crisis. Phage therapy comes with
2
a slew of promising properties: phages are generally highly selective for their target hosts, they
can self-replicate and self-propagate through a bacterial population, and they can be used to
insert foreign DNA into target strains. The ability to affect the genome of the target pathogen can
be especially useful in minimizing the selective pressure responsible for developing resistance.
Using bacteriophages as adjuvants for antibiotics has been proven to be effective in eradicating
E. coli both in vitro and in vivo [6]. Further methods are possible to delay the evolution of phage
resistance, such as treatment with a phage cocktail containing several phage strains, targeting of
non-essential genes, and increasing the metabolic cost of developing resistance [4,6].
Other challenges present themselves in the pursuit of creating clinically relevant phage
therapies. Depending on the viral strain, phages can be difficult to isolate and characterize. Since
phages replicate in their hosts (highly dangerous pathogens), mass production would require high
security facilities [4]. Because of the inherent specificity of bacteriophages, no phage equivalent
to broad-spectrum antibiotics can be prescribed to the patient without diagnosis of the causative
bacterial strain. Phage therapy also encounters a delivery problem because of the potentially
inflammatory immune response to large virion doses. To tackle this issue, we turned to synthetic
biology in the aim of engineering bacteria to act as a tunable and targeted delivery system.
Common tools in synthetic biology have previously engineered bacteria to act as seek-and-
destroy systems for common pathogens [7,8,9]. These systems generally detect the bacterial
communication molecules secreted by the target strain (quorum-sensing autoinducers) and, upon
detection, release bacteriocins (small molecules that are lethal specifically against the target
strain) through either secretion or whole-cell lysis.
To help fight cholera infections, a probiotic E.coli strain can be recruited as the seek-and-
destroy vessel for vibriophage. Probiotics are bacterial strains that can confer a health benefit to
3
the host by creating a hostile environment for pathogens and promoting a healthy microecology
in the gut [10]. The E.coli strain Nissle 1917 [11] is one of the most widely studied probiotics
worldwide, it is commercially available and has been extensively studied as a treatment for
ulcerative colitis and acute diarrhea. In fact, a previous study by Duan and March in 2010
showed that a Nissle strain engineered to express one of the V.cholerae quorum-sensing
autoinducers was a highly effective pre-treatment for mice consequently fed V.cholerae [13].
Although further investigation is required to create clinical Nissle treatments, it is a promising
probiotic strain for use in synthetically designed phage therapy.
As in the case of the previously designed seek-and-destroy systems, our engineered
bacteria (EB) can use quorum-sensing to detect the target pathogens. Quorum-sensing
mechanisms use small membrane diffusible molecules (autoinducers) that are produced in each
bacterial cell and accumulate in extra- and intracellular space [12]. The concentration of
autoinducer increases as the bacterial population grows. Once a minimum threshold
concentration is reached, the autoinducers bind to receptor proteins which then regulate the
expression of genes that require coordination from the bacterial population. The best
characterized quorum-sensing system is also a common component used in synthetic biology
circuits: the LuxR/LuxI system. Natively, LuxI is a constitutively expressed synthase which
synthesizes the autoinducer acyl homo-serine lactone (AHL) from an abundant precursor
available in the cell. At high AHL concentrations, AHL binds to its receptor LuxR which then
dimerizes with another AHL:LuxR pair and then acts as a positive transcriptional regulator on
luxr promoters.
4
Figure 1. V.cholerae quorum-sensing architecture. a) At
low cell density, membrane bound autoinducer receptors
LuxPQ and CqsS act as kinases, phosphorylating
downstream proteins LuxU and LuxO, resulting in
production of four small RNAs (sRNA). The sRNAs inhibit
the production of a transcriptional activator, HapR. b) At
high cell density, AI-2 (produced by LuxS) binds to LuxPQ
and CAI-1 (produced by CqsA) binds to CqsS turning the
kinases into phosphatases. De-phosphorylation of LuxU and
LuxO results in transcription of quorum-sensing regulated
genes. See main text for details. Diagram based off
schematic from Ng and Bassler 2009 [14].
a) Low Cell Density
b) High Cell Density
Figure 2. Representation of LuxR/LuxI quorum-sensing
based population growth controller from You and Cox [34].
5
After the initial discovery of the LuxI/LuxR system in Vibrio fischerii, the databank of
identified quorum-sensing autoinducers grew to include oligopeptides, pseudomonas quinolone
signal (PQS), bradyoxetin, and the aptly named autoinducer-2 (AI-2), a furanosyl borate diester
[14]. The gene which codes for the AI-2 precursor synthase has been found in over 70 bacterial
species and is widely considered to be an interspecies communication molecule. AI-2 molecules
from one species has been known to affect quorum-regulated processes in other species [13]. In
fact, both E.coli and V.cholerae have the AI-2 precursor synthase. To avoid crosstalk and false
positives, a different QS channel must be used as the pathogen identifier in our EB.
The interspecies communication network is not the only quorum-sensing system in
V.cholerae (see Fig. 1). These bacteria also have an intraspecies channel which utilizes
oligopeptides as the diffusible autoinducers, namely the CqsS/CqsA network. CqsA synthesizes
the oligopeptide (S)-3-hydroxytridecan-4-one (CAI-1). CqsS is a two-component
phosphatase/kinase CAI-1 receptor. When unbound, CqsS acts as a kinase, phosphorylating the
downstream protein LuxO. LuxO regulates the expression of quorum-regulated small RNAs,
which in turn inhibit the production of HapR, an activator of downstream promoters [14]. As
concentrations of CAI-1 rise, the peptides bind to CqsS, swapping its function so that it
dephosphorylates its downstream targets and thus promotes expression of quorum-regulated
genes. Additionally, the LuxO protein integrates information from both inter- and intraspecies
communication since it is also phosphorylated by the AI-2 receptor LuxPQ. Whether or not
V.cholerae can differentiate between the two signals is unclear, although it is known that CAI-1
is a stronger signal transducer than AI-2 [14, 15]. The increased complexity of the CqsS/CqsA
system makes it more difficult to use in engineered circuits but its specificity for CAI-1 makes it
the favourable QS system for the EB.
6
The variety of available quorum-sensing systems and their relative specificity permits the
design of synthetic circuits that use parallel quorum-sensing systems for different uses. One of
the fears of using engineered bacteria for human clinical treatments, especially ones for
gastroenteric diseases that will result in expulsion of some engineered bacteria into the
environment, is their potential effect on the local ecology. This necessitates a population growth
controller, or self-activated death switch, to be programmed into the EB to avoid blooms in the
environment and to avoid overwhelming the immune system while still in the patient. Such a
population growth controller has previously been employed by You et al in 2004, who used a
lethal protein under regulation of a quorum-sensing system to create a strain of E.coli that can
only grow to a constrained carrying capacity (Fig. 2) [34]. Drawing from this controller and the
V.cholerae quorum-sensing system we can construct seek-and-destroy bacteria that would pose
limited environmental concerns if employed as a clinical treatment.
Our genetic network was therefore designed so that it could potentially fulfill several key
functions (Fig. 3). Firstly, our EB would have to be kept under a population growth inhibitor.
Secondly, they would enter the lytic cycle upon detecting a threshold level of V.cholerae.
Finally, entry into the lytic cycle would correspond to a halt of population growth restraint in
order to alleviate the metabolic load on the cells as well as avoiding killing of EB cells before
they have a chance to release vibriophages. All three functions can be accomplished through
quorum-sensing, with entry into the lytic cycle and population inhibition release both being
downstream of Vibrio cholerae CAI-1 detection and EB population regulation being controlled
by the LuxR/LuxI quorum-sensing system. The population controller in our design was modelled
from the You et al circuit [34], with LuxI and LuxR expressed constitutively and a CcdB protein
under control of the luxR promoter. The toxin CcdB acts by binding to DNA gyrase, a catalyzer
7
of DNA uncoiling [16]. Regulating the topological state of DNA is essential to bacteria as it
effects key processes such as transcription, DNA replication, and recombination [41, 42]. The
population control circuit would be mirrored by a similar system for the second and third
functions. Constitutive expression of CqsS and LuxU/O, coupled with a qrr4 promoter, would
allow the EB to regulate the expression of two proteins, Cro and CcdA, in response to the
presence of CAI-1. It is known that the Cro protein is a positive regulator of the lambda phage
lytic cycle [21]. Since the vibriophage life cycle is poorly understood, in our designed circuit,
Cro can represent a lysis-inducing protein. CcdA is the antitoxin counterpart to CcdB, binding to
CcdB and preventing it from binding to its target. In the absence of V.cholerae, the EB would
grow and accumulate AHL, leading to the expression of CcdB and cell death, thus maintaining a
limited population. Upon reaching a threshold concentration of CAI-1, the EB would be released
from the population growth inhibition by accumulation of CcdA and would enter the lytic stage
via expression of a lysis-inducing protein (Cro). It is likely that the environment in the patient’s
gut would be hostile enough not to warrant a population growth controller, since it is more
probable that our EB will struggle to gain a foothold in the flourishing native gut florae.
However, should the EB be expelled out of the patient and into the environment, the population
controller could prevent unwanted proliferation of EB.
8
1) Population Size Regulation
Figure 3. Seek-and-destroy circuit. Diagram of seek-and-destroy circuit performing its
two duties. 1) In the absence of V.cholerae QS molecules, the EB are limited by a
population growth inhibitor that is regulated by their own quorum-sensing autoinducers
(AHL). 2) At high enough concentrations of V.cholerae, EB express an antitoxin (CcdA)
to the population inhibitor (CcdB) and also express a lysis-inducing protein (Cro) to release
vibriophages. See full text for details.
2) Phage Production in Response to V.cholerae CAI-1
9
The dynamics of this theoretical design were simulated using a mathematical model to
analyze the behaviour of the circuit. To begin experimentally constructing the genetic circuit,
easily available BioBrick components and cell strains were used. BioBrick components are
nucleotide sequences of standard biological parts used in synthetic circuit design and are part of
the Registry of Standard Biological Parts [40]. To avoid handling dangerous cell strains, readily
available E.coli strains were used to represent the EB and V.cholerae. The focus was placed on
the construction and expression of individual circuit components within these cells, rather than
studying realistic pathogen and phage dynamics. The E.coli K-12 strain was used to represent EB
because K-12 exists in a lysogenic state with lambda phage that can serve as a surrogate
vibriophage. E.coli MG1665 cells were used to represent V.cholerae as they are susceptible to
infection by lambda phage virions. The BioBrick component characterized was an inducible lytic
cassette, composed of a T4 phage holin, lysozyme, and antiholin [40]. Holins are a class of
proteins that form pores in the inner cell membrane allowing lysozymes to diffuse through and
degrade the peptidoglycan wall. The lytic cassette was primarily considered as a bacterial
population growth controller and subsequently as a potential inducer of virion production. In this
study, it was first confirmed that traditional methods could be used to induce the K-12 cell strain
to produce lambda phages which could infect the MG1665 cells. A plasmid containing the lytic
cassette was then constructed and expressed in K-12 cells. Frequent loss-of-function mutations in
the construct made characterization of the lytic cassette difficult. Nevertheless, some evidence
was found that the lytic cassette caused cell death and entry of the K-12 cells into the lytic phase
of the lambda phage life cycle.
10
Methods and Materials
Reagents and Buffers
All reagents used for restriction digestions were from New England Biolabs ® (NEB),
and their protocols were followed. Unless otherwise specified, high fidelity versions of the
restriction enzymes were used. Transformations were done via electroporation, following the
Knight protocol from OpenWetWare [33]. Plasmid DNA isolations were performed using
Qiagen miniprep kits. All OD measurements were done using the Spectronic 200
Spectrophotometer from Thermo Scientific. E.coli strains were stored at -80°C in Luria-Bertani
(LB) medium containing 30% glycerol.
Induction of E.coli K-12 lysis with exposure to ultraviolet light
The E. coli strain K-12 (ATCC Number: 10798; genotype: F+ lambda+) was used as a
substitute for our engineered bacteria. The E.coli strain MG1665 (ATCC Number: 700926
genotype: F- lambda- ilvG- rfb-50 rph-1) was used as a target strain. Cultures were grown in LB
medium (Bio-Shop Canada) overnight at 37°C and then diluted 1:500 into 20mL of fresh
medium. Once the culture had reached exponential growth (Optical Density (OD) at 600 nm
≈0.4) the cultures were transferred to 9 cm Petri dishes and exposed to UV light (254nm
wavelength, 40 J/m2) for either 5 or 10 minutes. Cultures not exposed to UV were treated the
same except without irradiation. Petri dishes were gently shaken in a circular fashion during
irradiation. Irradiated cultures were then transferred into culture tubes that were wrapped in
aluminum foil to allow for growth in the absence of light. OD600 measurements were taken
every 20 minutes. OD measurements for UV assays were done on undiluted samples.
11
Infectivity Assay
MG1665 cultures were diluted 1:500 from overnight cultures in 20mL of fresh LB
roughly 2 hours before the assay. K-12 cultures were irradiated with UV for 5 min as described
above. Samples were collected 140 minutes after exposure to UV light, spun down for 10 min at
13,000xg, and the supernatant was added to MG1665 cultures which were in exponential growth
(OD600 ≈ 0.4). Samples added to growing MG1665 cultures were topped off with media to
3.0mL. OD600 was measured every 20 minutes.
The response of the spectrophotometer deviates from linearity above an OD600 reading of 1.0.
To avoid this situation, culture samples were diluted 1:3 to ensure OD readings below 1.0.
Phage Plaque Assay
Soft agar (½ concentration of normal agar) was dispensed in 3.0 mL aliquots into sterile
tubes and kept in solution in a 50°C water bath. To each tube, 0.3mL of MG1665 cells and
various volumes of K-12 culture supernatant were added. The tubes were poured onto pre-made
agar plates, quickly spread around to ensure even distribution, and incubated at 37°C overnight.
Assays performed for UV-induced prophage production from K-12 were done with supernatant
samples taken 120 minutes after irradiation. Assays performed for IPTG induction of the lytic
cassette used supernatant samples taken 240 minutes after induction.
Transformations and other plasmid making techniques
BioBrick components were taken from the 2012 Spring Distribution of the BioBrick
Repository and transformed through electroporation into electrocompetent cells. For plasmid
constructions, inserts were first amplified via PCR, using the PfuTurbo® Hotstart PCR Master
Mix from Agilent Technologies and purified using the Qiagen QIAquick PCR purification kit.
They were then digested using appropriate enzymes and then purified from an 0.8% agarose gel
12
using the Qiagen QIAquick Gel Purification kit and ligated into the plasmid backbone. Similarly,
plasmids were digested and purified from an agarose gel and dephosphorylated using NEB
Antarctic Phosphatase.
Plasmid samples were sent to The Center for Applied Genomics DNA Sequencing Facility for
sequencing with the following primers:
Forward pZ12_AatII_lseqp: 5’ CCGAAAAGTGCCACCTGA 3’
Reverse pZ12_Avr_rp: 5’ ATTACCGCCTTTGAGTGAGC 3’
Making the pZe12-K112808 plasmid for use as circuit component
The pZe12-luc backbone from Expressys (DE) is a reporter plasmid with an IPTG-
inducible luciferase (1.1). The BioBrick BBa_K112808 was amplified using the PCR primers so
that it could be ligated in between the KpnI and PacI sites of the pZe12-luc backbone:
Forward K112808_Fwd_KpnI: 5’GAGGGTACCCTTAAAAGGAGGGTCTATGGCAGGCAGCACC 3’
Reverse B012_Rev_PacI: 5’GAGCATTAATTAAATAAACGCAGAAAGGCCCACC 3’
Figure 4. Genetic map of pZe12-luc plasmid. The plasmid contains a luciferase coding region under a pLlacO-1 promoter, a colE1 origin of replication and an ampicillin resistance marker
AatIIXhoI
EcorI
KpnI
XbaI
AvrIISpeI
SacIt0 T1
RBS
luciferase
PLlacO-1
Apr
pZE12luc
colE1
13
Reverse P1A2_K12_Rev_PacI: 5’GCAGGTTAATTAAGCCTTTGAGTGAGCTGATACCGC 3’
For the two primers, PCR product sizes were 1.2kbp and 1.8kbp for B012_Rev_PacI and
P1A2_K12_Rec_PacI respectively.
Two different primer sets were used in amplifying the lytic cassette; one that included the
entirety of the cassette, and the other that truncated the original cassette after the second
terminator, BBa_B0012 (1.2). When the two constructs failed to be stable enough to express
reliably, a third construct was attempted that cut the lytic cassette at the end of the lysozyme
coding region (after component K112806) and removed all terminators, thus removing all
homology. However, this short construct was too unstable to survive in transformed cultures
even for short periods of time.
T4 holin T4 anti-holin Terminators
Constitutive promoter T4 lysozyme
Long Construct
Short Construct
Figure 5. Diagram showing subparts of the Long and Short constructs of the BBa_K112808 lytic cassette.
14
Mathematical Model
A nonlinear system of ordinary differential equations (1) was created to capture the key
kinetic dynamics of the proposed circuit in action in the presence of a pathogen culture. The
following general assumptions were adopted from the You et al mathematical model [35] for
their population growth controller when creating our model: bacterial populations grow
logistically and within a shared carrying capacity, quorum-sensing components of the circuit can
be represented by their diffusible autoinducers, and protein production and degradation rates
follow first order kinetics.
In this model, the EB population was split into two subgroups; either lysogenic E.coli that
are growing logistically and under inhibition from the population growth controller (E), or E.coli
(1)
A A
AA A A A AB
AA A
EB, lysogenic
V.cholerae, lysogenic
EB, lytic
V.cholerae, lytic
Phages
AHL
CAI-1
Lytic cassette
CcdB
CcdA
CcdA:CcdB
15
that have entered the lytic cycle (En). Lytic E.coli are assumed not to be dividing and have no
associated growth rate term. Entry into the lytic cycle of our EB is regulated by the quorum-
sensing diffusible molecules expressed natively by V.cholerae (CAI-1). CAI-1 concentrations
directly affect expression of the lysis inducing protein, Cro (R) and the protein CcdA (A), which
can dimerize with CcdB (B). CcdB expression is linearly regulate by AHL (L) concentrations.
EBlysogenic
AHL ccdB
Phages Lytic Cassette
ccdB:ccdAdimer
V.cholerae lysogenic
CAI-1 ccdA
EBlytic
V.choleraelytic
Detect and Eradicate
Pop. Growth Regulation
Figure 6. Diagram of seek-and-destroy mathematical model. In the red box are the molecular components for the population growth regulation. In the blue box are components for detection and eradication of V.cholerae, including the pathogens and phages themselves
16
Similarly, V.cholerae can either grow logistically (D) or, after infection with vibriophages, enter
a lytic stage from which they burst to release more vibriophage particles (Dn). Similar to lytic
EB, lytic V.cholerae have no growth term. Vibriophages (P) can either be taken up by uninfected
V.cholerae or degraded through first order kinetics. Production of phage particles is dependent
on a burst size (β) and a cell lysis rate (b). Similarly to the You et al model, both quorum-sensing
regulated proteins are proportional to the concentration of diffusible autoinducer produced
linearly by the bacterial populations. In the population controller, the EB death rate is linearly
related to the CcdB concentration and the switch from lysogeny to lysis is also linearly
dependent on the concentration of the Cro protein. CcdA and CcdB binding dynamics are
described by an association and disassociation constant. For simplicity, the CcdA:CcdB dimer
(AB) was not given a degradation term, it was assumed that the dimer dissociates and the
individual molecules degrade independently. Numerical simulations were performed using
Matlab’s stiff ODE solver “ode15s”, which is a variable order solver based on numerical
differentiation formulas (see Matlab documentation for details). Steady state values were
numerically solved using the “fsolve” function with starting conditions near but not equal to
some of the final concentrations taken from numerical simulations (S3.1-3.2).
The majority of parameter values were taken from the following sources: the population
regulation model by You et al [34] and the V.cholerae and vibriophage infection model from
Jensen et al [2]. The CcdB and CcdA binding coefficient was taken from Dao and Charlier [16],
the dissociation coefficient was approximated to be on the lower end of the range for the
association values. CcdA production rate was assumed to be the same as that for CcdB but the
degradation term was doubled since CcdA is much more unstable than CcdB [16]. Lysis
inducing protein (R) was given identical kinetics as CcdB, as it was assumed that its lethal
17
functionality would be similar to the toxic CcdB’s effect on the cell. Finally, lysis rates were
initially taken from a bacteriophage model by Cox and Rees [35] and Maynard and Birch [18].
See supplementary figures for a full table of parameter values.
In models where different species operate on widely disparate time-scales, quasi-steady
state can be assumed for the faster species. To apply the quasi-steady state assumption the
following model components were solved analytically for steady state and then substituted in the
other equations: CcdB, CcdA, CcdA:CcdB, Cro, AHL, and CAI-1. This resulted in a simplified
model of only 5 players: all four bacterial species and vibriophages (2). A further simplification
was made by setting the two lytic bacterial specie concentrations (En and Dn) to steady state,
under the assumption that once the cell commits to lysis it dies within a doubling time (on
average, 40 minutes after induction) [17] (3). For legibility, coefficients in (3) were substituted
as described in (4).
(2)
(3)
18
Where,
To update some of the unknown coefficient values, a lambda phage infection model was
fitted to the experimental data from the infectivity assay (5). This model was slightly modified
from the Maynard and Birch model [18], a non-dimensional ODE system describing three
players: uninfected cells, phage, and infected lysogenic cells. Uninfected E.coli (E) grew
logistically at rate, kE, to some carrying capacity, K. They were infected at a rate, ki, and a
fraction, f, entered lysis. Cells that chose lysogeny (D) grew at a rate, kD, to a carrying capacity
of KD. Lysogenic cells could also be superinfected with lambda phage at the same rate, ki, as
uninfected cells. Lambda phage (P) burst from infected cells that chose lysis at some burst size,
b. Values for growth rate and carrying capacity were taken from fitting a logistical growth model
(4)
(5)
19
to growth curves for the bacterial cultures. Experimental data values were normalized to the
calculated carrying capacity and the model was then fit to the data using a system of trial and
error. Once the closest fit was achieved (as measured by coefficient of determination), the rate of
lysis in infected cells was re-calculated to be applicable to our model of the entire proposed seek-
and-destroy circuit. See supplementary methods for dimensional model (S1.3).
20
Results
Inducible lambda phage production in E.coli K-12
Exposure to ultraviolet radiation has been shown to induce entry into the lytic phase in
lysogenic bacteria, by creating pyrimidine dimers in DNA [19]. These mutated sites can be
repaired if the cell is exposed to sunlight, activating DNA photolyase which catalyzes the
cleavage of the cyclobutane ring of the pyrimidine dimers [20]. Sites which are not repaired
become single stranded DNA sites that act as SOS signals. The RecA protein binds to these sites,
forms multidimensional helical filaments, and is activated. Active RecA acquires protease
activity through which it activates downstream proteins that can then affect cell cycle regulation,
stop DNA synthesis, and instigate error-prone DNA replication. RecA also cleaves CI, the lytic
repressor, allowing initiation of the lambda phage lytic cycle [21]. UV-inducible cell lysis,
specific to K-12 cells, was confirmed by tracking OD600 levels of E.coli K-12 and MG1665
cultures exposed to either 5 or 10 minutes of UV light (Fig. 7A). Exposure to UV light had no
discernible effect on growth of MG1665 cultures, demonstrating that UV exposure itself at this
dose was not harmful to the cells. In contrast, K-12 cultures showed a dramatic drop in OD600
80 minutes after exposure to UV light, with a more drastic drop for the culture exposed for 5
minutes. Cultures exposed to UV light recovered after the drop in OD600 (about 2 hours after
being irradiated). This recovery can be attributed to a subpopulation of E.coli K-12 cells that did
not complete the lysis switch, either due to a weak SOS signal or a lack of DNA damage to begin
with.
21
0 50 100 150 2000
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Time (min)
OD60
0
MG 0minMG 5minMG 10minK12 0minK12 5minK12 10min
Figure 7. UV induction of lambda prophage. A) OD 600 of K-12 and MG1665 cultures exposed to 0,5 or 10 minutes of UV light. B) K-12 culture irradiated for either 0 (ctrl) or 5 minutes (UV). Samples of the supernatant were taken 120 minutes after UV exposure and added to MG1665 culture C) at time 0. For each sample, 3.0mL was added to the MG1665 culture: either 3.0mL of K-12 supernatant or 1.5mL of LB + 1.5mL of supernatant. Negative control is 3.0mL of LB added to MG1665 culture (MG ctrl). OD measurements were done on undiluted samples. Each data line represents a single replicate.
A
0 50 100 150 200
0.4
0.5
0.6
0.7
0.8
0.9
1
1.1
1.2
1.3
Time (min)
OD 600
K12 0 minK12 5 min
0 20 40 60 80 100 120 140 1600.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Time (min)
OD 600
MG CtrlMG K12 ctrl 1.5mLMG K12 ctrl 3.0mLMG K12 UV 1.5mLMG K12 UV 3.0mL
B
C
22
To confirm the production of lambda virions, supernatants of lysed K-12 cultures were
added to growing MG1665 cultures in an infectivity assay (Fig. 7B-C). Supernatant samples
were taken from K-12 cultures exposed to UV light for 5 minutes since that exposure time
resulted in the more drastic drop in OD600 and thus probably allowing for greater virion yield.
MG1665 cultures grown with supernatant from lysing K-12 cells showed a volume-dependent
growth rate impediment. Lambda phage is a temperate phage, meaning that infected MG1665
cells can enter a lysogenic state instead of lysing. This could explain the lack of a drop in OD600
levels for the MG1665 culture. The reduction in growth rate of the MG1665 cultures could
therefore be attributed to a small percentage of infected cells randomly lysing rather than
integrating the lambda phage into their genome, or it could be attributed to the metabolic strain
of infection slowing down the cell cycle [22].
As a final confirmation that lambda phage was infecting the MG1665 cultures, a phage
plaque assay was performed (Fig. 8). Briefly, isolated supernatant from lysing or non-lysing K-
12 cultures was added to growing MG1665 cultures and then plated in soft agar (see Methods).
No plaques formed in the control plate (no UV exposure) and only a few plaques formed on the
experimental plate. The low number of plaques could be attributed again to the low incidence of
lysis being chosen over lysogeny. Despite the low number of phage plaques and the MG1665
behaviour in the infectivity assay, it can be concluded the E.coli K-12 strain can be induced to
enter the lytic life stage and create lambda virions which can infect MG1665 cells, in accordance
with established literature [21].
23
0.5 mL 1.0 mL 1.5 mL
Figure 8. Phage Plaque Assay for UV induced K-12. K-12 cultures were irradiated for 5 minutes and supernatant samples were taken 120 minutes later. Different volumes of supernatant samples were added to MG1665 plated on soft agar. A) Plaque count for all plates. B) Photos of plates with UV induced K-12 samples. Plaque count represents a single assay
A
B
SSE = 0.0603 r2 = 0.8611
SSE = 0.0052 r2 = 0.9462 SSE = 0.0697
r2 = 0.6457
Figure 9. Fitting infection model to infectivity assay data. Data points represent OD 600 measurements from infectivity assay of K-12 induced to lyse via UV and MG1665. Data points were normalized to calculated carrying capacity (see main text for details). Solid lines represent model predictions. Sum of squared errors of prediction (SSE) and the coefficient of determination (r2) for each data set and appropriate model prediction is inset. A) Ctrl represents MG1665 culture grown with supernatant from non-irradiated K-12 cultures. Infected represents MG1665 cultures grown with 3.0 mL of supernatant of K-12 cultures exposed to 5 min of UV. B) Data represents growth of MG1665 cultures grown with 1.5mL of supernatant of irradiated K-12 culture + 1.5mL of LB.
A B
24
In an effort to draw kinetic parameter data from these infection assays, a mathematical
model was modified to fit the data (Fig. 9). First, a logistic growth model was fit to MG1665
growth curves to get parameter values for growth rate and carrying capacity. OD600
measurements from the infectivity assay were then normalized to the carrying capacity and a
non-dimensional version of the infection model was fit to the data from the MG1665 culture
grown in the 3.0mL supernatant sample of the lysing K-12 culture, i.e. the MG1665 culture that
should be infected by lambda phage particles released from K-12. While the model could
accurately capture the dynamics of this infected culture (as shown by the high coefficient of
determination (r2) score) it was less accurate in predicting growth of the uninfected (or control)
culture. Furthermore, when these parameter values were tested against data from the MG1665
culture grown in only 1.5mL of lysing K-12 supernatant, the model became even more
inaccurate (r2 = 0.6457). Regardless, a parameter value for the lysis rate of E.coli cells that have
entered the lytic state was pulled from the fitted model for use in updating the mathematical
model of the seek-and-destroy EB circuit. See supplementary for a list of parameter values
(S1.2).
BioBrick Lytic Cassette
To begin constructing the seek-and-destroy circuit, a lytic cassette from BioBricks was
chosen for characterization. This cassette is composed of a promoterless T4 lysozyme and T4
holin, and a T4 antiholin under control of a constitutive promoter. The cassette contains three
terminators in total, BBa_B0010 and BBa_B0012 after the T4 lysozyme coding sequence, and
BBa_B0010 at the end of the cassette. In an effort to reduce sequence repetition, two different
versions of this cassette were created; one containing the entirety of the original cassette (called
Long) and one stopping at the first terminator (called Short) (see s1.2 in Methods).These
25
constructs were ligated into a pZe12-luc backbone, under a pLacO promoter and transformed
into K-12 cells (plasmids: pZe12-K112808L and pZe12-K112808S for the Long and Short
construct respectively). It was hypothesized that chemically inducing the expression of this lytic
cassette could consequently induce prophage production in the K-12, suggesting a role as the
vibriophage releasing component of our designed EB. If expression of the lytic cassette failed to
result in lambda virion production, it could still play a role in EB population control.
26
Figure 10. Expressing the lytic cassette A) IPTG toxicity assay for K-12 pZe12-luc and B) MG1665 pZe12-luc cultures. C) IPTG induction of K-12 pZe12-K112808L and D) K-12 pZe12-K112808S. Graphs show average and standard deviation of three trials. OD 600 measurements were made on a 1:3 dilution of samples in LB.
A
B
C
D
27
Growth of K-12 and MG1665 cultures was monitored in the presence of different IPTG
concentrations to check for potential IPTG toxicity (Fig. 10A-B). Although IPTG has been
known to reduce some protein synthesis [23] in E.coli strains, it did not seem to have detrimental
effects on growth of K-12 and MG1665 cultures as measured by OD600. When IPTG was added
to K-12 cells transformed with the lytic cassettes pZe12-K112808L or pZe12-K112808S, the
highest concentration of IPTG (5mM) showed some growth inhibition for both constructs (Fig.
10C-D). No difference could be seen between the pZe12-K112808L and the pZe12-K112808S
strains. It was expected that the lytic cassettes would be much more sensitive [40] to smaller
IPTG concentrations. The lack of response in the transformed cultures is possibly due to
mutations in the plasmid that lead to a loss of function. DNA sequencing of the plasmid DNA
retrieved from transformed cells revealed that both Long and Short were lacking the coding
sequences for the lytic cassette, although the promoter region was still intact. The slower growth
rate of cultures being grown at 5mM IPTG might be attributed to a subpopulation of the culture
which maintain a functional lysis cassette and are being killed, since IPTG itself was shown to
have no negative effect on K-12 growth rate. The lack of difference between the Long and Short
constructs could be attributed to both constructs having different physiological disadvantages.
The high level of sequence similarity in the long construct and the metabolic strain of holin and
lysozyme leakage in the short construct result in two different selective pressures that both drive
the cells to eliminate the cassette. Since the cultures being tested come from overnight dilutions,
there is sufficient time for the bacterial populations to lose the original plasmid structure.
28
Although the lytic cassette was an ineffective and difficult-to-employ technique for
population regulation, it was hoped that expressing the cassette would prove to be sufficient to
induce virion production in the K-12 cells. The infectivity assay was not performed since it was
difficult to pinpoint when maximal virion release would be occurring. The infectivity assay also
previously proved to lack sensitivity to small amounts of lambda phage. To test for trace
amounts of phage particles the phage plaque assay was performed instead (Fig. 11). In a series of
such assays, occasional plaques appeared in trials with 5mM IPTG for the pZe12-K112808L
construct. The lack of plaques in any of the control plates would seem to indicate that IPTG
induction of the lytic cassette is responsible for production of some phage particles.
Figure 11. Phage Plaque Assay for lytic cassette constructs. Total count of visible plaques for MG1665 cultures plated with various volumes of K-12 pZe12-K112808L (A) and K-12 pZe12-K112808S (B) supernatant, 240 minutes after induction with either 0 or 5 mM of IPTG. Shown is total plaque count for 3 trials (A) and for 1 trial (B).
A) pZe12-K112808L
B) pZe12-K112808S
29
Mathematical Model
In order to predict our EB’s hypothetical ability to eradicate Vibrio cholera, a
mathematical model was created to simulate the dynamics of the proposed circuit in action in the
presence of Vibrio cholerae. The model was analyzed analytically in three cases: zero initial EB
concentration, zero initial V.cholerae concentration, or both bacterial populations are present
(Fig. 12A). In the first case, the pathogen grows to carrying capacity. In the second case, the EB
exhibit dampened oscillations around the steady state which, due to the population regulation
circuit, is some fraction of the carrying capacity. This steady state is determined by the various
kinetic rates of the molecular components of the population regulation circuit (AHL and CcdB)
(S.1.4). Stability analysis of these steady states is made complicated by the high-dimensionality
of the mathematical model. Eigenvalues for this state could not be solved analytically. Numerical
eigenvalue solutions implied that both cases where only one of the bacterial players is present are
stable. Whereas ODE systems of 3 equations or fewer have been well characterized, it is difficult
to draw concrete stability information from 11 eigenvalues. In both single-strain steady states,
the eigenvalues in those cases are 10 negative to 1 positive. Intuitively, if V.cholerae is growing
at the environment’s carrying capacity, introduced EB would find themselves quickly
outcompeted without successfully denting the pathogen population. The case where all model
players are at a concentration of zero also underwent stability analysis. It would be hypothesized
that this state would be unstable since even a slight deviation from the origin by either of the
bacterial populations would drive the system to one of the other steady states. However, the
eigenvalues did not reflect this, with all but two being negative, implying some stability to the
system (S2.5).
30
Analytical solutions of a third steady state where EB and V.cholerae are both present
were impossible to find, as confirmed with Matlab’s symbolic equation solver. Numerical
solutions showed that for a variety of initial conditions the pathogen population would be
completely eradicated and the EB would settle into its constrained density after exhibiting
dampened oscillations (Fig. 12A). This is the same steady state as the second case described
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
A
B D
0 → 1 E.coli
V.cholerae
C
Figure 12. Numerical simulations of full mathematical model. A) Varying initial concentrations of bacterial players, from 0 → carrying capacity for E.coli (black to blue lines) and simultaneously from carrying capacity → 0 for V.cholerae (orange → green). B) Varying rate of production for lysis inducing protein, from 0 to 5 in increments of 0.5 (black to blue). C) Varying rate of degradation for lysis inducing protein from 0 to 5 in increments of 0.5 (black to blue). D) Varying rate of entry into lysis from 0 to 0.048 in increments of 0.0048 (black to blue). Graphs show non-lysing bacterial concentrations (i.e.: E and D) normalized to carrying capacity for 30 hours. Inset graphs show V.cholerae concentrations for first minutes of simulation.
Initial Concentrations dR: 0 → 5
vR: 0 → 5 η: 0 → 0.048
0 0.01 0.02 0.03 0.04 0.05 0.06 0.07 0.08 0.09 0.10
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to Carrying Ca
pacity
Time (hrs)
0 0.1
0 0.05 0.1 0.150
0.2
0.4
0.6
0.8
1
1.2
CFUs/mL no
rmalized
to C
arrying Ca
pacity
Time (hrs)
0 0.15
0 0.05 0.1 0.150
0.2
0.4
0.6
0.8
1
1.2
CFUs/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 0.15
0 0.05 0.1 0.150
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 0.15
31
above. The model was then simulated for different variable values, specifically: lysis rate, Cro
production and degradation, and CAI-1 production and degradation. (S2.1 and Fig. 12B-D). All
of these parameters could not be found in literature. For these parameters, no bifurcations could
be found in the ranges tested. These simulations all resembled those of the initial parameter value
simulations, with variable tuning affecting the dynamics of the bacterial populations but never
the final state of the system.
In an effort to simplify the analysis of our mathematical model, quasi-steady state was
assumed for all molecular players, resulting in a five-equation system. Quasi-steady state could
be applied since changes in transcription and translation levels occur on the order of minutes,
whereas bacterial population growth, lysis, and response to lethal proteins occur on the order of a
bacterial generation time (anything from 15-60 minutes). Solving this reduced system gave the
same final concentrations as the previous system (Fig. 13). Eigenvalue analysis easier to
decipher, with consistently negative eigenvalues for this steady state across the entire range of
parameter values tested, with the exception of very low (not biologically relevant) values (S2.2).
If we continue to assume quasi-steady state for the lytic populations of the EB and
V.cholerae, we can reduce the system further to three equations. Numerical simulations of this
system proved to be unrealistic, with V.cholerae concentrations plummeting almost
instantaneously to zero regardless of initial conditions (Fig. 14). Conversely, numerical solutions
for the steady states concurred with those of the previous model versions and steady state
stability analysis showed this steady state to be stable, with the exception of parameter values
near zero (S2.3).
32
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/mL no
rmalized
to C
arrying Cap
acity
Time (hrs)
0 →1
E.coli
V.cholerae
Figure 13. Numerical simulations of reduced mathematical model. A) Varying initial concentrations of bacterial players, from 0→carrying capacity for E.coli (black to blue lines) and simultaneously carrying capacity→0 for V.cholerae (orange→green). B) Varying rate of production for lysis inducing protein, from 0→5 in increments of 0.5 (black to blue). C) Varying rate of degradation for lysis inducing protein from 0→5 in increments of 0.5 (black to blue). Graphs show non-lysing bacterial concentrations normalized to carrying capacity. Insets show V.cholerae concentrations for the first 0.15 hrs.
Initial Concentrations A
vR:0 →5 B
dR:0 →5 C
0 0.150
0.5
1
0 0.150
1
0 0.150
1
33
Finally, the full model was simulated with the parameter value lifted from the fitted
infection model. However, since the parameter value for calculated lysis rate was so low (~10-11)
it effectively removed the EB’s ability to react to V.cholerae presence. For all initial conditions,
the two bacterial populations would grow to their respective carrying capacities such that their
total concentrations equalled the system’s carrying capacity (S2.4).
0 5 10 15 20 25 300
0.2
0.4
0.6
0.8
1
1.2
CFU
s/m
L no
rmalized
to C
arry
ing Cap
acity
Time (hrs)
0 →1 E.coli
V.cholerae
Initial Concentrations
Figure 14. Numerical simulations of 3-ODE model. Varying initial concentrations of bacterial players, from 0 to carrying capacity for E.coli (black to blue lines) and simultaneously from carrying capacity→0 for V.cholerae (orange→green). Graph shows non-lysing bacterial concentrations normalized to carrying capacity. Inset shows V.cholerae concentration for first 0.15 hrs of simulation.
0 0.150
1
34
Discussion
As antibiotic-resistant bacteria begin to cusp on the verge of a global epidemic, serious
pursuits are being undertaken into alternative treatments. Phage therapy, first investigated over
seven decades ago, is now being reconsidered as a promising new alternative. One of the main
challenges in employing phage therapy is production and delivery of the virions. To address this
challenge, we turned to synthetic biology to design a bacterial vessel to seek out target pathogens
and release the deadly phages.
The bacterial strain of choice used to represent the seek-and-destroy engineered bacteria
(EB) was E.coli K-12, which is in a lysogenic state with the lambda phage. It was shown that
exposure to UV light at 254 nm for 5 minutes was sufficient to induce the cells to lyse. Though
the results were not definitive, infectivity assays and phage plaque assays supported established
literature claiming that UV exposure results in prophage induction [21]. In a previous study on
UV lysis induction in E.coli WU3610, it was shown that at high doses of UV (~6.4J/m2) about
75% of lysogenic bacteria become infective centers [24]. Since the UV dose used in induction of
K-12 was nearly 6.5 times greater, we can assume that a high percentage of the population was
induced, as long as the cells have competent lambda phage. The surprising scarcity of plaques
formed in the phage plaque assay is perhaps not only due to a lack of lytic induction but also a
sub-optimal protocol resulting in only a fraction of the available phages being added to the
susceptible MG1665 culture. Furthermore, below a certain threshold of lysing cells, plaques
would not be visible due to being overgrown by adjacent lysogenic [25] E.coli. Further
confirmation of phage presence could have been attained by performing PCR amplifications for
lambda phage DNA on samples that were hypothesized to contain phage particles.
35
In an effort to gather more biologically relevant parameter values for simulations of the
circuit design, a phage infection model was fit to the above-mentioned infectivity assay. A few
remarks are required here about the fallibility of forced model fitting. According to a paper by
Gunawardena in 2014 [38], when fitting a model to experimental data, only about 20% of the
parameters are well constrained by the fit. In order to prove the model’s accuracy, it is necessary
to constrain it on one set of experimental data points and to prove its validity by having it then
predict a second data set. Unfortunately in the case of fitting the infection model to the in vivo
data, only a single data set exists for each experimental condition. Any set of parameters can be
forced to fit a data set without reflecting any biologically relevant values. Therefore, although the
model was forced to fit one set of measurements accurately, because it lost accuracy when
compared to other experimental measurements its results must be viewed with skepticism.
The BioBrick lytic cassette BBa_K112808 was designed to cause cell death through an
onslaught on bacterial cell walls. It has the potential to fulfill two roles in a seek-and-destroy
genetic circuit: population growth inhibition and induction of phage production. Analysis of
BBa_K112808 functionality in vivo was made difficult by frequent loss-of-function mutations
due to the structure of the BioBrick component and the plasmid backbone used. The loss-of-
function mutations were determined to be prevalent in the cultures by nucleotide sequencing.
One of the drawbacks of construction of synthetic genetic circuits is the use of a registry of
standard components. This often results in part repetition, especially in more complicated
components with polycistronic regions or multiple promoters. In the case of the BBa_K112808
lytic cassette, the terminator BBa_B0010 is repeated at the end of both coding regions (i.e. after
the T4 lysozyme and after the T4 anti-holin). Sequence similarities between proximate DNA
segments, especially ones of such great length (80bp), will frequently result in replication
36
slippage and cause homologous recombination [27]. The greater the metabolic load of the
transformed plasmid on the host system, the greater the selective pressure to destroy the
synthetic circuit. A previous study into evolutionary stability of BioBricks in E.coli MG1665
cells found that plasmids could lose functionality as quickly as overnight for constructs with a
high metabolic load [27,38]. The lethal nature of the proteins under the inducible promoter serve
as a strong selective pressure for the bacterial cells. The lac promoter is known to be leaky [43]
and the pZe12-luc backbone is a high copy plasmid, together this results in a significant amount
of leakage of the cassette. Thus, attempts to remove the repeated terminator and constitutive
antiholin part of the lytic cassette were not sufficient to create a stable plasmid. The shorter
construct, pZe12-K112808S, which lacks the repeated BBa_B0010 component, also lacks the
antiholin coding sequence. Since the antiholin’s primary function is to nullify any leakage from
the holin gene, the shorter construct therefore leaks lethal proteins, resulting in an urgent
selective pressure against the plasmid. Future circuit engineering would require more stable
elements, not only for in vitro or in vivo characterization but also for any potential therapeutic
uses. Attempting to coerce bacteria into exhibiting selfless behaviour is counter to their frantic
scrabble for survival and it remains a constant engineering challenge.
Although our experimental findings could not decisively demonstrate the lytic cassette’s
ability to diminish population concentration, previous experiments [40] demonstrate that it can
efficiently exterminate a bacterial population. What is less evident is whether the cassette is
sufficient for induction of the lambda lytic phase, since the isolated plaques from the phage
plaque assay for BBa_K112808 are inconclusive proof. The lysogenic-lytic switch for lambda
phage is a carefully regulated process with known triggers for induction of prophage production,
such as: changes in environmental nutrient level, DNA mutation, and high multiplicity of
37
infection (number of lambda phages in a single cell) [21,24,25]. The lambda phage life cycle
decision can be condensed to the opposing activities of two repressor proteins, Cro and CI, on
the OR promoter region (Fig. 15). This bidirectional promoter region expresses genes required
for lysogeny in one direction and genes required for lysis in the other. At the moment of
infection, the lytic/lysogenic decision is made based on the ratio of Cro to CI concentration, with
Cro repressing the lysogenic pathway and CI repressing the lytic. Whereas Cro concentrations
are not subject to intense regulation, CI levels are determined by cell status at the moment of
infection. Among the first genes transcribed after infection is CII, a lysogeny transcription
activator which promotes transcription of cI from the PRE promoter. The CII protein is
susceptible to degradation by host proteases and its concentration reflects the host’s state. Even
after lysogeny is established, it is known that certain factors can induce a switch to lysis through
their effects on the stability of CII [21,28]. For example, low cAMP concentrations result in
higher activity of the bacterial protease HflB which decreases the concentration of CII, allowing
for OR123 to escape repression and for the phage to enter lysis.
While no literature addressing the direct effect of cell wall degradation on CII stability
has been found to date, one can speculate on the cell’s reactions to such a drastic upheaval. One
can imagine that the porosity of the walls could lead to a scattering of cAMP molecules leading
to an increased degradation of CII. A known inducer of lysis is protein denaturing through heat
shock [39], which could be similar to secretion of proteins through the damaged walls. It remains
to be elucidated whether the experimentally observed phage plaque is a testament to the lytic
cassette’s ability to produce viable virions or whether the lonely plaque stands as a marker of
biological noise.
38
a
b
c
Figure 15. Lysis/Lysogeny switch in lambda phage. a) Short operator region of the lambda phage genome containing three binding sites (OR1-3). Binding to the PRM promoter region results in transcription to the left, which includes transcribing the cI protein. Conversely, binding to the PR promoter region results in transcription of the right side and thus the Cro protein. b) As CI concentrations increase, cI dimers bind first to the OR1 site, then the OR2 site and block the RNA polymerase from binding to the PR promoter. Consequent transcription of the left hand side of genes results in lysogeny. c) With increasing Cro concentrations, Cro dimers bind to OR3
resulting in transcription of the right hand side genes, leading to lysis. d) Binding affinities for CI and Cro as their respective concentrations increase.
Cro cI
OR3 OR2 OR1
lysis
Increasing cI conc.
Increasing cro conc.
d
39
Should it be confirmed that population regulation components of our circuit cannot
double as the lysis inducing factor, alternative methods need to be explored. While it was
initially thought that overexpression of the lysogenic repressor Cro would be sufficient to enter
lysis, further research into the lysogenic/lytic decision mechanism suggests that this would not be
a reliable inducer. The lysogeny/lysis operator region contains three binding sites overlapping
the PR and PRM promoters. The two repressors (Cro and CI) have different affinities for the
binding sites, with cI preferring OR1 >OR2>OR3 and Cro preferring OR3>OR2=OR1 [21]. For an
E.coli cell existing in a lysogenic state, CI is bound to OR1 and OR2 and, at high concentrations,
to OR3 (Fig. 15). In order for lysis to be initiated, Cro needs to bind to OR3 with OR2 and OR1
free so that the RNA polymerase can bind to PR and begin transcribing lytic genes. Expressing
Cro might allow it to bind to the transiently free OR3 site, but it would require two consecutive
stochastic releases of OR2 and OR1 from CI. This is unlikely since CI dimers bound at OR1 help
stabilize CI bound at OR2. In order to induce lysis, some upstream protein would have to be
expressed that destabilizes CI. Of course, such a protein, once identified, might be specific for
lambda prophage induction and an analogue would have to be found for vibriophages. As of
now, little literature exists about the vibriophage life cycle, presenting a significant hurdle in
harnessing these phages for therapeutic use.
The next challenge that arises is the projected clinical efficiency of a small EB culture
eradicating a Vibrio cholerae infection. This question is answered, at least partly, through the
mathematical simulation of the EB system. Although many of the coefficients used in the model
were approximated or estimated, bifurcation analysis shows that it is only at extreme values
(non-biologically relevant) that the EB fails to eradicate the Vibrio cholerae. Obvious limitations
of our mathematical model come to mind when placing all our confidence in its conclusions,
40
including the computational challenges of simulating the eleven non-linear differential equations
with disparate time scales and the complexity involved in drawing conclusions from steady state
stability analyses. To reduce the complexity of the model and begin stressing it outside its
previous comfort zone, the quasi-steady state assumption was applied. This assumption is
applicable for systems with time-separation and claims that the molecular species with fast
dynamics can be considered to be in a steady-state concentration [29]. The simplified model
corroborated the findings from the original model, proving that the initial model’s behaviour was
not an artifact of its computational limitations. Numerical simulations and eigenvalue values
would indicate that from all but trivial initial conditions, our EB can demolish the pathogens.
The most interesting finding from the model is that a very small population of phages is
sufficient to quickly and efficiently kill the pathogen culture. In the Jensen model of vibriophage
growth during a cholera outbreak, an initial phage concentration of 106 virions/L was enough to
cut the duration of the outbreak in half and reduce the number of infected individuals [2]. This
was equal to less than one virion per pathogenic cell. Thus, even when initial conditions are such
that EB concentration is a small percentage of V.cholerae concentration, the self-propagating
nature of the vibriophages always pushes the pathogens to extinction.
In order to place our confidence in the results attained from our mathematical model we
need to re-evaluate the assumptions upon which the model is based. Physical laws predetermine
what conclusions can be drawn from a set of assumptions since a mathematical model can only
follow logical, consecutive steps to its resolution [38].
Firstly, the numerical representation of the quorum-sensing is a potential
oversimplification of the multi-component systems. In the case of the LuxR/LuxI circuit, the
You et al paper [34] assumed that activity of the circuit was limited by AHL concentrations since
41
LuxR and LuxI are expressed in abundance relative to the autoinducer concentration
fluctuations. It was similarly assumed that, despite differences in quorum-sensing architecture,
the CqsS/CqsA/CAI-1 quorum-sensing component of the seek-and-destroy circuit could be
described with the same mathematical equations. Both QS components are regulated by the
levels of their respective autoinducers. On the other hand, a more recent paper by Weber and
Buceta [30], which studied the effect of stochastic noise on the LuxR/LuxI quorum-sensing
system, found that variations in LuxR levels drove phenotypic variability and determined
quorum-sensing switch precision. Despite these contradicting theories, we would be inclined to
trust the You et al model because of its ability to accurately predict the dynamics of their
population growth controller. However, the conclusions drawn from the experimental data were
re-examined in a later study by Marguet and You in 2010 [31]. An investigation into possible
underlying causes of the observed population oscillations in cells containing the LuxI/LuxR-
ccdB circuit revealed that plasmids containing only the lethal ccdB were sufficient to produce
those oscillations. Plasmid amplification due to RNA Polymerase I level increase and decreased
division rates at high population densities caused the drastic bacterial population fluctuations
previously seen. Pointing out logical flaws in the model assumptions promises to be a
prodigious task. However, the fact that the original three-equation model was able to accurately
describe experimental behaviour suggests that it is still useful as a predictive tool.
Secondly, although the utilization of the quasi-steady state assumption (QSSA) was
useful in confirming stability analysis of steady states, the nature of the designed EB circuit leads
us to question the validity of using the QSSA. Quasi-steady state has been mostly applied in
biochemical [32] modeling when describing enzyme reactions or enzyme and substrate
interactions. Application of the QSSA can potentially cause the loss of dynamical behaviour by
42
oversimplification. Indeed, the reduced 5-equation version of the model did not show the
population oscillations of the EB culture present in the full 11-equation model. In fact, despite
the difference in time-scales between the different model species, assuming quasi-steady state
obfuscates the relationship between the molecular components and the bacterial players in the
model. However, although applying the QSSA to the model reduces its ability to capture
behavioural dynamics, it remains a useful tool as a steady-state stability analyzer.
In light of these contradictions and doubts one might begin to wonder whether
mathematical modeling is an exercise in futility. However, if we are to truly consider synthetic
biology an engineering discipline, then theoretical testing of our designs is mandatory. These in
silico experiments could be instrumental in identifying which circuit components need to be
tightly regulated. Furthermore, predicting different model behaviours would allow us to identify
why an unexpected experimental result might be occurring. Mathematical models are useful
tools that can clarify experimental results and uncover correlations that are not intuitively
evident.
43
Conclusion
Synthetic biology is a relatively young field, one whose boundaries expand daily as potential
circuit components and designs are characterized and created. It has within it the potential to
introduce revolutionary new medical treatments for crises that we are struggling to prevent. The
spread of antibiotic resistant bacterial strains threatens to make many standard clinical treatments
obsolete. By turning to synthetic biology praxes, we can design seek-and-destroy bacteria that
act as vessels to deliver phages to targeted pathogens. Such a genetic circuit was therefore
designed that used quorum-sensing molecules to regulate its two main functions; controlling the
growth of the seek-and-destroy bacteria and lysing upon detection of the target pathogen. To
realize the circuit, a mathematical model was developed to probe the design and assembly of the
circuit was begun in vivo with available circuit components.
Firstly, our chosen representative strain for our EB (K-12) was confirmed to be prophage
inducible via traditional methods. Secondly, construction on the seek-and-destroy circuit began
with a BioBrick lytic cassette. Characterization of this cassette was made difficult due to
frequent loss-of-function mutations but preliminary results hint towards the cassette having the
dual function of being a population regulator and a phage releaser. Whether or not we want those
two functions coupled in our EB circuit requires further investigation. Finally, a mathematical
simulation of the proposed circuit implied that the parasitic nature of vibriophages make them an
excellent avenue for study in creating realistic phage therapy treatments.
Although synthetic biology promises to be an important and novel tool in our biological
problem-solving arsenal, it comes with its own plethora of unique and perhaps still unidentified
challenges. The instability of synthetic circuits in such selfish organisms as bacteria make them
unreliable and uncooperative. Ambitious synthetic biologists are constantly working towards a
44
standardized method of circuit construction so that we can predict and avoid possible causes of
circuit failure. Though mathematical models, detailed databanks, and optimized computer
programs will allow us to maximize our chances of success for each original circuit design, the
persnickety nature of biology means that we cannot uncouple theoretical design maxims from
experimental trial and error. A two-pronged attack of theory and wet-lab tinkering will help us
use synthetic biology to provide solutions for a wide variety of global problems.
45
References
1. Nelson EJ, Chowdhury A, Flynn J, Schild S, Bourassa L, Shao Y, LaRocque RC, Calderwood SB, Qadri F, Camilli A. 2008. Transmission of Vibrio cholerae is antagonized by lytic phage and entry into the aquatic environment. PLoS Pathog. 4(10):e1000187
2. Jensen MA, Faruque SM, Mekalanos JJ, Levin BR. 2006. Modeling the role of bacteriophage in the control of cholera outbreaks. Proc Natl Acad Sci USA. 103(12):4652-7
3. Guarner F, Malagelada JR. 2003. Gut flora in health and disease. Lancet. 361(9356)512-9.
4. Gross M. 2014. Phage therapies for plants and people. Curr Biol. 24(12):R541-4 5. Sabour PM, Mansel WG. 2010. Bacteriophages in the Control of Food and Waterborne
Pathogens.ASM Press. p273-281. 6. Lu TK, Collins JJ. 2009. Engineered bacteriophage targeting gene networks as adjuvants
for antibiotic therapy. Proc Natl Acad Sci USA. 106(12):4629-34 7. Hwang IY, Tan MH, Koh E, Ho CL, Poh CL, Chang MW. 2014. Reprogramming
microbes to be pathogen-seeking killers. ACS Synth Biol. 3(4):228-37 8. Gupta S, Bram EE, Weiss R. 2013. Genetically programmable pathogen sense and
destroy. ACS Synth Biol. 2(12):715-23. 9. Saeidi N, Choon KW, Lo TM, Nguyen HX, Ling, H, Leong SSJ, Poh CL, Chang MW.
2011. Engineering microbes to sense and eradicate Pseudomonas aeruginosa, a human pathogen. Mol Sys Biol. 7:521
10. Fooks LJ, Gibson GR. 2002. Probiotics as modulators of the gut flora. The British Journal of Nutrition.. 88 Suppl 1:S39-49.
11. Jacobi CA, Malfertheiner P. 2011. Escherichia coli Nissle 1917 (Mutaflor): new insights into an old probiotic bacterium. Digestive Diseases.. 29(6):600-7.
12. Lowery CA, Dickerson TJ, Janda KD. 2008. Interspecies and interkingdom communication mediated by bacterial quorum sensing. Chem Soc Rev. 37(7):1337-46.
13. Duan F, March JC. 2010. Engineered bacterial communication prevents Vibrio cholerae virulence in an infant mouse. Proc Natl Acad Sci USA. 107(25):11260-4.
14. Ng WL, Bassler BL. 2009. Bacterial quorum-sensing network architectures. Annu Rev Genet. 43:197-222.
15. Miller MB, Skorupski K, Lenz DH, Taylor RK, Bassler BL. 2002. Parallel quorum sensing systems converge to regulate virulence in Vibrio cholerae. Cell. 110(3):303-14
16. Dai-Thi MH, Charlier D, Loris R, Maes D, Messens J, Wyns L, Backmann J. 2202. Intricate interactions within the ccd plasmid addiction system. J Biol Chem. 277(5):3733-42.
46
17. Ryan GL, Rutenber AD. 2007. Clocking Out: Modeling Phate-Induced Lysis of Escherichia coli. J Bacteriology. 189(13):4749-55.
18. Maynard ND, Birch EW, Sanghvi JC, Chen L, Gutschow MV, Covert MW. 2010. A forward-genetic screen and dynamic analysis of lambda phage host-dependencies reveals an extensive interaction network and a new anti-viral strategy. PLoS Genet. 6(7):e1001017
19. Belov OV, Krasavin EA, Parkhomenko AY. 2009. Model of SOS-induced mutagenesis in bacteria Escherichia coli under ultraviolet irradiation. J Theor Biol. 261(3):388-95.
20. Kizilel R, Demir E, Azizoglu S, Asimgi H, Kavakli IH, Kizilel S. 2012. Investigation of real-time photorepair activity on DNA via surface plasmon resonance. PLoS One. 7(8):e44392
21. Ptashne, M. 1986. A Genetic Switch: Phage λ and Higher Organisms Second Edition. Cell Press and Blackwell Scientific Publications, Cambridge. 192 p.
22. Maynard ND, Gutschow MV, Birch EW, Covert MW. 2010. The virus as metabolic engineer. Biotechnol J. 5(7):686-94.
23. Kosinski MJ, Rinas U, Bailey J. 1992. Isopropyl-β-D-thiogalactopyranoside influences the metabolism of Escherichia coli. Appl Microbiol Biotechnol. 36:782-784.
24. Witkin EM, Wermundsen IE. 1997. Induction of lambda prophage and of mutations to streptomycin resistance in separate small fractions of a lysogenic derivative of Escherichia coli B/r by very low doses of ultraviolet light. Mol Gen Genet. 156(1):35-9.
25. Gallet R, Kannoly S, Wang IN. 2011. Effects of bacteriophage traits on plaque formation. BMC Microbiol.11:181
26. Gunawardena J. 2014. Time-scale separation—Michaelis and Menten’s old idea, still bearing fruit. FEBS J. 1(2):473-88.
27. Sleight SC, Bartley BA, Lieviant JA, Sauro HM. 2010. Designing and engineering evolutionary robust genetic circuits. J Biol Eng. 4:12.
28. Bandyopadhyay K, Parua PK, Datta AB, Parrack P. 2011. Studies on Escherichia coli HflKC suggests the presence of an unidentified λ factor that influences the lysis-lysogeny switch. BMC Microbiol. 11:34
29. Rao C, Arkin A. 2008. Stochastic chemical kinetics and the quasi-steady state assumption: Application to the Gillespie algorithm. J Chem Phys. 129(9):095105
30. Weber M, Buceta J. 2013. Dynamics of the quorum sensing switch: stochastic and non-stationary effects. BMC Syst Biol. 7:6.
31. Marguet P, Tanouchi Y, Spitz E, Smith C, You L. 2010. Oscillations by minimal bacterial suicide circuits reveal hidden facets of host-circuit physiology. PLoS One. 5(7):e11909.
32. Flach EH, Schnell S. 2006. Use and abuse of the quasi-steady-state approximation. Syst Biol (Stevenage). 153(4):187-91.
33. Reshma P. Shetty, Jason R. Kelly. May 2007. Knight: Electroporation. OpenWetWare. http://openwetware.org/wiki/Knight:Electroporation. August 5th, 2014.
47
34. You L, Cox RS 3rd, Weiss R, Arnold FH. 2004. Programmed population control by cell-cell communication and regulated killing. Nature. 428(6985)868-71
35. Cox C, Rees J, Voorhees K. 2011. Modeling bacteriophage amplification as a predictive tool for optimized MALDI-TOF MS-based bacterial detection. J Mass Spectrom. 47(11):1435-41.
36. Pasotti L, Zucca S, Lupotto M, Cusella De Angelis MG, Magni P. 2011. Characterization of a synthetic bacterial self-destruction device for programmed cell death and for recombinant proteins release. J Biol Eng. 5:8
37. Rokney A, Kobiler O, Amir A, Court DL, Stavans J, Adhya S, Oppenheim AB. 2008. Host responses influence on the induction of lambda prophage. Mol Microbiol. 68(1):29-36.
38. Gunawardena J. 2014. Models in biology: accurate descriptions of our pathetic thinking. BMC Biol. 12:29
39. Smith HL, Thieme HR. 2011. Persistence of bacteria and phages in a chemostat. J Math Biol. 64(6):951-79.
40. Huh Jin. October 2008. Enterobacteria phage T4 Lysis Device-no promoter. Registry of Standard Biological Parts. http://parts.igem.org/Part:BBa_K112808. August 15th, 2014.
41. Reece R, Maxwell A. 1991. DNA Gyrase: Structure and Function. Critical Review in Biochemistry and Molecular Biology. 26(3/4):335-375
42. Bahassi EM, O’Dea MH, Allali N, Messens J, Gellert M, Couturier M. 1999. Interactions of CcdB with DNA gyrase: Inactivation of Gyra, poisoning of the gyrase-DNA complex, and the antidote action of ccdA. J Biol Chem. 274(16):10936-44.
43. Penumetcha P, Lau K, Zhu X, Davis K, Eckdahl TT, Campbell A. 2010. Improving the Lac System for Synthetic Biology. BIOS 81(1):7-15.
48
List of Supplementary Figures S1.1 Table of parameter values for mathematical model of seek-and-destroy circuit 49
S1.2 Table of parameter values for infection model 50
S1.3 Dimensional version of infection model 50
S1.4 Analytical steady state of EB under population growth control 51
S2.1 Further numerical simulations of 11-ODE math model 52
S2.2 Numerical simulations of 5-ODE system 54
S2.3 Numerical simulations for 3-ODE system 55
S2.4 Numerical simulations for full model with parameter value pulled from infection model 56
S2.5 Eigenvalues 56
S3.1 Matlab code for numerical simulations 57
S3.2 Matlab code for steady state analysis 59
S3.3 Matlab code for fitting infection model to infectivity assay data 62
49
Supplementary
S.1.1 Table of parameter values for mathematical model of seek-and-destroy circuit
Variable Description Value Unit Source kE E.coli growth rate 0.97 1/h You [35] mx Carrying capacity 1.24*109 CFU/mL You [35] d death rate due to
ccdB 0.0004 nM/(mL*h) You [35]
vL AHL production rate 4.80*10-7 nM/(mL*h) You [35] dL AHL degradation
rate 0.64 1/h You [35]
vC CAI-1 production rate
4.80*10-7 nM/(mL*h) set to be the same as vL
dC CAI-1 degradation rate
0.64 1/h set to be the same as dL
vB ccdB production rate 5 1/h You [35] dB ccdB degradation
rate 2 1/h You [35]
kD V.cholerae growth rate
0.25 1/h Jensen [2]
kON ccdB:ccdA association rate
0.1 1/nM Dao [16]
kOFF ccdB:ccdA disassociation rate
0.001 1/nM Based off of Dao [16] findings. Approximated
vA ccdA production rate 5 1/h set to be the same as vB dA ccdA degradation
rate 4 1/h double dB
β1 virion burst size from E.coli
100 virions/(CFU/mL) Jensen [2]
β2 virion burst size from V.cholerae
100 virions/(CFU/mL) Jensen [2]
ω phage degradation rate
0.028 1/h Jensen [2]
q infection rate for V.cholerae
3.36*10-5 mL*h/virion Jensen [2]
b1 lysis rate for E.coli 1.5 1/h Cox [37] b2 lysis rate for
V.cholerae 1.5 1/h Cox [37]
vR cro production rate 5 1/h set to be equal to vB dR cro degradation rate 2 1/h set to be equal to dB η rate of entry into
lysis state for E.coli 0.023 nM/(mL*h) Smith [39]
50
S.1.2 Table of parameter values for infection model
Variable Description Non-dimensional
value
Source Dimensional Value
Unit
kE growth rate of uninfected E.coli
0.5 From fitting growth curve to logistic growth
0.5 1/h
f fraction of cells which choose lysis over lysogeny upon infection
0.35 estimated N/A N/A
b virion burst size of lysing cell
25 estimated 25 virions/CFU/m
L kD growth rate of
lysogenic E.coli 0.18 estimated 0.18 1/h
K carrying capacity for non-infected E.coli
1.33 From fitting growth curve to logistic growth
1.24*109 CFU/mL
KD carrying capacity for lysogenic E.coli
0.6 estimated 5.58*108 CFU/mL
ki lysis rate for cells in lytic state
0.1 estimated 7.83*10-11 1/h
P0 Phage count at time = 0 20 estimated N/A N/A dp degradation rate of
phage 0.1 estimated 7.83*10-11 1/h
S.1.3 Dimensional version of infection model
A non-dimensional version of (1) was created, as seen in main Methods, by substituting (2) into (1).
(1) (2)
51
S.1.4 Analytical steady state of EB under population growth control.
All other species at steady state are equal to zero. Subscript of “s” stands for steady state
concentration for EB (E) ccdB (B) and AHL (L).
52
S.2.1 Further numerical simulations of 11-ODE math model
vC: 0 → 9.8*10-7
dC: 0 → 1.28
eigenvalues
vC: 0 → 9.8*10-7
eigenvalues
dC: 0 → 1.28
0 ->1 E.coli
V.cholerae
A)
B)
53
Numerical simulations of full 11-ODE model of EB seek-and-destroy circuit and associated
eigenvalues at the resting steady state for each simulation. Black to blue lines represent E.coli
concentration normalized to carrying capacity, with increasing parameter values. Green to
orange lines represent V.cholerae concentration normalized to carrying capacity, with increasing
parameter values. Initial conditions are 1.24*108 CFU/mL for EB, 1.24*109 CFU/mL for
V.cholerae and zero for all other species. On the right of all numerical simulations are visual
representations of the real components of the eigenvalues, grey representing negative values and
black representing positive values. Each column represents one set of eigenvalues for each
parameter value. A) Increasing rate of CAI-1 production (vC) from 0 →9.8*10-7 nM/(mL*h) in
increments of 9.8*10-8 nM/(mL*h). B) Increasing rate of CAI-1 degradation (dC) from 0→1.28
1/h in increments of 0.128 1/h. C) Increasing rate of lysis (b1 and b2) from 0→2 1/h in
increments of 0.2 1/h.
b1 and b2: 0 → 2.0
b1 and b2: 0 → 2.0
eigenvalues
C)
54
S.2.2 Numerical simulations of 5-ODE system.
Similar conditions to S.2.1 but for the 5-ODE math model and only showing parameter value
variations for lysis rate A) b1 and b2 and for CAI-1 production rate B) vC.
b1 and b2: 0 → 2.0
b1 and b2: 0 → 2.0
eigenvalues
vC: 0 → 9.8*10-7
vC: 0 → 9.8*10-7
eigenvalues
A)
B)
55
S.2.3 Numerical simulations for 3-ODE system.
Similar to S.2.1 and S.2.3. Only showing parameter variation for CAI-1 production rate, vC.
Simulations of other parameter variations were computationally impossible.
vC: 0 → 9.8*10-7
vC: 0 → 9.8*10-7
eigenvalues
56
S.2.4 Numerical simulation for full model with parameter value pulled from infection model
Similar to S.2.1-3. All parameter values set at initial values with the exception of the rate of lysis
(b1 and b2) which are set to 7.8*10-11 1/h as determined from fitting the infection model to the
data from the K-12 and MG1665 UV infectivity assay. Shown on the left are numerical
simulations with black → blue lines representing increasing EB concentrations as normalized to
carrying capacity. Simultaneously, orange → green lines represent decreasing V.cholerae
concentrations, also normalized to carrying capacity. On the right, each column in the matrix
represents a set of eigenvalues for that condition (i.e. column 2 shows eigenvalues for E0 =
0.2*mx and D0 = 0.8*mx). Grey represents negative values and black represents positive values
for the real parts of the eigenvalues.
S.2.5 Eigenvalues for steady state where all species are zero, for 11-ODE model with initial
parameter values
Initial concentration: EB ↑ as V.cholerae ↓
eigenvalues
λ1 = -7*10-11
λ2 = -3.99
λ3 = -2.00
λ4 = -2.0
λ5 = -0.64 λ6 = -0.64
λ7 = -0.028
λ8 = -0.001
λ9 = -7*10-11
λ10 = 0.25
λ11 = 0.97
57
S.3.1 Matlab code for numerical simulations
ODEs for full 11-equation seek-and-destroy model function dydt = pmod(t,y) %Assigning all variables global kE mx d z kD q b1 b2 Bet1 Bet2 w vl dl vc dc va da vb d_b vr dr kon koff; E = y(1); D = y(2); En = y(3);Dn = y(4);P = y(5);L = y(6); C = y(7); R = y(8);B = y(9); A = y(10);Ab = y(11); dydt = [kE*(E*(1-(E+En+D+Dn)/mx)-d*E*B-z*R*E); kD*D*(1-(E+En+D+Dn)/mx)-q*P*D; z*R*E-b1*En; q*P*D-b2*Dn; Bet1*b1*En+Bet2*b2*Dn-q*P*D-w*P; vl*E-dl*L; vc*D-dc*C; vr*C-dr*R; vb*L+koff*Ab-d_b*B-kon*A*B; va*C-da*A-kon*A*B+koff*Ab; kon*A*B-koff*Ab;]; end
Call_pmod takes one argument, allowing one parameter value to be varied with each call of the function
function [T,Y] = call_pmod(b) %Assigning values to all variables global kE mx d z kD q b1 b2 Bet1 Bet2 w vl dl vc dc va da vb d_b vr dr kon koff; kE = 0.97; mx = 1.24e9; d = .004; z = 0.023; kD = 0.25; q = 3.36E-5; b1 = 1.5; b2 = 1.5; Bet1 = 100; Bet2 = 100; w = 0.028; vl = 4.8E-7;dl = 0.64; vc = 4.8E-7; dc = 0.64; va = 5; da = 4; vb = 5; d_b = 2; vr = 5; dr = 2;kon = 10^(-1);koff = 0.001; %Setting up initial conditions tspan = [0 60]; y0 = zeros(11,1); y0(1:2) = [b*mx (1-b)*mx]; [T,Y] = ode15s(@pmod,tspan,y0); end
Performing a numerical simulation of the pmod function on a range of parameter values. This is
a script called numsimviz.m hold on for i=0:0.1:1 [T,Y] = call_pmod(i); plot(T,Y(:,1)/1.24E9,'color',[0 0 i]); plot(T,Y(:,2)/1.24E9,'color',[(1-i) 0.5 0]);
58
end ylabel('CFUs/mL normalized to Carrying Capacity'); xlabel('Time (hrs)');
After first quasi-steady state approximation, model is reduced to 5 equations. function [T,Y] = moleculargone(b) %Using quasisteady state on all molecular players reduces system to 5 %dimensions kE = 0.97; mx = 1.24*10^9; d = 0.004; r = 0.023; kD = 0.25;q = 3.36e-5; b1 = 1.5; b2 = 1.5; Bet1 = 80; Bet2 = 80;w = 0.33; vl = 4.8*10^-7; dl = 0.639; vc = 4.8*10^-7*2*b; dc = 0.639; va = 5; da = 4; vb = 5; db = 2; vr = 5; dr = 2; kon = 10^(-1);koff = 10^(-5); function dydt = myfun(t,y) E = y(1);D=y(2);En=y(3);Dn=y(4);P=y(5);
dydt = [kE*E*(1-(E+En+D+Dn)/mx)-d*vb*vl/(db*dl)*E*E-r*vr*vc/(dr*dc)*D*E;
kD*D*(1-(E+En+D+Dn)/mx)-q*P*D; r*vr*vc/(dr*dc)*D*E-b1*En; q*P*D-b2*Dn; Bet1*b1*En+Bet2*b2*Dn-q*P*D-w*P;]; end tspan = [0 60]; y = zeros(5,1); y(1:2) = [0.1*mx mx]; [T,Y] = ode15s(@myfun,tspan,y); end
For numerical simulations, numsimviz is used but with line 3 changed to [T,Y] = moleculargone(i); Another application of the quasi-steady state equilibrium reduces the model to 3 equations:
function [T,Y] = solvtrzyeqns(b) kE = 0.97; mx = 1.24*10^9; d = 0.004; r = 0.023; kD = 0.25;q = 3.36e-5; b1 = 1.5; b2 = 1.5; Bet1 = 80; Bet2 = 80;w = 0.33; vl = 4.8*10^-7; dl = 0.639; vc = 4.8*10^-7*2*b; dc = 0.639; va = 5; da = 4; vb = 5; db = 2; vr = 5; dr = 2; kon = 10^(-1);koff = 10^(-5); a1 = r*vr*vc/(dr*dc*b1); a2 = q/b2; a3 = d*vc*vb/(db*dc); a4 = r*vr*vc/(dr*dc); y1 = Bet1*a4; y2 = Bet2*q; function dydt = myfunc(t,y) dydt = [kE*y(1)*(1-(y(1)+y(2)+a1*y(2)*y(1)+a2*y(3)*y(2))/mx)-a3*y(1)^2-a4*y(2)*y(1); kD*y(2)*(1-(y(1)+y(2)+a1*y(2)*y(1)+a2*y(3)*y(2))/mx)-q*y(3)*y(2); y1*y(2)*y(1)+y2*y(3)*y(2)-q*y(3)*y(2)-w*y(3);]; end y0 = zeros(3,1); y0(1:2) = [b*mx (1-b)*mx]; tspan = [0 60];
59
options = odeset('NonNegative',[1 2 3]); [T,Y] = ode15s(@myfunc,tspan,y0); end
For numerical simulations, numsimviz is used but with line 3 changed to [T,Y] = solvtrzyeqns(i); S.3.2 Matlab code for steady state analysis
For each set of parameter values, the steady state is solved for using “fsolve”. Eigenvalues at
these steady states are then calculated and written to an excel file. function [eigs] = solvepmod() kE = 0.97; mx = 1.24e9; d = .004; z = 0.023; kD = 0.25; q = 3.36E-5; b1 = 1.5; b2 = 1.5; Bet1 = 100; Bet2 = 100; w = 0.028; vl = 4.8E-7;dl = 0.64; vc = 4.8E-7; dc = 0.64; va = 5; da = 4; vb = 5; d_b = 2; vr = 5; dr = 2;kon = 10^(-1);koff = 0.001; function dydt = myfun(y) E = y(1); D = y(2); En = y(3);Dn = y(4);P = y(5);L = y(6); C = y(7); R = y(8);B = y(9); A = y(10);Ab = y(11); dydt = [kE*(E*(1-(E+En+D+Dn)/mx)-d*E*B-z*R*E); kD*D*(1-(E+En+D+Dn)/mx)-q*P*D; z*R*E-b1*En; q*P*D-b2*Dn; Bet1*b1*En+Bet2*b2*Dn-q*P*D-w*P; vl*E-dl*L; vc*D-dc*C; vr*C-dr*R; vb*L-d_b*B-kon*A*B+koff*Ab; va*C-da*A-kon*A*B+koff*Ab; kon*A*B-koff*Ab;]; end y0 = zeros(11,1); tspan = [0 60]; y0(1:2) = [0.1*mx 0.1*mx]; y0(6:11) = 300; options = optimset('MaxFunEvals',50000,'MaxIter',4000); eigmatrix = zeros(11,22); j = 1; solmatrix = zeros(11,11); s = 1; for i=0:0.1:1; y0(1:2) = [0*mx 0*mx]; [sol] = fsolve(@myfun,y0,options);
60
solmatrix(:,s) = sol; s = s+1; v = [kE,mx,d,z,kD,q,b1,b2,Bet1,Bet2,w,vl,dl,vc,dc,vr,dr,vb,d_b,kon,koff,va,da]; J = myjacob(v,sol'); eigs = eig(J); eigmatrix(:,j) = real(eigs); eigmatrix(:,j+1) = imag(eigs); j = j+2; end xlswrite('/Thesis/evals.xlsx',eigmatrix,9); xlswrite('/Thesis/evals.xlsx',solmatrix,10); end
Similarly, for the 5-equation ODE system steady state analysis: function molgoneigs() %Looking for bifurcations again for molecular qss system kE = 0.97; mx = 1.24*10^9; d = 0.004; r = 0.023; kD = 0.25;q = 3.36e-5; b1 = 1.5; b2 = 1.5; Bet1 = 80; Bet2 = 80;w = 0.33; vl = 4.8*10^-7; dl = 0.639; vc = 4.8*10^-7; dc = 0.639; va = 5; da = 4; vb = 5; db = 2; vr = 5; dr = 2; kon = 10^(-1);koff = 10^(-5); function dydt = myfun(y) E = y(1);D=y(2);En=y(3);Dn=y(4);P=y(5); dydt = [kE*E*(1-(E+En+D+Dn)/mx)-d*vb*vl/(db*dl)*E*E-r*vr*vc/(dr*dc)*D*E; kD*D*(1-(E+En+D+Dn)/mx)-q*P*D; r*vr*vc/(dr*dc)*D*E-b1*En; q*P*D-b2*Dn; Bet1*b1*En+Bet2*b2*Dn-q*P*D-w*P;]; end eigmatrix = zeros(5,22); j = 1; solmatrix = zeros(5,11); s = 1; y0 = zeros(5,1); y0(1:2) = [0.1*mx 0.1*mx]; options = optimset('MaxFunEvals',50000,'MaxIter',40000); for i=0:0.1:1; vc = i*2*4.8E-7; [sol] = fsolve(@myfun,y0,options); solmatrix(:,s) = sol; s = s+1; v = [kE mx (d*vb*vl/(db*dl)) (r*vr*vc/(dr*dc)) kD q b1 b2 Bet1 Bet2 w]; J = molgoneJacob(v,sol'); eigs = eig(J); eigmatrix(:,j) = real(eigs); eigmatrix(:,j+1) = imag(eigs); j = j+2; end xlswrite('/Thesis/molgone_evals.xlsx',eigmatrix,3);
61
xlswrite('/Thesis/molgone_evals.xlsx',solmatrix,4); end
And for the 3-equation model: function trzyeigens() %Looking for bifurcations again for trzy eqn system function dydt = myfun(y) E = y(1);D=y(2);P=y(3); dydt = [kE*E*(1-(E+D+a1*D*E+a2*P*D)/mx)-a3*E^2-a4*D*E; kD*D*(1-(E+D+a1*D*E+a2*P*D)/mx)-q*P*D; y1*D*E+y2*P*D-q*P*D-w*P;]; end eigmatrix = zeros(3,22); j = 1; solmatrix = zeros(3,11); s = 1; y0 = zeros(3,1); y0(1:2) = [0.1*1.24E9 0.0*1.24E9]; options = optimset('MaxFunEvals',50000,'MaxIter',40000); for i=0:0.1:1; kE = 0.97; mx = 1.24*10^9; d = 0.004; r = 0.023; kD = 0.25;q = 3.36e-5; b1 = 1.5; b2 = 1.5; Bet1 = 80; Bet2 = 80;w = 0.33; vl = 4.8*10^-7; dl = 0.639; vc = 4.8*10^-7; dc = 0.639*2*i; va = 5; da = 4; vb = 5; db = 2; vr = 5;dr = 2; kon = 10^(-1);koff = 10^(-5); a1 = r*vr*vc/(dr*dc*b1); a2 = q/b2; a3 = d*vc*vb/(db*dc); a4 = r*vr*vc/(dr*dc); y1 = Bet1*a4; y2 = Bet2*q; [sol] = fsolve(@myfun,y0,options); solmatrix(:,s) = sol; s = s+1; v = [kE mx a1 a2 kD a3 a4 q y1 y2 w]; J = trzyJacob(v,sol'); eigs = eig(J); eigmatrix(:,j) = real(eigs); eigmatrix(:,j+1) = imag(eigs); j = j+2; end xlswrite('/Thesis/3_evals.xlsx',eigmatrix,3); xlswrite('/Thesis/3_evals.xlsx',solmatrix,4); end
The appropriate excel sheet was read and the eigenvalue values were visualized as a two-colour
matrix. This script is called eigenvalueviz.m numbs = xlsread('/Thesis/evals.xlsx',9); xvals = numbs(1,:); xvals(isnan(xvals)) = []; reals = numbs(:,1:2:end);
62
reals = reals./abs(reals); imagesc(reals);
S.3.3 Matlab code for fitting infection model to infectivity assay data.
To calculate growth rate and carrying capacity of K-12 and MG1165, the Matlab Open Curve
Fitting app was used (“cftool”). function [] = maynard_nodil() %This one will be immutable. It's the first infection trial. %data points ctrl = [0.389 0.524 0.729 1.02 1.16 1.24 1.24]; inf = [0.389 0.36 0.409 0.49 0.582 0.703 0.821]; % Where x3 is the 1.5mL trial ctrl = ctrl/1.25; inf = inf/1.25; % time = 0:20:20*6; time = 0:6; kE = 0.5; %from fitting ctrl f = 0.35; b = 25; kD = 0.18; Kd = 0.6; K = 1.33; %from fitting ctrl ki = 0.1; Po = 20; dp = 0.1; function dydt = myfun(t,y); E = y(1); P = y(2); D = y(3); dydt = [E*(1-(E+D))-ki/kE*E*P; K/kE*(b*ki*E*P*f-ki*D*P-ki*E*P-dp*P); ki/kE*(1-f)*E*P+kD/kE*D*(1-(E+D)/(Kd*K));]; end y0 = [ctrl(1);0;0]; [t,y] = ode23s(@myfun,[0 6],y0); modc = interp1(t,(y(:,1)+y(:,3)),time); SSE = (modc-ctrl); SSE = sum(SSE.^2) h1 = plot(time,ctrl,'^'); hold on plot(t,(y(:,1)+y(:,3)),'blue'); y0 = [inf(1); Po; 0]; [t,y] = ode23s(@myfun,[0 6],y0); modi = interp1(t,(y(:,1)+y(:,3)),time); SSE = (modi-inf); SSE = sum(SSE.^2) h2 = plot(time,inf,'r+'); [ax,h3,h4] =plotyy(t,(y(:,1)+y(:,3)),t,y(:,2)); set(h3,'color','red'); set(h4,'color','green'); ylabel(ax(1),'OD 600'); ylabel(ax(2),'Phage/mL'); legend([h1 h2 h4],{'Ctrl','Infected','Phage Particles'}); end