Deichman Alex M. Choi Won Cheol Baryshnikov Anat. Yu.

RNA-editing, New Hypothetical Mechanisms and Contours of The New Paradigm

2005

Contents

Part 1. RNA-editing and other intracellular mechanisms Introduction. RNA-Editing in different biological species RNA-Editing in some viruses Minimally-editing sites of various genes transcripts

Some features of U-insert-deletion editing of pre-mRNA in trypanosome gRNA-dependent RNA-editing minicircular and maxicircular DNA-components of trypanosome kinetoplasts

Another type of insert RNA-editing in protozoa

C→U editing desamination in animals\ dC→dU editing desamination in animal immunoglobulin

A→I editing desamination in animal

tRNA-editing in different biological species

RNA-editing in chloroplasts and mitochondria of plants

Conclusion

References

Part 2. New Hypothetical Mechanisms and Contours of The New Paradigm

Introduction

Mechanism variable “reverse translation” of individual epitope (vIERT-mechanism) vIERT-mechanism and mitochondria of macrophages vIERT-mechanism and chloroplasts of plants

Possible connection of hypothetical mechanisms with universal genetic code (UGC) evolution

Possible connection of hypothetical mechanisms with RNA-editing and other intracellular mechanisms - - - - - - ---- -- - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - [Summary (part 1 + part 2): ~ 180-200 pages (with pictures, references) for Russian]

Legends

5 - Pre-mRNA editing of ATPase subunit-6 3

5 AAAG AGCAGGAAAGGU UAGGGGGAGGAGAGAAGAAAGGAAAGUUGUGAUU UUGGAGUUAUAG AAUAAGAUCAAAU…3’

3 .UUUUUUUUUUUU AUUAAUAGUAUAGUGACAGUUUUAGACUAAGCAAU AGCCUCAAUAUC AUAUAGG…

5

gRNA this pre-mRNA

Oligo-U-tail part Middle-information part Anchor part

5 3

AGGAAAGGU UAGGGGGAGGAGAGA uA Gu uA uuA uAu uGu uGu u GAAA uuuGGuuU Gu uAUUGGAGUUAUAG AAUA …

… UUUUUUUUUUUU AUUAAUAGUAUAGUGACAG UUUUAGAC UAAGCAAU AGCCUCAAUAUC

AUAU…

3 5

Fig.1

Pre-mRNA editing of ATPase subunit-6 in Trypanosome brucei mitochondria. Intermollecular anchor duplex was formed between 3’-part of this pre-mRNA and its gRNA before editing. In the result of editing 19 uridines appeared (insert of small “u”) and four ones deleted (asterisks); the

NH 2 C93

H61— Zn

COOH

Fig. 2:

Scheme of the RNA-editing region of rat cytidindeaminase containing an active site. The diagram shows zinc-coordinating (Gys-61, Cys-93, Cys-96) and proton-shuttle (Glu-63) enzyme region. Conservative phenylalanins (Phe-66, Phe-70, Phe-76, Phe-87) are shown as connecting -segment between active site and -spirals/RNA-binding is mediated by Gys-61, Clu-63, Phe-66, Phe-87 and Cys-93.

E63E6F6

C96 F8F76F7

Cytocin-nucleatide deaminases

H.sapiens S.serevisiae

T2 phageT4 phage

Cytocin-nucleaside deaminases

B.subtilis

H.sapiens

E.coli

R.norvegicus H.sapiens

RNA-editing cytidindeaminases

Fig. 3:

Three types of cytosin deaminases. Phylogenetic analysis and construction of a part of the evolution tree of different deaminase types are performed by comparison of elongated (of 50-60 amino acid residues) and deaminases regions containing a functionally active site and having probably a common precursor.

( А ) Normal Editing ( Б ) Hyper Editing

Editing ferment

С -- --- -C- C C C C ─── ▼ ▼ ▼ ▼ ▼ U U U U U

── C C C C ── ▼ ▼ ▼ ▼ Anchor -like sequences U U U U And Unidentified elements

─ С ─ ── ─────── ─ С ────────

anchor sequence there are , but other elements absent .

Fig. 4:

Supposed sequences necessary for Apobec-1-mediated mRNA-editing. (A) At least anchor sequence and other unidentified elements are required for RNA-editing in animals. Anchor sequence was lost in mRNA Nat-1 and other unidentified elements are absent in proteins P1 and FAS mRNA; normal editing does not occur. (B) In conditions of Apobec-1 overexpression for hyperediting the presence of other unidentified elements, such as in mRNA Nat-1 is important, but not anchor sequence, which however does not prevent from editing ApoB in mRNA. Protein P1 and FAS mRNA that preserved anchor sequence, though lost other elemnts, are edited neither by main nor by additional sites.

мРНК АпоБ

мРНК Nat-1

мРНК FAS,P1)

Anchor sequences

Unidentified elements

eIF4F

Competition

Translation Translation Grow cell Grow cell

Fig. 5

Scheme of protein Nat-1 function (and binding protein 4E-BPs) as translation repressor. Nat-1 competes with eIF4G for bindin to eIF4A and inhibits cap-dependent and cap-independent translation types (translation repressor 4E-BPs inhibits cap-dependent translation only).

eIF4G

eIF4E

eIF4A

eIF4E

eIF4A

4E-BPs

Nat-1

а) Н2О NН2 О

N N Н N N

N N NH2 N N

Adenosine Inosine R R

б) Uridine Adenosine О H H N N N H N

N N N R O

H R Cytosine N H O Inosine N Н

N N Н N

N N N

R O R

Fig. 6 : Transformation of adenosin (aminogroup deamination in position 6) into inosin (a) was accompanied by substitution of one canonical pair stably forming hydrogen links (b) for non-standard (А:U→I:C); intermediate (“suspending”) I:U pair is thermodynamically less stable and is less preferable for creation of complementary sites.

3-

5-

RNA-exon Inverted repetition RNA-introne

Fig. 7:

Formation of double strand pin structure in pre-mRNA at adenosin deaminating editing. Double strand RNA can be formed by different elements of cellular and virus mRNA. There is presented a variant where complementary site consists of two parts, each of them contains RNA-intron; the loop part of the pin structure is formed at the expense of invert repetition while the other (shaded) – due to interaction of the intron part with pre-mRNA exon. Brightened adenosin (A) is one of the sites of editing deamination in pre-mRNA exon.

А

Z -ДНК

5' -ДНК

3' –ДНК

RNA-exon Invert repetition RNA-untrone

Fig. 8:

Model of a possible transcription link with pre-mRNA editing (its double strand part). Transcriptional complex (rounded rectangle) moves standardly along the gene; at a definite moment from the beginning of transcription at 5’-non-translating gene site a resistant to twisting/untwisting Z-DNA conformation is formed. It is supposed that one part A I editing double strand RNA adenosin deaminase (dsRAD) interacts with Z-DNA (fixing), and the other part – with a newly synthesised pre-mRNA, which due to invert repetition is curculed in dsRNA being a deaminase substrate of this type. Such interaction of dsRNA-dependent adenosin deaminase allows performing well-ordered editing to splicing.

Transcrip-tionalcomplex

A А

Зависимая от днРНКаденозиндезаминаза

dsRNA-dependentadenosideaminase

?

Fig. 9:

The link ( ) or a possible link ( ? ) of RNA editing with molecular polymorphism of different types of biological polymers (their fragments).

RNA-editing

RNA polymorphism level

Genetical polymorphism

Protein polymorphism

Legends

Fig.1:Pre-mRNA editing of ATPase subunit-6 in Trypanosome brucei mitochondria.

Intermollecular anchor duplex was formed between 3’-part of this pre-mRNA and its gRNA before editing. In the result of editing 19 uridines appeared (insert of small “u”) and four ones deleted (asterisks); the length of intermollecular duplex increases towards 3’ 5’ pre-mRNA editing.

Fig. 2:Scheme of the RNA-editing region of rat cytidindeaminase containing an active

site. The diagram shows zinc-coordinating (Gys61, Cys93, Cys96) and proton-shuttle (Glu63) enzyme region. Conservative phenylalanins (Phen66, Phen70, Phen76, Phen87) are shown as connecting -segment between active site and -spirals/ RNA- binding is mediated by Gys61, Clu63, Phen66, Phen87 and Cys93.

Fig. 3:Three types of cytosin deaminases. Phylogenetic analysis and construction of a

part of the evolution tree of different deaminase types are performed by comparison of elongated (of 50-60 amino acid residues) and deaminases regions containing a functionally active site and having probably a common precursor.

Fig. 4:Supposed sequences necessary for Apobec-1-mediated mRNA-editing. (A) At

least anchor sequence and other unidentified elements are required for RNA-editing in animals. Anchor sequence was lost in mRNA Nat-1 and other unidentified elements are absent in proteins P1 and FAS mRNA; normal editing does not occur. (B) In conditions of Apobec-1 overexpression for hyperediting the presence of other unidentified elements, such as in mRNA Nat-1 is important, but not anchor sequence, which however does not prevent from editing ApoB in mRNA. Protein P1 and FAS mRNA that preserved anchor sequence, though lost other elemnts, are edited neither by main nor by additional sites.

Fig. 5Scheme of protein Nat-1 function (and binding protein 4E-BPs) as translation

repressor. Nat-1 competes with eIF4G for bindin g to eIF4A and inhibits cap-dependent and cap-independent translation types (translation repressor 4E-BPs inhibits cap-dependent translation only).

Fig. 6:

Transformation of adenosin (aminogroup deamination in position 6) into inosin (a) was accompanied by substitution of one canonical pair stably forming hydrogen links (b) for non-standard (А:U→I:C); intermediate (“suspending”) I:U pair is thermodynamically less stable and is less preferable for creation of complementary sites.

Fig. 7:Formation of double strand pin structure in pre-mRNA at adenosin

deaminating editing. Double strand RNA can be formed by different elements of cellular and virus mRNA. There is presented a variant where complementary site consists of two parts, each of them contains RNA-intron; the loop part of the pin structure is formed at the expense of invert repetition while the other (shaded) – due to interaction of the intron part with pre-mRNA exon. Brightened adenosin (A) is one of the sites of editing deamination in pre-mRNA exon.

Fig. 8:Model of a possible transcription link with pre-mRNA editing (its double

strand part). Transcriptional complex (rounded rectangle) moves standardly along the gene; at a definite moment from the beginning of transcription at 5’-non-translating gene site a resistant to twisting/untwisting Z-DNA conformation is formed. It is supposed that one part A I editing double strand RNA adenosin deaminase (dsRAD) interacts with Z-DNA (fixing), and the other part – with a newly synthesised pre-mRNA, which due to invert repetition is curled in dsRNA being a deaminase substrate of this type. Such interaction of dsRNA-dependent adenosin deaminase allows performing well-ordered editing to splicing.

Fig. 9:The link ( ) or a possible link ( ’) of RNA editing with molecular

polymorphism of different types of biological polymers (their fragments).

RNA-Editing and Other Intracellular Mechanisms

2005 г ., Deichman А . М ., Choi W. Ch., Baryshnikov А .Yu. Russian Cancer Research Center, 115478 Moscow, Kashirskoje shosse.24. tel/fax 7-095-(394.62.39), E.mail: deichman@mtu-net.ru , amdeich@rambler.ru (Published: Moscow 2005, Publishing «Practical Medicine».) Summary

Literature review is related to the phenomenon of RNA-editing in different species – from protozoa and plants to humans. Various types of RNA-editing are considered including deletions/inserts and replacement of separate nucleotides in mitochondria, nucleus and chloroplasts. RNA-editing types can be both common for all the three (CU editing desamination) and more special for certain cellular organelles (U-deletion/insert editing in trypanosome mitochondria; АI editing desamination in cytoplasm and nucleus of nuclear and virus pre-mRNA). There are also some conditionally minor and exotic RNA-editing types. The review examines a possible connection of RNA-editing phenomenon with other gene expression processes (transcription, translation, splising, etc.) in individual organism development and in phylogenesis. Particular attention is paid to the complicated editing complexes (editosomes) organization formed from various non-enzyme components (such as mRNA, small guiding RNA – mitochondrial gRNAs and nuclear/nucleolar snRNAs/snoRNAs, additional protein factors, Zn+2 , etc.) and enzyme activities (such as RNA-ligase, endo- and exonuclease, end uridine transferase, desaminase, helicase, etc.). The review considers the fact of matrix RNA-editing dependence from mRNA (such as at CU desamination), two-strand RNA (such as at АI desamination) or mixed gRNA- mRNA hybrid chimera (such as at U-deletion/insert editing). Different RNA-editing types connected with deletions/inserts and certain nucleotide replacements are accompanied by numerous effects such as nucleotide replacements in amino acid codons, appearance/dissapearance of stop/start codons, reading frame shift, the order of RNA fragment restoration in splising and others. In the result of these effects there may appear previously concealed protein polymorphism, elongated and shortened protein forms (such as apolipoprotein-B). The review notes a possible connection of protein and other types of polymorphism with RNA-editing in different normal and pathologic processes (including oncogenesis).

Key words: RNA-editing, mitochondria, nucleus, chloroplasts.

RNA-Editing and other intracellular mechanisms.

Introduction

1.Numerous editing types and objects in different organisms

RNA-editing is a phenomenon of any posttranscriptional (sometimes co-transcriptional) change (except RNA-splising and polyadenilizing) in primary RNA sequence (mRNA, pre-mRNA, tRNA, rRna), which reveals changes of single (specific) and/or a number of (specific and non-specific, though not random) nucleotides corresponding to the expressed genes - from protozoa to human. While in different genetic systems mechanisms not linked from the first sight function that however display some similarity in their biochemical strategies, regulatory sequences and cellular factors responsible for such unusual RNA processing events (Gott, Emeson, 2000). Editing RNA sequences of these genes are non collinear to their genom homologues. The genes, which mRNA undergoes the mentioned changes and displays such differences in the transcript cloning DNA of a gene, are called editing genes (cryptogenes). Besides protein coding pre-mRNA, transport (Lonergan et al., 1993) and ribosomal RNA (Mahendran et al., 1994) as well as transcripts of non-coding genome sites may experience editing. RNA-editing is widely spread in many eukaryotic organisms and viruses and the ways and results of the process can vary a lot in different species (Yurchenko, 1999). Possibly in the nearest future new editing ways will be discovered that will lead to intensifying research in this field as well as to reconsideration of the essence and role of this phenomenon in organisms evolution (Benne 1993).

RNA-editing mechanism is quite enigmatic and probably one of the oldest processing forms (Sloоf, Benne 1997; Blanc et al.,1996; Heisel et al.,1994; Sper-Whitis et al.,1996), that mostly takes place post-transcriptionally (“quaint” transcription form) in specific sites and the so called “recognition” sites (Konstantinov, Moller 1994). Usually deletions/inserts and conversion replacements of single (pairs or several) nucleotides occur in RNA molecules (Yoshinaga et al.,1996; Petselt et al.,1997 ; Patton et al,1997; Petshek et al.,1996; O’Connel et al,1997; Yurina,Odintsova, 1998). Not only separate coding genome sites (mRNA, tRNA of most mitochondrial, rare nuclear and chloroplast genomes) are edited but also some intrones, spacers, non-identified open reading frames (ORF) in normal as well as in some pathologically altered and tumor cells (Melher et al., 1995). Two types of hydrolytic nucleosid RNA-desamination (С→U and А→I) can cause genetic instability mediating connection between RNA-editing and cancer (Anant, Davidson 2003). Editing is shown in cellular genetic elements and virus genes (Barciszewska et al.,1994; Herbert 1996; Kubo, Mikami 1996; McGormic-Graham, Romero 1996). Since the 80s RNA-editing has become a widely studied phenomenon revealed in mitochondria, chloroplasts and in some cases in nucleus (Lavrov et al., 2000).

Some exact examples should be mentioned where editing takes place. Eukaryotic 5S nuclear rRNA suggests editing (and splising) of primary transcript where there are numerous replacements and deletions/inserts of single nucleotides (Shymanski et al.,1995). Superior plant mitochondria showed tRNA-editing in acceptor and anti-codon stems, the same as histidine tRNA D-loop of larch (Marechal-Dronard et al.,1996), pre-mRNA of oxidative phosphorylation proteins and ribosomal protein mRNAs, as well as pre-mRNA and rRNA intrones (Yurchenko, 1999). Editing was shown in barley tRNA lisin intron containing maturase (matK) (Vogel et al.,1997), some mRNA of proteins involved in photosynthesis, but not in tRNA and rRNA of chloroplasts (Yrina, Odintsova, 1998). Β-amiloid protein precursor mRNA editing causes frame shift that probably is an important pathogenesis factor in many non-family early and late forms of Alzheimer's disease (Leeuwen et al.,1998). Sight disorder in patients with Oguchi disease could be associated with arrestin-protein gene mutation (1147A deletion) important for this function. However it was shown that mRNA of this widely expressed gene (including muscles, skin, placenta, blood cells and in five eye tissues – retina, front capsule, iris, lens and bulbar conjunctiva) had normal sequence but the function was not restored. Thus the suggested role of editing is possible but not clear (Wada et al., 1999).

As correlation between increased level of RNA-editing and frequency of the reversion to plasmide mediated fertility in superior plant cells (sorghum, tobacco and rice) with male cytoplasmic sterility (MCS), an oblique connection with this process can be suggested (Howad,Kempken 1997; Zabaleta et al.,1996; Van Tang et al.,1996; Iwabuchi et al.,1993; Blanc et al.,1996). Independent deletion/insert and replacement editing types were noted in mtDNA transcripts (mt-mitochondria) of different species, but not in mt-plasmid Physarum, which transcription did not depend on mtDNA (Takano et al.,1997). Interestingly, editing process did not work with transgenic introduction of mitochondrial sequences into tobacco chloroplasts. Perhaps, non-identical processes of the phenomenon in different biological systems and organelles can explain this fact (Sutton et al.,1995; Zeltz et al.,1996). Editing is considered to be an essential part of biological information transfer process, which requires the same accuracy as replication, transcription and translation (Jakubowski 1995).

This field of studies has been developing avalanche-like since the mid-80s and so far has accounted for hundreds of reports. The Internet (MedLine) presents 1-2 papers in 1986-1987, 7 papers – in 1988, 20 – 76 articles for the period of 1989-1993 and 1.5-2 hundred papers annually in 1994-2003. RNA-editing is most often associated with transcriptionally active DNA sites of mitochondria, nucleus and chloroplasts. Mutual dependence of editing and translation is noted simultaneously as the disorder of the latter leads to the deficiency of additional protein factors necessary for editing (Karcher,Bock 1998; Hirose et al.,1998; Hirose,Sugiura1997). The editing proteins are involved in ribosome assembling (Phreaner et al.,1996). Most of papers reporting editing are related to mitochondria, many – to nucleus, less – to chloroplasts. It is possible that the interesting though only disputable now question about RNA editing in prokaryotes is just a question of time (Brennicke et al., 1999), and the answer can be received in the near future. The well-known fact that different eukaryotic RNA-editing types from nucleus as well as from mitochondria and chloroplast, i.e. organelles originating probably from prokaryotic-like endosymbionts, shows the importance of investigation of this issue (Brennicke et

al.,1999). Thus, single S2 ribosomal protein mt-mRNAs of wheat (perhaps of rice, maize, but not dicotyledons where rps2 gene more likely is coded by nucleus) with prokaryotic homologues undergo C→U conversions (by seven positions) with concomitant changes in amino acid encoding (in wheat this gene had a long C-end extension as compared with prokaryotic homologues) (Vaitilingom et al., 1998). There was pioneer presentation of a prokaryotic tRNA-editing enzyme tad4 (tRNA-adenozine desaminase from E.coli) with the yeast homologue (by Tad2p subunit) capable for site specific editing in nucleotide pendulous positions (#34 in Apr-tRNA). This prokaryotic enzyme could specifically bind and modify yeast tRNA (Asp)-minisubstrate due to anti-codon loop with the necessary secondary structure (stem/loop) (Wolf et al., 2002).

Inscrutability of editing is usually associated with the following:1) it requires non-evident and therefore rapidly evolving sites, i.e. simultaneously

with the non-clear choice of editing sites and forming trigger mechanism starting the whole editing machine (Covella, Gray 1993; Shields,Wolfe 1997; Slobf, Benne 1997; Mundel, Schuster 1996; Lu et al., 1998); moreover, nothing is clear about final aims of editing ( “far plans”, quotation Blanc et al., 1996);

2) so far the mechanism of this not-one-step enzyme-cascade process is unknown to the high extent (Karcher,Bock 1998; Williams et al.,1998; Adler, Hajduk 1997; Barcizewska et al.,1994);

3) finally, it is unclear why cells often prefer to keep and start energy-requiring “editing machines” (including editing of virus mRNA-transcrips) instead of once introducing nucleotide changes into the genes “for long” .

It can be noted that RNA-editing in essence breaks the collinear principle according to which one gene is responsible for the only one form protein synthesis (Petzelt et al.,1997; Chang et al.,1997), or tRNA decoding only one codon (Borner et al.,1996). Probably protein polymorphism in superior plants, particularly by ribosomal protein gene rps12 in Petunia is wide spread. Editing at main and additional sites may undergo all or part of mRNA molecules of the gene (Lu et al.,1996; Ito et al.,1996; Wilson, Hanson 1996). It is likely that protein polymorphism associated with RNA-editing expresses as a result of the prior polymorphism in RNA molecules, in particular lasso-like intrones of group II (Heltzer et al.,1997), with rybozyme properties (and possibly performing the role of primary RNA and DNA-polymerising molecules).This partly accords to the concept of RNA-genome world (Stuart, 1993a), and contemporary RNA-World is characterized by metabolic RNA molecules involvement in the whole multitude besides transcription-mediated RNA-editing key events: translation (via tRNA and rRNA), translation quality control (tmRNA), ribosome maturation (snoRNA), RNA-processing (snRNA, snoRNA), replication (telomere RNA), protein translocation (SNP RNA), cellular transport (vRNA), etc. (including unknown); source of this variety could have formed in the epoch of prebiotic RNA-World (Meli et al., 2001).

According to this concept and applied to biological systems that use dsRNA (double-strain RNA) as a substrate in editing (as in A→I editing desamination GluR-receptor of animal brain), mediated dsRNA phylogenesis needs irreversible component for RNA→RNP→… evolution. In this process RNA-relicts are gradually replaced by proteins taking the part of biological catalysts competing for small molecules and triggering a complex (of some steps) variant of RNA-processing. There form: protoribosomes, various

small RNAs, pre-tRNA, tRNA-processing, ability for recombinations, splising (assembling component), some editing types, etc. It is suggested that editing may play a certain role in creating an irreversible component (Jaffares et al., 1998). The role of specific dsRNA-binding proteins (DSRBPs) is important as they participate, besides RNA-editing, in the transcription activation processes, translation initiation inhibition, cellular mRNA localization, stabilization, signal transduction and post-transcriptional gene silence (PTGS; =RNAi-mechanism interfering RNA). Genes, which products bind to poly-U/polyC-substrate (shown by radioactive labeling), are defined as potentially coding such RNA-binding proteins (Ramanathan et al., 2003).

Such proteins include (>20: RKR-kinase, Staufen, ADARs, perinuclear RNA-binding protein spermatid, etc.) an increasing family of eukaryotic, prokaryotic and virus-coding products, evolutionary preserving the ability to recognize dsRNA (that is important both for gene expression and maintenance of protective anti-virus mechanisms) and jointly using common conservative motif (at least in 11 pairs of different nucleotides), specifically facilitating interaction with dsRNA-sites, and their damage at homo- and even heterozigotes can lead to embryo-lethality (Saunders, Barber 2003). Moreover, firstly there were described multi-functioning regulatory proteins of shuttle RNA-metabolism (including sense-antisense-mediated disintegration with nucleus participation), able to interact not separately just with DNA or RNA (i.e. only in nuclear or cytoplasmic compartments) but also simultaneously control nuclear and cytoplasmic steps (e.g. transcription and translation, or RNA-processing and translation, other combinations) of gene expression (Wilkinson, Shyu 2001). Computer analysis of human and mouse genome has shown that crossing but opposite directed transcripts (in double-directed transcribe sites) have potential for formation of perfect sens-antisens endogenic dsRNA-duplexes. Such duplexes besides RNA-editing are associated with various phenomena: genome imprinting (2-3% of genes have so called “marks”: the origin of their appearance and disappearance is unknown), interfering RNAi, translation regulation, alternative splising, X-inactivation. Bio-informative approach (includes RT-PCR; >84% specificity) revealed over 300 new candidates for overlapping (at 5’- and 3’-UTR-sites) transcription units (Shendure, Church 2002).

Processing of eukaryotic RNA including alternative splising and editing can generate some different messages from one gene. As a result RNA pool defined as ribo-type varies and has different information components, one of which is editing-strengthened specific ribo-type. It is suggested that if such ribo-type is required within a long-term natural selection, it can be included (certainly by an unknown mechanism) into genome. And eukaryotic evolution consequently is defined by alternative ways, where DNA and processing RNA interact constantly (Herbert, Rich 1999).

As expected there is no single common opinion on all the aspects about the role and place of RNA-editing as an extra coding mechanism, and in the context of its link to other biological processes of genome expression responsible for individual and species evolution (Benne 1993; Stuart 1998). Thus, some authors suggest that there may exist a connection between a high frequency of changes in separate nucleotides of RNA in editing from one side and reverse mutations (i.e. return to initially recorded nucleotides in a gene) in DNA from the other side (hypothetically – as a result of reverse transcriptase activity towards RNA fragment, see: plant organelles, Grienenberger 1993). However such

connection aggravates the plexus of this complicated and ambiguous process as in that case resulting from RNA-editing there must be revealed a mechanism associated with genetic polymorphism besides possible protein polymorphism connected with the expression of editing and non-editing RNA forms (Lu et al., 1996). There are no data directly confirming this and the spread of editing in cellular organelles is considered to be linked to the mechanism of withstanding to mutation accumulation in asexual genetic systems (Borner et al., 1997). Nevertheless, studying cytochromoxidase genes (subunities cox-II,III) of superior plants there is a conclusion about a possible closeness of directions of nucleotide changes in RNA (in editing) and DNA (during phylogenic reconstruction). Potential role of U→C editing is distinguished in generation of point nucleotide replacements in (cDNA-transcripts of bombesine-like neuropeptides of amphibians and animals (Nagalla et al.,1994). At the same time it has been noted that proteins of some genes (in particular, kinetoplast COIII genes of seven trypanosome species), which transcripts undergo wide editing, accumulate mutations ≈ 2-fold faster than non-editing and limitedly editing their versions (Landweber, Gilbert 1993). .

But other authors do not consider possible such connection between RNA-editing on the one hand and phylogenic DNA reconstruction, reverse mutations and point replacements in DNA on the other hand. They consider that expressed by editing concealed protein polymorphism does not relate to the genome evolution (except T→C transition into protein-coding DNA site). And editing, in the whole, is only an inside process for transcription. And they even suggest incorrect phylogenesis in the case if editing sequences will be transferred between DNA-containing cellular structures (Bowe, Pamphilis1996) – especially as such transfer has not been shown yet for editing sequences (as possibly it is an evolutionary long-term multi-step process). Naturally while objectively the existence or absence of such connection will not be shown (as well as separate existence of both variants, e.g. for the species using different genetic systems), both skepticism and optimism are equally possible. Anyway at present all the studied and impaired by editing signals (of triplet code, splising, binding to ribosome, translation frame shift, intact introne, etc.) as well as known components and activities responsible for editing, are encoded by the genome and therefore lay within Central Dogma of molecular biology “DNA creates RNA creates Protein”. At the same time the origin of some editing components appearance – e.g. ability for gRNAs self-renewal (“guide”-RNA) in maxi- and minicircular components of trypanosome mitochondrial kinetoplast DNA (see nest part) – still remains unclear and makes possible different suggestions (Benne 1993) for unknown mechanisms (including formation of hypervariability and genetical fixation of nucleotid sequences in the process of both vertical and horizontal their transmission) and structures (Deichman, Baryshnikov, 2005).

The result of editing may be the following: 1) appear and dissapear shortened and elongated protein molecule forms at regulation of terminating codon (Davidson et al.,1995; Heinemann et al.,1994); 2) develop initiatory codons including 4-nucleotide ones (Yoshinaga et al.,1997; Thomson et al.,1994) that are more preferable (Hirose, Sugiura 1997; Sugiura 1995; Yoshinaga et al.,1996; Wakasugi et al.,1996). However pyrimidine and most of purine (except 3 terminating codons) transitions by the third nucleotide cannot principally lead to a new phenotype (sense) expression of the codon (Phreaner et al.,1996). Neighboring protein amino acids may belong to distant codon triplets, primarily

separated by introne but then linked by splising. Direction of editing in different genetic systems may not coincide: in trypanosome mitochondria strict 3’→5’ direction is followed in relation to the definite editing site, while in Physarum polycephalum mitochondria and superior plant organelles there is no preference in the editing direction (Benne 1993).

The choice of editing sites can depend on primary RNA structure (Kubo, Mikami 1996; Williams et al., 1998) but some nuclear encoded enzymes, as animal dsRNA-dependent adenosindeaminase , do not have clear specificity to dsRNA (Kim et al.,1994). No common primary structure in RNA-editing in different genetic systems was found (Benne 1993). In whole editing mechanisms are associated with:

- matrix-directed processes involving special small directing mitochondrial (gRNAs) and nuclear/nucleolar (snRNA/snoRNA) RNA the contents of which (as in mitochondrial gRNAs) or indirectly (as in small nucleolar RNA, snoRNA, directing methylation in rRNA) influences nucleotide editing in trypanosome RNA (Stuart 1993b; Levitan et al.,1998);

- unusual enzyme processes leading in particular to transitions (Blanc et al.,1996) and depending on RNA (ssRNA; as for the editing cytidindeaminase; the dsRNA role is being studied) or on dsRNA (as for adenosindeaminase) – in C→U and A→I deamination, respectively, in animals (Anant 1997; Bass 1997). However the role of matrix is possible here as well.

At present it is difficult to say how different editing types can combine in one cell or organelle (as in Physarum polycephalum mitochondria) as every editing type has been studied individually so far. Nevertheless, some authors believe the role and origin of editing matrix to be more enigmatic than that of deaminase (Blanc et al., 1996). Notably, enzyme types of deamination can be divided into matrix-mediated (and dependent on ssRNA, or dsRNA) and common (without editing) dependent on shifts, preferably increasing concentration of separate nucleotides and nucleosides in the result of biochemical reactions (Blanc et al.,1995; Frech et al., 1996). Evolutionary connection and transformation the ones into the others is still being discussed

RNA-editing trypanosome complex includes different components (such as mRNA, gRNA=”guide”-RNA, additional protein complementation factors, etc.) and activities (such as RNA-ligase, end uridine transferase, endo- and exonuclease, helicase, etc.), which, as a rule (Missel,Goringer 1994), were found in two RNP-complexes of cellular extracts (Adler, Haiduk 1997; Corell et al., 1996). The difficulty of editing processes and objects (including newly appearing) is in the fact that so far very few (single) protein amino acid sequences have been determined; shown (and compared to appropriate mRNA-editing) two of them – trypanosome ATPase subunit-9 and animal apolipoprotein-B. Recently for edited 5’-site mRNA-transcript of trypanosome kinetoplast apocytochrome-b there has been shown coinciding by primary translation sequence and functionally active protein version (Horvath et al., 2000). Few objects with really included into editing RNA changed nucleotides have been shown. If not specially determined, among such nucleotides there may be found (as in the shown for mRNA GluR-receptor A→I conversion) not common (canonical A,G,U,C) but modified, however behaving as canonical nucleotides at translation and obtaining cDNA. Secondly, the main obstacle for new ideas advance and check (not only the ideas – derivatives of those used in relation to

trypanosomes) is still impossibility of simple use in vitro systems for most genetic systems. At the same time non-accounted editing gene DNA versions were not found (Benne 1993).

RNA-editing is a dynamically developing investigation field and many new data will appear in the near future, though some tendencies can be already seen. It is important to consider that at present the frequency of any editing type mainly depends on the frequency of studying of definite objects, but not on the spread of this type in the nature. In this respect among nucleotide changes C→U conversion is the most frequent but really common editing type for all three organelles (mitochondria, nucleus, chloroplasts) in various eukaryotic species (from Physarum polycephalum to superior plants and animals). This editing leading to appearance of sense and terminating codons is usually associated with RNA-dependent cytidindeaminase activity (Thomson et al.,1994). The second frequent type of nucleotide changes (according to literature data – fifth) is U-deletion (rarely)/U-insert(often) characteristic for trypamosom ide mitochondria (Piller et al., 1997). The third of most frequent nucleotide changes types is A→I conversion (see appropriate part) as a result of nuclear-encoding and dsRNA dependent deaminases activity (some of them are unusually translated – in nucleoli), editing (in cytoplasm/nucleus) cellular and virus mRNA (Kim et al., 1994).

Among conditionally minor nucleotide changes A→G replacement in drosophila’s nucleus (often) and ground snail mitochondria are observed (Petschek et al.,1996; Vokobori, Paabo 1995), U→C replacement in mitochondria and plant chloroplasts (often) and in animal cell nucleus (Yoshinaga et al.,1996; Yoshinaga et al.,1997; Beier et al.,1992; Nagalla et al.,1994). Regarding A→G replacement under dADAR-deaminase drosophilae (Ma et al., 2002) as a result of editing guanine (G) was found instead of genome adenine (A) in cDNA-transcript of protein subunit α-1-Ca+2-potential-/-(ion)-sensitive pre-synaptic drosophilae channel (Dr.mеlanogaster). This subunit, called Dmca-1a polypeptide, encodes the so called cocaphony (=nightband A) gene, named because of its involvement in release of neurotransmitters and finding the link between behavioral variants (neurofunctional phenotypes) of drosophilae and the grade of editing of three different sites of heterogenic Dmca1a-transcripts of this gene (Smith et al.,1998; Kawasaki et al., 2002). DHPLC-analysis (denaturating high powerful liquid chromatography) of the gene mouse homologue microprocessing events (Cacna1-alpha; etc, mRNA family including rare) revealed preserved positions of the sites of single nucleotide editing post-transcriptional processes (for 2 amino acids in extra cellular IVS4-loop; total in 3% transcripts) and alternative 3’-end splising (Gallo et al., 2002). Interestingly, both (A→G)-RNA-hyperediting and expression of mRNA eukaryotic 4fmp-gene of fertile drosophila (late-embrionic period) depended on regulating interaction with anti-sense (sas-10)-transcript (anti-sensregulation with P2-promotor) and consequent formation of dsRNA structures (edited two strains).Both closely situated genes (on the opposite DNA-strains) are connected with X-chromosome. It is suggested that the sense of such regulation is in aimed post-transcriptional degradation of dsRNA-targets by interfering RNAi-mechanism and limiting expression of mRNA corresponding to antisens-factors (Peters et al., 2003), and variety of dADAR-fragment pre-mRNA-forms from embryonic period determined many biological/physiological processes as well as neural functions in insect CNS (Ma et al., 2002). There have been also identified potentially new RNA-editing cases (Stapleton et al., 2002).

For the first time U→C editing (unclear mechanism: trans-amination/-glicosilation or replacement) was shown in chimerical 16S mt-RNA testicles, sperm and somatic mouse (animal) tissues containing additional 121-nucleotide 5’-end fragment deriving from L-strain of mt-genome. Position-121 was edited after chimerical 16S RNA synthesis (probably outside mitochondria) and that was not cloning artifact, sequencing or gene polymorphism. The whole chimerical RNA was coded neither by mitochondrial nor nuclear DNA and was the result of trans-splising and post-transcriptional events. Interestengly the first 120 nucleotides forming invert repeats were completely complementary to the inside (position 240-360) 16SRNA sequence, that may suggest participation of large dsRNA-structures with editiing mechanism similar to that catalyzed by ADAR(1/2)-enzymes. 16S RNA function can be connected with the formation of the cell pole and modification of the transcript – a necessary step after fertilization. Previously U→C replacement were described for plant transcripts and WT1-gene of Wiliams tumors in rat and human (Villegas et al., 2002).

WT1 is a suppressor gene of Wiliams tumor (nephroblastoma, frequency 1 per 10 thousand newly-born), tumor development is associated with genital abnormalities, lack of iris, slow mental development, etc. This is a gene of 50kb all ten exsons of which generate mRNA only in 3kb (Mrowka, Schedl 2000). Normal kidney development (critical organ for surviving) is a complex process requiring accurate combination of proliferation, differentiation and animal cell apoptosis (mouse, rat, human) and depending on numerous genes playing an important role during embryon (pro-, meso-, meta- nephrosis) transformations. Mutations in one of the genes, WT1-gene, critical for normal organ development led to the development of tumor and abnormal kidney development (DDS- and Fraiser-syndroms) Over 20% WT-tumors included deletions, cuts, translocations and missesns-mutations of WT1-gene. DDS is a rare congenital children syndrom including diffuse mesangyal sclerosis, heavy hypertension, steroid-resistant nephro-syndrom, male pseudohermaphroditism and high risk of Wiliams tumor. Among over 60 described mutations (family and de novo) leading to the miss of WT1-protein intactness most ones were dominant-negative missesns-mutations in exsons 8 and 9 encoding 2 and 3 zinc-finger domens, respectively, and mutation point was R394W-mutation (nucleotide 1180). Fraiser-syndrom (perhaps it is an atypical DDS), as well as DDS depended on introne mutations leading to the difficulty in recognition of splise-donor site-2 and missing protein (KTS”+”)-isoform (see below).

Many WT1-gene products (up to 24 known, their ratio in embryogenesis, for the evolution period are strictly conservative) have transcriptional and post-transcriptional activities and are determined by : 1) alternative translational start-sites (one adds 68 N-end amino acids), 2) alternative RNA-splising and 3) U→C RNA-editing (Leu280Pro-dimorphism – as a result of U839C nucleotide change in exone-6). Noted only in animals exone-5 encodes 17 amino-acids and that gene product form increases promoter repression and exone-9 encoded only three – lysine/threonine/serine=KTS amino acids located between C-end 3 and 4 protein zinc-finger-motifs. WT1-product can bind to promoter-sites of more than 20 inferior located genes (including the receptor to epidermal growth factor, transcription RAX2 factor, insuline-like growth factor 2) and effect in two directions in relation to transcription, the effect depending on the cell type and gene-target. In particular repressing function of WT1-product gene in vitro/vivo (of wild and

mutant type) was noted for the gene promoter of insuline-like factor 1 (expression IGF-1=transmembrane tyrosinekinase) able to cause tumorogenic effect in many tumor models as well as activate hyperplasia of prostate and breast cancer and DNA appeared to be critical but less was the product protein binding ability (Tajinda et al., 1999; Sharma et al., 1994). WT1 is simultaneously a transcriptional and post-transcriptional RNA factor. This protein can interact with RNA non-specifically N-end recognition and specifically bind via C-end zinc-finger-motifs. Moreover high affinity to RNA was found for (KTS”+”)- form (preferable co-localization – with splis-factors) and to DNA - (KTS”+”)-product form, which like transcriptional regulators is diffusely distributed in the nucleus (Mrowka, Schedl 2000) Among conditionally exotic species the following were noted: in animal nucleus – G-insert (Petzelt et al.,1997), UА replacement (Novo et al.,1995), in different species mitochondria (mould mucosa, ground snail, squid, inferior mushrooms) – UU-insert, as well as UА , GGAA and A,GU,C and C,U,GA changes (Gott et al., 1993; Vokobori, Paabo 1995; Tomita et al., 1996; Laforest et al., 1997). Among new editing types there were also noted GA changes in mRNA phosphotranspherase (GlcNac-1), UА – in human mRNA galactosidase (Villegas et al., 2002), and 14 varying in editing rate AG sites (transition in the first codon nucleotide, mainly in T1-domen) in mRNA of classical protein (subunit of tetramere), delaying straitening of K+ channels in potential-regulating repolarization of the axon of giant squid (Rosenthal, Bezanilla 2002). Small RNA (snoRNA) nucleolar animal RNA directing nucleotide methylation in rRNA are indirectly connected with editing (analogue with matrix-mediated editing involving so called gRNAs) (Levitan et al., 1998; Brule et al., 1998).

1.2. RNA-editing in some viruses

Nucleotide changes were noted for viruses, which genomes are formed by single- double-strain sequences, such as AG and UC transitions (in a number of cases these transitions including clasterized may be secondary to AI editing deamination under nuclear-encoding adenosinedeaminase function) and A- and G-inserts. There were no nucleotide changes like CU convertion and U-insert/deletion (Volchkov et al., 1995; Lai 1995). RNA-viruses are characterized by both point and hypermutations under cellular enzyme activity, modifying RNA of their own and virus evolving (probably simultaneously) genomes. Virus RNA-editing with ribosome properties leads to hypermutations (i.e. mutations in a number of sites) accompanied by transitions and multiple amino acid replacements (Lai 1995; Сattaneo 1994; Vanchiere et al., 1995; Sanchez et al., 1996).

………………………………………………………..…………………………………………………………

1.3 Minimally edited sites of different species gene transcripts

Interestingly, in mRNA of all three organelles – mitochondria, nucleus, chloroplasts – of distant species (from protozoa to superior plants and animals) there were found fragments (so called minimal cassettes) 14-29 nucleotides long, the length of which

is sufficient for editing inside different RNA (including heterologic and in alternative sites of own RNA) in in vitro systems. Only newly synthesized RNA are edited by very small aimed at inserts sites (Lowe et al., 1997; Visomirski-Robic et al., 1997). Inside such cassettes CU editing was noted for transcripts of nuclear (mRNA Apo-B) and chloroplasts (psbL) genes генов (Backus, Smith 1992; Davies et al., 1989; Backus, Smith 1994; Backus et al., 1994; Anant et al., 1995a; Chaudhuri et al., 1996), and U(rare)- and C(often)-insert editing types for transcripts of mitochondrial genes in Physarum (Visomirski-Robic, Gott 1997) .

More often CU editing sites was in AT(AU)-rich sites (Backus, Smith 1994; Anant et. al., 1995b). And small fragment of 22 nucleotides mRNA apolypoprotein-B showed affinity to proteins 66 and 44kDa editing complex (editosomes), and the presence of so called anchor and concealed anchor sequences (necessary for interaction with editing fragment), lightened the return to editing by the main site (Backus et al., 1994). Editing inside minimal gene psbL (polypeptide-L photosystem-2) cassettes and subunit ndhD (NADN-dehydrogenase) of tobacco chloroplasts led to creation of initiating codon (АCGАUG). ÀC mutation above the site canceled and GC decreased minimal cassette editing (Chaudhuri, Maliga 1996). In case of АI(G) mutations by Amber/W-site in the main strand of hepatitis-D virus RNA (HDV) with human adenosinedeaminases (in special systems with incorporated reporter-fragments) there were shown minimally needed substrates in 24 (for hADAR1; above the site 4 pairs of paired bases was required) and 66 (for hADAR2; 21 pairs of paires bases was required) nucleotides; the size of minimal substrates (as well as the way of recognizing them) for both deaminases, however, varied in each editing site (Sato et al., 2001). The value of minimally AI editing substrate containing one non-complementary A:C pair was even less – 15 base pairs – at protein editing including only catalytic domen ADAR1-enzyme (minimally editing system) though including the Z-DNA-binding motif enhanced editing and probably provided more substrate specificity. In minimal substrate of 23 nucleotides there were observed two additional editing sites at 5’-end (position 4-8 spiral pairs) on complementary strand at the distance of 11-15 nucleotides from the first one (Herbert, Rich 2001). Interestingly, in case of U-insert/deletion editing pre-mRNA in trypanosomes connected with the use of so-called gRNAs, the length of median-informative purine-enriched (mostly by adenine) gRNA part makes the value of the same order (~ 1.5 – 3 tens nucleotides) as it is in minimal cassettes (Simpson et al., 1993).

2. Some peculiarities of pre-mRNA U-insert/deletion editing in trypanosome.

2.1 General issues

Since U-insert/deletion editing by separate and multiple sites in mitochondrial pre-mRNA (kinetoplasts) of trypanosomides was first described, fundamental interest in the studies in this area concerning the mechanism of complicated realization system of genetic information in protozoa has increased. The first observation concerned, first, four uridine inserts in three sites in mitochondrial transcripts cox2 trypanosome gene T.brucei and, second, specificity of maxicircular mitochondrial genomes of L.tarentolae, T.brucei and C.fasciculata. In these maxigenomes own tRNA genes were absent, but nuclear-coded

mRNA were imported in the organelles from cytoplasm. Also there was lack of initiatory codons of many structural genes and regions encoding some genes contained equally localized reading frame shifts (Benne et al.,1986; Shaw et al., 1988; Simpson etal.,1989; Kapushos et al., 2000). Then there were described single 5’- and 3’- and widely 3’-5’ types of insert/deletion mRNA editing.

Contemporary Trypanosomatidae are unicellular flagellates, zooflagellates, direct progeny of ancestors that gave start to all eukaryotic kingdoms and perhaps the first cell lines with mitochondria. Trypanosomidae mitochondria biogenesis is also unique because only 5% proteins (concerns inside organelle membranes) are encoded by mt-gene while 95% are nuclear-encoded proteins imported post-translationally. Many genes contain incomplete ORFs which primary transcripts are remodeled by RNA-editing; protein synthesis is mediated by cytosole tRNA of eukaryotic types and mt-ribosomes (by rRNA) – the smallest of the known (by 30% less reduced human mt-rRNA). Finally a number of different parasite mitochondrial activities are connected with unusual organism life cycle (Schneider et аl., 2001). Trypanosomidae are parasites of one (these are Crithidia, Leptomonas, Blastocritidia and Herpetomonas) or two (Leichmania, Trypanosoma, Phytomonas) hosts and infect a wide range of plants invertebrates and vertebrates. In the second case parasitism is related to a complicated life cycle and accompanied by restoration and inhibition of respiratory chain function depending on the habitat conditions of that life phase. Besides the interest of studying this object was in the fact that, on the one hand, in homologic genes of different organism of this group (Trypanosomidae) different by some specific features of their evolution history, site length, edited in pre-mRNA was different. The most marked examples may be genes of subunit 3 (Landweber et al., 1993) of cytochromoxidase (COIII), which over 90% of amino acid sequence is created in the result of editing, 6 subunit ATPase (ATP-ase-6) and 8 subunit (ND8) NADH dependent ubichinonoxidoreductase.

On the other hand and because of high homology of the primary structure of some quite conservative and undergoing editing trypanosome genes, it can be suggested that the size and structure of edited sites will be practically the same. It was also suggested that total number of uridil edited sites of pre-mRNA inside the genus at least would be close enough even for some representatives of different species (in particular, including parasitizing between insects and L.tarentolae vertebrates). That was shown for the most part of studied closely relative species of Leishmania (Kolesnikov et al.,1999) forming in all phylogenetic structures the most compact group among other trypanosomatides (Yurchenko, 1999).

Different trypanosomatide species can differ by homologic gene editing intensity. In the whole the most powerful and intensive editing- that probably confirms its wide spread in mitochondria of this group ancestor (Maslov et al., 1994). Trypanosomes are transferred to their hosts by mechanical contact, sex contact and via insect-carrier. African Trypanosoma gambiense, carried by tsetse fly can cause sleep disease in human. Dramatical changes in T. brucei life cycle occur in mitochondrial (kinetoplast) components of respiratory system. Coming into animal blood system with excreted secret at the bite, trypanosomes usually lose cytochromes, components of Crebs cycle and generate energy due to glycolysis. Other trypanosomes on the contrary return with animal blood, and, being transmuted in a thin intestine of an insect in procyclic of the shape,

almost fully restore ability to the synthesis of all components of oxidation phosphorilation. Finally in insect saliva glands there develop infectious metacycle forms, which are transferred to animal. Selective advantages of growth in one or another parasite cell cycle stage can be provided with editing along with other mechanisms (Stuart 1993а).

2.2 “Guide”RNA (gRNA)-dependent editing

There are defined “guide”-RNA-dependent (Simpson 1997) and “guide” – RNA-independent, but dependent on the secondary RNA structure editing types (Frech 1996; Alfonzo 1997). gRNA molecule consists of 3 parts (fig.1):

– 5’-anchor necessary for specific pairing and development of primary anchor duplex with 3’end of pre-mRNA at editing initiation (in the absence of that editing sharply drops or syops completely). Complementarity due to standard complementarity pairs of this gRNA part in the so called “guide”-RNA – mRNA (gRNA-mRNA) hybrid chimera is over 90% initially; – purine rich (mainly adenine) proper median-information part that determines mainly insertion (rarly deletion) uridine in pre-mRNA at the next editing stage. This stage continues until necessary level of final complementarity in expanding duplex is reached. After editing complementarity is increased 1.5-2-fold and reaches ~70% (Kable et al.,1997); – and end part 3’-oligo-U, suggested being one of the sources (rarely depositary) of uridines that was shown by revealed covalent link between gRNA and pre-mRNA oligo-U-end st the editing site in subunit-6 of trypanosomidae ATPase (Rusche et al., 1995). Besides 3’-end part provides additional but necessary for editing by main and additional sites conformation-stabilizing interaction with purine-enriched pre-mRNA part. Final complementary 35-40% little differed from the initial (Kable et al.,1997). According to gRNA-paradigma kinetoplast U-deletion/insert editing requires high

accuracy, leads to restoration or reading frame shift in mRNA and is mediated by interaction of short (40-70 nucleotides) and having common structural molecule properties gRNAs with partly complementary fragments to pre-mRNA. Notably, for accurately directed cut nature uses trans-activizing small RNA in a large number of species events (e.g. for systems RNAase R-TRNA; U7-mRNA giston; snoRNA–rRNA; U5-introne 1 group, etc.) of cellular RNA-processing (Cruz-Reyes et al., 2001). Site selection with gRNA is not unique as complementary (not intra-, but intermolecular) interaction of mRNA sites occur at other editing types: in vertebrates and invertebrates at AI deamination at tRNA editing and at directed 2’-O-ribose methylation in rRNA (Sloof, Benne 1997).

Recently there were shown specific post-transcriptional 2’-O-methylation and conversional pseudouridilizing of rRNA (Liang et al., 2001) in trypanosome nucleoli, directed by small nucleolar guide-sniRNAs (N/ASA-RNA from the respective RNP). Genes of such RNA clasterized for single or multiple different RNA, and the first shown was h1-RNA able to pseudouridilize 28SrRNA (by U3643). This semi-canonic N/ASA-RNA (69 nucleotides) was the least of all described analogous RNA (small nuclear snRNAs U1,U2,U4 and U5) of other eukaryotes containing only single pin structure, key

for mediated by one processing endonuclease, and processed from long polycistrone transcript (transcription – under RNA-polymerase II) together with (C/D)-snoRNAs. Among the latter there was identified (by imprinting of mother expressed gene on mouse chromosome12) regulating editing (or alternative splising of non –dentified gene yet) MVP-343-snoRNA (Shimoda et al., 2002).

…………………………………………………………………………………….

2.3 Mini-ring and maxi-ring DNA components of trypanosome kinetoplasts

Mini-rings of kinetoplasts can be represented by several classes (in T.brucei – up to 200-300 and more) carrying different gRNA-genes, frequency of each is not the same. Moreover, sequence of gRNA-genes in mini-rings does not always correspond strictly to 3’5’ order function and even in the same mini-ring there can be found gRNA for different mRNA – including those related to different stages of trypanosome life cycle (Stuart 1993а). Located in variable site of mini-ring gRNA-gene is limited in Trypanosoma brucei by inaccurate invert repetitions of 18 base pairs 5’-GAAATAAGTAATAGATA-(~110bpcassette)-TATTTATTATTTTATTTT-3’ (Pollard et al.,1991). On the whole, in the result of similar structure analysis, it can be considered that in trypanosomes there is controlled if not primary sequence, then size of real and potential gRNA-gene cassettes. In T. brucei mini-rings T.equiperdum there was shown three sites containing such invert repetitions with potential frames for reading gRNAs. In variable site of mini-ring L.tarentolae matrix there is located non-flanked by invert repetitions but read gRNA-gene; following 150 base pairs there is conservative site (Thiemann et al., 1994). Located between 18 nucleotide sequences gRNA-encoding sequences may reflect their evolution and functional significance when in the result of multiple events of transposition and amplification there becomes possible divergence of these genes undergoing mutations and recombination. Although some cassette sequences in T.cruzi (1.2 kb) and C.fasciculata (2.5 kb) have no end repetitions, this does not exclude potential possibility of their encoding multiple gRNAs (Stuart 1993a).

During the study of mitochondrial genome there was carried out comparative-evolutionary investigation of sequencies (first of all of conservative sites) genes of cytochromeoxidase subunit 3 (COIII), their protein products and cDNA of their primary transcripts obtained in the result of wide (in Herpetomonas, T.brucei), and 5’-preferable (in L.tarentolae, C.fasciculata) editing in kinetoplasts of several trypanosome species. This analysis allowed the authors (Landwеber, Gilbert 1993) to suggest that mutations leading to frame shift in this gene mRNA were formed due to compensator mutations in gRNA itself and probably their genes. As the result, widely editing transcripts and therefore products translated by them accumulated mutations ~ 2 times faster than non-editing and their 5’-editing versions.

The shortes (25-30 nucleotides) of all known there turned out gRNAs encoded by maxi-ring DNA in fish-parasitic trypanosomides Trypanoplasma borelli. Unusual was there the presence of 5’-non-coded and heterogenic in length oligo-U sequence (with 5’-end di/triphosphates), function and mechanism of formation of which is still unclear though it is suggested that this can be due to RNA-ligasing or trans-splising. There is

discussed a possibility that the observed organization of gRNA genes in large ring molecules (functionally analogues to mitochondrial DNA of other organisms) trypanosomides is older than in mini-rings, though the recently obtained data do not exclude the reverse polymerization of mini-rings (Yasuhira et al., 1996; Yurchenko 1999).

Being studied over 25 years kinetoplast DNA (kpDNA) of trypanosomide mitochondria is a highly organized structure (mitochondrial nucleotide body), makes 10-25% of total cellular DNA and is found in different Trypanosomеs and Тrypanoplasma borelli (bodonids/cryptobiids). It is determined by the contained multi-copy mini-ring (0.5-9.5 t.p.n,; size differences are species-dependent) and/or usually few maxi-ring (23-40 t.p.n. and more; make less than 105 of total kinetoplast DNA) DNA sequences. Rings form a whole associate (so –called “chain armour”) due to multiple cohesions and retaining by the type of catenanes of neighbor mini-ring and sometimes maxi-ring molecules. In supporting associate there could not be excluded the retaining role of proteins (including integral and base polypeptides giston-like up to 67 kDa) among which there may be those that are specific to conservative (GGGGTTGGTGTA and GGGGTTGG) sequences of telomere-like repetitions (i.e. proteins with potential telomerase activity) and those that process gRNA. Also there cannot be excluded the role of specific RNA (Sloof, Benne 1997; Yurchenko 1999).

Among trypanosomes there are found mutants with changed maxi- and/or mini-ring component of kpDNA which lack normal transcript reproduction. T.brucei maxi-ring molecules contain some gRNA-genes and have editing encoding site where there are located: 2 rRNA genes (9S and 12S), several genes of protein components of oxidating phosphorilation, as a rule homologous for most mitochondria of different species, etc. Among these genes are: ND7 and ND8 – subunits NADH-dehydrogenase found usually in nuclear and chloroplast genomes (it is the first found example in mitochondria) and ND7 gene had 2 independently editing domains separated by conservative (at least in T.brucei, L.tarentolae and C.fasciculata) non-editing sequence; A6 (subunit- of ATPase), RPS12 and some non-identified and containing cytosine-rich ORF sites. In L.tarentolae the latter correspond to G-rich sites (in both trypanosomes there are six) and they preserve the same localization and direction. Divergent site contains high-repeated (in particular ND5 and rRNA) sequences. Some maxi-ring genes in T.brucei have single overlapping (up to 42 nucleotides of non-editing mRNA) transcripts (ND7/COIII, COIII/Cyb, COII/MURF2, CR4/COI, CR6/ND5), confirming that editing must precede processing completion. Maxi-rings of L.tarentolae have gRNA genes at least for Cyb, MURF2, ND7 and COIII genes.

In kinetoplastide mini-ring molecules of trypanosomides (e.g. mini-rings of T.cruzi, T.brucei, parasitic digenetically – between insects and vertebrates, and mini-rings of C.fasciculata, parasitic monogenetically – only on insects), gRNA genes are localized at specific sites inside variable site, and the number and accuracy of location may be specific not only for certain species but also for lines (Simpson 1997; Simpson et al., 1993). Mini-ring component is high-ploid (5-10 000 copies), can be heterogenic in size and primary sequence even in isolates of one species and probably multimeric (i.e. consists more than of one minimal ring). gRNA-gene transcripts mediate editing of kriptogen mRNA-transcripts. In so-called “pseudokriptogenes” transcripts are not edited productively under some conditions, but can preserve potential ability to editing in other conditions. Mini-rings practically do not contain modified bases. It is unclear what superfluity of mini-ring

component is necessary for, but there are necessary for editing and adaptation of trypanosomides (every time in relatively new conditions) gRNAs and possibly other genes or their parts. The latter is quite problematic as mini-rings have excess of stop-codons and ORFs found often do not reveal homology with known proteins.

It is unclear how transcription from mini-matrix occurs (there are no data about the number of promoters, processing character and cystron multitude in newly synthesized transcripts) and if there are any subsidiary cellular mechanisms. Nevertheless it cannot be excluded that there function expression mechanism principally different from that used at transcription of cytosol eukaryotic mRNA that use short RNA capping its untranslating 5’-end with specific signal (absent in mini-rings) for joining the “cap” and necessary for translation initiation. To avoid transcription problem in trypanosome mt-DNA there was developed a method of their transfection with RNA-polymerase gene of T7 bacteriofage. It turned out that this polymerase isolated from cpDNA transfected by cell L.tarentolae and T.brucei fages is in active (transcribed) form. In such system transcription transmitted by two ways – transfer DNA-cassette with T7 polymerase at cell electroporation and directly into isolated trypanosome mitochondria – allows transcribing foreign (in particular fage) genes (Estevez et al., 1999).

Mini-rings contain several (1-4) conservative sites of 100-200 b.p. (GC-component in average makes 23%, in some species – up to 51%), different by certain deletions, inserts, replacements, but with common consensus dodecamera sequence 5’-d-(GGGGTTGGTGTA)-3’. This sequence (so-called universal conservative CSB3-block – common for all investigated trypanosomides) perhaps performs the role of origin (ori) – start point of L-chain replication (H-chain contains conservative 5’-GGGCGT-3’ start point of replication). Pseudododecameras sometimes appear at some acts of duplication of life important sites for DNA, the following reduction of such independently evolutionising multimeric mini-rings and able to perform replacement functions. As a rule, mini-rings contain the same number of variable sites (in some trypanosomides hypervariability can reach 70-80% of total length). Such sites contain information about gRNAs and dispersed short (to 20 b.p.) imperfect invert repetitions related as well as mini-rings to the most rapidly evolving DNA in nature. In T.brucei where the is found the widest editing, the accuracy of this mechanism is less than in L.tarentolae – perhaps, because of high variability of gRNA in excess mini-ring component (Stuart 1993a; Simpson et al., 1993).

Mini-ring cpDNA also contains some regularly repeated (after 10-11 nucleotides, i.e. spiral coil) oligo-A tracts (4-6 dA) and possibly other elements (perhaps in trypanosomes there is laying of the elements, structures and mechanisms that then are widely used by other eukaryotes?). Among the latter there are those disposed to formation of structures like bent helix with abnormal physical chemical characteristics (electrophoresis mobility, etc.) inside the fragment of ~ 450 b.p. DNA. In comparative aspect there are interesting those sequences disposable to formation of secondary structures of “shamrock leaf” type, which are characteristic for start and termination of DNA replication in eukaryotic mitochondria. Such sequences limit the site of bent helix, which differently from forming loops classical palindrome duplex and local conformation curve (at В↔Z DNA transition ), non-sensitive to S1 nuclease and located between ori and gRNA-genes. Sometimes found (in particular at interaction with short peptides) close to three two-spiral DNA sites (and other structures), site of curves perhaps can be recognized

by protein ‘enzyme machines”. Often the location of curves determines choice of only one from several conservative sequences of multimeric mini-ring – that provides replication initiation. On the whole one may speak about unique program of associate mini-ring component organization. The main features of associate organization are heterogeneity, symmetry (location of conservative and variable sequences) of multimeric molecules, simultaneous presence of differently organized molecules.

Both ring structures – mini- and maxi-rings – can release from associate, independently replicate with formation θ-structures by Kerns and join the associate. From repeated replication open mini-rings are protected by unusual gaps (gaps are rebuilt only after replication) with 1-2 ribonucleotides at 5’-end, recognized by topoisomerase and spread onto the part of universal dodecamera. In hybrid T.brucei mini-rings are inherited from both parents, and maxi-rings – only from one ancestor (Gibson et al., 1997). This reminds the situation with transmission, respectively, nuclear and cytoplasmic inheritance in eukaryots, though relation of mini-ring component to nuclear DNA has not been shown yet. Localized in mini-rings ( as in T.brucei, L.tarentolae and Т. borelli) gRNAs- and gRNA-like genes are able to express gRNA molecules then undergoing 5’-uridilizing. Variable sites and start points of replication determin class specificity of mini-ring sequences, loss of which as a feature of genetic lability, probably, confirms the absence of need in protein products, that are not used without editing. In unusual growth conditions and such selective pressure that is accompanied by loss of mini-rings and accumulation of mutations in maxi-rings, the level of kinetoplast mitochondrial gene expression may sharply fall (Sloof,Benne 1997; Yurchenko 1999).

Seeming really complicated the interpretation of mediated by molecules of gRNAs U-insert/deletion editing and gRNA-paradigm is connected at least with 5 observed for different tripanosomides peculiarities:

- first, with the loss excessively reproduced mini-ring classes (of 890 b.p.) together with encoded by them most gRNA-genes at long-term (over 50 years) culturing in UC-line of L.tarentolae where shortage of gRNA-repertoir may be explained by the loss of necessity to reproduce protein structures of some G-rich (G1-G5) maxi-ring sequences – so-called conditional ‘pseudocriptogenes”. Direct corellation between the number of copies of mini-rings and excess of gRNA transcripts ( i.e. gene-dosing effect) was not observed, as a big role can be related to promoter power and rate of these molecules degradation (Simpson et al., 1993). However gRNA-genes here are encoded not only by mini-, but also by maxi-rings;

- second, with prevailing (paradox) single homogenic mini-ring class (of 2550 b.p. as in C.fasciculata) in the result of amplification of one specific mini-ring sequence (presenting finally over 90% of total cpDNA), but – with simultaneous retaining from total dissapearence of multiple minor classes of mini-rings (the share of which is only some cpDNA percent). Here direct correlation was not also observed between the number of mini-ring copies and excess of gRNA molecules;

- third, there was shown common excess of minirings – over 200-300 different classes in T.brucei (agent of cattle surra, transferred be tsetse fly) – accounting for over 90% of total cpDNA and presented as catenans of 1kb

length. Every mini-ring contains ~ 3 gRNA-genes, and totally there may be potentially presented over 600-900 different gRNA types. Every gRNA and considering total number of inserts in average can encode 1.5 tens uridines – that is much more than required for editing of known pre-editing mRNA (Stuart 1993a). Some gRNA here had unusual 20-nucleotide 3’-expansion, perhaps associated with the default either of transcription termination or 3’-processing. There were found much overlapping (from 2 to 52 nucleotides) gRNAs. The necessity of existence of wide gRNA-repertoir, probably, can explain excess major and simultaneous retaining from total dissapearance minor mini-ring sequences;

- forth, there was shown extremally heterogenic for its own lines and some isolates mini-ring DNA of T. cruzi kinetoplasts. Mini-rings (of 1500 p.n.) had 4 conservative and 4 variable sites. For 2 different T.cruzi lines (Sylvio and Can) there were determined excessively reproducible by mini-rings gRNA molecules and homologic (i.e. common) for both lines. Differences between them were in such transitions that did not prevent formation of gRNA-mRNA complementary hybridization. Sequence leveling of variable sites containing both excessive and homologic gRNA showed that these sites with high probability were derivatives from common ancestor sequence accumulating random polymorphism inside/round gRNA-genes. In this relation it was suggested that these T.cruzi lines can have cloned origin as a result of previous long-term development period in isolation (Simpson 1997);

- - fifth, there were found 2 large rings (~ of 80-90 and 170-200 t.p.n.) and initially total absence of mini-rings in kinetoplast-like mitochondrial DNA of Trypanoplasma borelli (bodonid, cryptobiid) 2 lines. In the large ring of 80-90 t.p.n. there are G-rich sites and some mitochondrial genes (non–editing genes COII, COIII as well as 3’- and 5’-editing genes Cyb and COI). One of G-rich sites was found in the analysis of partly editing transcripts encoded by 3’5’ pan-editing kriptogene RPS12, location of which was different from that observed usually in trypanosomide maxi-rings – perhaps in the result of divergence. Characteristic for this gene super-conservative domain-binding sequences were functionally significant, preserved amino acid sequence – and were edited.

Kriptogen RPS12 (=G6) T.borelli is a diverging family gene member with most conservative C-end part. In three separate domains of homologic transcript L.tarentolae there were found 117 inserts in 49 and 32 deletions in 13 sites, and from eight identified gRNAs there were seven encoded by mini- and only one by maxi-rings (Simpson et al., 1993). In tandem repetition (~1kb) of another large ring – of 180 t.p.n. (perhaps, this is polymerized mini-ring analogue) – there were found gRNA-like sequences of 40-60 nucleotides long that could be marked α-32Р-GTP by 5’-end and that in electrophoresis migrate with the rate little different from that of tRNA. Mechanism of additional 5’-uridilizing and its possible function are unknown. Different types of large rings of 180 t.p.n. in their tandem repetitions 1kb contained highly frequency-variable gRNA-encoding sequences. Variability character of these sequences illustrated plasticity of gRNA-gene component and it reminded the situation in C.fasciculate where over 90% of cpDNA represented only one mini-ring class, at the same time all minor classes were simply retained from total disappearance.

Thus, if to consider that every time U-insert/deletion editing was related to only limited RNA molecule spectrum; that in a number of cases gRNA-coding ability of mini-rings was duplicated by maxi-rings; that in most cases the systems studied revealed unknown mechanism, providing retention from total disappearance of gRNA (and similar) encoding sequences (usually in mini-ring DNA), so perhaps these causes (not considering unknown hypothetical mechanisms, providing formation of hypervariability and transfer of nucleotide sequences, for more see (Deichman, Baryshnikov, 2005) explain unusual flexibility and plasticity for renewal of gRNA-coding ability repertoire in evolution in various conditions under long-term maintenance of culture growth. Frequency of individual gRNA-genes in mini-rings can vary practically without any effect on editing system – but until total loss of mini-ring specific classes occur. More over, with the loss of necessary for specific editing information in gRNA-genes (and similar) inside mini-rings for some trypanosomides (T.brucei, T.cruzi) it is quite probable that they are replaced by other not containing identical or almost identical directing gRNAs editing.

Surprisingly, despite plasticity of the frequency variability of mini-ring sequences, total number of conjunct kinetoplast mini-rings remains the same – that confirms the existence of both the number control system and alternative, possibly structural, role of mini-rings and mini-ring DNA. Evolution source of gRNA-genetic system in kinetoplastides has not been determined yet, though it is clear that its presence is more important and intriguing than in which exactly structures - mini-ring (as in T.cruzi,C.fasciculata), maxi-ring (as in T.borelli), or in mini- and maxi-ring (as in T.brucei, L.tarentolae)) – it functions (Simpson 1997). Also we should note that deep interrelation developed by small rRNA (history of phylogenic tree) between kinetoplastides/trypanosomides (especially – sources of enigmatic origin of their mitochondrial organization) remains hardly understandable and it needs reassessment. However developed by cytoplasmic heat-shock-protein hsp90 (including second positions of codon nucleotides), kinetoplastide tree was divided into 4 main stores, where 1-3 ones referred to different Bodonids, and only store 4 – to trypanosomides that was located between store 1 (including Dimastigella, Rhynchomonasm, some Bodo spp., and possibly Rhynchobodo) and other Bodonids, specifically between Bodo saltans and Bodo sf. It cannot be excluded that net organization here is a derivative of different kinetoplastide and open lariat-mini-ring components apart from others generally can have the earliest origin (Simpson et al., 2002).

Changes in kinetoplast (Lee et al.,1992; Chiang et al., 1996) and nuclear DNA of trypanosomide are connected with the effect of their emerging resistance to chemicals and antibiotics. Thus, in some L.mexicana strains in different concentrations of arsenite (5-50 mcМ) in vitro significant changes were observed in the contents of kinetoplast cpDNA (variant A) – the same however at late stages of selection. Kinetoplast DNA isolated from wild type strains as well as grown in the presence of arsenite, had absolutely different restrictase maps with weak cross-hybridization signal (identity – less than 0.1%). Most changes were connected with redistribution of mini-ring molecules shares when one of the minor for wild type classes started dominating over the others; every class perhaps had corresponding own editing potential. Similar effect was observed in developing resistance to tunamicin (variant T). It was revealed that changes in A- and T-variants of strains were related to nuclear DNA of trypanosomatides. Developing resistance was accompanied by

transkinetoplastidia, i.e. specific amplification of nuclear DNA sites, forming large circular molecules and were probably the result of previous changes in redistribution and selection of separate mini-ring molecules in kpDNA. Similar results were obtained for T.cruzi as well.

In diskinetoplastidia previously seen kinetoplast mitochondrial structure disappears due to almost total loss of only maxi-(for that there is enough, for example, strong damage of Cyt-gene or amplification of highly changed maxi-genome part) only mini-, or both components. Also this is possible due to practically total transition from ring to linear type of heterogenic by length and primary structure DNA molecules (Alves et al., 1994; Yurchenko, 1999). Editing role in connection to development of resistance to chemicals and antibiotics has not been assessed here, but in any case redistribution of shares of different classes of mini-rings means possible redistribution of editing potential. In T.brucei however diskinetoplastidia did not prevent functioning of editing complex and mutants deprived of either natural substrates for RNA-editing or all (almost all) gRNAs preserved all 4 (cut, deletion/insert, total deletion in vitro) primary catalytic and editing activities (Domingo et al., 2003).

Analysis of pan-editing criptogenes micro-evolution, conducted by comparing primary structures of ND7, ND8, ND9 and COIII genes of close-relative African trypanosomides T.brucei and T.congolense, showed non-random distribution of editing sites. In mitochondrial sequences G-, A- and C-nucleotides were determined mainly by maxi-, and filling of U-nucleotides by mini-rings (Sloof, Benne 1997). Differences in structures of the genes studied referred first of all, as it was previewed, to cut out and completed timidines (Ts). Some found purine replacements were silent and did not change coded amino acid sequence (Read et al., 1993a; Read et al., 1993b; Yurchenko 1999). At the same time there was found editing of hundreds of sites: in L.tarentolae 6 were pan-edited, in T.brucei – 9 genes (СОХ III etc.). There is an opinion that pan-editing is the most ancient hereditary form (molecular fossil), enhancing the ability to retrotrans-positions in potential criptogenes in relation to some genes which transcripts require little or no editing. Initiation of editing depends on formation of primary anchor duplex between first initiating gRNA and 3’-part of mature mRNA able to cis- and trans- mutual orientation. For the second gRNA there are conditions for cohesion with mRNA only after the work end of the first, in the result of consequence 3’5’ duplex editing expansion, the evidence for that comes from partly editing in 3’-part transcripts having certain range and direction characteristic junctions in their editing domains.

It is the analysis of partly editing sites that suggested a possibility of incorrect interaction of gRNA and pre-mRNA as a result of:

- quality non-correspondence when one of interacting components turned out “foreign”;

- position non-correspondence when gRNA anchored not at its site and has not formed correct primary anchor duplex protecting from incidental editing. In another case because of looping in pre-mRNA besides primary there is incorrectly formed secondary anchor duplex with the same gRNA leading to the duplex frame shift;

- crimps in deletions and inserts created by G:U (sometimes other) pairs.

Preferable formation of anchor but not the rest part of hybrid duplex is referred besides all to advantage in released free energy: in L.tarentolae for mRNA RPS12, MURF4 and COIII counted advantage was 30-190% (Simpson et al., 1993). Expanding duplex as a rule has some 3’5’ independently oriented separated domains, the order of their editing needs determination in most cases (Sloof, Benne 1997). It was shown that pan-editing mechanism, i.e. multiple (almost continuous) in relation to 3’- and 5’-parts of the same pre-mRNA editing, requires consequent function of a number of overlapping gRNAs and different gRNAs could give identical editing. The full set of overlapping gRNA in L.tarentolae was identified for transcripts of ribosomal protein S12 as well as COIII and МURF4 genes. Such editing, probably main one, is evolutionary earlier than derivatives 5’-inside and 5’-end criptogenes editing. This results from compararive analysis of editing of homologous G-rich criptogenes ND7, MURF4 and COIII in L.tarentolae, T.brucei and C.fasciculata: thus pre-mRNA ND7 in T.brucei is pan-edited in 2 domains, while in L.tarentolae and C.fasciculate this pre-mRNA reveals 5’-inside editing for one and 5’-end – for other domain. Similar situation is in case of MURF4 and COIII transcripts where plenty of uridines in plenty of sites were inserted before pre-mRNA maturation – practically doubling into mature mRNA. More over another mechanism is possible; in the result of possible retransposition of totally or partly editing transcripts, there may by expected gradual elimination of some (pan-editing) genes and on the contrary, appearing other (non-editing) genes (Simpson, Maslov 1994; Lye et al.,1993; Simpson et al.,1993).

Both 5’- and 3’-ends of mRNA have different evolution “history” and therefore independent 5’- and 3’- types of editing and 3’-cut/polyadenilising. It is not clear if there is connection between poly-U in gRNA and poly-A in mRNA (in some mRNA-genome copies of criptogenes 3’ poly-A sequences were absent), but both polyadenelising and appearance of uridine resulting from U-insert or even CU editing changes equally could lead to stop-codons (Heinemann et al., 1994; Kozlowsky, Yohampath 1997). On the other hand there was correlation between editing and transcript polyadenelising, in particular protein RPS12. Non-editing transcripts contained almost only short (~20А), and partly all non-editing transcripts both short and long (~ to 120-200А) 3’-poly-A sites. However the signal of translation of editing transcripts hardly were only long poly-A ends (Militello, Read 1999).

Editing can cover practically al the length of pre-mRNA including 3’- and 5’- non-translating sites and even poly-A tail where there were noted separate positionally variable U-inserts. But it is not sure that the same mechanism functions everywhere, which is connected with the existing in mitochondria end uridintransferase active in relation to 3’-gRNA and rRNA (Stuart et.al., 1992; Stuart 1993b, 1993а). TUTase is a key enzyme in 3’-end insert/deletion editing and is contained in at least 2 stable configurations; in containing RNA-ligases (р45 and р50) and gRNAs (to 40%) complexes of 500 and 700 kDa, and its inhibiting in pro-cycle T.brucei decreased editing and survival of the parasite (Aphasizhev et. al., 2002). Although the significance of editing outside coding sequence part is not clear there is suggestion that it effects translation and resistance of mRNA to degradation. Only the last nucleotides of 3’- and 5’non-translating mRNA sites are never edited (Yurchenko 1999). However criptogenes evolution seems very specific in that for maintaining correctness of the editing process characteristics, there should co-evolve

correspondingly and simultaneously gRNA gene(s) and corresponding covered be it(them) in pre-mRNA part of the gene. And specificity of nucleotide interaction of these components allows replacement A for G (and vise versa) and C for U (and vise versa) in both pairs. G:U pairs are much less frequent in anchor part of hybrid duplex – as usually asymmetrically formed A:C pairs ( A – in mRNA, and C – in gRNAs). Increase of A frequency in gRNAs leads to additional U-inserts in editing mRNA – that corresponds to increased Ts contents in coding maxigenome part (Simpson et al., 1993). And successful co-evolution of cinetoplastides, ancient organisms having intriguing mechanism of gene expression control and complicated morphogenesis type (organized inside cytoskeleton), and their hosts, as suggested being connected by an inside link with successful transmission of coursing (shuttle-like) parasite vectors, which uses multi-differentiated forms of complicated cell life cycles (Gull 2001).

Besides mitochondrial gRNAs trypanosomes (T.brucei) have shown partly complementary and potential (by computer calculation) but not experimentally revealed, tendency to pairing with 5.8S and 18S rRNA small nucleoli RNA (snoRNA) of 85 nucleotides long, some of which (snoRNA-2) are encoded by multicopy gene and connected with matrix-directed (i.e. with the function like guide one) methylation (Levitan et al., 1998; Corell et. al., 1993; Riley et al.,1994; Stuart 1993b).

According to the most developed in relation to U-insert/deletion editing in Trypanosoma brucei model, there is understanding about existence of multitude of ways for preserving and transmission of genetic information and transfer it from one RNA type to another, in particular from small directing gRNAs to pre-mRNA. Perhaps relicts of early RNA-genetic system may be both gRNAs and RNA-intrones, as both distribute inside them information about RNA-genome management (Simpson et al., 1993). Huge number (some hundreds) of single U-inserts (sometimes deletions) by many sites of most mitochondrial mRNA of trypanosomes allowed the authors to make vivid, though controversial suggestion that as if at a new and RNA level there is rewriting of genetic code (Stuart 1998; Benne 1996). Perhaps genetic code evolved, roughly, in two stages, with primary appearance of canonical code in the last universal common ancestor (LUCA) and the following divergence into multiple nuclear and organelle genealogy. Three theories are used for explanation (each could make its contribution): 1) capture of codons (caused by mutations nucleotide shifts eliminate definite codons without any selection), 2) minimization of genome (firstly, by the number of required for tRNA translation) and 3) ambiguity (translating in more than one amino acid) codons (Knight et al., 2001). However, it cannot be excluded that formation of contemporary code is a much longer, complicated and tricky convergation process, in the result of which a number of initial genetic systems were those that turne out to be built into contemporary UGC code (including nuclear and organelle; and divergence and may be single LACA-organism, appeared independently from codes-ancestors, was not needed in a pure way), and those that did not pass selection, adaptation and eliminated either being very early codes-ancestors, changed unrecognizably (Deichman, Choi, Baryshnikov 2005).

Editing requires multiple separate, bigger than at splising, catalized steps and perhaps serves as an alternative regulator between different ways of generating energy (as in case of editing pre-mRNA proteins of oxidative phosphorylation system) and cell cycle stages. Besides, it is noted that the loss of one of two hosts, i.e. digenetic way of life

in other parasite, freely living Bodo saltans, reveals the loss of deletion/insert U-editing (Landweber et al., 1994) by some and switch of wide gRNA-dependent editing from certain genes to other ones (Blom et al., 1998). When studying the Bodonid it conclusion was made about: a possible evolutionary separateness of creation of individual mini-rings, firstly, and nets of mini-ring associates, secondly; a more close their evolutionary link with trypanosomatides than for T.borelli, which lack non-polymerized mini-rings. The analysis of nucleotide sequences of 4 complete mini-rings, their 14 fragments and 14 gRNAs allowed to identify mini-ring equivalent 1.4 kb long. Every mini-ring contained 2 cassettes of gRNA-genes in oppositely located variable (~ of 200 nucleotides) sites alternating with 2 conservative ones. The latter contained sequence of a curved spiral type with degenerating CSB-3 dodecamera motif. Three different methods (electronic microscopic, sedimentation analysis and gel-electrophoresis) showed that mini-ring component is represented by individual circle and liner monomers (85-90%) with little number of catenising dimmers and trimers but not multimeric associates. This is the first example of kinetoplastides with non-catenising gRNA-gene containing mini-rings (Blom et al., 2000).

The main reasons for circumvention of energetic imbalance and survival of trypanosomatides in unusual growth conditions (for Рhylomonas serpens), as well as in blood circulation and digestive tract of insects and vertebrates (for some other trypanosomatides), perhaps there were two reasons. Both are related to P.serpens: firstly – deletion/insert U-editing, in particular leading to appearance of non-canonical initial AUU codon in preserved products of A6 and ND7 genes; secondly – import of some lost and responsible for respiratory functions of mitochondrial enzymes during the period of their dwelling in plants (phloem, latex, fruit pulp). The loss of reproduction important ATP genes, COIII (subunits-3 cytochrome-c-oxidase), Cyb (apocytochrome b) and perhaps others, led to the loss of their functions of respiratory complexes III and IV. In mitochondria maxi-rings (~ 31 t.p.n.) inside the region of 6234 p.n. all mentioned genes are localized including 12S and 9S rRNA genes as well as MURF1, MURF5 and G-3 kriptogenes with unknown functions. As there were lost at different level editing genes of ATPase (А6 =MURF4 necessary for function of respiratory complex V) and NADH-dehydrogenase (subunits ND7, ND8, ND9), it was suggested that in conditions with the excess of amino acids able to be simultaneously a source of energetically important carbohydrate component, reproduction of ATP was compensated at the expense of glycolisis enhancement in glycosomes. There should be such ATP level that is enough for inter-membrane import of the lacking respiratory enzymes; the availability of these enzyme genes in the nucleus is being studied (Maslov et al., 1999).

The number of U-inserts as a rule is much more than U-deletions (Seiwert, Stuart 1994), i.e. there differ basic and minor editing forms, that can continue till the end of processing, and U-insert optimizes more accurately conditions of the reaction by ATP, UTP, RNA-component and protein factors (Cruz-Reyes et al., 1998b). U-deletion/cut and U-insert oppositely depended on ATP, ADP because of allosteric effect in the site of anchor duplex (Cruz-Reyes et al., 1998a) and provided switch between terminal respiratory trypanosome systems (Stuart et al., 1997). In the change of life cycle phase of T.brucei there were changes in the rate of components editing, which were responsible for energy reproducing (ATP) by glycolisis and oxidative phosphorilation. Thus blood flow forms (where there was more glycolisis) accumulated completely editing ND7, ND8

(subunits NADH-dehydrogenase), CR6 (frame, encoding cytosine-rich site; there were edited other CRI-CR5 frames as well), A6 (subunits-6 ATPase) and non-editing Cyb and COII transcripts. And procycle forms (predominated phosphorilation) accumulated editing Cyb, COII, A6 and non-editing ND7, ND8 and CR6 transcripts. It is not excluded that regulating role may be played by molar ratios between pre-mRNA and different types of gRNAs (Stuart 1993а). U-insert in pre-mRNA and gRNAs are more often connected with activity of end uridinetransferase (TUTase), while U-deletion – with specific 3’-OH exonuclease (Adler, Hajduk1997; McManus et al., 2000). In the presence of gRNA activity increased and in the presence of 3’-pre-mRNA-fragment – specificity of deleting 3’-exoribonuclease; uridines pairing with purines of gRNAs were protected from deletions specific in relation to non-paired uridines that was necessary for accurate editing (Igo et al., 2002).

One mRNA in trypanosome mitochondria besides maxi-ring gene may be edited by some gRNAs, i.e. additionally performed control of mRNA by multiple scattered in mini- and/or maxi-rings of gRNA-genes (Corell et al., 1993; Reley et al., 1994). Thus mRNA that is controlled by multiple gRNAs and concentrated in kinetoplasts encodes mitochondrial protein hsp70 and in cytoplasm this heat shock protein (shaperon) is encoded only by mRNA and distributed equally (Klein et al., 1995). Certainly it is a big problem – what forms any separate specific gRNA-coding ability in low-molecular mitochondrial DNA, moreover when realization of such ability requires specific control of variable sequence in mini-rings. So the reasons for existing of multitude specific gRNAs including in each separate mRNA and accuracy of their localization in editing remains enigma, the solution of which will lead to the better understanding of the editing phenomenon (Avila, Simpson 1995; Simpson 1997). It cannot be excluded that the clue may be connected with hypothetical mechanisms of formation of hypervariability and transfer (including horizontal) nucleotide components between DNA-containing organelles and cells (Deichman, Baryshnikov, 2005).

It is considered that those genes (their parts) are intensively edited , which transcripts contain G-rich sequences. Simultaneously there are noted decreased contents of C (related to G) and T residues (which requirement is decreased because of built-in in mRNA uridine residues) and vise versa, increased contents of purines in relation to pirimidines in less edited genes (Koslowsky et al., 1991). By 3’-ends gRNA-mRNA chimeras reveal unusual expansions (Reley et al., 1994). In the presence of ATP editing enhanced and ligases preferred U (in the absence of ATP preferences were different: G>U>С>А), but in the absence of gRNAs appropriate length of poly-U tail no site was edited in pre-mRNA (Arts et al., 1995; Palazzo et al., 2003). The exact editing mechanism is not completely clear (Yasuhira, Simpson 1996; Goringer et al., 1994; Frech, Simpson 1996), and there is suggestion that gRNA-mRNA chimera can function as a construction block for assembling of high-molecular editing machine (Shu et al., 1995), and presents only an aberration end of editing products (Stuart et al., 1997).

Simultaneously free gRNAs were not found (Shu et al., 1995), but there were found free from pre-mRNA (A6) gRNAs/protein 8S and 15S complexes, containing some types of specific gRNAs and two proteins (~ of 90 and 21 kDa) with affinity with different gRNAs performing perhaps protective (in relation to nucleases) function. Presumably and by analogy with forming at several steps ribosomal and splisosomal complexes, for such

gRNAs/protein complexes there is suggested the role of primary complexes developing at the first steps of assembling of high-molecular gRNAs-mRNA-editing machine having characteristic for whole editosome 19S and 35-40S active complexes (Shu et al., 1995). It is supposed that purine-rich mRNA site interacting with relative gRNAs protects uridine tails from 3’-exonuclease activity of both editing complexes. In the absence of such interaction (base-pairing involving modified mRNA) the function of this nuclease did not stop. Complex 35-40S is considered completely ready for active editing, as it contains the full set of editing enzymes and pre-mRNA. RNP-complex 19S provided poly-U tail with single uridines, while its subunit 10S without 3’-exonuclease activity – multiple uridines; the presence of relative mRNA however was necessary (McManus et al., 2000).

………………………………………………………………………………………………………….

3. Other type of insert (and other types) of RNA editing in protozoa

Wide editing by over 1000 sites (mainly C-inserts) in mitochondria of mixomicet Physarum polycephalum was found not only in some mRNA including proteolipid and -subunits ATPase, apocitochrome-b and subunit-1 of NADH-dehydrogenase, but in large and small subunits rRNA and in 3 tRNA-lisine, glutamine, methionine. Editing of transcript subunit-1 citochromeoxidase (co1=cox1) was there unique for any eukaryot as it revealed combination of 66 non- homogeneous inserts (59C, one U and three mixed dinucleotides) and 4 CU convertions though phylogenesis of other mixomicet species was connected with historically different 4 types of editing (Horton, Landweber 2000; Horton, Landweber 2002), which fixed separately (e.g. in Clastoderma debaryanum not only U-inserts). MtDNA-genome of P.polycephalum (circular molecule of 62 862 b.p., with 74% by AT-component) contains genes of 12 known proteins (3 subunits cox1, apocitochrome-b, 2 subunits ATPaseF1Fo, 5 subunits NADH-dehydrogenase and one ribosomal protein; were obtained with the use of BLASTX-program), 2 rRNA-gene and 5 tRNA-genes. In nad7-gene there was shown 51 inserts at 46 sites, and boundaries 20 ORFs (14 from them were transcribed) were modified by editing (Sasaki, Kuroiwa 2001).

The character of non-matrix but important in formation of long ORFs peculiarities of RNA-structure and for survival at every life cycle stage of P.polycephalum modification in newly synthesized mt-transcripts, was connected with 3’-extraend (not inside positioning in the result of actions cut/suture) insert editing, the nature of which mostly remains unclear. However it is clear that editing: 1) depended on renewal of transcriptional elongation from non-matrix site (both processes competed for site-recognizable matrix part), not connected 2) with sliding (as in paramixoviruses) at pausing of RNA-polymerase (including accuracy and advance along DNA-matrix, as well as stabilization of corresponding RNA-DNA-hybrid) with concentration 3) of inserting nucleotide at the site, below the site (but not in surrounding sequences) as well as 4) with specific nucleotide context (perhaps cis-performing elements near C-site) of definite editing site and interaction with newly synthesized RNA and trans-active factors.

Probably it is not surprising that the number of mechanisms of highly specific editing and system types of RNA editing is comparable. In average there was edited every 25 nucleotide in mRNA and every 40 – in rRNA and tRNA: 90% - C-insert + rare U-, A-,

G-inserts and CU conversions (Cheng et al., 2001; Byrne, Gott 2002). Nucleotide insert and site editing recognition are two different specific processes, that results from the analysis of sporadic errors (false edited in vitro small gaps/inserts) only in RNA-transcripts supporting matrix editing. And presence of large deletions obtained in editing process confirms possibility of “jump” of transcription-editing apparatus from site to site, it is not excuded that it is the result of interaction with editing (cis?)-determinants (Byrne et al., 2002).

Editing in P.polycephalum is compared with that in trypanosomes, though there is considerable difference in organization of their mitochondrial genomes (in Physarum there are mitochondrial plasmids, but no mini-ring component) and natural habitat of these different representatives of eukaryots (Miller et al., 1993). In fact, insert editing by single nucleotides (in Physarum over 90% are C, but not U) is characteristic for both species. Besides, in Physarum, excluding different combinations of dinucleotides before editing site (more often these are АU, GU, АG , seldom CU, UU, АА, UА and quite seldom others), inside editing RNA there was not found any consensus-sequences that may be considered signal. This does not exclude, perhaps, a possibility of directing editing process with molecules like gRNAs (but – with poly-C, not poly-U tail part) or another also including not only canonical but G:U destabilizing pairing in transmission of sens-antisens information signal. However necessary for confirmation of identity mechanisms of editing in Physarum and trypanosomes small gRNA-like molecules with 3’end poly-C tails were not found. Moreover insert editing in Physarum (unique case) appeared to be mixed, while mitochondrial transcripts had excess not only single C (very often) and U (seldom), but also single dinucleotide (CU, GU, GC and АА) inserts. Inserts larger than dinucleotide, CC or UU, and deletions and any nucleotide substitutions there was not found. The distance between inserts varied from several, up to some tens of nucleotides (that also does not correspond to distribution and number range of inserted uridines in trypanosomes), and was in average 25 nucleotides for mRNA and 43 nucleotides for rRNA (in three tRNA there was found only one-two single C or C and U inserts in anti-codon and acceptor stems and in pseudouridine loop).

In Physarum mRNA molecules are practically not created de novo, as it is characteristic for trypanosome, but editing is performed over very different structural RNA components – two strand pairing parts of stems, loop, single strand parts (in particular in the small rRNA subunit), as well as conservative and variable sites. And editing in conservative sites enhanced the grade of their conservativeness. It should be noted that the data of the work ( Miller et al., 1993), where for 4 mRNA there is summarized number of each 64 codons before and after editing, show that some codons (as AUC isoleicin, GUC valin, ACC treonin) were created almost exclusively at the expense of insert editing (the part of single C-inserts was 94%), while other initially excessively present codons (such as phenylalanin UUU, isoleicin AUU, valin GUU, tyrosin UAA, asparagin AAU, aspartat GAU, glicin GGU and lisin AAA) either were not restored by editing or only a little. There were intermediate (such as phenylalanin UUC, leicin CUU, prolin CCA, glutamin CAA), when codon occurred not rarely, and even very often (as leicin UUA), but nevertheless was demanded by insert editing. Analysis of partly editing RNA of this mixed type of insert editing showed that that was firstly, post-transcriptional and secondly, two-directed, i.e. related to both 3’- and 5’-ends processing. It is supposed that

dinucleotide inserts particularly in developing by editing reading frame for mRNA cytochrome-b of Physarum mitochondria where there is observed high percentage (20%) non single C-inserts requires separate mechanism (Wang et al., 1999). On the whole it may be considered that in Physarum and trypanosomes there function basically different mechanisms (Wang et al., 1999).

4. C U editing deamination in animals

It was shown that CU editing deamination can be site-specifically (Yamanaka et al., 1996). It is widespread and revealed, apart from other kinds of nucleotide changes in editing, in all three DNA-containing cell organelles, in nucleus, mitochondria and chloroplasts in differently organized species. In plant organelles, but not in mitochondria of fungi and animals, this is the main and almost single (excluding rare UC changes) of presently known editing types. Notably, in trypanosomes (Leptomonas collosoma) CU editing was described at the first time in domain III of small nuclear 7SL RNA; this RNA gene is represented by one copy with citosin in position 133. In editing more free from ribosome nuclear, conformation II, form 7SL RNA transforms in ribosome-connected cytoplasmic, conformation I, form (Ben-Shlomo et al., 1999).

Taking not less than 5 minutes, site-specific CU editing, observed in vitro during incubation of recombinant cytidindeamenase in the presence of mRNA apolipoprotein-B (Apo-B) of rat and additional protein factors from different sources (Anant et al., 1995b), is found by changes of corresponding nucleotides in cDNA. Such cDNA were obtained in the result of reverse transcription of mRNA Apo-B with the following its copy and reproduction of necessary clones. Editing in nucleus (Yang et al., 2001) was preceded by occurring in the first two minutes mRNA Apo-B binding to additional protein factors. Most works related to this editing type were performed with nuclear-encoded site-specific cytidindeamenase of animals.

The most frequently site-specific CU deamination is noted in editing of nuclear mRNA of apolipoprotein-B (mRNA ApoB) more expressed in liver cells and erythrocytes of animal thin intestines. And usually in embryonic and early post-natal period there dominates Apo-B (Apo-B 100) expression in liver, while in later post-natal and adult period – in thin intestines where elongated protein form is transformed in shortened (Apo-B-48). Apolipoprotein-B is a necessary structural component of lipoproteins secreted by thin intestines and liver. mRNA Apo-B expression in thin intestines cells and hepatocytes is regulated transcriptionally, post-transcriptionally and translationally, and editing here is a very fine process, as there edited one of over 14000 nucleotides though most of transactivating core-factors of editosome are not completely characterized yet (Anant, Davidson 2002).

Protein product mRNA ApoB 100 contains 4536 amino acid residues secreted as a rule by the liver and includes in the lipoproteids of low and very low density transporting cholesterol into tissues. In Apo-B-48 there are 2152 amino acid residues of amino terminal part of ApoB 100; it is secreted by enterocytes of thin intestines and circulates in the contents of chylomicrones and their derivatives directed to different tissues. So Apo-B-48-containing particles are catabolized faster than those containing ApoB 100. Site-specific deamination mRNA ApoB 100 by C(6666) in the contents of corresponding to glutamin

(CAA) 2153 codon, goes with formation of stop-(UAA)-codon and shortened form of apolipoprotein (Navaratnam et al., 1995; Anant et al., 1995a; MacGinnitie et al., 1995; Sowden et al., 1998). The level of apolipoprotein-B in blood plasma of a large population varies widely and its increase is connected with the increased risk of heart coronary arteriosclerosis (Voyiaziakis et al., 1999).

As statines and components of bile acids, temporary increase of editing mRNA ApoB (with simultaneous transgenic expressions of Apobec1- and TAT-proteins in genotherapeutic procedure on hepatocytes) can promote decrease of aterogenic LDL-fraction (with the domination of ApoB-100 in hypercholesterinemia) and on the contrary increase of synthesis and secretion of Apo-B-48-containing VLDL-fraction (less aterogenic and disappearing faster from blood plasma) lipoproteins (Yang et al., 2002; Hersberger et al., 2003). On the ratio of both protein forms (synthesis, secretion, degradation), triglycerid synthesis and flow of fat acids in liver, contents and ratio of fractions of lipoproteins, chylomicrons and rat hepatocytes (towards editing enhancement) could have influence increased (particularly growth hormone, insulin, etc.) hormone background (Linden t al., 2000).

Long-term chronic excess GH (growth hormone) induced notable changes in metabolism of lipids and lipidoproteins bGH-transgenic mice and body weight, the level of serum cholesterin, insulin-like I-factor and insulin increased, while glucoses, free fat acids and triglycerids decreased; editing mRNA ApoB and liver triglycerid secretion decreased. Thus, there were observed decrease of production and increase of degradation of VLDL-fraction of lipoproteids, and preferable flow of fat acids in muscular tissue (Frick et al., 2001). Thyroid hormone modifying expression of a great number of genes also regulates metabolism of lipoproteins (mobilizing liver triglicerids) in vivo and in non-optimal tissue-specific editing mRNA ApoB (linear model of innate hyperthyroidism in Pax8(-/-) mice losing follicular cells) mediates changes in gene expression of additional protein (ACF) factor (Mukhopadhyay et al., 2003). Intracellular production and degradation ApoB 100 was connected respectively with MTP (microsomal triglicerid-transport protein) and proteosomes (Chan et al., 2000). Unexpectedly weak change in secretion of triglycerids (in response to fat-rich food) in inbred Apobec1(-/-)-deficient mice (obtained backcrossed with C57/B) could be connected with the shift in the synthesis of different (particularly preserving ApoA-IV level) stable expressing large isoforms ApoB, able to maintaining minimal deviations in metabolism and regulation of levels and ratios of different lipoproteins, their complexes and assembling in intestines. Preferably there degraded ApoB-100-containing (mainly aterogenic LDL-, less VLDL-) fractions of lipoproteins (Xie et al., 2003).

Protein p27 called Apobec-1 (27 кDа) is the only catalytic subunit of animal cytidideaminases having such a high percentage of homology that in model experiments of determination of main and additional editing sites (in conditions of expression and superexpression of Apobec-1) source of naturally expressed or transfected Apobec-1 (human, rabbit, rat, mouse) as a rule is not important. Characteristic of editing animal cytidindeaminases different from their bacterial analogue in E.coli is their dependence on polymere (molecules RNA) but not monomeric ((ribo-nucleotide/-nucleoside) RNA-substrate. They contain separate RNA-binding, RNA-editing and as usual hydrolytic cytidideaminases using as substrate mononucleotides and mononucleosides as well as

dependent on double-strand RNA editing adenosindeaminases, zinc-binding (fig.2) sites. Existence of each separate site was shown by the method of its disconnection from others ( Navaratnam et al., 1995).

In the Apobec-1 protein there are two specific sites: the site responsible for formation of ---structure necessary for interaction with mRNA near editing site; and the site responsible for proton transmission in deamination, i.e. performing proton-shuttle function. Not all specific sites (especially RNA-binding) are identified completely in different species; they often overlap and not always present linear located continuous fragments. In Apobec-1 a critical amino acid in the prononing accompanying deamination is negative a charged glutamin acid (Glu104 – in human, Glu63 – in rat). Critical zinc-binding amino acids in Apobec-1 are one gistidin and two cysteins: Gis102, Cis129 and Cis132 – in human, Gis61, Cis93 and Cis96 – in rat (Navaratnam et al., 1995). Zinc-coordinating domain has 35-40 amino acids with consensus sequence Gis/Cis-Ala/Val-Glu-(X)24-30-Pro-Cis-(X)2-Cis for different Apobec-1. Impairment of this domain leads to sharp weakening or elimination both editing and deamination enzyme functions. Of three zinc-binding amino acids in rat Apobec-1 two (Gis61 and Cis93) directly included in RNA-binding, though canonical RNA-motif was not found and final real ratio between RNA-binding and editing was not established (MacGinnitie et al., 1995; Sowden et al., 1998). In Apobec-1 for nuclear localization there are responsible residues 97-172 and 52 N-end amino acids and for endocytoplasmic redistribution – 15 C-end ones including leicins (Yang et al., 2001). From evolution point of view it is interesting (fig. 3) that enzyme Apobec-1 contains deaminase activity related to monomer (nucleotide and nucleoside) RNA-substrates. That allowed authors (Navaratnam et al., 1995) to suggest that site specific editing in initial cytidindeaminases was possible in the result of mutations at the later stages that let acquire ability to bind and use as a substrate polymeric RNA.

Other known facts are also notable:– many cytidindeaminases are bifunctional and capable as a substrate to use not only ribo-, but also deoxyribonucleotides (MacGinnitie et al., 1995; Yamanaka et al., 1997). Thus for Apobec1 and some of its homologues expressed in bacteria and forming editosome complexes RNA-substrate was physiological editing object; however single-strand DNA underwent deamination in vitro as well (ssDNA) (Petersen-Mahrt, Neuberger 2003). Besides, it was shown that unregulated activity (super-activity) of Apobec1-family members leading to aberrative (disregulative) editing as well as expression of editing factors could lead to deamination of dC-nucleotides, including outside physiological targets, however having strict primary/secondary structural preferences (Anant, Davidson 2003); – that significant number of common enzymes (including synthesase, dehydrofolatreductase, akonitase, catalase, glyceraldehydrogenase) also interact with RNA though critical amino acids directly including into binding to RNA are not known here as well. Such enzymes include mono- and dinucleotides as substrates or co-factors or contain concealed nucleotide-binding sites (as in akonitase or catalase). In relation to the first three enzymes it is known that nucleotide-binding and RNA-binding sites can overlap and domains interacting with mono- and dinucleotides can include in binding with polyribonucleotides, that

perhaps promotes evolution from more primitive mono- and dinucleotide-binding functions to polymeric RNA-binding (Navaratnam et al., 1995). However at this stage the role of mediated Apobec-1 deamination of monomers in cellular metabolism of nucleosides is only being discussed (Hirano et al., 1996). The age of supposed transmission of Apobec-1 from birds to animals is about 170 million (Fujino et al., 1999).

Recently there has been first presented another cloned member of supergenic family of cytidindeaminases, Apobec-2, which is more conservative but evolutionary connected with Apobec-1. In human this gene is expressed in 6th (6p21) and in mouse in 17th (17p21) chromosome. mRNA Apobec-2 expression is characteristic only for heart and skeletal muscles and deamination activity of containing 224 amino acids Apobec-2 proteins was much lower than in Apobec-1. The new cytidindeaminases family member revealed no editing activity related to mRNA Apo-B (Liao et al., 1999). It was also found out that one other deaminase Apobec-family member human Apobec3G (CEM15) had ability to wide anti-retrovirus protection and was active in relation to HIV transcripts and other retroviruses (or integrating into the genome of reverse transcripts, cDNA, as Apobec-1 family members display potential to dC-deaminating DNA-mutative activity). Its function was connected with deamination impairment (lethal editing G-to-A hypermutation) of transcript/(retrotranscript) Vtf-protein HIV providing circumvention of innate intracellular anti-viral protection at the last stage of viral production and the most powerfully expressed in T-cells. In the presence of Apobec-3G Vif-protein was inactive and virus – noninfectious (Mangeat et al., 2003).

It was shown and confirmed that binding to mRNA ApoB (and some other RNA-substrates) Apobec-1 needed AU-enriched (to 70%) sites inside such RNA (Anant et al., 1995; Sowden et al., 1998). Au-enriched sites are formed of:

– so called minimal cassette (of 2.5-3 tens of nucleotides including the main editing site and sequences flanking it), which is sufficient for displaying site-specific editing effect including heterological RNA and in alternative sites – homological RNA;– containing in minimal cassette so-called critical anchor sequence of 11 nucleotides (UGАUCАGUАUА), which is directly connected with Apobec-1 and every its nucleotide is irreplaceable in terms of end editing effect in standard (canonical) site;– UGAU tandemly repeated motif formed by first four nucleotides of anchor sequence mRNA ApoB. This minimal critical motif is necessary at editing by additional sites in 5’- and 3’-directions (from the main site) of this RNA (Sowden et al., 1998). The frequency of UGAU tandem repetition near editing site in mRNA ApoB is ~ 8-

fold higher than in random distribution. Notably, the first three nucleotides from both ends of tandem repetition correspond to the stop-codon. On the contrary, decreased editing level particularly in cox-III gene of olea europaeal (superior plant) is associated with the presence of GC-component (Perrota et al., 1997). Inside carboxiterminal part Apobec-1 there is located leicin-rich site supposingly necessary for connecting and formation of homodimers or dimmers with other proteins; editing does not function without this site or weakens sharply, probably due to defective assembling of editing complex (MacGinnitie et al., 1995).

Recently it has been shown that immobilized on filters Apobec-1 links to saturating activity (Кd ~ 435 nM) with fragment mRNA ApoB of 105 nucleotides long. A higher affinity (Кd ~ 50 nM) was observed at connecting Apobec-1 with AU-rich fragments with UUUN(А/U)U-consensus by sequence RNA. The main such sequence was UUUGАU (the last four bases correspond to tandem repeating motif) and minor – UU, respectively after 3 and 16 nucleotides following the editing base. Previewed secondary structure indicated to location of such editing site at the open loop part (Anant, Davidson 2000). Secondary structure, double-strand RNA-stem, formed at the expense of cooperation of anchor and 5’- or 3’-spacer effective elements enhancing editing in vitro. Phylogenetic analysis of primary structure mRNA Apo-B in 32 animal species revealed minor differences in 31 and editing in vitro was not weak here. Only mRNA-substrate of guinea pig having 3 nucleotide variations (including U6743) in 3’-consensus element was edited weakly. These deviations probably led to expansion of dsRNA stem and decrease of editing effectiveness in C(6666), which is two nucleotides far from the open loop part. However introduction of single reverse mutation (U6743C) here was enough to returning to the initial editing level. Any mutation leading to stem expansion sharply decreased editing level (Hersberger et al., 1999). More effectively (and before export out of nucleus) there was edited exactly splising (in the site of 3-part motif 26 exone of 7.5 kb) mRNA ApoB; using RNA-reporter-construct it was shown that proximally and distantly located in relation to C(6666) splise-sites suppressed editing (Sowden, Smith 2001).

However the presence of just Apobec-1 enzyme for site-specific editing of corresponding RNA-substrate (mRNA ApoB and others) is insufficient. Editing complex besides Apobec-1 has to contain additional protein factors, in particular, present in intestines (enterocytes of thin intestines) and liver fractions of so-called S-100 extracts (MacGinnitie et al., 1995; Anant et al., 1995a; Hersberger, Innerarity 1998). With Apobec-1 in active editosome and through its J- and G/F-domains there links localizing in nucleus (preferably) and cytoplasm protein ABBP-2 (=DnaJ class II, = Hsp40-co-shaperon, homologue Hsp70-proteins) able to downregulate editing mRNA ApoB; protein links to Hsp70 (both are necessary components of editosome) and depending on endogene ATP, displays ATPase activity. This protein perhaps participates in subcellular distribution, shift of Apobec1 (at the expense of interaction with Hsp70) and unlike other additional proteins (ABBP1, ACF, GRY-RBP), does not contain RNA-recognizing motifs (Lau et al., 2001). Also as dominant negative editing inhibitor and heterodimerizing with Apobec-1 and ACF (perhaps involving other components of editosome choloferment), was widespread ARCD-1 protein (224 amino acids, 25 kD, chromosome 6p21.1; dose-dependent) – homologue Apobec-1 (and C-deaminase from E.coli), new cytidindeaminase with RNA-binding, but without CU catalizing (in vivo/in vitro editing) activity (Anant et al, 2001b). Obviously positive and negative regulation pre-existing protein editosome factors explained both increase of synthesis and editing mRNA ApoB in cell nuclei of rat liver in response to introduction of ethanol; RNA- and protein synthesis de novo was not necessary (Giangreco et al., 2001). Ethanol or insulin stimulation here increased levels of rat protein p66/ACF (by 93.5% - human homologue) and editing mRNA ApoB in nucleus heterochromatin (activity is connected with editosome 27S-complex; cytoplasmic 60S-complex was not active (Sowden et al., 2002).

Though the work in this direction started not long ago it is known that expression and overexpression of such factors presented at different ratios in every tissue not only effects the editing rate, but also the ability to include or exclude it completely. Interestingly, additional factors are found even in cells expressing neither Apobec-1 enzyme (RNA-dependent cytidindeaminase) nor mRNA ApoB-substrate. It is unclear if it means that additional factors from such cells really take part, at least mediated, in this type of editing. The excess of additional factors with preserving (but not complete elimination) of Apobec-1 level leads to enhancement of editing in embryonic and early post-natal period in rat. Similar enhancement of editing can be observed in conditions of specific hormone and diet regulation of rat life activity (Sowden et al., 1998; Lorentz et al., 1996).

Additional factors are necessary for editosome assembling due to which widely spread, but not everywhere such protein factors of complementation are sometimes called “adaptors of approach” of substrate RNA-matrix and Apobec-1 enzyme. Additional factors (proteins of 66 and 44 kDa of t.n. S100 fractions of liver extracts and of thin intestines of monkeys, rats and other animals) are able to connect not only with canonical RNA-substrate (mRNA ApoB), but also with different other mRNAs. They include mRNA luciferases, inhibitor of Nat-1 translation and even anti-sens RNA ApoB (Anant et al., 1995b); the reasons are not clear yet. Recently there have been obtained cDNA of a new protein factor ACF (nuclear apobec-1-complementation factor, 64.3 kDa) with three different unidentified RNA-recognizing motifs (RRMa; contribution to the connection is different), one of which, interestingly, was dsRNA-binding and similar to that in ADAR-enzymes (Maas et al., 2001). ACF connected with high affinity with ssRNA (but not dsRNA) sites of mRNA-substrate ApoB. Additional unique C-end domain was necessary for protein-protein (including factors) interactions and, what is unusual, only RRMs was not enough for connection with mRNA ApoB. Some amino acids in pre-RRM were required for complementary and editing activities but not for interaction with Apobec1, and deletion of RG-rich (from C-domain) site excluded both complementary activities and RNA- and Apobec1-binding features (Mehta, Driscoll 2002).

Mutagenesis of different ACF sites showed that RNA-binding, protein-protein interaction (with Apobec1) and RNA-editing are being charged for by different though partly overlapping (N-end – in relation to the first two types of interaction ) domains (Blanc et al., 2001). ACF together with Apobec-1 completely met necessary for editing mRNA Apo-B requirements in vitro. ACF-protein did not connect with RNA-substrate with impairment of anchor sequence, and immunological exhaustion of the factor by rat S-100 extracts led to elimination of editing. Complementation factor ACF widely expresses in tissues losing Apobec-1 and mRNA Apo-B and probably includes into other, different from editing and processing mRNA events (Mehta A., et al., 2000). For mRNA factor, which gene (~ 80 kDa) contains 15 exons (three of them are non-coding), it is characteristic tissue-specific splicing with generation of at least 9 different transcripts, up to 75-90% of which are functional (Hendersen et al., 2001). With ACF there links factor of multi-component editosome, GRY-RBP-protein (RNA-binding, preferably by AU-sites) and competitively inhibits both binding ACF (or the protein itself) to mRNA ApoB and to Apobec-1 (by its C-end), i.e. modifying transcript editing. Processing of hepatic rat cells with anti-sens oligonucleotide GRY-RBP increased editing of mRNA ApoB. The ACF-gene family member (clasterised with other Apobec1-binding proteins: with ACF, hnRNP-

R and ABBP-1) protein GRY-RBP (69.6 kDa) had 3 RNA-recognizing motifs, homologous to those in human ACF (Blanc et al., 2001; Lau et al., 2001). ApoB mRNA-binding protein, component of choloferment, CUGBP2 of 54 kDa had similar competitive inhibition modifying editing (Anant et al., 2001a).

Protein factors of liver of transgenic mice overexpressing Apobec-1 are absent in hepatomic cell lines McA and HepG2, respectively, mouse and human. Perhaps differences in editing by not main sites here are explained exactly by different cellular context in relation to additional protein factors in these systems (Sowden et al., 1998). Not only regulation of metabolism Apo-B, but also enhancement of editing mRNA ApoB in cell cultures McA7777, Caco-2 and FAO (2.5-8-fold) depended on increase of concentration of extracellular Ca+2 (Chen et al., 2000). Such modulating enhancement occurred in case of using inhibitors and activators of protein kinases, i.e. of modifying protein phosphorylation (Chen et al., 2001).

For study of the effect of overexpression of Apobec-1 on editing of the main (C6666) and additional sites (in 5’- and 3’-directions from the main site and anchor sequence) in mRNA ApoB there were used two main biological systems: first, - transgenic mice and rabbits with spontaneous (in vivo) overexpression of Apobec1. Overexpression was accompanied by enhancement of editing not only the main, but also additional (preferably in 3’-direction from the main), so-called hyperediting sites and appearance of hepatic cellular dysplasia and carcinoma (Yamanaka et al., 1996). Besides, second, there were used expressing invitro mRNA ApoB and additional factors (in quantities sufficient for editing of one site) of hepatic cell cultures (Sowden et al., 1998) of rat (МсА) and human (HepG2-Apobec) with overexpression of cDNA-transfected Apobec-1 different species (rat, rabbit, human).

The definition hyperediting is introduced to differ enhancement of editing in overexpression Apobec1 in animals by the main site from that for additional. At 90% additional sites were observed in 3’-direction from the main site in mRNA ApoB, mRNA of repressor Nat-1 translation and mRNA tyrosinekinase TEC-1 (Hersberger et al., 2003), though sometimes even moderate expression Apobec-1 led to appearance of hyperediting, that, unfortunately, limited possibilities of potential Apobec-1-mediated mono-genetherapy. It appeared that anchor sequence is absolutely necessary for editing of canonical site or that closest, but standartly located (i.e. of 4-6 nucleotides to anchor sequence) alternative site, near which it was introduced experimentally, but not for editing of additional sites. Moreover, mutations in anchor sequence mRNA ApoB significantly decreased normal editing, but unexpectedly increased editing of additional sites, thus such increase was called abberrative pathophysiological editing by multitude cytidin residues (Yamanaka et al., 1996; Yamanaka et al., 1997). If system is balanced by Apobec-1 and additional factors (fig.4), then anchor sequence is necessary and sufficient for editing of the main site. At the same time it is suggested that in hyper-editing besides additional protein factors some unidentified structural elements can play a role, anyway, as without them there are observed neither normal, nor hyperediting in mRNA proteins P1 and FAS FAS (Yamanaka et al., 1997). Not any cytidines undergo hyperediting , but preferably those, which are in AU-(far rarely in GC) surrounding.

Analysis of the results of editing in the condition of overexpression of Apobec-1 allowed to create a model of 2-step recognition. The first step is in a relatively free

recognition between mRNA ApoB and Apobec-1 and additional factors (or their complexes) in the conditions when anchor sequence is not required, but some unidentified (AU-enriched) structural elements are necessary. Such elements are contained in limited number of corresponding RNA-substrates, recognized out of tens thousands of others. First and dependent on additional factors step is necessary and sufficient for editing of multitude of additional sites (i.e. hyperediting). Interaction with unpaired anchor sequence is required for editing by specific site additionally (second step). Without anchor sequence there is found only hyperediting (Yamanaka et al., 1996).

Another type of abberative editing related not only to the main (or main and 3’-hyper-editing), but also simultaneously 5’-(preferably) and 3’-additional sites in the conditions of overexpression Apobec-1 in rat hepatocellular cultures (McA) and human (HepG2-Apobec), are called mixed, promiscuous (in fact joint in relation to the main and additional sites) editing. There is noted an individual frequency of editing of separate sites. Unlike hyperediting that in expression of corresponding RNA-substrate (mRNA Apob, mRNA repressor Nat-1 translation, etc.; expression level is not important) and the availability of Apobec-1 enzyme (expression level is important and the source of origin – not) requires only corresponding complementary additional factors, promiscuous editing depends also on anchor (anchor-like, if any available, like in Nat-1 translation repressor) and on tandemly repeating UGAU-repetitions located in 3’-part mRNA (Sowden et al., 1998).

Level of Apobec-1 expression here hardly determines new editing sites, but rather significantly enhances the editing rate of already formed main and additional sites (what is evident when comparing editing in McA and McA-Apobec hepatocellular lines). Cellular localization of overexpressed enzyme is the same (nucleus) at editing 5’- and 3’-sites that in other conditions are not recognized as additional. In rat hepatic cells (McA) there dominats 5’-, while in human hepatic cells (HepG2-Apobec) besides 5’- there is observed also effective 3’-joint editing. Ability to promiscuous editing was common for the sources Apobec-1 from rat, rabbit and human, and distribution and efficacy of the use of the sites in joint editing is determined by type-specific cellular differences by additional factors.

Deletion of anchor sequence functioning here as special promotor of editing excludes editing of the main site and significantly decreases but not exclude promiscuous editing. On the contrary, deletion 3’-tandemly repeating UGAU-repetition selectively decreased promiscuous, but left without changes editing of the main site. In the conditions of overexpression Apobec-1 there was observed domination of 3’-hyperediting in transgenic mice comparing with 5’-joint editing in hepatic cellular lines (Sowden et al., 1998). Synthetic mRNA ApoB or natural mRNA (as mRNA repressor Nat-1 translation) deprived of such repetitions in their 3’-part (in mRNA ApoB – these are 6695-6698 and 6703-6706 nucleotides) lost their ability to joint (i.e. 5’-preferably) editing in McA and HepG2-Apobec cells. Nevertheless after introduction/exclusion of UGAU-motif the question about switch from 5’-joint to 3’-hyper-editing in different systems is not considered automatically, as required and some other (additional) factors. Thus additional factors necessary for hyper-editing mRNA repressor Nat-1 translation and presenting in transgenic mice there lack in rat (McA) and human (HepG2) hepatic cultures. At the same

time the presence of UGAU-repetition (as for mRNA ApoB of hourse, cat, sheep) can be insufficient for joint editing in liver and thin intestines (Sowden et al., 1998) .

……………………………………………………..…………………………………………………….

4.1 ( C U)/(dC dU ) editing deamination of animal immunoglobulins

Not long ago there appeared dosens of works where the was shown a critical role of transcription initiation (pausing of “faltering” RNA-polymerase is often connected with RNA editing) in formation of somatic hypermutations (SHM) in molecules of immunoglobulins (Storb et al., 1998; Bachl, Ollson 1999; Winter, Gearhart 1998; Green et al., 1998) and other molecules, in particular in associated with apoptosis transcriptional factor bcl-6, but not in some of genes of “household” (Storb et al., 1998). Such dependence of appearing SHM without delay of transcription initiation, can be partly connected with RNA editing. RNA editing due to SHM in Var-(here point mutations)- and switch Sμ- (here more deletion)-sites IgM and due to CSR (class-switch recombinations) it was directly shown in some (over 1.5 tens) works and related CU deamination in AU-rich sites of transcripts of genes from activated B-cells from deficient by AID-enzyme of mice (Muramatsu et al., 2000; Muramatsu et al., 1999). Such editing is suggested precceeding regulation and catalysis of DNA-modifying step (there is coordinated interaction of RNA- and DNA-levels (Kinoshita, Honjo 2001), and may be associated with hyper-IgM syndrome (Fuleihan 2001); hypothetically possible link of RNA, RNA- and DNA-levels also presented in the work (Deichman, Choi, Baryshnikov, 2005). There was even created an artificial system, in which CSR immunoglobulins, under the effect of editing AID-cytidindeaminase, caused in fibroblasts (Okazaki et al., 2002). Normally repertoire AT in memory B-cells and naïve B-cells is different (by selective characteristics and high level of SHM in the first), and in deficient by AID-enzyme of patients – almost the same (Meffre et al., 2001). Mechanism SHM in germinate centers of B-cells is unknown, but for SHM/CSR – processes there is evident a key role of RNA editing Zn+2 – dependent AID-enzyme, and it is not excluded not only for RNA-level, but also in the relation to such following impairment dsDNA; which led to creation of hot point and supposedly error effect of DNA-polymerase (Jacobs, Bross 2001; Muramatsu et al., 1999).

Interestingly, critical hot point at SHM is considered mutatable DNA-nanomer GACTAGTAT, containing one of variants of hypermutable (including codons of termination, serin AGC, but not UCA, and others; mainly by G- and C-nucleotides inside CDRs-, but not FR-sites) motifs, RGYW- or inverted to it WRCY, where R=A/G, Y=C/T, and W=A/T and any changes , in which by an order there is decreased frequency SGM of both DNA-strands in productively and unproductively rearranged IgVk-genes and flanking them sequences (Foster et al., 1999; Liu et al., 1997). In shifting such nanomer to 100 nucleotides above initial position the frequency SGM also decreased by an order (Bachl et al., 1997). Connection of such DNA-nanomer with RNA editing seems probable enough, if it is noted that it almost completely (with its hexanucleotide ACTAGT part where first four nucleotides of hexanucleotide are complementary to tandem UGAU-repetition, determining part of anchor sequence, while the last four are themselves DNA-version of

that) is complementary to DNA-variant of anchor sequence of 11 nucleotides (UGAUCAGUAUA), necessary for activation of deaminase at CU transcript editing.

Supposed editing of newly synthesized transcripts of animal immunoglobulins (Ig) is considered to be linked with a new cytidin deaminase family member, homologue Apobec1, activation-inducing AID-deaminase (in human both genes are located in 12p13-chromosome). Activity of this protein (24 kDa) is connected simulateneously with CSR (region-specific class-switch DNA-recombination), SHMs (somatic hypermutation, two-staged) and gene conversion processes, while expression – stricktly with activated mature B-cells of germinative centers (GCs). So far little has been known about molecular mechanisms SHM and CSR, but in AID-defecient cells both processes (but not maturation of GCs) were excluded. Common for all three genetic processes providing diversity AT, most probably is DNA-cut mechanism, when temporary transitional secondary structure (stem, S, or stem/loop, S/L, easily are formed with inverted sequences) in S- or V- sites of Ig-gene, is recognized by cutting enzyme, regulated by RNA-editing AID-activity. After cut there are formed ssDNA-tails processed by having a tendency to errors DNA-polymerases (completing gaps) or exonuclease-mediated cut with the following correction or fixation of non-corresponding to the main enzymes of mismatch-reparation, and in case of CSR the ends will be ligased by one (NHEJ-), and in case of SHM – another ligasing system (Okazaki et al., 2003; Honjo et al., 2002).

CSR-function with participating AID required de novo protein synthesis necessary for RNA-editing and suppression of the synthesis by cycloheximid/puromicin blocked CSR; in this model there were used spleen B-cells of AID “-/-“-deficient mice, which were transfected with AID-ER-construct (enzyme/estrogen receptor) and expression of AID triggered by estrogen analogue, 4-hydroxi-tamoxifen, required not more than an hour (Doi et al., 2003). So far an idea has dominated that recognition and cut of DNA in 2 different, CSR and SHM, processes are mediated by similar or the same molecules, which participate in RNA editing; it concerns first of all AID-deaminase (Kinoshita, Honjo 2001).

Mutations in AID often causes impairment of B-cell differentiation and are the cause of HIGM2 development – autosomal recessive form of hyper-IgM-syndrom (Bross et al., 2002), connected with defect CD40-activating. Definition of relative frequency of AID-mutations {only 50 patients: 23-“with”(hyper-IgM-syndrom), and 27 “without” (i.e. with common variable immunodificency)-CD40-ligand-defect} revealed existence of at least 3 their types in 18 (including 14 Canadian French, 2 Indians, and brother/sister from Okinava) patients with hyper- IgM-syndrom (Minegishi et al., 2000). Second, more hard kind hyper-IgM-syndrom – rare inherited immunodeficiency X-mediated disease, connected with defective CD40-Ligand/CD40-interaction (disorder of signal way): defect exactly in CD40-Ligand-gene (there are attempts to correct it by genetical screen) causes simultaneous worsening of T-cell, B-differentiation and monocyte function (Fuliehan 2001). There was also found a link between regulated common serum IgE-level in atopic astma and polymorphism in gene AID (=AICDA) deaminase. Gene defect led to appearance of hyper-IgM-phenotype and loss of Ig(G,A,E) in mice and human (Japanese families). Screening of polymorphism in 5’-flanking and coding gene sites revealed three new (5923A/G, 7888C/T, 8578A/C) and 1 rare (R25C) variants of polymorphism, as well as 2 new (by RT-PCR) splis-variant AICDA, one of which lost all exon-4 (variant 1, 367

b.p.), and other (variant 2, 453 b.p.) – first 30 b.p. of this exon. In patogenetically developing atopic astma total level of serum IgE was most connected with disorders in underlined 7888C/T alleles of polymorphic AICDA-gene (Noguchi et al., 2001).

Most probably, that cutting enzyme is endonuclease (thoug activity of AID-deaminase is not excluded ); besides RNA-editing main function of AID-enzyme is considered to be dCdU DNA-editing (both strands) with following function of tending to errors polymerase activity (Diaz, Storb 2003). In relation to endonuclease there is supposed a scenario according to which AID-editing modifies unknown pre-mRNA, coding nicking-ferment, specific to S/L-structures, moreover AID connects neither with ds-Sμ, nor with ss-Sμ, or with core-Sμ sites (Honjo et al., 2002; Nagaoka et al., 2002).

Two different methods showed that AID-ferment can in vitro specifically deaminze cytidins in ssDNA; and under conditions of transcription – in dsDNA (including synthetic analogues characteristic for in vivo endogenic CSR-sites) with generation of transcription-oriented secondary structures, which were deaminated in ssDNA substrates (Chaundhary et al., 2003). Further deamination can stimulate suspended dsDNA-cuts, which are necessary for the following mutations, but not sufficient (Bross et al., 2002). Reparation of dsDNA is easier with Nijmegen-protein of damage syndrom (Nbs1) and phosphorilating H2A-histone (γ-H2AX=γ-H2afx; this deficiency in H2AX“-/-“ mice excluded CSR) inside CH-site of nuclear foci (cells of G1-stage), initiation of formation and localization of which, as well as induction of mutative Sμ-sites, is caused by AID-modifying above-located DNA-impairment, that preceeds CSR-initiation (Petersen et al., 2001). Nevertheless critical for generation of highly affinity antibodies and effective immune response molecular basis of SGM-mechanism, connected with including AID-ferment and specific molecules and ways of reparation, still remain weakly understandable (Papavasiliou, Schatz 2002).

Similar to AID, Apobec1 and its homologues Apobec3C and Apobec3G revealed potential possibility to trigger DNA-mutative dC-deaminsing inrelation to dC:dG bases) activity expressed in studying of artificial E.coli system, however each enzyme revealed differences in choosing specific local sequences-targets (Harris et al., 2002). After rearranging immunoglobulins variety of V-genes is supported by SHM-(prevailing point mutations)/(+ gene conversion)- , and C-sites – CSR-(large deletions in Sμ-site)-processes. All three mechanisms depend on AID-editing transitions and nucleotide context near dC:dG pairs in E.coli, though can be initiated by common DNA-damage as well (it is the first SHM step). Mutative characteristics of AID enhanced with the deficit of uracil-DNA-glycosilase (Petersen-Mahrt et al., 2002), mediating excision reparation (DNA-substrate model) of cut bases; alternatively (RNA-substrate model), AID similar to Apobec1 can function as RNA-editing enzyme. (Bross et al., 2002). In ectopic AID-expression in mouse NIH-3T3 fibroblst cells in artificial GFP-substrate there was achieved induction of hypermutation, which frequency and distribution were characteristic for SHMs (>90% - point mutations, mainly in V-genes, the rest – deletions/duplications) of immunoglobulins in B-cells. Frequency of mutations strongly correlated with the level of transcription of gene-target and the possibility for mutations confirmed the presence of necessary co-factors in fibroblasts (Yoshikawa et al., 2002). AID-induced CSR in fibroblasts (IgMIgG/E/A), as in endogenic CSR in B-cells, depended on transcription of S-sites. Up to 50-60% of all mutations were preferably

localised in complementary (RGYW)/(WRCY) inside hot points (damaged dsDNA then repaired) and critical cis-activating for SHM in V-sites Ig elements there were promotors and enhancers, but not rebuilt V(D)J-genes themselves (Bross et al., 2002; Jacobs, Bross 2001). Mutations in AID itself often led to eliminating both CSR and SHM (Lieber 2000).

…………………………………………………………………………………………………….

5. A I editing deamination in animals

In deamination of this species (fig.6) adenosine (A) transforms in inosine (I) that further, in replication and translation, is admitted as guanine (Gerber et al., 1997; Bass 1997). So in replication, particularly of RNA-viruses, associated not with the step deletion/insert, but with transforming (substitution conversion) AI deamination, nucleotide editing leads to change A:U for G:C pair in complementary strands, i.e. to AG transitions by main (editing) and to UC – on complementary strands. In translation there is observed change of sens of editing codons, but stop-codon is not formed, though it can transform in tryptophan and others. First inosine was shown in cytoplasmic tRNA, then in pre-mRNA and virus transcripts (Schaub, Keller 2002). A number of ADAR-family members of adenosindeaminases, active towards pre-mRNA, virus RNA, synthetic dsDNA form large multicomponent protein complexes. It is supposed that exactly large nuclear RNP-particles (lnRNP) containing 4 main splisesomal subunits and pre-mRNA-substrates are united with RNA-editing sypermolecular complex. Method of indirect immunopresipitation showed the link of site-selective editing enzyme of active deaminases (ADAR1/2) with protein splise-somal (Sm, SR) components inside lnRNP-particles (Raitskin et al., 2001).

Replication of RNA-virus of D type hepatitis is accompanied by integration in the cell genome of its minus-strand as RNA-intermediate. Editing change goes in plus-strand, where there is observed selective AI deamination (and in minus strand – secondary UC transition) and in translation there is observed appearance of tryptophan (instead of stop codon) and additional 19 amino acids in the elongated form of specific virus antigen.

After selective deamination translation of glutamin (different subunits GluR) and serotonin (5HT2) brain receptors (Lai et al., 1995; Burns et al., 1997; Lowe et al., 1997), necessary for rapid neurotransmission is accompanied by Glu/Arg and Arg/Glu substitutions (Bass 1997; Maas et al., 1996; Yang et al., 1997; Lai et al., 1997), leading to change of ion (in relation to Са+2, К+, NH4

+, etc.) penetrability (Bass 1997; Gerber et al., 1997; Maas et al., 1997; O’Connell et al., 1997; Koller et al., 1997) and some neurotic diseases (Mittas et al., 1997). In dorsal-root site of neurons in late-embryonic period and in newly-born rats penetrability of Ca2+ increased, then decreased in the first week of postnatal period, depending on the rate of posttranscriptional editing Gln/Arg-site in GluR5 receptor subunit of pore of Ca2+ channel (Lee et al., 2001). Effectiveness of editing of this site in subunit GluR5 and GluR6 of glutamin receptor of temporal area of cerebral cortex of epileptics (with drug-resistant form) was significantly higher than in control (Kortenbruck et al., 2001). Sharp increase of inflow of Ca2+ ions is a possible cause of selective death of cells of motoneurons of spinal marrow in amiotrophic lateral sclerosis

(ALS). Conductivity of Ca2+ in this is mediated by AMPA receptor (alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate), which is critically regulated by assembling GluR-2 subunit of glutamin receptor (hypothesis AMPA- mediated neurocyclisity in ALS ethiology). In its turn complete assembling of splising GluR2 subunit and normal level of Са+2 were determined by the absence of fall of editing level in Gln/Arg site (Takuma et al., 1999; Kawahara et al., 2003).

Transport AMPA receptor from endoplasmic reticulum (ER) to the surface of the cell played critical role in modulation of the force of synaptic signal, and retaining in ER depended on Arg607 at editing Gln/Arg site GluR2, complexating with GluR3, but not GluR1, while reversion to Gln caused increase of receptor expression on the neuron surface (Greger et al., 2002).// In GluR2-deficient mice there changed biophysical (including enhancement of Ca+2 penetrability to toxic level) and other features of native AMPA receptor; the mice, which lacked Gln/Arg editing in GluR2-subunit, died within 3 weeks after birth, but with damaged GluR2-gene lethality was not obligatory (Harvey et al., 2001). It is supposed that (Gln/Arg) RNA editing of AMPA receptor appeared with the division of Agnatha and Gnathostome but not later than the stage of cartilaginous fish. In animals arginin editing creates codon, which in Gln-codon containing species (hagfish and other vertebrates) is realised with a certain introne component; this component (already/still) is absent in Arg-codon containing organisms (Kung et al., 2001).

Low editing of Gln/Arg site in mRNA GluR2 of human brain is connected with progression of malignant gliomas (including the one combining with epileptic attacks); normally the site is edited at 100%. Simultaneously editing and alternative splising in 5HT2CR-transcript changed. ADAR-enzymes that are especially in abundance in the nerve system tissues, edited exone, introne, as well as 5’- and 3’-UTRs sites of transcripts, but deamination of specific transcripts required individual activity either ADAR1 or ADAR2 enzyme. In the whole, probably, editing is necessary not only for generation of codons variability, but also for support of the functions of RNA-transport and stability (Maas et al., 2001).

Decreasing basal activity and affinity with substrate, RNA-editing of various subunits of serotonin (5HT2C) receptor, having different drug sensitivity, played a modifying role in regulation and transmission of serotonin erginic signal in drug therapy (Herrick-Davis et al., 1999). There was noted a significant editing increase for A-site and characteristic combinations of five editing sites (А, В, С’=E, С and D) in pre-mRNA leading to the change of amino acid sequence (in second intracellular loop, etc.) of this receptor isolated from prefrontal cortex of patients with stable tendency to suicide (not regarding diagnosis), but not with schizophrenia or depressive disorders. In the follow up therapy with the use of hallucinogens (lisergin acid diethylamid) psychotropic agents it is necessary to consider the contribution or complications introduced by editing into generation of 5HT2C-receptors responsible for serotonin erginic effect: processing by anti-depressants (particularly Prozac) led to reverse of editing at each site to the alternative (Niswender et. al., 2001; Gurevich et al., 2002a).

Editing of sites C’ and C was serotonin-dependent and critical in decreasing of the effectiveness of serotonin erginic neurotransmission in activation by G-protein (Gurevich et al., 2002b). Editing isoforms of serotonin and melatonin receptors modulated cell proliferation and viability of skin cells (Slominski et al., 2003). Editing of three-five sites

(in codons Ile, Asi and Ile, respectively, in positions 156, 158 and 160), localized inside changing conformation (for energetically more beneficial space orientation of secondary structure) of secondary intracellular loop (IL2) of mRNA-duplex, and splising mRNA isoforms of serotonin 5-HT(2C)R-receptors were necessary for their effective interaction with intracellular loops (G-protein, etc.). This illustrates high sensitivity of surface system interactions to small structural changes of interacting components (Wang et al., 2000; Visiers et al., 2001). However, G-proteins interacted more effectively with non-edited 5-НТ(2С-INI)R receptor form expressed more at the drop of RNA-editing level of frontal lobe of cerebral cortex in patients with schizophrenia (P=0.001; the gene did not mutate), that as supposed, can be connected with the changed activity of editing deaminases (Sodhi et al., 2001). Receptor mediated activation of human G13-protein alpha-subunit (and other heterotrimeric G-proteins, molecular switches controlling numerous biological important processes) and preferable choice for intracellular signal ways changed at editing of 5-HT(2C)R with generation of a number of its forms (and deep functional consequences) from a single gene. Significance of post-transcriptional mechanisms increasing molecular variability became especially apparent after decoding human genome when there were found only about 30 thousand potential genes (Price et al., 2001).

To create conditions for AI editing of any double strand RNA structure (dsRNA) RNA-introne participation is required, part of which makes an invert repetition necessary for formation of end part of pin structure, while its other part complementarily interacts with preceeding exone in the editing site. Some such intrones, e.g. introne in pre-mRNA GluR-B receptor (site +60) of rat brain contains so called hot points. Thus (fig.7) both introne parts are necessary, which probably performs not only stuctural, but also a yet being discussed information role (Herbert 1996; Liu, Samuel 1999); the latter can be an important component in an unknown mechanism of formation of somatic hypermutations (SGM) in immunoglobulins (Deichman, Won Cheol, Baryshnikov 2005).

Besides common deaminases and dependent on single strand RNA (ssRNA, the role of dsRNA is being studied) expressed in most animal tissues cytidindeaminases, there is a family of dependent on double strand RNA, nuclear-encoded and simultaneously functioning in cytoplasm and nucleus. They were also found in practically all tissues in various eukaryotic species, from worms and frogs to rodents, bull and human (Maas et al., 1996; Liu et al., 1997; O’Connell et al., 1997; Lai et al., 1997; Maas et al., 1997; Bass 1997). Earlier some deaminases isolated from somatic animal cells were identified as enzymes (“denaturases”) with an unusual mechanism of unswinging RNA-duplex. The nature of specific dsRNA binding to helicases was different from that of AI editing adenodeaminases, as in the second case the reaction did not require triphosphates and two-valent ions (Nishikura, Kim 1993); perhaps this is connected with evolutionary more earlier formation of corresponding structures in the latter. The role of different helicases in RNA editing is being discussed (Seeburg 2000). Mutation of RNA-helicase of drosophila led to dramatic changes in transcripts splicing (in the editing region), which protein products support functioning of Na(+)-channels; the number of Na(+)-channels in mutant drosophilas dropped in the result of formation temperature-dependent block. In its turn AI editing of over 80% of helicase RNA-transcripts required a mechanism with participation of the secondary dsRNA-structure (Reenan et al., 2000).

Such dsRNA-dependent deaminases containing different number of binding dsRNA motifs can display two types of deamination (in vitro studies):

– a high percent non-selective deamination concerning about 50% of all mRNA adenosins. It is found directly or indirectly in corresponding cDNA at AG and UC transitions of complementary RNA-strands. Sometimes due to numerous sites such deamination is called hypermutative. It is Characteristic for completely complementary and rather long (over 50 base pairs) of dsRNA regions;

– and low percent (less than 10% of all adenosins) selectively editing deamination, characteristic for dsRNA formed by weakly complementary strands having as a rule non-standard pairs, protrusions, loops, single strand gaps or completely complementary but with shortened (less than 50 base pairs) fragments.

Enzyme selectivity changes from substrate to substrate and shows in such preferable deamination when 5’-neighbouring nucleotides (in declining mode) are A,U (probable target is AU-enriched region), rarely C (but not G), as well as in preferable avoiding of deamination by 3’-end nucleotides (Bass 1997). Substrate (not less than 15-20 b.p. of imperfect RNA-duplex, dsRNA) can be formed by virus plus and minus strands (in virus replication) firstly, minus strand (for viruses replicating via RNA-intermediate), and mRNA cells secondly, as well as complementary exon and intron sequences of processing cellular mRNA (Bass 1997; Melher et al., 1995).

Hypermutation (=hyperediting), i.e. high percent and unselective deamination of adenosins in mRNA so far has not been connected with any exactly defined biological microeffect (such as substitution of amino acid or appearing/disappearing of a stop codon). However it is supposed that there is a macroeffect of enhancement of persistent and lytic viral properties firstly, and initiation of triggering degradation of having become more available for nucleases nucleic sequences of somatic cells and therefore changes in nuclear export, secondly (Bass 1997). In the bull glioma cells the dsRNA-dependent AI deaminating editing causes multiple RNA-mutations (so-called hypermutations) in the contents of viral and cellular RNA (Chen et al., 1995). Within the family of dsRNA-dependent adenosin deaminases there are containing two R-motifs common with translation regulator interferon-inducible and RNA-dependent proteinkinase (PKR), and adenoviral RNA could inhibit both editing by such deaminases and intracellular translation (Liu et al., 1997; Lei et al., 1998). Susceptible to deaminases function dsRNA becomes more sensitive to ribonucleases function (Bass 1997). Hyperediting especially unusual long continuous dsRNA often associated with infectious DNA/RNA-viruses (which also were often edited) underwent cytoplasmic depletion at specific I:U and U:I (but not G:U or U:G) sites; did not deplete unmodified and even containing up to 4 consequently located I:U pairs already edited by dsRNA).

Thus deaminases with the provision of a number of strategies of cellular anti-virus protection used dsRNA for stimulation and uniquely hyperediting viral RNA-structures – as molecular targets (Scadden, Smith 2001a). Both AI editing (with the formation of I:U pairs) and the mechanism of short-term interfering RNA (meeting RNAi=siRNA), including short RNA, are competetively linked with the formation and degradation (under nucleases effect) dsRNA of different nature (cellular, viral) and potential anti-virus role in cells. However if dsRNA formation starts with the interaction with ADAR2-deaminase, the mechanism of interference is excluded and as editing enhances

(hyperediting) siRNA reproduction is progressively inhibited. Interfering RNA caused degradation of relative mRNA (Scadden, Smith 2001b), did not directly depend on deaminases but depended on initiating dsRNA, which formation sharply weakened in ADAR-deficient animals (Knight, Bass 2002).

DsRNA-dependent adenosin deaminases (such as dsRAD, DRADA, АDAR, etc.) are expressed in most animal tissues (in particular in rat these are tissues of liver, kidney, spleen, testicles, lymph nodes, NK- and T-cells, etc.), in transformed and tumor cell lines (especially from central and peripherral nervous system as well as HeLa, 3T3, etc. ). The studies carried out on Drosophila melanogaster, Bombyx mori and Caenorhabditis elegans showed intranuclear localisation of this enzyme gene in most somatic cells of adult animals (Herbert 1996). Substitution of А:U for I:U pair at АI deamination promotes creation of a more probable for selective, than for multiple editing of dsRNA conformation; dsRNA for editing was absolutely necessary and single strand RNA and DNA were not necessary. C-end of dsRNA-dependent adenosin deaminases has a region with structural homology with catalytic domain of common hydrolitic deaminases and includes Zn2+-coordinating site. N-end has a binding site with the located in Z-conformation DNA (fig. 8), affinity to which reaches subnanomolar values.

It is known that common hydrolictic adenosin deaminases (in different tissues – different ratio of different ADA-ferment isoforms) are key enzymes of metabolism regulation of purine nucleotides and nucleosides and disorders there lead mainly to severe combined immune deficiency of T-(preferably) and B-lymphocytes, arrest of RNA and DNA biosynthesis, as well as impairment of DNA structure and cell death. It is supposed that with adenosin and desoxiadenisin accumulation and ADA inhibition immunity deficiency can occur as a result of SAM (S-adenosilhomocystein) intracellular accumulation, which inhibits reactions of transmethylation of RNA and DNA. ADA is a cytosole and mainly membrane-bound enzyme expressed in all cell types and its expression level can differ in 1000 times and its highest activity was noted in the least mature T-lymphocites (Potapov, Khramtsova, 1993). Perhaps that as it is in case of common and ssRNA-dependent cytidindeaminases, in case of ADA and DRADA there can also be supposed existence of a similar link. Also it is supposed that there even exists a common precursor for deaminase family of both types: ADAR- and ADAT-enzymes (variations in structure of catalytic domains of which is connected with specificity, respectively, to mRNA and tRNA), as well as APOBEC-1 and cytidindeaminase E.coli (Herbert, Rich 2001; Сho et al., 2003).

Unlike the situation in vitro, in case of in vivo it is unclear if only deaminases enzyme function, or their complexes with additional proteins selectively limiting or on the contrary expanding the rate of dsRNA use as a substrate in deamination function as well. Tendency to dsRNA formation is characteristic for most pre-mRNA so a possibility for regulation by such deaminases editing arouses great interest in researchers (Herbert 1996; Herbert et al., 1995). However it turned out that besides pre-mRNA-substrates (at least of human brain and C.elegans; there was used the method of identification of inosin-containing RNA) ADAR-enzymes in dsRNA also edit introns non-translating and uncoded regions (including repeated elements), and to such extent that perhaps AI conversions in encoding sites are rather exceptions than a rule. Such dsRNA can have characteristic pin stem/loop secondsry structures (Morse et al., 2002).

Situation difference compared to cytidin deaminases is in the suggestion that substituted (CU conversion) editing is maily still connected with the specificity to primary RNA structure, while dsRNA-dependent adenosin deaminases interact with many dsRNA and contain three repetitions important for dsRNA-binding (Herbert 1996). Like cytidin deaminases AI editing deaminases contain zink-dependent and effecting proton transfer regions (Lai et al., 1995). Animal adenosin deaminases (particularly dsRAD, DRADA, ADAR) recognize transcription active in vivo DNA sites forming in the result of torsion tension and under the effect of advancing polymerase. This indicates the link with transcription and possible modulation of editing be Z-DNA. Resistant in vivo to negative supertwisting, Z-DNA as high-energy B-DNA confomer and DNA segment, is better formed in the GC-enriched regions, and, probably, it is located in 5 '-UTRs (non translating ends) genes where its connection with adenosin deaminases of the given type is formed; in its turn АI (≈G) enzyme act enhances the presence of GC-component.

Recognition of Z-DNA by deaminase ADAR1 and intron use in management of exones processing allows to edit newly synthesised RNA-transcripts up to splicing. And structural characteristics of Z-DNA-binding domain (spiral-turn-spiral) of enzyme show, that it can be compared with globular domain of proteins similar to histon Н5 (Herbert, Rich 1999). Besides ADAR1 tumor associated DML-1 protein specifically connected Z-DNA, that allowed to use both proteins (by photochemical and enzymatic procedures) as a specific tool for determination of local Z-DNA-structures in a cell (Oyoshi et al., 2003). Two enzyme forms are known: small ADAR1-S, and large ADAR1-L; ADAR1-L over 70 times more active than ADAR1-S form in case of substrate editing, which could be edited simultaneously in a nucleus and cytoplasm, and also at fast and effective cytoplasmic virus replication (translation was not obligatory). If the substrate was edited only in a nucleus, ADAR1-S the form was much more active. Besides an anti-virus role, ADAR1-L, probably, was responsible for editing of such mRNA, in which the editing site was preserved after processing (Wong et al., 2003). It is very interesting, that translation of ADAR1-enzyme is shown not in cytoplasm as it is usual, but in a nucleus (possibly on a nucleolar surface), and did not depend on editing; nuclear translation, however, decreased at point mutations inside dsRNA-connecting or С-end domains of enzyme (Herbert et al., 2002). Moreover, there appeared connected with nucleolar a constant dynamic association of moving ADAR-1/2-deaminases: expressed from alternative start - codons (in HeLa and COS7 cells) and cut down on containing a signal of nuclear export to the N-end, both enzyme forms were located exclusively in a nucleus, and were simultaneously accumulated in the nucleolar (in the new Photobleaching-compartment) - whence again could be moved to a nucleus and cytoplasm. In case of expression, editing - competent mRNA GluR-B, enzymes from nucleolar de-localised into the accumulation regions of transcripts (Desterro et al., 2003). Minimally editing there appeared to be a system containing a protein only with the catalytic domain ADAR1 and dsRNA-substrate of 15 nucleotide pairs and one mismatch-(A:C)-pair. Important for embryonic erythropoesis ADAR-1 enzyme as well as AI editing was found in all organisms from Caenorhabditis elegans to vertebrates and human (Seeburg et al., 2002), and in С.elegants was in most or in all cell of the nervous system end developing vulva, and both ADARs types had different roles but sometimes functioned together and were important for normal behavior (Tonkin et al., 2002).

The role of dsRNA-binding motifs (DSRBMs) ADAR1 in editing enhanced with the extention of the substrate length (GluR-B etc.), but they were not necessary for a minimal substrate. The absence of Z-DNA-binding motifs ADAR1 (which more actively connected with Z-DNA- than Z-RNA-substrate) did not cancel completely, while the presence (as well as 5’-additionally introduced pirimidines) enhanced editing and probably provided domination in editing of specific RNA-substrate sites reproduced by corresponding transcription active regions of Z-DNA. Additionally editing sites were clasterized on the complementary strand 11-15 pairs downstream the main one; editing beginning in the nucleus could continue after mRNA export into cytoplasm and some RNA were edited only in cytoplasm. Mechanism with the use of not only ancient catalytic domain (edited in relation to minimal substrate) but also DSRBMs and Z-DNA-binding motifs, supported enhancement and space-time control of editing of elongated substrates at the expence of association of specific transcriptional sites with the corresponding Z-DNA-region (Herbert, Rich 2001).

Specific Z-DNA binding with dsRNA-dependent adenosin deaminases, particularly with human ADAR1, is determined by Z-DNA-binding Zab domain located in N-end enzym part. This domain includes two motifs: Zalpha motif with high affinity to supertwisted cellular Z-DNA and even that of plasmids, which is included into more conservative core part of Zab domain of 77 (from 133 to 368) amino acids. Stechiometric interaction of Zalpha motif ADAR1 with double strand DNA/RNA chimeric (dCrG)-hexanucleotids (by method of crystallization and study of circular dichroism with the permission of 2.5 A) primarily formed right-turning A-conformation, which rapidly transformed into stable left-turning Z-conformation of the complex (Brown et al., 2002). The second motif, Zbeta, unlike Zalpha displays not highly specific conformation, but specificity to primary Z-DNA structure with increased GC-component contents. Both motifs are separated by divergence tandem repetition of 49 amino acids and both are necessary for supporting conformation and nucleotide specificity of interaction between Zab domain and Z-DNA. In the newly formed complex Zab domain becomes low sensitive to proteases (Kim et al., 1999; Schwartz et al., 1999). Recombinant with PKR (proteinkinase, regulator of translation) adenosin deaminase PKR-ADAR1 (both- interferon-inducible and dsRNA-binding enzymes, respectively with 2 and 3 dsRNA-binding motifs) in case on non impairment of the region between catalytic and RNA-binding domains was able to preserve editing in synthetic dsRNA to a high extent. However (PKR-ADAR1)-enzyme almost lost site-specific deamination in Glu/Arg and intron (+60) sites in pre-mRNA GluB-R and completely excepted the same at A-site in pre-mRNA 5HT(2C)R (Liu et al., 2000).

Human ADAR1, but not Xenopus had non-typical signal nuclear localisations (in N-end region; overlaped with the third dsRNA-binding domain) and characteristics of shuttle protein, capable to move between nucleus and cytoplasm, i.e. regulate nuclear import and export. Simultaneously regulation of nuclear concentration of enzyme (its accumulation here was transcriptionally dependent) prevented from hyperediting of structured nuclear RNA (Eckmann et al., 2001). With two promotors ADAR1 there is connected appearance of 2 enzyme forms: constitutional nuclear (cADAR10 and shuttle (nuclear-cytoplasmic) interferon-inducible (iADAR1) form, the expanded N-end part of it contains functional signal of nuclear export inside Z-DNA-binding domain (Poulsen et al.,

2001). Editing activity of shuttle form ADAR1 (towards Arg/Gly site in GluRB and A-site in 5НТ2СR) was inhibited at vaccination by viral interferon-resistant E3L-protein. ADAR1 contains three different domains: N-end Z-DNA-binding (with 2 Z-DNA-binding motifs), central dsRNA-binding (with 3 DSRBMs) and C-end AI editing. And E3L-protein (wild type) contains first two analogous domains and obviously inhibits editing, probably by its carboximal DSRBM-motif. At the same time disruption of this motif excluded such antagonism, and deletion of the whole Z-DNA-binding domain E3L-protein little effected inhibiting of editing (Liu et al., 2001). Hyperedited in nucleus inosin-specific oocyte dsRNA of Xenopus (cultured in HeLa-cell extracts) specifically and cooperatively were retained in the nucleus in multiprotein complex (containing inosin-specific RNA-binding protein p54-nrb, splice-factor PSB and structural protein of intranuclear matrix matrin-3), and were able to anchor in nuclear matrix allowing maintainance of preferable export of the nucleus of selective, but not random (unfunctional) editing mRNA (Zhang, Carmichael 2001). Also there were fixed simultaneously increase of concentration of intron-containing edited mRNA (5% of all adenosins) and the level of ADAR1 expression in T-lymphocites nad macrophages (in vitro stimulated by mediators TNF-α, Int-γ, etc.) at caused by endotoxin acute systemic inflammation in mice. Besides, RNA-editing was induced in Concovalin-A-activated spleenocytes, stimulated by IL-2 in vitro (Yang et al., 2003). In T-cells of patients with SLE-(systemic red lupus) there were shown ADAR1-mediated heterogenic (deletions, transitions, transversions) mutations of transcripts (frequency 1.22х10-3/b.p. that was 7.5 fold higher than in control) of regulatory RI-α subunit of proteinkinase-A (type-1), which expression dropped; there were determined 2 hot points but genomic mutations were not found. Controversely, expression level of deaminase with this autoimmune disease connected with dysfunction of immune-effector cells was higher in 3.5 times (Laxminarayana et al., 2002).

It was shown that when binding with the chromosome, deaminase ADAR1 Xenopus recognizes different adenosins of this substrate and has different necessary for specific connection with dsRNA (in the central part), Z-DNA-binding (in NH2-part) and catalytic (C-end) domains (Doyle, Jantsch 2003). Interestingly, that according to the results of the experiments with chimeric ADAR1(+/–)-heterozigotes of mouse embryos (dathly phenotype), it appeared that such defect was still critical to day 14, i.e. in the period not later than embryonic erythropoesis in liver (Wang et. al., 2000). Moreover, ADAR1 induced by interferon can play a significant role in pathogenesis of microvascular lung cell impairments (Rabinovici et al., 2001). Not only ADAR1, but also other IFN-inducible proteins (PKR, 2’-5’-oligoadenilatsynthesase OAS and RNase L, Mx-GTFase, inducible iNOS2-synthesase, proteins of MHC I and II) participate in cellular antiviral interferons’ effect, that prevents a whole-scale realization of multiple virus strategies in the virus/host interaction.The central role belongs here to dsRNA modeling protein phosphorylation and the following RNA-degradation (respectively, under the effect of PKR and 2’-5’- oligoadenilat-dependent RNase L) as well as ADAR1-mediated RNA-editing (Samuel 2001).

In case of rat ADAR2 mRNA alternative splicing at proximal editing 3’-acceptor site led to elongation of such mature transcript by 47 nucleotides, i.e. in fact to the regulated by enzyme editing (intron АААU) and modulation of own mRNA expression.

And AU- effectively imitated highly conservative AG-nucleotide, usually found at 3’-splising connecting sequences. Genomic DNA showed AA and AG dinucleotides, respectively, at proximal and distal 3’-acceptor sites (Rueter et al.,1999 ). RNA-binding domain (RBD) ADAR2 protected duplex region of RNA-substrate round editing site from hydrolytic depletion (but at the same time some nucleotides on non-editing strand near the site became hypersensitive). Connection with dsRNA required conformation changes in catalytic domain, supporting bigger availability for dissolvent with one out of five enzyme triptophans (Yi-Brunozzi et al., 2001).

Like ADAR1 for ADAR2 it is characteristic to have the same 5’-(A,U>С,G)-nucleotide, but other 3’-(U,G>С,А)-neighbour preferances; ADAR2 also has some trinucleotide (UАU, ААG, UАG, ААU) preferences. Like most dsRNA-binding proteins, both enzymes can connect with any dsRNA (cross specificity) but when connected deaminases edit definit adenosins more effectively than others. In all tested dsRNA human and frog ADAR1 showed similarity, deaminating the same adenosins (Lehmann, Bass 2000). ADAR2 deaminase more effectively than ADAR1 edited Gln/Arg and intron (+60)-sites in pre-mRNA GluR-B subunits and editing was more effective in tiple (homodimer ADAR2 + RNA-substrate) of the complex (Jaikaran et al., 2002). Notably, homodimerization of effectively editing enzymes (by method of affinity and eliminating column chromatography) also was necessary for ADAR3 members and cytidin family deaminases (Cho et al., 2003). For both deaminases there were shown 2 homologic regions: connecting dsRNA N-end and C-end domains. It is unclear how (inside 20 different substrates with 4 sites of editing) there are deaminated just definite adenosins, however domain is determined, that plays a dominant role in supporting substrate specificity. A:C pair was edited more effectively comparing with other (А:А, А:G, А:U) non-complementary pairs in editing site (Wong et al., 2001).……………………………………………………………………………………………………………………………………..

6. tRNA editing in various species

As well as for RNA as a whole, in tRNA now there are most frequently noted CU editing changes (deaminating conversion is more probable), and the majority of works on tRNA of far apart species concern mitochondria, and in relation to nucleus and chloroplasts there is even less information. The central role at editing is suggested for RNA molecules (including mRNA, gRNAs, etc.). Participating in various processes (translation, etc.) and quite often edited, tRNA molecules also play the important role for intracellular processes. tRNA molecules are called a treasury of the stereochemical information, and not less than 3.5 ten non-standard modified bases represent about 10 % of nucleotides of each (Zenger 1987). It is considered that tRNA editing is necessary for various processes: – for cutting тRNA from predecessors, i.e. maintenance of effective folding at processing and splicing in plant organelles (Kable et al., 1996; Marechal-Dronard et al., 1996a; Vogel et al., 1997); – for amplification clasterized nuclear tRNA-genes of animals (Beier et al., 1992);

– for regulation of expression of 3'-polyadenelysing in the region of mitochondrial mRNA-genes overlapping in birds and molluscs (Yokobori, Paabo 1997; Tomita et al., 1996; Yamazaki et al., 1997; Yokobori, Paabo 1997; Hatzoglou et al., 1995); – for strengthening the stability of connection between tRNA and acetelysed amino acid. Individual presence of each of 3 nucleotides, located in an angular part of L-shaped structure of various tRNA of unrelated species, was the most effective, and with participation of specific tRNA-synthesis maintained appropriate carrying of false activated Аа-tRNA to the hydrolysis place (Hale et al., 1997 was provided; Farrow et al., 1999); – for regulation of 3 '-end тRNA-processings.

In the latter case edited version of 3'-processing tRNA (Phe) of plants was cut easily, and not edited, and containing some non-standard nucleotide pairs in acceptor stem, the version of this molecule - was not cut. Comparison of plant nuclear 3’- processing tRNA enzyme with mitochondrial one confirms that both activities belong to various enzymes. Nevertheless RNAase-Z endonuclease (nuclear 3'- processing tRNA enzyme) effectively cut both - intron-containing nuclear and mitochondrial (in particular pre-tRNA gystidin) tRNA-precursors. RNAase-Z consists only from protein subunits, and after a cut leaves 5'-end phosphoril and 3'-end hydroxil; molecular weight of enzyme is about 122 kDa, it is stable in a wide range and most active at рН 8.4 and 35ºС (Mayer et al., 2000).

In mitochondrial tRNA of round worms besides postranscriptionally added aminoacceptional trinucleotide ССА one added nucleotide is fixed, i.e. inserted (Oкimoto et al., 1990), and in tRNAS in ameboid are also substituted (UА,G and АG) and other editing types (Lonergan, Gray 1993). There are found out new eukaryotic тRNA-specific adenodeaminases Таd1р and Таd2р/Таd3р, capable to modify adenosin А37 (А→I editing) in tRNA alanin, and also the first nucleotide of anticodon (А34) of several eukaryotic and bacterial tRNA. Deaminase Таd1р, unlike human ADAR (1,2) of deaminases, has no the domain connecting it with dsRNA, and, probably, is the evolutionary predecessor of these deaminases. On the contrary, deaminating domains ADAR (1,2) and Таd1р are very similar, and even are similar to analogous domains of cytidin and cytosin deaminases (Keller et al., 1999) from their ancient predecessors they, probably, also appeared (Gerber, Keller 2001). Recently there was identified the first animal тRNA-specific human ADAT1 adenosin deaminase (cloned and sequenced its unique gene), also responsible for А37I modification. This is a member of ADAR-family RNA-editing deaminases (about 30 kb), contains more than 9 exons, and codes proteins of 499 amino acids (Maas et al., 2000). tRNA-drosophila specific adenosin deaminase (dADAT1), as well as Таd1р, did not show activity in relation to dsRNA, but specifically deaminated adenosin (А37) in inosin in insect тRNA. dADAT1 gene was located in Аdh regions of drosophila chromosome 2, and showed a greater nucleotide similarity with animal ADARs, than with yeast homologue Таd1р - that confirms a hypothesis of ADARs and ADAT1 origin from a common progenitor (Keegan et al., 2000). ADAT2 and ADAT3 function as heterodimers, deaminating swinging position 34 in eukaryptic tRNA (Schaub, Keller 2002).

Various methylation types (on each of 4 nucleotides, on oxygen in 2'-OH ribose group etc.), characteristic for the majority of canonic tRNA, register as posttranscriptional change (Brule et al., 1998). Among the non-standard asparagin tRNA bases of marsupials there were found pseudouridin (ψ) before, and quosin (Q; in result of

GQ replacement) - after editing (Morl et al., 1995). Sometimes it is considered, that as a result of editing by some native mt-tRNA, in particular in plants, it is possible to avoid consequences of undesirable mutations and recombinations, leading to inactivation, or full loss of significant number of mRNA-genes inherited from endosimbiont-predecessor (Dietrich et al., 1996). As a whole inclusion of modified bases in tRNA is possible, testifies their possible former role in evolutionary dynamics of the whole universal (UGK) genetic code (Deichman, Choi, Baryshnikov 2005).

In animals and plants editing can sometimes include not all hundred, but only the certain percent of cytoplasmic and mitochondrial tRNA of the given species (Beier et al., 1992; Janke, Paabo 1993; Marechal-Dronard et al., 1996b). The same gene can code tRNA, specific more than to one codon - if nucleotide changes at editing concern the main anticodon bases (Borner et al., 1996). So, for example, it is shown, that imported (as well as all others tRNA) in mitochondria triptophan tRNA (CCА) of trypanosome L.tarentolae is exposed to specific C→U modification in the first anticodon position. It allows, except for own, to decode and UGА-stop codon as triptophan (UGG) - at compartmentalization of editing activity in kinetoplasts, but not in cytoplasm. Though all tRNA were imported, some of them preferably located in cytoplasm (tRNA-Gln, etc.), in mitochondria (tRNA-Ile, tRNA-Lys), or (tRNA-Trp, and tRNA-Val) - in both. For the first time there was shown a possibility of tioliration usually not modified U33 tRNA (Trp) L.tarentolae (Alfonzo et al., 1999; Kapuchos et al., 2000; Crain et al., 2002). All L.tarentolae mt-tRNA were coded by a nucleus (only here simultaneously are present both 5 ’-and 3 '-expanded precursors of various tRNA though subcellular distribution slightly contaminating fractions was not the same) and were imported in mitochondria from cytosol, and end processing preceded both to tRNA import and editing (Kapushos et al., 2000). There is found editing of the second anticodon basis in mt-tRNA of marsupials (Janke, Paabo 1993; Borner et al., 1996; Janke et al, 1994; Morl et al., 1995), in anticodon stem in ameboids (Barger et al., 1995; Marechal-Dronard et al., 1996а), in acceptor and D-stems in molluscs and ameboids (Tomita et al., 1996; Yamazaki et al., 1997; Lonergan, Gray 1993; Barger et al., 1995). And mt-tRNA of such different species as worms and human, had defective Т-, D-and variable loops (Oximoto et al., 1990; Helm et al., 1998).

Some mitochondrial tRNA-genes of gasteropod mollusc Pupa strigosa had unusual secondary structure with Т-and D-reduced stems, and many - unstable acceptor stems corrected by post transcriptional RNA-editing. Mitochondrial gene of a mollusc (14189 b.p.) is highly compact, contains genes of 13 proteins, 2 rRNA and 22 tRNA. Such contents of tRNA-genes is typical for animal mtDNA. Mitochondrial genoms of this mollusc and having lungs ground snail have common features: extremely small genome size, absence of the long not coding sequences, the reduced size of overlapped and similarly located genes. At the same time the arrangement of genes in some other molluscs varies (Kurabayashi, Ueshima 2000). Finally in micsomicet Physarum polycephalum tRNA (a mucous mould) individual C, or C and U inserts at one - two sites were observed in anticodon, aminoacceptor stalks, and in pseudouridin loop (Miller et al., 1993).

Due to editing in acceptor parts of plant mt-tRNA (Marchfelder et al., 1996), of mushrooms (Laforest et al., 1997), molluscs, etc. (Yamazaki et al., 1997), there are quite often eliminated non-complementary pairs such as C:А (Marechal-Dronard et al., 1996а, b) though as a condition of effective RNA-folding in plants there was preservation of such

C:А and C:U pair discrepancies in tRNA (Schok et al., 1998). Editing in acceptor tRNA part, conducting to leading to the appearance of trinucleotid equivalent anticodon, can be important for interaction with corresponding synthesase. Replacement C→U in position 4 of acceptor tRNA-Phe stalk (GАА) of mitochondria of beans, a potatoes and Oenothera led to correction of defective C:А pairings, to increase in stability of secondary structure of acceptor tRNA stalk, and to recognizing simplification by related Aа-tRNA-synthesase. Similarly C→U replacement in mt-tRNA (Phe) of dicotyledonous plants corrected complementary pairing (C:А→U:А) bases in acceptor, and for tRNA-Gis of a larch it concerned also dihydrouridil (DHU) and anticodon stalks edited by pre-tRNA (Fey et al., 2001). In potato tRNA-Cys (GCA) editing provides C28:U42→U28:U42 transformations of not canonic pairs, and in moss (M.polymorpha) this U28 is already coded by genome, and editing for the subsequent its isomerisation in pseudouridin is not required (Fey et al., 2002). In the other case as for tRNA-Cys(GCА) Oenothera, on the contrary, the same replacement, but already in anticodon stalk, led to occurrence of unsteady G:U pairs. For linkage with tRNA, and also with poly-U, poly-АU, but not poly-G,-C, or – and-A, there competes Apobec1-catalitic subunit of nuclear anima citidindeaminase (Anant et al., 1995b), and additional protein factors of complementation strengthened such linkage (Anant et al., 1995a). In some animal tRNA, as well as in RNA-intron of plant mitochondria, there contain edited pirimidine residues (Benne 1993).

New type of 3 '-end RNA-editing is found in mt-tRNA of multilegs (arthropoda Lithobius forficatus): here only 1 (trnaQ) from 22 tRNA-genes codes full pairing in aminoacceptor stem (that is necessary for tRNA-processing and recognizing by corresponding synthesase). At the same time in other tRNA-genes there contains some (1-5) discrepancies, and the neighbouring tRNA-genes in clasters are widely overlapped, and 5'-end acceptor sites can carry out a role of a matrix for synthesis of 3 '-ends de novo (in eight tRNA here were edited 28 nucleotides, 22 formed canonical pairs in 3 '-end acceptor stalk, and 6 - at other positions) - it is possible with participation RNA-dependent RNA-polymerase (RdRp). Origin of RdRp can be connected to viruses (for example in mushroom mitochondria Ophiostoma nova-ulmi), with mitochondrial genomes (homologous gene is in mt Arabidopsis thaliana), and nuclear genomes of various eukaryots; The tRNA data were not imported from cytosol and had unusual secondary structures and number of base pairs in acceptor and anticodon stalks (Lavrov et al., 2000). In total here it was revealed four various of tRNA-editing type: СU conversion, a С/U-insert, matrix-dependent editing of first three nucleotides at 5'-ends tRNA, and matrix-independent editing at 3 '-ends; and all four were found in mitochondria. Alternative editing (polyadenilising and C-inserts) here, unlike that of tRNA of some other animals, did not lead to correction of discrepancies in acceptor stalk; i.e. it is probable, that each product of various editing systems includes controlof both individual nucleotide (addition / reparation), and the whole CCА-end. For animal mt-tRNA processing of 3 '-ends preceded editing (in plants on the contrary). Unusual secondary structures concerned: strongly changes or deleted Т-, D-, both V-loops and stalks of tRNA (necessary for recognition by processing enzymes 5 ’-and 3 '-ends tRNA), atypical number of nucleotide pairs in акцепторном a stalk (i.e. 8 or 6 instead of 7; it is important for formation for initiatone and elongator tRNA), and rare not canonical pairs (Т:Т) and structures (Т:Т + camber) in anticodon stalk (Lavrov et al., 2000).

Let's notice, that processing of 5 '-ends tRNA with participation of Rnase P - is similar in all organisms, while generation of the maturing 3 '-ends - more complex and variable step on a way to functional molecules tRNA: in bacteria it is the multistep process which is carried out by endo-and exonucleases, and in the majority of eukaryots - single-step, connected with endonuclease elimination of 3 '-trailer part, and addition of trailer aminoacceptor CCА-stem (with participation of nucleotidiltransferase, which homologues are in organisms of all three kingdoms). In animal mitochondria many genes code tRNA-genes cut on 3 '-ends which are functionally restored more likely not specialized, but reparating editing (Schurer et al., 2001).

It is interesting, that electrophoretic mobility completely necessary for U-insert/deletion editing in trypanosome molecules gRNA was little different from those for cytoplasmic tRNA. Originally gRNAs were not identified as independent fraction. Notably, that trypanosome kinetoplasts, including maxi-and minirings, and unlike mitochondria of supreme eukaryots, do not contain tRNA-genes; RNA-products here are coded by a nucleus and imported inside organelles (Simpson et al., 1993; Alfonzo et al., 1999). Constant selective transport from clasters, but not the single genes nuclear-coded tRNA in trypanosome L.tarentolae mitochondria was shown, and the computer analysis showed absence of additional U-editing (Lye et al., 1993). In potato 11 tRNA, necessary for synthesis of proteins in mitochondria, are coded by a nucleus - and it is possible, it is typical for mitochondria of many supreme plants. Moreover some tRNA-genes in mitochondria of supreme plants were transcribed from inserts of plastide DNA. In this connection it is supposed, that some own mitochondrial tRNA-genes turn to pseudogenes - however initial tRNA-genes of mitochondria are always own ones (Yurin, Odintsov 1998). There was observed insignificant import of tRNA aspargin in mitochondria from cytosol of transgenic plants, expressing yeast aspartat-tRNA-synthesase, and mutations in tRNA limited import and recognition by synthesase, which affinity to tRNA in this case fell. Interaction of tRNA with synthesase though also is necessary, but was insufficient (Dietrich et al., 1996). As highly possible event there is assumed transport in mitochondria for similar edited tRNA: protozoa Acantamoeba castellanii, 13 from 16 which tRNA-genes are edited (Barger et al., 1995), and inferior mushroom Spizellomyces punctatus in which 5 of 8 тРНК-genes were edited (Laforest et al., 1997). Export of various eukaryotic tRNA from a nucleus in cytoplasm is mediated by protein exportin-t, which connects directly, with high affinity, and, preferably, with processed tRNA. Maturing tRNA in a nucleus went before export, and concerned: separately 3 ’-and 5 ’- ends, in some cases splicing, and also post transcriptional additions (editing) 3'-CCА acceptor leg, and separate modified nucleotides. In absence of splicing tRNA, exportin-t could connect containing intron unsplicing form; connecting, this protein recognized the common for prokaryotic and eukaryotic tRNA conservative sequences. Critical for linkage with exportin-t protein were: tRNA-(and tRNA-like) structure, correctly processed 3 ’-and 5 '-ends, and ТрsiC loop (Lipowsky et al., 1999). For lost anticodon loop mt-tRNA lysin of marsupials there is supposed replacement on similar tRNA by export from a nucleus (Janke et al., 1997). It is not excluded there is transfer of tRNA-genes from plasts (corn, rice) in a nucleus and mitochondria with subsequent their fragmentation(Visomirski-Robic 1995; Nakazono et al., 1996; Vogel et al., 1997).

Though there is a point of view (Henze, Martin 2001), that such transfer for evolutionary time between oraganelles, first of all from chloroplasts and mitochondria into a nucleus, could demand RNA-fragments of chromosomes DNA-, cDNA intermediaries, and, even, the whole chromosomes organelles, alternatively, it is possible to assume and another idea - i.e. transfer of very small fragments of genes, with the subsequent correction of each separate such fragment, and their assembly in the whole genes. However such approach, except for attraction of already available mechanisms, also demands development new (probably fundamental) mechanisms, and, that is problematic, can suppose existence of rather complex multistage steps – multi-stepping [see (Deichman, Cheol, Baryshnikov 2005)]. Search for direct transfer and the subsequent fastening of the whole native big nucleotide fragments in genome most likely is capable to find some (however, always important) exceptions firstly, and to promote gathering of the information outside of a positive field secondly. In particular it concerns detection of mitochondrial sequence (with 99 % homology, i.e. this is rather recent moving) in the antisense orientation inside transcribing, but not functionally preceeding nuclear V-ATPase-B gene of rice (Kubo et al., 2001). Clone cDNA*21 of this gene was with a number of stop-codons, 5-th instead of 14 introns, and indicating to duplications by repeating exons and introns. In this sequence there are 3'-part of gene rps19 and 5'-part of gene rps3. As here was not fixed RNA-editing, and introns group II were preserved, there was rather used DNA-intermediate. The given gene was attributed to the category capable to transcription and splicing of pseudogenes, and transfer - to unsuccessful event though, it is possible, that actually there was fixed only instant shot of a long proceeding dynamic evolutionary process of formation of a gene with new structurally functional features.

Mt-tRNA editing of lysin marsupials (11 species) was not observed, probably, because of import of nuclear-coded and affinity to tRNA cytosol mitochondria; earlier such import was shown for plants, yeast and protozoa. And for animals there was shown import of others structural RNA - endoribonuclease subunit RNase MRP, 5S rRNA, RNase P, etc. - and also many nuclear-coded proteins (Dorner et al., 2001). Mt-tRNA (Lys) here differed by highly unusual primary and secondary structures (frequently reduced or changed): (1) anticodon was presented by standard UUU and not canonical UCU, the ACA and АUА triplets; (2) by the structure of DHU-part and separate nucleotides; (3) by 3'-terminations containing up to 11 variously alternating additional A and C residues, reminding short poly-A tails and signals of RNA degradation, i.e. products of quickly evolving pseudogenes, which, it is possible, could accept more functional and ordered for translation tRNA-structure; (4) there was constant only acceptor stalk containing 6-7 nucleotide pairs, probably used in punctuation of released neighbor СОII-ATP8-transcripts. However mt-tRNA editing for marsupials is known: it was shown, that tRNA (Asp) was formed in result of СU conversion on the second position in tRNA(Gly) anticodon. In some species import problem is connected with the fact that (1) import occurs on a background of available own functional tRNA-genes (yeast), and (2) unknown functional abilities of intramitochondrial Аа-tRNA-synthase (marsupials). At the same time, it is possible , synthases on occassion can perform only transport, in structure of a complex, functions (yeast), and in some cases (human) one synthase is responsible for amino acylising simultaneously of cytoplasmic and mitochondrial tRNA (Dorner et al., 2001).

It is supposed that editing of three mt-tRNA (they have not coupled first three nucleotides), and import of 13 or 16 missing nuclear-coded tRNA in Hyaloraphidium curvatum mitochondria (according to modern molecular data a species is referred to the inferior mushrooms though earlier was considered pale-green algae). Linear mt-gene (chromosome in 29.97 kbp) contains genes of 14 known mt-proteins, big and small rRNA, and 3 ORFs; also the inverted repetitions (1.43 kbp), and rare for mushroom mitochondria (but not green seaweed and protists) genomic architecture with fragmented mt-rRNA are shown. It is interesting, that sequences, highly homologic to intron-2 mt-cox2-gene of this species, are found in nuclear intron of monocotyledonous plants - that supposes transfer of II group introns for repeated their use in formation of splicosomal intron (Forget et. al., 2002).

Maturase (matK) in intron structure of lysin tRNA of barley chloroplasts was edited in such a manner that provided necessary at splicing predecessor folding (Vogel et al., 1997). It is interesting, that in mushrooms and animals having as a rule 22-24 of tRNA-gene in mitochondria (Kuzmin, Zaytseva 1986), there suggest existence of a common endosymbiotic precursor. However phylogenesis of this long ago diverged kingdoms built from nuclear and mitochondrial rRNA here, did not coincide (Paquin et al., 1997). By present time it has not been proved, that life is connected with unique universal (UGC) genetic code, and all found between species homology - with extremely vertical (in a number of generations) way of transfer and fastening of genetic information (Deichman, Cheol, Baryshnikov 2005). Therefore any modern phylogeneses (but preserved nucleinic acids of hundred millions, billions years of age has not been found), built on these or those nowadays existing sequences (perhaps except for some ones built on viruses), can reflect ratio between organisms only within the framework of a modern UGC-code firstly. And, secondly, without taking into account a possible role of processes connected not only with vertical, but also the horizontal transfer especially dominating as they consider (Woese 1981; Woese 2000), in early-evolution epoch (monocelled and earlier).

…………………………………………………………..…………………………………………………………………….

7. RNA editing in plant chloroplasts and mitochondria

Unlike editing in mitochondria of other kingdoms, where for RNA of various nature (mRNA, pre-mRNA, tRNA, rRNA) there were already observed different editing types (including C→U, but not А→I conversion; U-inserts (more often)/deletions (less often); and also rare C-, U-, or UU-, GU-, CU-, GА-inserts, and rare А→G, U→А, G, GG→АА, C, U, G → And, Pur→Pyr replacements), in plant chloroplasts and mitochondria (but not in nucleus) so far there has been observed almost exclusively CU (much less often UC) type of editing, characteristic, however, and for nuclear-coded sequences in animals (Sugiura 1995; Yurchenko 1999; Gott et al., 1993; Vokobori, Paabo 1995; Tomita et al., 1996; Laforest et al., 1997).

Characteristic feature of plant cells is simultaneous presence of 3 genomes: nuclear, chloroplast and mitochondrial. Chloroplast and mitochondria are semi-

autonomous organelles, containing necessary for expression genes attributes. Products of these genes are usually included in formation of big uniform complexes with nuclear-coded proteins, and expression of 3 genomes is modulated by complex regulatory processes, which can be various at photosynthesizing and not photosynthesizing tissues (Douce, Neuburger 1989). Many published data describe structure and the organization of plant organelle genomes, including full chloroplast genomes of tobacco, rice, and Marchantia polymorpha - and mitochondrial genom, etc. Much enough information on transcription and processing of transcripts in chloroplasts has been collected; much less is known about mitochondrial transcripts of plants, though as a whole it is quickly developing area, and there are some data on biochemistry of transcription, RNA-polymerases, factors of transcription, RNA stability and maturing, cytoplasmatic male sterility (CMS) and organelle evolution , though as a whole biochemistry of RNA editing in plant cell organelles practically is not investigated. In some cases absence of editing can conduct to obtaining plants with a mutant phenotype, or phenotype CMS. More detailed description of process of RNA editing in cellular plant organelles can be found in the review (Odintsova, Yurina 2000).

Organelles possess a significant number of common features: presence of mono-and multicystron RNA transcripts, some genes are faltering, and mature transcripts are formed by cys- or a trans-splicing. Homologous genes in various species are very conservative, i.e. significant homology is preserved in their primary structures (Grienenberger 1993). The further complication in understanding of processes in plant cells began with the discovery in vitro RNA editing (C→U, and rare U→C conversion) in mitochondria (Covello et al., 1989; Gualberto et al., 1989), and then in chloroplasts (Hoch et al., 1991; Kudla et al., 1992), but not in a nucleus. In animals the given type of conversion is shown for nuclear-coded and expressed in many tissues apolipoprotein-B.

In plants mitochondria there are genes where the genetic code with a deviation from universal is used. So in protein product сох-2 of corn gene (and unlike its mitochondrial analogue in yeast and bull) tryptophan position corresponded not only to canonical UGG, but also CGG-codon of arginin (Fox et al., 1981). Distinctions at sequences of сох-3 gene and its cDNA transcripts in Oenothera have been considered an artefact (Heisel, Brennicke 1987). Further, however, it became clear, that C→U conversion really occur (Covello, Gray 1989; Gualberto et al., 1989; Lamattina et al., 1989). In other genes, and in other plants use of CGG codon also (but not at 100 %) has been connected to a deviation from a universal code, though, as in case of string beans mitochondria (Marechal et al., 1987), it has been shown, that there is only one tRNA, and one gene of tryptopan tRNA in genome, and that editing in plant mitochondria is a widespread phenomenon. At the same time editing was not revealed in mitochondria of green seaweed Chlamydomonas reinhardtii where near to rRNA gene there were found gene ND1 (subunit-1 of respiratory NADN-dehydrogenase) and a gene of reverse transcriptase-like protein (Boer, Gray 1988), and in liverwort M.polymorpha, (Oda et al., 1992; Ohyama et al., 1991). Received in the result of recombination chimeric Turf-13 gene of corn Т-line with male sterility was not edited - probably due to the excess of fragments, homologic to structural 26S rRNA (Dewey et al., 1986), which in plants mitochondria (except for

Oenothera), is not usually edited. In case of Oenothera 26S rRNA there were revealed 2 sites of editing (C→U and U→C); the close distance between them (only 4 nucleotide pairs) supposes a possibility of transmutation. At the same time sequences 5S and 18S of rRNA here strictly corresponded to their genes. From almost five hundred of edited Oenothera sites in a соb-gene less than one percent corresponded to U→C, and all others - C→U conversion. However here again, (as, however, in several cases as well) existence of U→C conversion was not an artefact (Schuster et al., 1990). So far there have been described only four cases of U→C transformations in supreme plants. It concerns mitochondrial genes сох3 of wheat, соb and сох2 of Oenothera and сох2 of peas. Editing many times prevailed in coding region. The idea of a very insignificant (less than 4 %) editing of translated genes outside of coding region is not clear, but the result is supposed to be increase in transcript stability and enhancement of its connection with ribosome (Grienenberger 1993). In non coding parts of mitochondrial transcripts, as well as in intergenic sites of jointly transcribed genes there are few editing sites, and intron sequences of some transcripts undergo both cis-, and trans-splicing - that, probably, is important for their correct folding. Editing of mitochondrial transcripts of supreme plants is very widespread (more than 1000 cases known), and concerns all truly mitochondrial protein - coding genes. However frequency of RNA editing is gene specific: thus the product of nad5 gene has 5.5 sites, and orf206 (which product participates in citochrome-c protein biogenesis) - 67.5 sites for 1000 base pairs. In protein - coding nuclein sequences there are usually observed equal distribution of editing sites, though in regard to exons of mitochondrial genes nad4 and nad5 of wheat it not true. Editing of three arginin codons (in orf575 and one in orf240) in transcripts of two participating in biogenesis citochrome-c genes led to tryptophan codons appearance, and restored consensus protein sequences, apparently necessary for connecting with the gene (Odintsova, Yurina 2000).

Containing class II mitochondrial introns, transcripts of some genes (сох2, nad1, nad2, nad4, nad5) undergo cis- or trans-splicing. Splicing is effected by preceding and, probably, critical for folding correction, C→U conversion (Michel et al., 1989). Then the secondary structure of complementary interacting several domains (EBS1, EBS2) of intron (in particular - at сох2 of wheat and corn gene), and exon (IBS1, IBS2) is modified. Obviously, it results in formation of dsRNA with several pendulous G:U, instead of complementary G:C pairs, similar to that observed for tRNA, rRNA and pre-mRNA (Grienenberger 1993). Ability to editing, as in case of wheat mitochondria lysates, depends on Mg2+ ions , protease activity and increased temperature. The decrease of temperature led to downregulation of expression, intron splicing and RNA-editing of transcripts of wheat cox2-gene (Kurihara-Yonemoto, Handa 2001). Sequences of 3'-sites (not core-structures) of some introns of group II inside mt-genes nad1 and nad7 of floral plants unexpectedly revealed a higher than usual for these introns divergence; domains 5 and 6 here had weaker spiral structure, which stability, however, grew at (А:C) → (А:U) RNA-editing transformations. For introns of group II plant - specific variations of nucleotides at the RNA-level were bigerg (Carrillo et al., 2001), than at the DNA-level (up to 11 nucleotides in different species).

Some mitochondrial genes (cox3, nad4, atp9, orf156 in wheat, etc.) are edited only completely, whereas others (cox2, nad3, rps12 and rps13 of Oenothera and wheat, etc.) reveal usually only partial editing. On 13 sites (widly), and with formation of stop-codon

there is partly edited transcript of mt-gene of succinatedehydrogenase subunit (sdh4, co-transcribed with a cox3-gene completely edited on 14 sites in sequence of 1.1-4.4 thousand bases long.) of potato, Solanum tuberosum L. (Siqueira et al., 2002). Thus one part of sites of each transcript is exposed to C→U conversion (from 0 up to 100 %), and other part - keeps C without change (Grienenberger 1993). Because of unfinished processing and various localization of initiation codon (etc.), transcription in supreme plants in mitochondria proceeds as a highly complicated process accompanied by multitude of RNA molecules (transcripts of one gene) of various sizes (Mulligan et al., 1991). There is a correlation between frequency of this multiple incompletely processed RNA and partly edited sequences. Spliced mature transcripts usually appear edited completely, and prevailing incompletely processed transcripts (as intron containing сох2 genes in Petunia and Мaize) - partly edited. It is considered that only completely edited transcripts start unique sequences of protein (Gualberto et al., 1991). Editing direction in partly edited pre-RNA is substantially casual, i.e. without obviously strict 3'→5' orientation characteristic for U-inserts/deletions in trypanosomes, but in a clear parallel with processes of maturation and splicing (Grienenberger 1993). The analysis of distribution of editing sites of co-transcribed nad3-rps12 genes of wheat has shown, that polarity in RNA editing is absent. RNA editing generated occurrence edited completely, partly, and not edited forms of transcripts of mt-RPS12-gene (at Petunia, etc.) - that is shown by interaction of their protein products with corresponding antibodies. Comparison of editing efficiency of mitochondrial genome, identical in several Petunia species, has allowed suggesting influence of different nuclear background responsible for reproduction of the factor, supervising transcripts stability. Thus it is considered, that mitochondrial plant genes, which transcripts are edited partly, can code more than one protein product - i.e. to form here so-called protein RNA polymorphism (Lu et al., 1996). One of CMS phenotypes was received on transgenic tobacco lines producing protein, translated with not edited mRNA of atp9 gene. At such translation a protein is formed, which differs by seven positions from the true one consisting of 74 amino acids. Probably the competition between true and modified proteins induces synthesis of chimeric АТPases, loss of ability to form АТP and the CMS phenotype (Hernould et al., 1992). Partly edited transcripts not only accumulate in polysomal RNA mitochondria, but also are transclated. Abberant products of translation can degrade and not form functional mitochondrial complexes. It was shown that only edited products for АТP-synthase and NADP•Н-dehydrogenase complexes, though polysomal fractions contain also partly edited mRNA (Lu, Hanson 1994; Mulligan, Maliga 1998) are accumulated. RNA editing was investigated for homologic sequences in cut chimeric ОRF77 (located in the neighbouring site with ОRF355) and atp9 mt-genes of corn with S-type of CMS, accompanied by a pollen development collapse of the unknown mechanism (Gallagher et al., 2002). Transcripts of atp9 gene were edited completely, and in ОRF77-transcripts corresponding nucleotides either were not edited, or were edited inefficiently because of the differences in flanking sequences; unexpected trailer editing in ОRF77 led to truncation of protein before appearing of 17-amino acid peptide (ОRF17). In mitochondrial genome of floral plant Arabidopsis thaliana, there were observed in mRNA only 456 C→U (not U→C) editing sites: 441 in several ОRF, 8 in introns, 7 in

leading sequences. Editing was not found in any rRNA and several tRNA. Frequency of individual codons editing in coding regions altered from 0 up to 19 %. Some less used codons were edited on first two nucleotids, and significant selection of nucleotids in the neighboring with the edited site was not found. As a whole mRNA-editing here raised hydrophobility of coded mitochondrial proteins (Geige, Brennicke 1999).

In 86 % of C→U editing there is a change of amino acids in structure of coded plant mitochondrial proteins. In 49 % out of them the changes concern the first codon nucleotids, in 30 % - the second, and 7 % concern preservation, actually a reconstruction from Pro (CCU), conservative Leu (UUR) and Phe (UUN) at double CC→UU conversion. In addition 14% of nucleotide changes concern the third (silent) codon nucleotide , and have no phenotype characteristic. We shall notice, however, that unlike C→U replacements, in case of Pur↔Pyr replacements always (in double codon families, subfamilies), and in case of А↔G - twice, it cannot be fair concerning the third codons nucleotide. Initiating codon (in particular for сох2 gene of wheat, corn, peas, etc.), as a rule, is formed from codon Tre (АCG) →Met (АUG), and stop-codons - from 2 codons Gln (CАG→UАG, CАА→UАА) and codon Arg (CGА→UGА). Also due to editing there is formed initiating (nad1 gene) and terminating (for atp9 and rps1 genes) codons of wheat mitochondria, and the most changes concern coding region. Editing resulting from C→U (usually individual) transitions in plant mitochondria is characterized as the mechanism of correction, leading to so-called preservation of conservative amino acids of protein sequences - that is especially notable in comparison of genes of various species with homologic genes of non vegetative organisms. Thus not only a problem of use of mitochondrial genetic code in plants is perhaps solved, but also post- transcriptional preservation of functionally important conservative amino acids. At the same time RNA editing at nonconservative positions of protein molecules can be an indicator of species-specific distinctions and roles of amino acids as those, for example, that are important for interaction of various subunits of respiratory circuit complexes (Grienenberger 1993).

RNA editing was found in mitochondria of all investigated species of angiosperms and gymnosperms. Editing was not found in representatives of Chlorophyta - green seaweed and multicellular red seaweed. Among representatives of Pteridophyta (ferns) and Bryophyta (mosses) RNA editing in mitochondria was revealed not in all species. So for Bryophyta editing of nad5 mt-gene was found in 7 thalline species, 30 species of mosses, leaf liverwort and 2 Ceratophyllum. It is interesting, that in Ceratophyllum U→C replacements were frequently found, and in leaf liverwort Jungermanniidae about 6 % of all codons were edited. Simultaneously in both organelles RNA editing was absent in 7 species of complex liverwort (Marchantiidae). Replacements U→C in mitochondria of evolutionary earlier ferns are found much more often, than in superior plants (Odintsova, Yurina 2000).

For chloroplasts of many species of superior and inferior plants there are known complete nucleinic sequences of their ring genomes which organization includes inversions, inverted repetitions, and also identified and non- identified reading frames, which nucleotide sequences contain homologic conservative sites. For creation of initiating codon in expressed chloroplast genoms of superior plants also there is used C→U conversion mechanism when АCG (Tre) codon, contained in genes rps12 (rр12) of

corn, ndhD and psbL (subunit of photosystem-2) of tobacco, it is modified in initiating АUG (Met) codon. In some species in the given position treonin codon is replaced by АUG codon and editing it is not required any more (Hoch et al., 1991; Grienenberger 1993; Tsudzuki et al., 2001). The same kind of editing, with efficiency of 20 %, in plastid rps14-transcript of moss (Physcomitrella patens) created initiating (АUG) codon, confirming a possibilty of strong dependence of regulation of protein translation (here mRNA rps14) on RNA editing (Miyata et al., 2002). It is supposed, that C↔U conversion mechanism can lead to modification of secondary structures (stem/loop), in particular in 5'-UTRs regions of ndhG-transcript, and to influence on gene expression. Besides inside small ОRF (of 12 codons) from intergenic (ndhI/ndhG) regions there can be restored conservative codons (Drescher et al., 2002).

Comparison of highly conservative sequences of homologic genes, in particular having 4 sites of editing ndhA and nad1 genes of various plants, has shown, firstly, that internal codons are edited as well. Secondly, in products of these genes there appear highly conservative for many species leucin (UUА, UUG) and phenylalanin (UUC). Thus as a result of mRNA editing the degree of interspecific conservatism of some sites of protein sequences increases, that, it is probable, essential for maintenance of structure/function of peptides, coded by genome ndhA. Frequency of sites of editing in not translated sites of chloroplast transcripts is much lower, than in those coding amino acid sequence. And it is early to speak about absence of editing of introns in transcripts of plastom genes since it has been found only for 5 of 18 introns in genes rpl2, rps16, ndhA and ycf3 (Odintsova, Yurina 2000).

Characteristic feature of Ceratophyllum (Anthoceros formosae) is that in more than half of cases of editing of 52 protein - coding genes and seven ORFs of chloroplasts sense codons are restored from nonsense - codons U→C, and 5 initiating and 3 terminating codons – by C→U editing. Only 509 C→U and 433 U→C conversions are fixed in 68 genes and 8 ОRFs of chloroplasts; one C→U modification is determined for tRNA, and none - for rRNA; but interintron processing, obviously, was preceded by RNA editing of intron sequence, complementary to the editing site, probably, there was a distant sequence with cis-recognizing elements (Kugita et al., 2003a; Kugita et al., 2003b).

Vegetative photosynthetic mutants of tobacco ( etc.) are characterized by reduction of growth, falling of the contents and increase in fluorescence of chlorophyll, and also by the loss of editing by transcript of psbF gene, which phenylalanin codon is present in the same position, as in that of edited serin codon of spinach with a normal phenotype (Bock et al., 1994). In spinach and tobacco psbF gene is identical to 100 %, but editing machine is active for transcripts only in spinach chloroplasts; loss of editing led to a mutant phenotype with decrease in growth, chlorophyll contents, organelle high fluorescence, but without complete loss of function (Sasaki et al., 2001). The same mutant phenotype in Chlamydomonas reinhardii appeared, presumably, after artificial introduction of prolin codon (which is characteristic for petB-gene of corn), and because of defective assembly of apocitochrome cb6f, connected with absence of editing of Pro204Leu(CCА→CUА), and appearance, there of, of the block of electron transfer and absence of photosynthesising activity. At the same time in corn and tobacco (superior plants), such editing that is interesting from the evolutionary point of view, proceeds already spontaneously (Zito et al., 1997; Sasaki et al., 2001).

Though conditions of light and growth phase influence the degree of silence of an editing site (Hirose et al., 1996), light- inducing processes directly did not effect as determinants of revealing editing sites in cytochrome b 559 genes (psbF) and polypeptide-L photosystem-ΙΙ (psb-L) of spinach chloroplasts. However there was observed reduction of editing in seeds and roots in comparison with leaves (Bock et al., 1993). Editing of ycf-3 gene of various corn tissues also directly did not depend on conditions of light and a stage of growth, but in leaves there were observed two, and in other parts only one partly edited site - that led, respectively, to use of spliced and to accumulation of not spliced transcripts (Ruf, Kossel 1997). For ndhB-transcripts of corn plastids there was noted similar lowered C→U editing in roots (8 %), calloused thickening (callus: 1 %), in tissue-cultivated cells, and 100 % intact - for green leaves plastids. Totally in transcripts of 15 genes of plastids there were revealed 27 sites, editing efficiency of many of which reached 80-100 % and did not depend on the development stage. Editing rate of single sites did not correlate with the level of transcription - that corresponds to the model of individual site - specific trans activating factors of editing. In the whole, it is considered, that in angiosperms editing in plastids provides rather correction of subvital mutations, than generation of protein variability (Peeters, Hanson 2002). Editing on two sites of one of three genes necessary for light independent synthesis of chlorophyll in seaweed, inferior plants and gymnosperms, allowed to preserve functionally important Leu (CCG→CUG) and Try (CGG→UGG) in protein product of chlorophyll-B gene of pine Pinus Sylvestris at C→U conversion, respectively, codons Pro and Arg (Karpinska et al., 1997). In chloroplasts of black pine editing of new codons was revealed, namely GCA(Ala) →GUA(Val), CGG(Arg)→UGG(Try) and CАА(Gln)→UАА(Term), on the first and second positions of nucleotides. To the models of co-evolution of cis-activating elements of an edited site and coded by a nucleus trans-activating protein factors (in 56 kDa for psbE-, and in 70 kDa for and petB-transcripts) in superior plants (tobacco, peas), there also correspond performed in vivo/vitro biochemical studies connected with C→U conversion in transcripts. Thus, absence of editing sites was combined with loss of corresponding factors and their genetic modification (Miyamoto et al., 2002). Probably, even, that the same, specific towards some sites trans-factor (mainly - concerning 30 ones of 5'-located from C-site nucleotides; the role is not excluded and for 10 ones of 3'-nucleotides), function simultaneously in case of various (rpoB-and ndhF-) transcripts in both organelles of angiosperms (experiments were performed with participation of intact and transgenic plants). However there were revealed not consensus cis-activating sequences, but containing single conservative nucleotides of claster groups (Chateigner-Boutin, Hanson 2002). For such clasters (in experiments overexpressed transgens were used), containing 2-5 sites in 5'-direction from the site in tobacco plastid transcripts, there is suggested existence of the claster-specific trans-factors present in smaller concentration in roots (where restrictions are observed in editing of some sites and in efficient editing of start-codon in ndhD-transcript), than in green leaves (Chateigner-Boutin, Hanson 2003).

For the first time switching editing conversion (C→U) of a separate site-III (for ndhB-transcript NAD(P) H-subunit of chloroplast dehydrogenase gene), strongly dependent (1) on active photosynthesis (i.e. in absence of photosynthesis the site was not edited, and otherwise, and with intact photosynthesis machinery, it was edited completely),

and also on (2) light-dependent stages of plant development. One gene by means of mRNA-editing controled qualitative production of two proteins, one of them was serin-(not editing)-, and the second leucin-(editing)-containing, respectively, in absence (early dark morphogenesis), and in conditions (photomorphogenesis) photosynthesis. Together with rare U→C editing such changes at high specific sites are usually called reparation mechanism restoring at the level of transcripts conservative amino acids. It is supposed, that it could be caused either by direct inclusion of photosynthetic electronic transport, or mediated by indirect action of photosynthesis products (ferredoxin, NAD(P)Н2, АТP, molecular О2, sugars). Also redox-regulation of site-specific trans-activating nuclear factor is not excluded as well as action of the proton gradient providing proteins inclusion in tilakoid membranes. Such regulation of gene expression could provide primary selective advantage in fixing and further spread of RNA-editing in cellular organelles. And the given connection between photosynthesis, light-inducing stage of chloroplast development and RNA-editing is called unexpected (Karcher, Bock 2002а) though it is in the context of investigated processes, and, moreover, can include also genetic-code-forming processes (Deichman, Cheol, Baryshnikov 2005).

Temperature conditions also effected the degree of RNA editing in chloroplasts of superior plants (corn, etc.). Thus for mRNA rps14 and rpl20 genes editing quickly fell from 100 % to 30 % with the change of temperature from 20 to 37 degrees C, and was stabilized at the level of 40 % for 2 hours; however at returning to initial temperature the increase of editing level required much more time. The level of transcription raised in 5-10 times with temperature shift from 20 to 37 degrees in comparison with initial conditions of growth at 20 degrees - that, probably, led to such kinetic imbalance, at which the editing machine appeared unable to process excess of transcripts and performed only incomplete editing (Nakajima, Mulligan 2001). For plastid ndhB transcript of tobacco sensitivity to temperature increase (up to 37ºС, and further to 42ºС) appeared to be greater concerning steps of the subsequent processing (including: inhibition, and also partial at one, and site-specific editing at three sites RNA editing; significant blocking of splicing of group II introns at 42ºС; and maturation of 5’- and 3'-ends), than the transcription. The majority of dynamically functioning protein factors of processing are still unknown, but damage of this process contributed to delay of plant growth (Karcher, Bock 2002b).

As a rule, editing in plastids is found sometimes in the first position, practically never in the third, and, more often, in the second codon position. Most frequently codon UCА(Ser)→UUА(Leu) is edited and transition АC(UCА)→АU (UCА), and GCN→GUN are not found at all. The fact that in chloproplasts mainly the second, and, sometimes, the first (but not the third) codon positions are exposed to editing, was interpreted as connected with a possible participation of translation mechanism in this process. We shall notice, however, that if process of editing has any biological sense, avoiding of editing of the third position is justified, since C→U transition usually does not lead to change of codon sense at translation, and, hence, is functionally ineffective. At the same time such transition is not nonsense in case of rare occurrence of some related codons which presence, possibly, is dynamically restored by editing for the evolutionary period. On the contrary primary C→U change of the second nucleotide always, and the first almost always (except for CUG→UUG and CUА→UUА leucin codon pairs ) is justified

if the missense-mutation at RNA level corresponds to the biological purpose of RNA editing. Concerning coherence of editing with translation it is clear that this process influences final protein transcript expression. However editing of not translated sites firstly, and preservation of editing in ribosome- deficient white sites plastids of mutant barley albostrians secondly, proves, that editing in chloroplasts unequivocally does not depend on plastom ribosomes. In such plastoms albostrians rpoB gene (on three sites, as well as in wild type) and initiating codon of rpl2 gene are edited. Transcript of rpl2 gene was not completely spliced, though substantially (to 60-70 %) was edited; ribosomal protein L2 was not synthesized - because of that, most likely, functionally active ribosomes were not formed. Thus it is the most probable, that necessary for editing peptide components are coded by nuclear genes and go in organelles from cytoplasm (Odintsova, Yurina 2000). Also it is impossible to exclude possibility of participation in editing of some membrane-bound components of the organelle.

Editing of various sites was independent, and C→U mutation before editing site in containing intron gene NADH-dehydrogenase (subunit ndhB) of tobacco chlotoplasts reduced editing (Bock et al., 1997). Many factors of inclusion in selective sites recognition are not known, but among them there are of not plastid origin, and also common and different for chloroplasts and mitochondria (Bock, Koop 1997). Exogenically introduced in rpoВ subunit of corn chloroplast RNA-polymerase gene, C→U the site of editing spatially interfered with editing of a closely located endogenic tobacco site, and competed for transfactor (Reed, Hanson 1997). Probably, RNA editing, at least in part, is included in regulation of RNA-polymerase activity in chloroplasts. Thus for 11 genes of tobacco chloroplasts, as shown by cDNA analysis, 69 potentially edited sites are determined - and 31 of them are really shown. There has not been revealed a unique consensus sequence. Editing in mRNA of polymerase rpoA here restored conservative leucin which, as shown earlier, is important for activation of α-subunit transcription of E.coli RNA-polymerase. This site was edited in partly, and the degree of editing depended on conditions of growth and development of the plant (Hirose et al., 1999).

In corn chloroplasts there were revealed 25-26 functioning C→U sites at 13-14, and in closely related cereal (rice) 21 sites of editing in 11 transcripts of various genes; only 8 sites of editing between species were not common. Editing was excluded for those 7 sites, which genetically already coded Т, and in one case, for transcript of rpoB-gene (codon 206), conservative mRNA editing мРНК was not observed in rice - that, probably, is connected to the greater selectivity of separate sites. Total number of editing sites, calculated on a small number of genes in plastoms of rice, tobacco, and black pine (in pine the majority of sites were "new") was approximately the same, i.e. 25-30, that corresponds to ~ 0.13 % codons. But editing of structural RNA (rRNA and tRNA) here, unlike mitochondria, where totally there are determined up to 1000 (!) sites corresponding to 3-5 % codons, was not revealed. From total protein-coding genes (70) and several additional conservative ОRFs their most part (about 80%) does not require editing for mRNA preservation. Thus in plastids editing is found much less often, than in mitochondria, and causes only «thin (but necessary) adjustment» of genetic information, containing in nucleotide chloroplast DNA sequence (Odintsova, Yurina 2000; Corneille et al., 2000). For the first time it is shown (biochemically/molecular-biologically, in vitro/vivo), that for synthesis of fat acids in chloroplasts of peas and corn functionally

active acetyl-КоА-carboxilase is necessary (key ACCase, a accD-gene; it is procaryote-like homologue of multifunctional polypeptide), consisting of biotin-carboxilase and biotin (protein-carrier), and carboxiltransferase (CT). In its turn functional СТ-enzyme consists of nuclear-coded α-polypeptide, and chloroplast-coded membrane (as well as majority of proteins coded by organelle, for example RBPC – ribulosobiphospate carboxilase, RNA-polymerase, АТP-dependent-protease) β-polypeptide. One nucleotide in serin codon of mRNA β-polypeptide is edited with transformation in leucin. Related viable plants (four species), not having such critical Leu, undergo similar editing with formation of functional ACCases. By present RNA editing in chloroplasts is referred to widespread events of processing (as, for example, for ndh-A/B/D-genes of tobacco, respectively to 2, 9, and 2 sites of editing), promoting formation of stop /start- and sense codons (Sasaki et al., 2001). For plastid transcripts three tobacco species (N.tabacum - a product of crossing, N.sylvestris-mother, N.tomen-tosiformis-father), having respectively 34, 33 and 32 editing sites, 31 of which are conservative, there is shown С→U conversion, and marked distinctions concerned only ndhB/D-transcripts. Transcript ndhB on sites 7 and 8, divided by 5 nucleotides, was edited in first two tobacco species, and the third species did not edit site 8; also in first two, but not in the last, tobacco species, and with formation of АUG-start codon, there was edited the first site of ndhD-transcript. The mentioned differences are connected with differences in mechanisms of translation initiation with participation of not identical trans-factors. Some partly edited (from 4 to 6 - in green leaves) sites can represent some evolutionary intermediants, connected with the process of loss of editing (Sasaki et al., 2003).

Translation of ndhD subunit of NADH-dehydrogenase gene of tobacco chloroplasts required cutting and its transcript editing, and of two initiating АUG-codons there was used not initial, but the one received as a result of editing. An obstacle for translation of two not connected genes - NADН-dehydrogenase (ndhD subunit) and photosystem-1 (psaC) polypeptide of unique dicistrone operon - was interaction of eight complementary nucleotides of both genes (Hirose, Sugiura 1997). Editing in mRNA of psbL and ndhB hp-genes of superior plants (tobacco, etc.) in vitro (C→U conversion at ~ 30 sites) required participation of combination of common RNA-binding and site-specific trans-activating protein factors (shown by mutational analysis). These factors interacted with overlying transcripst cis-elements, and for psbL-gene mRNA it was immunologically identified protein of 25 kDa (ср31), required for editing on a number of sites (Hirose, Sugiura 2001). To cis-activating elements in relation to С→U editing site of II chimeric tobacco rpoB-minigene, which transgenic sequences here contained factually not edited and homologic not on all sites of chloroplast sequence of black pine, those sequences referred that were located in the region «-20 up to +6 » position from the site, however around С-site there was not revealed unique consensus-sequence in dicotyledons. Unexpectedly the change in position "-20" had the highest inhibiting effect on editing (Reed et al., 2001a).

Such chimeric minigene containing 27 nucleotides (including U-site-containing) was edited to 20 %, and, unlike that of 97 nucleotides, did not inhibit editing of endogenous rpoB-transcript – probably due to low affinity, concentration and various competition of edited or not transcripts for trans-activating factors. However U-site-containing ndhF transgene unexpectedly reduced editing of the same endogenous

transcript to the same degree as C-site-containing transcript, i.e. the C-site itself was not a critical target, recognized by trans-activating factors (Reed et al., 2001b). Though works on nucleotide replacement as a result of editing in chloroplasts are reported more slowly, than for mitochondrial and nuclear sequences of various species, the fact that in vegetative organelles there are found only C→U (less often U→C in the inferior, but not superior plants) transitions, however, do not contradict the present understanding about evolutionary advance of the genetic information in the direction from chloroplasts - to mitochondria and nucleus, but not to the opposite (Yurina, Odintsov a1998). The reasons of this surprising phenomenon can be connected with that it is Energy-Ray-Flow-(=ERF)-recognizing structures and organelles (chloroplasts, like-ones.), possibly, are both as forming itself genetic (UGC) code, as and variety within its frames (Deichman, Cheol, Baryshnikov 2005; Deichman 1993).

Editing character of the same genes (e.g. chlB in coniferous; ndhB - in barley, rice, tobacco, corn) in chloroplasts of closely related plants revealed significant interspecies variability. At the same time the surprising phylogenetic paradox is in the fact that editing sites reveal more similarities between distant, but not closely related species. Species-specific divergence is most strongly expressed among closely related cereals. Therefore per se presence/absence of editing sites cannot serve as criterion for an estimation of phylogenetic affinity between organisms. Thus frequency of occurrence and character of editing cannot correlate with phylogenetic position of an organism. Nevertheless presence of common motives of nucleinic sequences in transcripts of homologic and even non-homologic genes supposes that common components and/or mechanisms participate in editing systems of both plant organelles. And simultaneous absence of editing mechanism in both chloroplasts and mitochondria (concerning some genes) liverwort Marchantia also strengthens this assumption (Odintsova, Yurina 2000).

Nuclear and plastid genomes of plants form co-evolving units, which in interspecies combinations are not always compatible even for closely connected taxons (e.g. for Atropa-Nicotiana cybrids). Contribution to species formation (with intriquing fast reproductive isolation) and nuclear-plastid incompatibility here first of all was made by: (1) regulating elements (promotors, signal elements of translation and replication), (2) high-conservative intron-containing genes (distinctions here prevailed in regions with low functional importance), and (3) unequal RNA-editotypes (Schmitz-Linneweber et al., 2002b). Evolution of the whole eukaryotic genome depends on rearrangement and co-evolution of compartmentalised in cellular organelles and nucleus of plant genetic informatio, i.e. at endosimbiotic species formation (including cybrids, hybrids, as well as those of closly related species) with participation of at least three cellular (protocellular?!) systems, and, it is possible, horizontal transfer of genes (their parts?!), transcription, and raising editing potential of post-transcriptional processes, also responsible for genome/plastom incompatibility/integrity of organelles of different taxonomic origin at alloploidy

Such events are compatible with fundamental changes in expression of signal molecules, and concern all levels of complete system (Herrmann et al., 2003). Notably, at allotetraploidy (in vivo; connected with species formation) sometimes species-specific splicing-dependent site editing is possible, in particular from a short fragment of ndhA gene of spinach chloroplasts surrounded by heterological tobacco nuclear sequences,

dependent on the expression of nuclear-coded trans-factors. Thus only exon-exon merging products were edited, and intron-containing ones were not processed, probably, because of breaking of determining cis-elements. (Schmitz-Linneweber et al., 2001a).

In mitochondria and chloroplasts of RNA-editing systems, probably, co-evolve

(Grienenberger 1993), since for RNA-codons of transcripts of homologic (or functionally equivalent) genes of both organelles there is observed similar type of RNA editing – conversions leading to appearance of specific amino acids and signals, and for protein products of these genes – preservation of conservative amino acids. In particular, in genes of ndhA chloroplasts and subunit nad1 of corn mitochondria, there is preserved highly conservative leucin, preserved, however, also in genes animal and mushroom mitochondria.

Among mechanisms of conversion in organelles the preference is given to С→U editing deamination under citidindeaminase function (similar to that observed in apolipoprotein B mRNA as well), and U→C editing amination under АТP-dependent CTR-synthesase function – or similar enzyme as it is supposed for U→C conversion in RNA-genome of HDV as well (Taylor et al., 1992). With two mechanisms, which also do not require change of succharophosphate skeleton (i.e. without preliminary damage of the RNA-chain), but connected with transformation of the base – pyrimidin replacement similar to that known for DNA reparation (Olsen et al., 1989), and replacement in tRNA at transglycosilation (Bjork et al., 1987) – less hopes are connected. It is not excluded that one more probable mechanism proceeding with change of saccharo-phosphatic RNA skeleton (Blum et al., 1990), requiring cut suture (i.e. consecutive deletion C and insert U), and similar to that, which uses small cis-activating RNA – similar gRNAs, used in trypanosome. The analysis of experimental data available by present allows to think, that deamination - the most simple and probable mechanism though the real ratio of these mechanisms is unknown. Search for the mechanism of deletion/insert type, probably, would be more intensive if, as in case of trypanosome, existence of gRNA-like structures as transfactor was shown here, though for animal adenosindeaminases presence directing antisense exon-intron pin structures and deamination were shown, but the type of the mechanism deletion/insert - was not. As a whole, however, it is considered, unlikely that nucleotide changes occur as a result of conversion by more than one mechanism. And the use of the same gRNAs for homologic genes in both organelles is considered very improbable (Grienenberger 1993).

It is supposed, that editing site recognition does not depend on secondary RNA structure, and it is determined by its primary structure (Williams et al., 1998). Such conclusion was made in the analysis of changes in editing character of sequences of corn mitochondrial genes rps12 and rps12b. Gene rps12b during evolution, probably, appeared in the result of recombinations of ribosomal protein S12 gene with intron-1 of protein S3 (rps3) gene and the site of S1-like plasmid sequence in 2.3 t.p.n. Mechanism of such theoretically possible recombination was not-shown/not-proved, and, it is possible, and other mechanisms including mechanisms of formation and transfer of small, of 15-30 nucleotides, variable nucleinic structures here could function in the structure of vector-like sequences (Deichman, Cheol, Baryshnikov 2005). The formed new gene copy did not

differ by its internal part located between sites of editing 1 and 4 in transcripts (except for position "-5" in relation to site 1), but differed by seven additional nucleotides to site 1, and six – after editing site. All these modifications had no influence on sites 2, 3 and 4, however editing was absent in site 1. Thus it is more probable, that character of editing was more influenced by 5’-(i.e. on the part of site 1), but not 3'-recombinations (on the part of site 4). Besides an important role in site recognition and editing catalysis there can play usually short (sometimes long) cis-sequences located close (especially in position "-1"), or at some distance (within ranges from “-16 to +5 ”, or from “-48 to +40 ”) from editing sites. Cis-recognizing elements at (C→U) editing conversion at highly specific sites were studied by methods of electroporation of purified plant mitochondria – introductions of deleted and site-directed mutating sequences containing related cox-II gene in in vitro systems (Farre et al., 2001).

Pre- and splicing transcripts were analyzed, as well as products of chimeric (naturally merged) genes. Significant for editing were two kinds of sequences: 16 upward located 5'-nucleotides (in relation to C-specific nucleotide-target), and 6 downward located 3'-nucleotides (necessary in site positioning; it reminds the situation in psbL-gene tobacco chloroplasts). Systems of editing in mitochondria and chloroplasts are not identical, but have many common features, i.e. probably common origin of editing machine. Genes transfer reproducing investigated transcripts between organelles, and with all necessary conditions, frequently cancelled editing, i.e. consensus-signals (their primary and secondary structure) of sites recognition of different degree of specificity were different in every organelle and revealed some variations in architecture of editing, that, probably, was connected with evolutionary later formation of some basic elements of editing of specific sites (Farre et al., 2001). Though evolutionary appearance of editing in both organelles can be connected with originating from unique system, significant preservation of editing sites in homologic mRNA, respectively, plastids (ndhB, ndhD) and mitochondria (nad2, nad4) of floral plant Arabidopsis thaliana, was not found (Lutz, Maliga 2001).

The biochemistry of editing modifications in both organelles most likely is similar both concerning the mechanism, and concerning choice of specific C-site of selection. If at C→U conversion in mRNA Apo-B there was shown U presence but not any unusual modified base, which behaves as uridin in translation and reception of cDNA transcripts, whole in case of plants additional confirmation of uridin presence are still required. Editing factors can be proteins, RNA, RNP-particles (Grienenberger 1993). Above editing site there are usually found pyrimidins (mainly U) and seldom G, i.e. at repeated C→U editing on multiple UCR-motives in plant organelles there is preferably formed АU-enrichness of the region – as animal mRNA Apo-B. It is interesting, that preferability of U-inserted editing in purin-rich (mainly adenins) regions in trypanosomes (protozoa) also is accompanied by increase of АU-nucleotide enrichness which, in turn, is probable nucleotide AU-target at A→I editing deamination in animals, leading to strengthening of formed GC-nucleotide componens. Notably, in the framework of genetically unique biosphere (Deichman, Cheol, Baryshnikov 2005), which different parts (including photosynthesizing and not-photosynthesizing) exchange by shuttle nucleinic sequences (inside so-called GSHF-systems - the Genetic Shuttle Feedback), existence, and possibly also the opposition of variously focused editing systems is supposed to be expedient.

Specificity of a site choice is unlikely determined by each separate UCR-motif (hundreds of editing proteins would be required), or by tertiary structure of interacting components.

Leaging role, probably, belongs to the short RNA segment, which is long enough for editing in vitro, and which similarly to a part of nucleotide 193 of the first exon of wheat mitochondria сох2-gene, appears to be built-in, particularly, in 3'-trailer sequence of primary unique nad3/rps12 transcript (Gualberto et al., 1991). Nucleinic modifications here were found exactly in сох2-insert, and on the same sites, as in true сох2 transcript, and surrounding sequences were not edited. Mitochondria genomes of superior plants contain significant number of repeating sequences consisting of parts of the known genes (Bonen, Bird 1988), which are edited more successfully, than surrounding sequences (Grienenberger 1993).

Interestingly, from the evolutionary point of view, whether well observed phenomenon of pyrimidin conversion in organelles of superior plants is common for all plant kingdom. In Marchantia polymorpha mitochondrial transcript of сох2 gene (inferior plant) U is already there where in superior plants there is C undergoing conversion (Ohyama et al., 1991). Probably, therefore in M. polymorpha there is not observed editing necessary in other species for synthesis of homologic proteins with high amino acid similarity (Oda et al., 1992). Whether it means, that pyrimidin conversion has appeared after divergence of angiosperms from their predecessors (and then M. polymorpha has no this mechanism at all), or this is an ancient, but for some reason lost, or strongly inhibited in M. polymorpha mechanism – is unclear. However, it is considered, it is difficult to admit, that this type of editing appeared in slowly evolving genomes de novo – though even at a later evolution stage. Moreover this editing type is connected with the necessary correction of accumulated in mtDNA mutations. Besides hardly ever such mechanism could be limited only to one type of nucleotide conversions.

In chloroplasts there is the same editing type, but, obviously, now looks less tense. Probably, it is connected with the fact that after primary endosymbiotic events various types of nucleotide mutations in chloroplasts appeared and disappeared even much faster, than in mitochondria. Moreover it is well corresponds to the suggestions (Deichman, Cheol, Baryshnikov 2005), according to which light-receiving (=energy-ray-flow-receiving) structures (chloroplast-like organelles), participate in formation of genetic code, contemporary UGC. Subsequently, probably, editing mechanism appeared to be more required in mitochondria, not in chloroplasts where the number of edited sites remained ever less and less. In this sense character of RNA editing as an ancient phenomenon, related to a very early stage of emerging life, can be possibly a characteristic feature of those procaryots (more likely not modern), which were evolutionary predecessors of mitochondria and chloroplasts. This is also proved by C→U conversions preserved in nuclear-coded RNA. At the same time such scenario well corresponds to a possibility mitochondria polyphyletic origins (Gray et al., 1989).

Potentially possible transfer of modified genetic information from plant mitochondrial genes into a nucleus as it is supposed, most likely concerns already edited sequences. So in the majority leguminous Vigna (besides 2 exceptions) there appeared edited nuclear, instead of mt-сох2 genes. In 2 Vigna species (unguiculata and radiata), but not closely related Phaseolus, сох2 gene was absent in mitochondria (Nugent, Palmer 1991). It is considered, that one of the reasons of this relatively recent event can be the

end of transfer of completely edited separate parts of a gene into the nucleus . For the description of similar events a mechanism is suggested, according to which the edited RNA segment (or a part of a gene) is exposed to a reverse transcription, and at homologic recombination is included in organelle genome structure. It, probably, facilitates creation there genes containing this edited part of sequence, and does not exclude, simultaneously, an opportunity of its transfer between organelles, and also between organelles and nucleus (Grienenberger 1993). At the same time it corresponds to the suggestion that “ cellular computer ” (cellular computing) reads and "copies" DNA by processes, which modify nucleotide sequence at DNA and RNA levels (in nucleus, organelles, viruses eukaryotic family tree). And exact decoding of genes is possible only because the cell cannot completely eliminate memory of those mechanisms, which participated in their creation (and by present have evolved and appeared to be built-in in the modern context). In turn, RNA editing as one of cellular computing mechanisms, allows to offer an algorithm of creation of a functioning gene from the most unexpected (“hidden corners and places ” - quot. Landweber, Kari 1999; Horton, Landweber 2002) genome parts.

Similar mechanism, firstly, can be the basis for explanations of edited sites loss inside organelles, and, secondly, can explain large differences in the degree of editing in some homologic genes between different species. Thus, for example, RNA transcript of atp6 gene has 21 and 20 edited sites respectively, in Oenothera (Schuster et al., 1991) and Sorgho (Kempken et al., 1991), but only one site in Rapeseed (Handa, Nakajiama 1992). Besides in nuclear genome of peas (and soya) there were found sequences, homologic to mitochondrial one-copy and cut down rps7 gene (its segment). The gene of this ribosomal protein is in recombinatigenic region of peas mtDNA, and is overlapped with transcribing and edited reading frame of ссb248, that, in turn, has homology with helC gene, which product (ABC-subunit) transfers gem at cytochrome biogenesis (Zhuo et al., 1999). Assembly of separate cytochrome-ß proteins in various organisms and organelles is individual. Transcript of Taccmb gene (from Triticum aestivum, which 618 nucleotides code subunit of a ABC-transporter) has revealed 42 editing (С→U) positions changing identity of 32 out of 206 amino acids of protein product. Enzymatic activity was connected with the located on an internal mt-membrane transmembrane hydrophobic protein of 28 kDa (Faivre-Nitschke et al., 2001). Post-transcriptional С→U editing in rice mitochondria RNA led to appearance of 491 modified site (Notsu et al., 2002); mt-gene of rice {490520 b.p., contents of (G+C)-components – 43.8 %} contains 3 genes of rRNA, 17 genes and 5 pseudo-genes of tRNA, 11 genes and 2 pseudo-genes of ribosomal mt-proteins (homologic to those of liverwort M.polymorpha). In mitochondria 6.3 % nucleotides here are homologic to plastid’s (with a degree of conservation of 60-100 %), and 13.4 % – to nuclear sequences; it corresponds to suggestions about interorganelle transfer of nucleinic sequences, perhaps in the structure of transposons or retrotransposons. There is supposed an often and independent DNA-flow in/from mitochondria of floral plants, which can explain the range of genetic variations among mitochondrial genomes of superior plants (Notsu et al., 2002).

Thus, it is obvious, that RNA editing cannot be considered separately from the whole list required for the control and regulation of genetic expression (including dividing

systems) processes, such as transcription (including reverse), splicing, translation and post-transcriptional protein modifications. Edited on 19 sites by RNA-intermediate (mt-nad4-transcript, subunit NADН-dehydrogenase) and the subsequent its homologic recombination is connected with a possibility of mt-intron loss (nad4-i2; in this case its flanking region was not edited) in mitochondria of sugar beet and some related species (but not in wheat, turnip) at the level of a common predecessor (Itchoda et al., 2002).

…………………………………………………………………….……………………………………………………………………….

Conclusion

Thus, it is possible to see, that the word-combination RNA editing includes the whole group independently proceeding at the level of newly synthesized RNA molecules (pre-mRNA, mRNA, tRNA, rRNA; various components - including introns, exons - pin structures of dsRNA of cells and viruses) nucleotide changes, each of which is initiated and supported with the help of various specific multicomponent and multifermental complexes called editosomes. Individual editosome, similarly to ribosome and splicosome (primosome and likewise), consists of the whole set of components and activities, necessary for performing both site-specific, and multiple editing of various types, distinguished by a kind of nucleotide changes inside the special genomic signal. There are edited both - not coding (less often), and expressed (usually) genome regions. Thus there are created and disappear stop-codons (and consequently elongated and shortened protein forms appear and disappear), initiatory and sens codons. Without phenotypic changes there can remain editing of the codon 3-rd nucleotide frequently. Selection of the main site in various editing types is connected: (1) - with characteristic primary sequence (as at С→U conversion in mRNA Apo-B; dsRNA role here is only being studied); (2) - with antisense complementarity in secondary RNA structures. Such complementarity is characteristic, in particular, for: chimeric gRNAs-pre-mRNA molecules providing initiating of U-insert and U-deletions in trypanosomes, and also for pin structures of double-strand RNA, necessary for А→I conversion in cellular mRNA of GluR-receptor, some virus mRNA near to the edited site, etc. As a whole editing can depend on the structure of next single and dinucleotides, character of nucleotide enrichness of edited region, and also distantly located signal motives and yet unidentified sequences. Many genomic signals, especially outside coding region, and the order of nucleotide conversion in them are unknown. Accumulation of the AU-enriched regions are usually connected with C→U deaminating and U-inserted editing types, and with probable AU-target regions - А→I deamination, accompanied with amplification of GC-component).

Set of the realized and potential evolutionary-genetic acquisitions within the frame of the given genetic system, and also genome organization, probably, influence the editing character of specific biological object. But the crucial question can be, whether this process is "old" or "young"? Concerning other processes of genetic expression (splicing in eukaryotes; transcription direct and reverse; translation using essentially the same way both in bacteria, and in animal cells, etc.) there was the same question, and the answer, deriving from their common similarity in widely different organisms, usually was – "old"

processes, which appeared before species divergence billions years ago. There are very different mechanisms of RNA editing: with the use of "halting" RNA-polymerase, C-deaminase, A-deaminase, gRNA-insert/deletion machines, etc. These mechanisms use different mechanistic principles, and are applied in various genetic systems. All of them connected, however, inclusion of RNA molecules in editing process, which, in the prevailing opinion, could be among the very first macromolecules on the Earth (Gesteland et. al., 1999; Altshtein, Kaverin 1980). Thus in evolutionary sense RNA editing is more likely an "old" process, though various its forms appeared (or were preserved) by transformations inside various family trees (Benne 1993; Chang, Chan 1998).

Characteristic nucleotide changes at editing can include matrix-mediated dependence of this not single-step enzyme-cascade process from various RNA-components (mRNA, gRNAs, snRNA/snoRNA, various components of double strand RNA, tRNA, and, probably, rRNA), and various enzyme activities (such as deaminating, ligase, trailer uridin transferase, endo-and exonuclease, helicase, etc.). Besides the mentioned components and activities there is necessary participation of so-called additional protein factors (probably also performing the role of replacing precursor RNA-molecules), many of which are unidentified yet, and probably, perform among other, an adapting role on rapproachement of the RNA-substrate and editing enzyme. Such factors, often, can be reproduced in cells, expressing neither RNA-substrate nor editing enzyme. RNA editing is observed for all DNA-containing cellular organelles (mitochondria, nucleus, chloroplasts) and viruses. C→U editing deamination (conversion) - most frequently determined in all three cellular organelles (but not viruses) type of nucleotide RNA changes. U-insert/deletione editing is typical for gRNA-pre-mRNA of mitochondrial trypanosome duplex, and cytoplasmic and nuclear А→I editing dsRNA deamination in animals and viruses proceeds with participation of nuclear-coded enzymes. There are conditionally minor and exotic types of nucleotide changes. Usually it is single, less often double deletions/inserts and replacements; in viruses these are the ones more connected to nucleus and cytoplasm.

Various editing types proceed in RNA of cellular substructures (mitochondria, chloroplasts, and also nucleus and adjacent areas of cytoplasm) of the majority of the investigated biological species (from protozoa to human) and viruses, and both in normal, and in pathologically changed, including cancer, cells. Components necessary for editing and activity in mitochondria and chloroplasts in many respects coincide, but they are not identical. The example dependent on RNA (possibly dsRNA) cytidindeaminases, also able to deaminate monomeric (nucleotides and nucleosides) ribo-, and, even, deoxiribonucleinic substrates, indicates their probable evolutionary connection with usual hydrolotic deaminases, and, probably, with usual (such as aconitase, catalase, etc.) enzymes. The latter, like cytidindeaminases, contain overlapping mono-, dinucleotide- and RNA binding areas; moreover, existence of the common for (С→U) - and (А→I)-deaminases precursor form is possible. RNA editing is a part of the process of transmitting biological information (in particular between mRNA and gRNA, various components of dsRNA, etc.), requiring the same accuracy, as at replication, transcriptions, and translations – processes with which there is sometimes a direct and sometimes indirect link. It is a posttranscriptional (or co-transcriptional), but proceeding before splicing, and, probably, ancient enough mechanism. It does not contradict the

established understanding about evolutionary repeated moving of genes (or their parts) from organelles into nucleus, but not vise versa; the unsolved question is what form - RNA, DNA, cDNA, or even the whole chromosomes of organelles – serve for transmission of genetic information (Henze, Martin 2001).

Mysteriousness of editing is connected with several main causes: (1) - the requirement of non-evident selective advantages on creation of independently edited and rapidly evolving editing sites, i.e. with an ambiguity in the question how and why each separate editing mechanism can be started. Other question - whether there is a uniform control over simultaneously proceeding various editing types and a way of switching from one editing type to another in the same organelle, cell (organism) - is poorly studied at present; (2) – non-understandable issues concerning end aims (i.e. so-called «distant plans») of editing; (3) - an ambiguity in the question, whether RNA editing - itself being an expression of polymorphism at the level of RNA molecules – leads only to formation of possible protein polymorphism (there are shown, at least, some translated protein forms belonging to variously edited transcripts of the same gene RPS12 Petunia, etc.), or it, also can "be involved" in formation of DNA genetic changes. Due to the latter causes the first attempts are done to determine if there exists affinity in the direction of nucleotide changes between modified as a result of RNA editing on the one hand, and undergoing phylogenetic reconstruction DNA on the other; and whether there can be such affinity connected with suggested reverse transcriptase activity (in both cases there is no answer yet), or there are some additional or alternative mechanisms. Authors of the present review describe their view on the problem of RNA editing (where this mechanism as well as other known and hypothetical mechanisms can operate in a complex, possibly with periodic formation of closed self-regulating subgenetic systems) in the paper (Deichman, Cheol, Barychnikov 2005).

Often, editing as a whole is considered as genetic mechanism of reparation functioning at the RNA level, directed against missense-mutations at a genetic level, and preserved in evolution. However if the nature of this mechanism appears not exactly genetic, but also including factors (components, activity) of epigenetic nature or unidentified mechanisms of hypervariability, in this case editing can not only eliminate, but also precede appearance of new missense-mutations in the most different (including conservative) sequences. At present such possibility cannot be excluded at least for the case of editing in some trypanosomes, using directing ("guide") RNA, gRNAs which genes are coded not only by mtDNA, but also/or mini-(mainly) – and maxiring components of kinetoplasts, which nature of gRNA-renewing ability still remains unclear. In this context RNA editing can appear one of the group of mechanisms responsible for maintenance of nuclear-cytoplasmatic, and finally of epigenome-genetic links. Besides it is possible, the question will clear up (quotation Odintsova, Yurina 2000): «why genome contains "incorrect" information and a "wrong" transcript is read and why the error is corrected post - transcriptionally»).

Fig. 9.

The kind of situation is connected with editing, when resulting from the changes at the level of RNA molecules (in fact "RNA" polymorphism - including inside some tRNA), one gene becomes a source for more than one form of expressing product (impairment of collinearity principle), and, thus, additional cause of formation of protein polymorphism. At present there are no undisputable data to answer the question, whether RNA editing is the cause of formation of genetic polymorphism, and if yes, how (fig.9) it happens. Moreover, non-evident links of various polymorphism types can be connected not only with the undeveloped problem, but also with the existence of one or groups of the unknown mechanisms joined by unique, but some-level problem of formation and correction of expressing (or potentially expressing) gene parts for evolutionary significant (and consequently - difficultly observed in the majority of investigated systems) period.

ABBREVIATIONS ( and cuttings; explanations in text)

“guide”-RNA (gRNA) – directing U-insert/deletion editing mitochondrial trypanosome RNA. snRNAs, snoRNAs – respectively, small nuclear and nucleolar RNA kpDNA – kinetoplast trypanosome DNA.pre-mRNA – editing pre-mRNA.TUTase – necessary for U-deletion-insert editing trailer uridintransferase

of trypanosome kinetoplasts.

сDNA– obtained in the result of reverse transcription, cloning DNA-copy dsRNA, ssRNA – double-strand, single-strand RNA (mRNA, rRNA, tRNA). Glu-R – receptor of brain cells to glutaminic acid. Effects permeability of ion channels at neurotransmisson 5НТ – similar receptor to serotonin (5-hydroxitryptamin).Apobec-1 – catalytic subunit of animal RNA-dependent cytidindeaminases

Apo-B mRNA – mRNA of apolipoprotein-B – protein, responsible for metabolism of lipoproteins of low and very low density and chilomiACF – additional protein factor of С→U editing, Apobec-1-complementation factor.ORF _ open reading frame in the genome structure; contains complete and cut nucleotide gene sequences encoding known and unknown proteins

А, G, U, C (I)- bases edited in the RNA structure of different species (adenin, guanin, uridin, cytosin (inosin)CMS– cytoplasmic male sterility (in plants) n. p.– nucleotide pairs. b.p.– base pairst. n. p.– thousand of nucleotide pairs(mt-/chp-) – mitochondrial or chloroplast (protein, rRNA, genome,etc.) intracellular element ds/ss(RNA/DNA)– double-strand, single-strand regions (in RNA, DNA)

References

Altshtein A.D., Kaverin N.V. About the origin of virus genetic systems. // J. VHO Mendeleev. – 1980. – V.25. – N4. – P. 383-390. [in Russian] Deichman A.M., Choi W.C., Baryshnikov A.Yu. (part-2 present book). New Hypothetical Mechanisms and Countors of New Paradigm (some aspects). // Published “Practical Medicine”. – Moscow. – 2005. [in Russian and Englich] Deichman A.M. One of the variants of point mutations is probably triggered by epitope reverse translation. Hypothetical consept.// Dep.Manuscr. N1502-B93. –VINITI. –.Moscow. –1993. – 56 p. [in Russian] Zaenger V. Principles of structural organization of nucleic acids. tRNA – a treasury of stereochemical information. // Moscow. – Mir. –1987. – P.354-374. [in Russian]Kusmin E.V., Zaitseva G.N. Organisation and expression of mitochondrial genome.// In book: Summary of Science and Techniques. – V.6. –VINITI. – Moscow/ –1987/ – P.145-230. [in Russian] Kolesnikov A.A., Shonian G., Presber V. Edited site of kinetoplast gene MURF4 (ATPase 6) of leichmania has similar structure. // J.Molecular Biology. – 2000. – N1. – P.37. [in Russian] Odintsova M.S., Yurina N.P. RNA editing in chloroplasts and mitochondria of plants. // J. Physiology of plants. – 2000. – V.47. – P.307-320. [in Russian] Potapova G.I., Khramtsova S.N. Role of adenosin deaminase and metabolism of purins and pirimidins in impairment of functioning of immune cells in malignant growth.// Summary of Science and Techniques. – Oncology. – Moscow. –1993. – VINITI. – V.23. – P.85-168. [in Russian] Yurina N.P., Odintsova M.S., Comparative characteristics of structural organization of genomes of plant chloroplasts and mitochondria.// Genetics. –1998. – V.34. – N1. – P.5-22. [in Russian]

Yurchenko V.Yu. Multiplicity of organizational forms of miniring component of kinetoplastide DNA in Trypanosomatidae.// Ph.D. thesis. –1999. – Moscow. – MSU (biological faculty). [in Russian]

---------------------------------------------------------------------------------------------------------------

Adler B.K., Hajduk S.L. Guide RNA requirement for editing-site-specific endonucleolytic cleavage of pre-edited mRNA by mitochondrial ribonucleoprotein particles in Trypanosome brucei // Mol. Cell. Biol. – 1997. - Vol.17. - № 9. - P. 5377-5385.

Alfonzo J.D., Blanc V., Estevez A.M., Rubic M.A., Simpson L. C to U editing of the anticodon of imported mitochondrial tRNA(Trp) allow decoding of the UGA stop codon in Leichmania tarentolae // EMBO J. - 1999, - Vol.18. - N24. – P.7056-7062.

Alfonzo J.D., Thiemann O., Simpson L. The mechanism of U insertion/deletion RNA editing in kinetoplastid mitochondria // Nucl. Acids. Res. – 1997. - Vol.25. - № 19. -P.1751-1759.

Alves A.M., De Almedia D.F., Von Kruger W.M. Changes in Trypanosoma cruzi kinetoplast DNA minicircles induced by environmental conditions and subcloning // ukaryot.Micribiology. -1994. - Vol.41. - N 4. - P.415--419.

Anant S., Davidson N.O. An AU-rich sequence element UUUN(A/U)U dawnstream of the edited C in apolipoprotein B mRNA is a high-affinity binding site for Apobec-1: binding of Apobec-1 to this motif in the 3’untraslated region of c-myc increases mRNA stability // Mol. Cell. Biol. – 2000. - Vol.20. - N6, - P.1982-1992.

Anant S., Giankoni F., Antic D., Demaria C.T., Keene J.D., Brewer G., Davidson N.O. AU-rich RNA binding proteins Hel-N1 and AUF1 bind apolipoprotein B mRNA and inhibit postranscriptional CU editinng. // Nucl. Acids Symp. Ser. – 1997. - Vol.36. - P.115-118

Anant S., Henderson J.O., Mukhopadhhyay D., Navaratnam N., Kennedy S., Min J., Davidson N.O. Novel role for RNA-binding protein CUGBP2 in mammalian RNA editing. CUGBP2 modulates C to U editing of ApoB mRNA by interating with apobec1 and ACF, apobec1 complementation factor // J. Biol. Chem. - 2001a. - Vol.276. - N50. - P.47338-47351.

Anant S., Mukhopadhhyay D., Sankaranand V., Kennedy S., Henderson J.O., Davidson N.O. ARCD-1, an apobec1-related cytidine deaminase, exerts a dominant negative effect on C to U RNA editing // Am. J. Physiol Cell. Physiol. - 2001b. - Vol.281. - N6. - P.1904-1916.

Anant S., MacGinnitie A.J., Davidson N.O. The binding of apobec-1 to mammalian apoB RNA is stabilized by the presence of complementation factors which are required for post-transcriptional editing // Nucl. Acids Symp. Ser. - 1995а. - Vol.33. – P. 99-102.

Anant S., MacGinnitie A.S., Davidson M.O. Apobec-1 the catalytic subumit of the mammalian apolipoprotein B mRNA editing enzyme, is a novel RNA-binding protein // J. Biol. Chem. - 1995b. - Vol. 270. - № 24, - P.14762-14767.

Anant S., Davidson N.O. Identification and regulation of protein components of the ApoB mRNA editing enzyme , A complex event // Trend. Cardiovasc. Med. - 2002. - Vol.12. - N7. - P.311-317.

Anant S., Davidson N.O. Hydrolytic nucleoside and nucleotide deamination, and genetic instability: a possible link between RNA-editing enzymes and cancer? // Trend. Mol. Med. – 2003. - Vol.9. - N4. - P.147-152.

Aphasizhev R., Aphasizheva I., Nelson R.E., Simpson L. A 100 kD complex of two RNA-binding proteins from mitochondria of L.tarentolae catalyzes RNA annealing and interacts with several RNA editing components // RNA. - 2003a. - Vol.9. - N1. - P.62-76.

Aphasizhev R., Aphasizheva I., Nelson R.E., Gao G., Simpson A.M, Kang X., Falick A.M., Sbicego S., Simpson L. Isolation of a U-insertion/deletion editing complex from L.tarentolae mitochondria // EMBO J.- 2003b. - Vol.22. - N4, - P.913-924.

Aphasizhev R., Sbicego S., Peris M., Jang S.H., Aphasizheva I., Simpson A.M., Rivlin A., Simpson L. Trypanosome mitochondrial 3’ terminal uridylyl transferase (TUTase): the key enzyme in U-insertion/deletion RNA-editing // Cell. – 2002. - Vol.108. - N5. - P.637-648.

Arts G.J., Sloop P., Benne R. A possible role for the guide RNA U-tail as a specificity determinant in formation of guide RNA messenger RNA chimeras in mitochondrial extracts of Сrithidia fasciculata // Mol Bioch. Parasit. – 1995. - Vol.73. - № 1-2. - P. 211-222.

Aruseavage P.J., Bass B.L. A phylogenetic analysis reveals an anusual sequece conservation within introns involved in RNA editing // RNA/ - 2000. - Vol.6. - N2. – P.257-269.

Avila H.A., Simpson L. Organization and coplexity of minicircle-encoded guide RNA in Trypanosoma cruzi. // RNA. – 1995. - Vol.1. - N 9. - P.939-947.

Bachl J., Ollson C. Hypermutation targets a green fluorescent protein-encoding transgene in the presence of immunoglobulin enhancers // Eur. J. Immunol. – 1999. - Vol.29. - N4. - P.1383-1389.

Bachl J., Steinberg C., Wabl M. Critical test of hot spot motifs for immunoglobulin hypermutation // Eur. J. Immunol. – 1997. - Vol.27. - N12. - P.3398-3403.

Backus J.W., Shock D., Smith H.C. Only cytidines 5' of the apoB mRNA moorins sequence are edited // BBA 1994. - Vol.1219. - № 1. - P.1-14.

Backus J.W., Smith H.C. Three distinct RNA sequence elements are required for efficient apolipoprotein- B RNA editing in vitro // Nucl. Acids Res. – 1992. - Vol.20. - № 22. – P. 6007-6014.

Barciszewska M.Z., Erdman V.A., Barciszewska J. A new type of RNA editing 5S ribosomal DNA transcripts are edited to mature 5S rRNA // Mol. Biol. Int. – 1994. - Vol.34. - № 3. – P. 437-448.

Barger G., Plante I., Lonergan K.M., Gray M.W. The mitochondrial DNA of the amoeboid protozoon, Acanthamoeba castellanii: complete sequence, gene content and genome organization // J. Mol. Biol. – 1995. - Vol. 245. - № 5. – P. 522-537.

Baskus J.W., Smith H.C. Specific 3' sequences flanking a minimal apoB mRNA edititng "cassette" are critical for efficient editing in vitro // BBA. – 1994. - Vol.1217. - № 2. - P.65-73.

Bass B.L. RNA-editing and hypermutation by adenosine deaminase // Trend. Biochem. Sci. – 1997. - Vol.22. - № 5. - P.157-162.

Bass B.L. RNA-editing by adenosine deaminase that act on RNA // Annu. Rev. Biochem. – 2002. - Vol.71. - , P.817-846.

Beier H., Lee M.C., Sekiya T., Kuchino Y., Nishimura S. Two nucleatides next to the anticodon of cytoplasmic rat tRNA (Asp) are likely generated by RNA editing // Nucl. Acid. Res. – 1992. - Vol. 20. - № 11. - P. 2679-2683.

Benne R. RNA-editing in trypanosomes. The use of guide RNAs // Molecul. Biol. Report 1992. - Vol.16. - № 4. - P. 217-227.

Benne R. RNA-editing : The alteration of protein coding sequences of RNA / London: Publ. by Ellis Horwood Ltd. (Series Mol. Biol.). - 1993а. – 305p.

Benne R. RNA editing in mitochondria of Leichmania tarentolae and Crithidia fasciculata // Semin. Cell. Biol. - 1993b. - Vol.4. - N 4. – P.241-249.

Benne R. RNA-editing: how a message is changed // Curr. Opin. Genet. Dev. – 1996. - Vol.6. - №2. - P. 221---231.

Benne R., Vanden Burg J., Brakenhoff J.P., Sloof P., Van Boom J.H., Tromp M.C. Major transcript of the frameshifted cox II gene from trypanosome mitochondria conteins four nucleotides that are not encoded in the DNA // Cell. – 1986. - Vol.46. - № 6. - P.819-825

Ben-Shlomo H., Levitan A., Shay N.E., Goncharov I., Michaeli S. RNA editing associated with the

generation of two distinct conformation of the trypanosomatid Leptomonas collosoma 7SL RNA // J.Biol. Chem. – 1999. - Vol.274. - N36. - P.25642-25650.

Bjork G.R., Ericson J.U., Gustafsson C.D.E., Hagervall T.D., Jonsson Y.H., Wikstrom P.M. Transfer RNA modification // Annu.Rev.Biochem. – 1987. - Vol.56. - P.263-287. Blackhall J., Fuentes A., Magnusson G. Genetic stability of a porcine rotavirus RNA segment during repeats plaque // Virology. – 1996. - Vol.225. - N1. – P.181-190.

Blanc V., Jordana X., Litvak S., Araga A. Control of gene expression by base deamination the case of RNA editing in wheat mitochondria // Biochimie. – 1996. - Vol.78. - № 6. - P.511-517.

Blanc V., Litvak S., Arya A. RNA editing wheat mitochondria proceeds be a deamination mechanism // FEBS Lett. – 1995. - Vol.373. - № 1. - P.56-60.

Blanc V., Navaratnam N., Henderson J.O., Anant S., Kennedy S., Jarmus A., Scott J., Davidson N.O. Identification of GRY-RBP as an ApoB RNA-binding protein that interact with both apobec1 and ACF factor to modulate C to U editing // J. Biol. Chem. – 2001. - Vol.276. - N13. - P.10272-10283.

Blanc V., Henderson J.O., Kennedy S., Davidson N.O. Mutagenesis of ACF reveals distinct domains that modulate RNA binding , protein-protein interaction with apobec1 , and complementation of C to U RNA-editing activity // J. Biol. Chem. – 2001. - Vol.276. - N49. - P.46386-46393.

Blom D., de Haan A., Van den Burg J., Van den Berg M., Sloof P., Jirku M., Lukes J., Benne R. Mitichondrial

minicircles in the free-living bodonid Bodo saltans contain two gRNA gene cassetes and not found in large networks // RNA. – 2000. – Vol.6. - N1. – P.121-135.

Blom D., de Haan A., Van den Berg M., Sloof P., Jirku M., Lukes J., Benne R. RNA editing in the free—living badonid Bodo saltans // Nucl. Acid. Res. – 1998. - Vol.26. - № 5. P.1205-1213.

Blom D., Van den Burg J., Breek C.K., Speijer D., Muijsers A.O., Benne R. Cloning and characterization of two guide RNA binding proteins from mitochondria of Critidia fasciculata: gBP27, a novel protein, and gBP29, the orthologue of T.brucei gBP21 // Nucl. Acid. Res. – 2001. - Vol.29. - N14. - P.2950-2962.

Blum B., Simpson L. Guide RNA in kinetoplastid mitochondria have a nonencoded 3 oligo(U) tail involved in recognition of the preedited region // Cell. – 1990. - Vol.62. - N 2. - P.391-397 .

Blum B., Balakara N., Simpson L. A model for RNA editing in kinetoplastid mitichondria : small “guide RNA”molecules transcribed from maxicircle DNA provide the edited sequence information // Cell. – 1990. - Vol.60. – P.189-198.

Bock R., Hagemann R., Rossel H., Kudla J. Tissue- and stage-specific modulation of RNA-editing of the psbF and psbL transcript from spinach plastids – a new regulatory mechanism? // Mol. General. Genet. – 1993. – Vol.240. - № 2. - P.238-244.

Bock R., Hermann M., Fuchs M. Identification of critical nucleoproteid positions for plastid RNA editing site recognition // RNA. – 1997. - Vol.3. - № 10. – P. 1194-1200.

Bock R., Koop H.U. Extraplastidic site-specific factors mediate RNA editing in chloroplasts // EMBO J. – 1997. - Vol.16. - № 11. - P.3282-3288.

Bock R., Kossel H., Maliga P. Introduction of a heterologous editing site into the tobacco plastid genome: the back of RNA editing leads to a mutant phepotype // EMBO J.- 1994. – Vol.13. - № 19. - P. 4623-4628.

Boer P.H., Gray M.W. Genes encoding a subunit of respiratory NADH degydrogenase (ND 1) and a reverse transcriptase-like protein (RTL) are linked to ribosomal RNA gene pieces in Chlamidomonas reinhardtii mitochondrial DNA // EMBO J. – 1988. – Vol.7. - P.3501-3508.

Bonen L., Bird S. Sequence analysis of the wheat mitochondrial atf6 gene reveals a fused upstream reading frame and markedly divergent N-termini among plant ATP6 proteins // Gene. – 1988. – Vol.73. – P.47-56 .

Borner G.V., Morl M., Janke A., Paabo S. RNA editing changes of a mitichondrial tRNA in marsupials. //

EMBO J. – 1996. – Vol.15. - № 21. - P.5949-5957.

Borner G.V., Yokobori S., More M., Dorner M., Paabo S. RNA editing in metazoan mitochondria: staying fit without sex // FEBS Lett. – 1997. – Vol. 409. - № 3. - P.320-324.

Bowe L.M., de Pamphilis C.W.. Effects of RNA editing and gene proccessing on phylogenetic reconstruction. // Mol. Biol. Evol. – 1996. - Vol.13. - № 9. – P.1159-11566.

Brennicke A., Marchfelder A., Binder S. RNA editing // FEMS Microbiol.Rev. – 1999. - Vol.23. - N3. - P.297--316.

Bross L., Muramatsu M., Kinoshita K., Honjo T., Jacobs H. DNA double-strand breaks: prior to but not sufficient in targeting hypermutation // J. Exp. Med. - 2002. – Vol.195. - N9. - P.1187-1192.

Brown B.A.-2-nd, Athanasiadis A., Hanlon E.B., Lowenhaupt K., Wilbert C.M., Rich A. Crystalluization of the Zalpha domain of the human editing enzyme ADAR1 ccomplexed with a DNA-RNA chimeric oligonucleotide in the left-handed Z-conformation // Acta Crystallogr. D. Biol. Crystallogr. – 2002. - Vol.58. - N-Pt1. - P.120-123.

Brule H., Holmes W.M., Keith G., Giege R., Florent C. Effect of a mutation in the anticodon of human mitochondrial tRNA (Pro) on its post-transcriptional modiffication pattern // Nucl. Acid. Res. – 1998. – Vol. 26. - № 2. - P.537-543.

Burgess M.L., Stuart K. Sequence bias in kinetoplastid RNAs // RNA. – 2000. - Vol.6. - N11. - P.1492-1497.

Burns C.M., Chu H., Rueter S.M., Hutchinson L.K., Canton H., Sanders-Bush E., Emeson R.B. Regulation of Serotonin-2C receptor G-protein coupling by RNA editing // Nature. – 1997. – Vol.387, - № 6630. - P.303-308.

Byrne E.M., Gott J.M. Cotranscriptional editing of Physarum mitochondria RNA requires local features of the native template // RNA. – 2002. - Vol.8. - N9. - P.1174-1185.

Byrne E.M., Stout A., Gott J.M. Editing site recognition and nucleotide insertion are separable processes in Physarum mitochondria // EMBO J. – 2002. - Vol.21. - N22. - P.6154-6161.

Casey J.L. RNA editing in HDV genotype III requires a branched double-hairpin RNA structure // J. Virol . – 2002. - Vol.76. - N15. - P.7385-7397.

Carrillo C., Chapdelaine Y., Bonen L. Variation in sequence and RNA editing within core domains of mitochondrial group II introns among plants // Mol. Gen. Genet. – 2001. - Vol.264. - N5. – P.595-603.

Cattaneo R. Biased (A I) hypermutation of animal RNA virus genomes // Curr. Opin. Genet. Dev. – 1994. - , Vol.4. - № 6. - P. 895-900.

Chan L., Chang B.H., Liao W., Oka K., Lau P.P. Apolipoprotein B: from editosome to proteasome // Recent Prog. Horm. Res. – 2000. - Vol.55. – P.93-126.

Chang B.H., Chan L. Evolutionary analysis of RNA editing enzymes // Methods. – 1998. – Vol.15. - № 1. - , P. 41-50.

Chang L.S., Lin J., Wu P.F. cDNA sequence analysis of cardiotoxin variants from Taiwan cobra // Biochem Mol. Int. – 1997. - Vol.42. - № 1. – P.85-92.

Chateigner-Boutin A.L., Hanson M.R. Development co-variation of RNA editing extent of plastid editing sites exhibiting similar cis-elements // Nucl. Acid. Res. – 2003. – Vol.31. - N10. - P.2586-2594.

Chateigner-Boutin A.L., Hanson M.R. Cross-competition in transgenic chloroplast expressing single editing sites reveals shared cis-elements // Mol. Cell Biol. – 2002. – Vol.22. - N24. - P.8448-8456.

Chaudhuri J., Tian M., Khuong C., Chua K., Pinaud E., Alt F.M. Transcription targeted DNA deamination by the AID antibody diversification enzyme // Nature. – 2003. – Vol.422. - N6933. - P.726-730.

Chiang S.C., Yu J.C., Lee S.T. Transkinetoplastidyia in arsenite-resistant Leishmania major // Mol. Biochem.

Parazitol. – 1996. - Vol.82. - N 1. – P.121-124.

Chaudhuri S., Maliga P. Sequence directed C-to-U editing of the plastid psbL mRNA are located within a 22 nucleotide segment spanning the editing site // EMBO J. – 1996. – Vol.15. - № 21. – P.5958- -5964.

Chen Z., Hirano A., Wong T.C. Isolation and characterization of intranuclear ribonucleoprotein complexes accosiated with dsRNA adenosine deaminase from brain cells: implications for RNA-editing and hypermutation of viral RNA in the CNS // J. Neurovirol. – 1995. – Vol.1. - № 3-4. - P.295-306.

Chen Z., Eggerman T.L., Potosky D., Alborati M., Patterson A.P. Calcium increases ApoB mRNA editing. // Bioch. Biophys. Res. Commun. - 2000. - Vol.277. - N1. - P.221-227.

Chen Z., Eggerman T.L., Patterson A.P. Phosphorilation is a regulatory mechanism in ApoB mRNA edditing. // Bioch. J. – 2001. - Vol.357. - Pt3. - P.661-672.

Cheng Q., Jayan J.C., Casey J.L. Differential inhibition of RNA editing in Hepatitis Delta virus Genotype III by the short and long forms of HDAg // J. Virol. – 2003. - Vol.77. - N14. - P.7786-7795.

Cheng Y.W., Visomirski-Robic L.M., Gott G.M. Non-templated addition of nucleotides to the 3’ end of nascent RNA during RNA editing in Physarum // EMBO J. – 2001. - Vol.20. - N6, - P.1405-1414.

Cho D.S., Yang W., Lee J.T., Shiekhattar R., Murray J.M., Nishikura K. Requirement of dimerization for RNA editing activity of adenosine deaminases acting on RNA // J. Biol. Chem. – 2003. - Vol.278. - N19, - P.17093-17102.

Corele R.A., Read L.K., Riley G.R., Nellissery J.K. Allen T.E., Kable M.L.,Washal M.D., Seiwert S.D., Myler P.S., Stuart K.D. Complexes from Tryhanosoma brucei that exhibit deletion editing and other editing—associated propeties // Mol. Cell. Biol. – 1996. - Vol16. - ,№4. – P.1410-1418.

Corell R.A., Feagin J.E., Riley G.R., Strickland T., Guderian J.A., Myler P.J., Stuart K. Trypanosoma brucei minicircles encode multiple guide RNAs which can direct editing of extensively overlapping sequences. // Nucl. Acid. Res. – 1993. – Vol. 21. - № 18. - P.4313-4320.

Corneille S., Lutz K., Maliga P. Conservation of RNA editing between rise and maize plastids: are most editing events dispensable? // Mol. Gen. Genet. – 2000. - Vol.264. - N4, - P.419-424.

Covello P.S., Gray M.W. On the evolution RNA editing // Trend. Genet.– 1993. – Vol.9.- № 8, - P. 265-268.

Covello P.S.,Gray M.W. RNA editing in plant miochondria // Nature. – 1989. - Vol.341. - P.662-666.

Crain P.F., Alfonso J.D., Rozenski J., Kapuchos S.T., McCloskey J.A., Simpson L. Modification of the universaly unmodified uridine-33 in a mitochondria imported edited tRNA and the role of the anticodon arm structure on editing efficiency // RNA. – 2002. - Vol.8. – N6. - P.752-761.

Cruz-Reyes J., Rusche L.N., Piller K.J., Sollner-Webb B. Trypanosome brucei RNA-editing: adenosine nucleotides inversly affert U-deletion and U-insertion reactions at mRNA cleavage // Mol. Cell. Biol. – 1998. – Vol.1. - № 3. – P. 401-409.

Cruz-Reyes J., Rusche L.N., Sollner-Webb B. Trypanosome brucei U unsertion and U deletion activities co-purify with an enzymatic editing complex but are differentionally optimized // Nucl. Acid. Res. – 1998. - Vol.26. - № 16. - P.3634-3639.

Cruz-Reyes J., Sollner-Webb B. Trypanosome U-deletional RNA editing involves guide RNA-directed endonuclease cleavage , terminal-U-exonuclease and RNA ligase activities // PNAS. – 1996. – Vol.93. - № 17. - P.8901-8906.

Cruz-Reyes J., Zhelonkina A.G., Rusche L.N, Sollner-Webb. Trypanosome RNA editing simple guiding RNA features enhance U deletion 100-fold // Mol. Cell Biol. – 2001. - Vol.21. - N3. - P.884-892.

Cruz-Reyes J., Zhelonkina A.G., Huang C.E., Sollner-Webb B. Distinct function of two RNA ligases in active T.brucei RNA editing complexes // Mol. Cell. Biol. – 2002. - Vol.22. - N13. - P.4652-4660.

Davidson N.O., Anant S., MacGinnitie A.J. Apolipoprotein B messenger RNA editing: insights into the

molecular regulation of post-transcriptional cutidine deamination // Curr. Opin. Lipidology. – 1995. - Vol.6. - № 2. - P.70-74.

Davies M.S., Wakkis S.C., Dricoll D.M., Wynne J.K., Williams G.W., Powell L.M., Scott J. Sequence requirements for apolipoprotein ApoB RNA editing in transfected rat hepotome cells // J. Biol. Chem. – 1989. – Vol.264. - № 23. - P.13395-13398.

Desterro J.M., Keegan L.P., Lafarga M., Berciano M.T., O’Connell M., Carmo-Fonseka M. Dynamic association of RNA-editing enzymes with nucleolus // J. Cell. Sci. – 2003. – Vol.116. - NPt-9. - P.1805-1818.

Dewey R.E., Levings C.S., Timothy D.H. Nоvel recombinations in the maize mitochondrial genome priduce a unique transcriptional unit in the Texas male sterile cytoplasm // Cell. – 1986. – Vol.44. - P.439-449.

Diaz M., Storb U. A novel AIDs deaminase in the delivery of error-prone polymerases to immunoglobulin genes.// DNA Repair (Amst). – 2003. – Vol.2. - N5. - P.623-627.

Dietrich A., Small I., Cosset A., Weil J.H., Marechal-Drouard L. Editing and import: strategies for providing plant mitochondria with a complete set of functional transfer RNAs // Biochimie. – 1996. – Vol.78. - № 6. - P.518-529.

Doi T., Kinoshita K., Ikegwa M., Muramatsu M., Honjo T. De novo protein synthesis is required for the AID function in class-switch rec.ombination // PNAS. – 2003. – Vol.100. - N5. - P.2634-2638.

Domingo G.J., Palazzo S.S., Wang B., Pannicucci B., Salavati R., Stuart K.D. Dyskinetoplastic T.brucei contains functional editing complexes // Eukar. Cell. – 2003. – Vol.2. - N3. - P.569-577.

Dorner M., Altman M., Paabo S., Morl M. Evidence for import of a lysyl-tRNA into marsupial mitochondria. // Mol. Biol. Cell. – 2001. – Vol.12. - N 9. - P.2688-2698.

Douce R., Neuburger M. The uniquenes of plant mitochondria // Annu. Rev. Plant. Physiol. Plant. Mol.Biol. - - 1989. – Vol.40. - P.371-414 .

Doyle M., Jantsch M.F. Distinct in vivo roles for dsRNA-binding domains of the Xenopus RNA-editing enzyme ADAR1 in chromosomal targeting // J. Cell Biol. – 2003. - Vol.161. - N2. - P.309-319.

Drescher A., Hupfer H., Nicel C., Albertazzi F., Hohmann U., Herrmann R.G., Maier R.M. C-to-U conversion in trhe ndhI/ndhG of plastid from monocot plants: convential editing in an unconventional small reading frame? // Mol. Genet. Genomics. – 2002. - Vol.267. - N2. - P.262-269.

.Drozdz M., Palazzo S.S., Salavati R., O’Rear J., Clayton C., Stuart K. TbMP81 is required for RNA-editing in T.brucei // EMBO. – 2002. - Vol.21. - N7. - P.1791-1799.

Eckmann C.R., Neunteufl A., Pfaffstetter L., Jantsch M.F. The human but not Xenopus RNA editing enzyme ADAR1 has an atypical nuclear localization signal and displays the characteristics of shuttling protein // Mol. Biol. Cell. – 2001. – Vol.12. - N7. – P.1911-1924.

Edqvist J., Burger G., Gray M.V. Expression of Mitochondrial Protein-coding Genes in Tetrahymena pyriformis // J. Mol. Biol. - 2000. – Vol.297. - N2. - P.381-393.

Estevez A.M., Simpson L. Uridine insertion/deletion RNA editing in Trypanosoma mitochondria – a reveiw. // Gene. – 1999. – Vol.240. - N2. - P.247-260.Estevez A.M., Thiemann O.H., Alfonzo J.D., Simpson L. T7 RNA polymerase-driven transcription in mito-chondrion of Leichmania tarentolae and Trypanosoma brucei // Mol.Biochem.Parasitol.1999. – Vol.103. - N2. - P.251-259.Faivre-Nitschke S.E., Nazoa P., Gualberto J.M., Grienenberger J.M., Bonnard G. Wheat mitochondria ccmB encodesthe membrane domain of a putative ABC transporter involved in cytochrome-c biogenesis. BBA. – 2001. – Vol.1519. - N3. – P.199-208.Farre J.C., Leon G., Jordana X., Araya A. Cis-recognition elements in plant mitochondrion RNA-editing // Mol Cell. Biol. – 2001. – Vol.21. - N20. - P.6731-6737.

Farrow M.A., Nordin B.E., Schimmel P. Nucleotide determinants for tRNA-dependent amino acid discrimination by a class 1 tRNA-synthetase // Biochemistry. – 1999. – Vol.38. - N51. - P.16898-16903.

Fey J., Weil J.H., Tomita K., Cosset A., Dietrich A., Small I., Marechal-Droard L. Role of editing in plant mitochondrial transfer RNAs // Gene. – 2002. – Vol.6. - N1. - P. 21-24.

Fey J., Weil J.H., Tomita K., Cosset A., Dietrich A., Small I., Marechal-Droard L. Editing of plant mt-tRNAs. // Acta Biochim. Pol. – 2001. – Vol.48. - N2. - P.383-389.

Forget L., Ustinova J., Wang Z., Huss V.A., Lang B.F. Hyaloraphidium curvatum: a linear mitochondrial genome, tRNA-editing, and an evolutionary link to lower fungi // Mol. Biol. Evol. – 2002.,- Vol.19. - N3, P.310-319.

Foster S.J., Dorner T., Lipsky P.E. SHM of the VκJκ rearrangements: targeting of RGYW motifs on both DNA strands and preferential selection of mutated codons within RGYW motifs // Eur. J. Immun. – 1999. – Vol.29. - N12. - P.4011-4021.

Fox T.D.,Leaver C.J. The Zea mays mitochondrial gene coding cytochrome oxidase subunit 11 has an intervening sequenceand does not contain TGA codons // Cell. – 1981. – Vol.26. – P.519-525.

Frech G.C., Simpson L. Uridin/insertion into preedited mRNA by mitochondrial extract from Leishmania tarentolae: stereochemical evience for the enzyme cascade model // Mol. Cell. Biol. – 1996. - Vol.16. - № 8. - P.4584-4589.

Frick F., Bohlooly-Y. M., Linden D., Olsson B., Tornell J., Eden S., Oscarsson J. Long-term grow hormone excess induces marked alteration in lipoprotein metabolism in mice // Am. J. Physiol. Endocrinol. Metab. - - 2001. – Vol..281. - N6. - P.E1230-T1231.

Fujino T., Navaratnam N., Jarmuz A., von HaesslerA., Scott J. CU editing of apolipoprotein-B mRNA in marsupials: identification and characterisation of Apobec-1 from the American opossum Monodelphys domestica // Nucl. Acid. Res. – 1999. – Vol.27. - N13. - P.2662-2671.

Fuleihan R.L. The hyper IgM syndrome // Curr. Allergy Rep. - 2001. – Vol.1. - N5. - P.445-450.

Gallagher L.J., Bets S.K., Chase C.D. Mitochondrial RNA editing truncates a chimeric ORF associated with S-male-sterility in maize // Curr. Genet. - 2002. – Vol..42. - N3. - P.179-184.

Gallo A., Thomson E., Brindle J., O’Connell M.A., Keegan L.P. Micro-processing events in mRNAs identified by DHPLC analysis // Nucl. Acid. Res. – 2002. – Vol.30. - N18. - P.3945-3953.

Gao G., Simpson L. Is trypanosome brucei REL1 RNA ligase specific for U-deletion RNA editing and REL2 RNA ligase specific for U-insertion editing? // J. Biol. Chem. – 2003., May 14 [Epub ahead print].

Green N.S., Liu M.M., Scharff M.D. Immunoglobulin hypermutation in cultured cells. // Immun. Rev. – 1998. – Vol.162. - P.77-87.

Geige P., Brennicke A. RNA-editing in Arabidopsis mitochondria effects 441 C to U changes in ORFs. // PNAS. – 1999. – Vol.96. - N26. P.15324-15329.

Gerber A., O'Connell M.A., Keller W. Two forms of human dsRNA-specific editase-1 (hRED1) generated by the insertion of an Alu-cassette // RNA. – 1997. – Vol.3. - № 5. - P. 453-463.

Gerber A.P., Keller W. RNA editing by base deamination : more enzymes , more targets, new mysteries // // Trend. Biochem. Sci. – 2001. – Vol..26. - N6. - P.376-384.

Gerin J.L. Animal models of HDV infectiopn and disease // ILAR J. – 2001. – Vol..42. - N2. - P.103-106.

Gesteland R.F., Cech T.R., Atkins J.F. / Eds. - // The RNA World. N.Y.: Publ. CSHL-Press. - 1999. – 709p.

Giangreco A., Sowden M.P., Mikityansky I., Smitch H.C. Ethanol stimulates ApoB mRNA editing in the absence of de novo RNA or protein synthesis // Bioch. Biophys. Res. Comm. – 2001. – Vol.289. - N5. - P.1162-1167.

Gibson J.,Crow M.,Kearns J. Kinetoplast DNA minicircles are inherited from both parents in genetic crosses of Trypanosoma brucei // Parasitol. Res. – 1997. – Vol.85. - N 5. – P.483-538 .

Goringer H.U., Koslowsky D.J., Morules T.U., Stuart K. The formation of mitochondrial ribonucleoprotein complexes involving guide RNA molecules in Tryponosoma brucei // RNA. – 1994. – Vol.91. - № 5. - P.1776-1780.

Gotoh B., Komatsu T., Takeuchi K., Yokoo J. Paramyxovirus accessory proteins as interferon antagonists. // Mocrobiol. Immunol. – 2001. – Vol.45. - N12. – P.787-800.

Gott J.M., Visomirski-Robic L.M., Hunter J.L. Substitutional and insertional RNA editing of the cytochrome – C oxidase subunit 1 mRNA of Physarum polycephalum // J. Biol. Chem. – 1993. – Vol.268. - № 34. - P.25483-25486.

Gott J.M., Emeson R.B. Functions and mechanisms RNA editing // Annu. Rev. Genet. – 2000. – Vol.34. - P.499-531.

Grams J., McManus M.T., Hajduk S.L. Processing of polycistronic gRNAs is associated with RNA editing complexes in T.brucei // EMBO J. – 2000. – Vol.19. - N20. - P.5525-5552.

Gray M.W., Cedergren R.,Abel Y., Sankoff D. On the evolutionary origin of the plant mitochondrion and its genome. // .PNAS. – 1989. – Vol..86. - P.2267-2321.

Greger I.H., Khatri L., Ziff E.B. RNA editing at arg607 controls AMPA receptor exit from the endoplasmatic reticulum // Neuron. - 2002. – Vol.34. - N5. - P.759-772.

Greider C.W., Blackburn E.H. A telomeric sequence in the RNA of Tetrahymena telomerase required for telomer repeat synthesis // Nature. – 1989. – Vol.337. - P.331-336.

Grienenberger J.M. RNA editing in plant organelles // RNA editing .The alteration of protein co-

ding sequences of RNA / Ed. R.Benne – London: Publ. Ellis Harwood Ltd. – 1993. - P.154-180.

Gualberto J.M., Bonnard G., Lamattina L., Grienenberger J.M. Expression of the wheat mitochondrial nad3/rps12 transcription unit: correlation between editing and mRNA maturation // Plant. Cell. – 1991. – Vol.3. - P.1109-1120.

Gualberto J.M., Lamattina L., Bonnard G.,Weil J.H., Grienenberger J.M. RNA editing in wheat mitichondria results in the conservation of protein sequences // Nature. – 1989. – Vol.341. - P.660-662.

Gull K. The biology of kinetoplastid parasites: insight and challenges from genomics and post-genomics // Int. J. Parasitol. – 2001. – Vol.31. - N5-6. - P.443-452.

Gurevich I., Englander M.T., Adlersberg M., Siegal N.B., Schmaus C. Modulation of serotonin 2C receptor editing by sustained changes in serotoninergic neurotransmission // J. Neurosci. - 2002b. – Vol..22. - N24. - P.10529-10532.

Gurevich I., Tamir H., Arango V., Dwork A.J., Mann J.J., Schmaus C. Altered editing of serotonin 2C receptor pre-mRNA in prefrontal cortex of depressed suicide victims // Neuron. – 2002. – Vol.34. - N3. - P.349-356.

Hajduk S.L. Defining the editing “reaction” // Trend. Microbiol. – 1997. – Vol.5. - N1. - P.699-703.

Hale S.P., Auld D.S., Schmidt E., Schimmel P. Discrete determination in transfer RNA for editing and aminoacylation // Science. – 1997. – Vol.276. - № 5316. - P.1250-1252.

Handa H., Nakajima K. Different organization and altered transcription of the mitichondrial atp6 gene in male-sterile cytoplasm of rapeseed (Brassica-Napus L) // Curr.Genet. – 1992. – Vol.21. - P.153-159.

Harris R.S., Petersen-Mahrt S.K., Neuberger M.S. RNA editing enzyme Apobec1 and some of its gomologs can act as DNA mutators // Mol. Cell. – 2002. – Vol.10. - N5. - P.1247-1253.

Harvey S.C., Koster A., Yu H., Skolnick P., Baumbarger P., Nisenbaum E.S. AMPA receptor function is

altered in GluR2-deficient mice // J. Mol. Neurosci. – 2001. – Vol.17. - N1. – P.35-43.

Hatzoglou E., Rodakis G.C., Lecanidou R. Complete sequence and gene organization of the mito- chondrial genome of the land snail Albinaria courelea // Genetics. – 1995. – Vol.140. - № 4. - P.1353-1366.

Hausmann S., Jacques J.P., Kolakofsky D. Paramyxovirus RNA editing and the requirement for hexamer genome length // RNA. – 1996. – Vol. 2 - № 10. - P.1033-1045.

Heinemann T., Metzger S., Fisher E.A., Breslow J.L., Huang L.S. Alternative polyadenilation of apolipoprotein B RNA is a major cause of B-48 protein formulation in rat hepatoma cell lines transfected with human apoB-100 minigenes // J. Lipid. Res. – 1994. – Vol.35. - N12. – P.2200-2211.

Heisel R., Combettes B., Brennicke A. Evidence for RNA editing in mitochondria of all major groups of land plants except the Bryophyta // PNAS. – 1994. – Vol.91. - № 2. - P. 629 - 633.

Heisel R., Brennicke A. cDNA cloning of mitichondrial transcripts from Oenothera // Plant .Science. – 1987. -

- Vol.51. – P.225-230.

Helm M., Brule H., Degoul F., Cepanec C., Leroux J.P., Giege R., Florentz C. The presence of modified nucleotides is required for cloverleaf folding of a human mitochondrial tRNA // Nucl. Acid. Res. – 1998. – - - № 7. - Vol.26. - P.1636-1643.

Heltzer M., Schweyen R.V., Mueller M.W. DNA-polymerization catalysed by a group II intron RNA in vitro. // Nucl. Acid. Res. – 1997. – Vol. 25. - № 9. - P.1825-1829.

Henderson J.O., Blanc V., Davidson N.O. Isolation, characterisation and developmwental regulation of the human apobec-1 complementation factor (ACF) gene // BBA. – 2001. – Vol.1522. - N1. - P.22-30.

Henze K., Martin W. How do mitochondrial genes get into the nucleus? // Trend. Genet. – 2001. – Vol.17. - N7. - P.383-387.

Herbert A., Alfken J., Kim Y.G., Mian I.S., Nishikura K., Rich A. A Z-DNA binding domain present in the human editing enzyme, dsRNA adenosine deaminase // PNAS. – 1997. – Vol.94. - № 16. - P.8421-8426.

Herbert A., Lowenhoupt K., Spitzner J., Rich A. Double-stranded RNA adenosine deaminase binds Z-DNA in vitro // Nucl. Acid. Symp. Ser. – 1995. – Vol.33. - P.16-19.

Herbert A., Rich A. RNA processing and the evolution of eukaryotes // Nat. Genet. – 1999. – Vol.21. - N3. - P.265-269.

Herbert A., Rich A. Left-handed Z-DNA: structure and function // Genetica. – 1999. – Vol.106. - N1-2. - P.37-47.

Herbert A., Rich A. The role of binding domains for dsRNA and Z-DNA in the in vivo editing of minimal substrates by ADAR1 // PNAS. – 2001. – Vol..98. - N21. - P.12132-12137.

Herbert A., Wagner S., Nickerson J.A. Induction of protein translation by ADAR1 within living cell nuclei is not dependent on RNA editing // Mol. Cell. – 2002. – Vol.10. - N5. - P.1235-1246..

Herrmann R.G., Maier R.M., Schmitz-Linneweber C. Eukariotic genome evolution: rearrangement and coevolution of compartmentalized genetic information // Philos. Trans. R. Soc. Long. B. Biol. Sci. – 2003. - Vol.358. - N1429. – P.87-97.

Hernould M., Mouras A., Litvak S., Araya A. RNA Editing of the Mitochondrial atp9 Transcript from Tobacco // Nucl. Acid. Res. – 1992. – Vol.20. - P.1809-1810.

Hersberger M., Innerrarity T.L. Two efficiency elements flanking the editing site of cytidine 6666 in the apolipoprotein B mRNA support mooring-dependent editing // J. Biol. Chem. – 1998. – Vol.273. - № 16. - , P.9435-9442.

Hersberger M., Patarroyo-White S., Arnold K.S., Innerrarity T.L. Phylogenetic analysis of the apolipoprotein-B mRNA-editing region. Evidence for a secondary structure between the mooring sequence and the 3'

efficiency element // J.Biol. Chem. – 1999. – Vol.274. - N49. – P.34590-34597.

Hersberger M., Patarroyo-White S., Qian X, Arnold K.S., Rohrer L, Balestra ME, Innerrarity T.L Regulatable liver expression of the rabbit ApoB mRNA-editing enzyme catalytic polypeptide 1 (apobec1) in mice lacking endogenous APOBEC-1 leads to aberrant hyperediting // Biochem. J. – 2003. – Vol..369. – NPt2. - P.255-262.

Herrick-Davis K., Grinde E., Niswender C.M. Serotonin 5-HT2C receptor RNA-editing alters receptor basal activity : implications for serotoninergic signal transduction // J.Neurochem. – 1999. – Vol.73. - N4. - P.1711-1717.

Hirano K., Yong S.G., Farese R.V., Naig J., Sande E., Warburton C., Powell-Braxton L.M., Davidson N.O. Targeted disruption of the mouse apobec-1 gene abolishes apolipoprotein B mRNA editing and eliminates apolipoprotein B48 // J. Biol. Chem. – 1996. – Vol.271. - №17. - P.9887- 9890.

Hirose T., Fan H., Suzuki J.Y., Wakasugi T., Tsudzuki T., Rossel H., Suguira M. Occurance of silent RNA editing in chloroplasts: it's species specificity and the influence of enviromental and developmental conditions. // Plant. Mol. Biol. – 1996. – Vol.30. - № 3. – P.667-672.

Hirose T., Kusumegi T., Sugiura M. Translation of tobacco chloroplast rps14 mRNA depends on a Snine-Dalgorno-like sequences in the 5'-untranslated region but not on internal RNA editing in the coding region. // FEBS Lett. – 1998. – Vol.430. - № 3. -P.257-260.

Hirose T., Kusumegi T., Tsudzuki T., Suguira M. RNA-editing sites in tobacco chloroplast transcript: editing as a possible regulator of chloroplast RNA polymerase activity // Mol. Gen. Genet. – 1999. – Vol..262. - N3. - , P.462-467.

Hirose T., Sugiura M. Both RNA editing and RNA cleavage are required for translation of tobacco chloroplast ndhD mRNA: a possible regulatory mechanism for the expressions of a chloroplast operon consisting of functionally unrelated genes // EMBO J. – 1997. – Vol.16. - N22. - P.6804-6811

Hirose T., Sugiura M. Involvement of a site-specific trans-acting factor and common RNA-bindung protein in the editing of chloroplast mRNAs: development of a chloroplast in vitro RNA editing system // EMBO J. - -2001. – Vol.20. - N5. - P.1144-1152.

Ho C.K., Shuman S. Bacteriophage T4 RNA ligase 2 (gp24.1) exemolifies a family of RNA ligases found in all phylogenetic domains // PNAS. – 2002. – Vol.99. - N20. - P.12709-12714.

Hoch B., Maier R.M., Appel K., Igloi G.L., Kossel H. Editing of the chloroplast mRNA by creation of initiation codon // Nature. – 1991. – Vol.353. - P.187-180 .

Honjo T., Kinoshita K., Muramatsu M. Molecular mechanism of CSR: linkage with SHM // Annu. Rev. Immun. – 2002. – Vol.20. - P.165-196.

Horton T.L., Landweber L.E. Rewriting the information in DNA: RNA editing in kinetoplastids and myxomycetes // Curr. Opin. Microbiol. – 2002. – Vol.5. - N6. - P.620-626.

Horton T.L., Landweber L.E. Evolution of four types of RNA editing in myxomycetes // RNA. – 2000. – Vol. 6. - N10. - P.1339-1346.

Horvat A., Berry E.A., Maslov D.A. Translation of the edited mRNA for cytochrome-b in trypanosome mitochondria // Science. - 2000. – Vol.287. - N5458. - P.1639-1640.

Howad W., Kempken F. Cell type-specific loss of atp6 RNA editing in cytoplasmic male sterile sorghum bicolor // PNAS. – 1997. – Vol.94. - № 20. - P.11090-11095.

Hsu S.C., Syu W.J., Sheen I.J., Liu H.T., Jeng K.C., Wu G.C. Varied assembly and RNA editing afficiencies between genotypes I and II HDV and their implications // Hepatology. – 2002. – Vol.35. - N3. - P.665-672.

Huang C.E., Cruz-Reyes J., Zhelonkina A.G., O’Hearn S., Wirtz E., Solner-Webb B. Roles for ligases in the RNA editing complex of T.brucei: band IV is needed for U-deletion and RNA repair // EMBO J. – 2001. – Vol.20. - N17. - P.4694-4703.

Huang C.E., O’Hearn S.F., Solner-Webb B. Assembly and function of the RNA editing in T.brucei requires band III protein // Mol. Cell. Biol. – 2002. – Vol.22. - N9. - P.3194-3203.

Igo R.P., Weston D.S., Ernst N.L., Panigrahi A.K., Salavati R., Stuart K. Role of uridylate-specific exoribonuclease activity in T.brucei RNA editing // Eukar. Cell. - 2002. – Vol.1. - N1. - P.112-118.

Igo R.P., Lawson S.D., Stuart K. RNA sequences and base pairing effects on insertion editing in T.brucei // Mol Cell. Biol. – 2002. – Vol..22. - N5. - P.1567-1576.

Iseni F., Baudin F., Garcin D., Marq J.B., Ruigrok R.W., Kolakofsky D. Chemical modification of nucleotide bases and mRNA editing depend on hexamer or nucleoprotein phase in Sendai virus nucleocapsids // RNA. - 2002. – Vol.8. - N8. - P.1056- 1067.

Itchoda N., Nishizawa S., Nagano H., Kubo T., Mikam K. The sugar beet mitochondrial nad4 gene: an intron loss and its phylogeneti implication in the Caryophyllales // Theor. Appl. Genet. – 2002. – Vol.104. - N2-3. - , P.209-213.

Ito Y., Nakazono M., Kadowaki K., Tsutsumi N., Hirai A. RNA-editing of transcripts of the gene for apocytochrome-B (cob) in rice mitochondria // Genes. Genet. Syst. – 1996. – Vol.71. - № 2. - P.85-89.

Iwabuchi M., Kyozuka J., Shimamoto K. Processing followed by complete editing of an altered mitochondrial

atp6 RNA restores fertility of cytoplasmic male sterile rice // Embo J. – 1993. – Vol.12. - № 4. - P. 1437- 1446.

Jacobs H., Bross L. Towards an understanding of SHM // Curr. Opin. Immunol. – 2001. – Vol.13. - N2. –

P.208-218.

Jaffares D.C., Poole A.M., Penny D. Relicts from the RNA-world // J. Mol. Evol. – 1998. – Vol.46. - № 1. –

P.18-36.

Jaikaran D.C., Collins C.H., MacMillan A.M. A-to-I editing by ADAR2 requires formation of a ternary

complex on the GluR-B R/G site // J. Biol. Chem. – 2002. – Vol.277. - N40. - P.37624-37629.

Jakubowski H. Proofreading in vivo. Editing of homocysteine by amynoacyl-tRNA synthetases in Escherichia Coli // J. Biol. Chem. – 1995. – Vol.270. - № 30. - P.17672-17673.

Janke A., Feldmaier-Fuchs G., Thomas W.K., Von Halseler A., Paabo S. The mursupial mitochondrial genome

and the evolution of placental mammalians // Genetics. – 1994. – Vol.137. - № 1. – P. 243-256.

Janke A., Paabo S. Editing of a tRNA anticodon in marsupial mitochondria changes it's codon recognbtion. //

Nucl. Acid. Res. – 1993. – Vol. 21. - № 7. - P.1523-1525.

Janke A., Xu X., Arnson U. The complete mitochondrial genome of the Wallaroo (Macropus robustus) and the phylogenetic relatioship among monotremata, Marsupialia, and Eutheria // PNAS. – 1997. – Vol. 94. - № 4. - P.1276-1281.

Jayan G.C., Casey J.L. Increased RNA editing and inhibition of HDV replication by high-level expression of ADAR1 and ADAR2 // J. Virol. - 2002a. – Vol.76. - N8. - P.3819-3827.

Jayan G.C., Casey J.L. Inhibition of HDV RNA editing by short inhibitory RNA-mediated knockdown of ADAR1 but not ADAR2 expression // J. Virol. - 2002b. – Vol.76. - N23. - P.12399-12404.

Kabb A.L., Oppegard L.M., McKenzie B.A., Connell G.J. A mRNA determinant of gRNA-directed kinetoplastid editing // Nicl. Acid. Res. – 2001. – Vol.29. - N12. - P.2575-2580.

Kable M.L., Seiwert S.D., Heidmann S., Stuart K. RNA-editing: a mechanism for gRNA-specified uridylate insertion into precursor mRNA // Science. – 1996. – Vol.273. - № 5279. - P.1189-1195.

Kable M.L., Heidmann S., Stuart K.D. RNA-editing: getting U into RNA // Trend In Biochemistry Science

(TIBS). – 1997. – Vol.22. - №5. - P.162-166.

Kapushos S.T., Alfonzo J.D., Rubio M.A., Simpson L. End proccessing precedes mitochondrial importation and -editing of tRNAs in Leishmania.tarentolae // J. Biol. Chem. – 2000. – Vol.275. - N48. - P.37907-37914.

Karcher D., Bock R. Site-selective inhibition of plastid RNA editing by heat shock and antibiotics: a role for plastid translation in RNA editing // Nucl. Acid. Res. – 1998. – Vol.26. - № 5. - P.1185-1190.

Karcher D., Bock R. The aminoacid sequence of a plastid protein is developmentally regulated by RNA editing // J.Biol.Chem. - 2002a. – Vol.277. - N7. - P.5570-5574.

Karcher D., Bock R. Temperature sensitivity of RNA editing and intron splicing reaction in the plastid ndhB transcript // Curr. Genet. - 2002b. – Vol.41. - N1. – P.48-52.

Karpinska B., Karpinski S., Hallgren J. The chlB gene encoding a subunit of light-independent protochlorophyllide reductase is edited in chloroplast of conifers // Curr. Genet. – 1997. – Vol.31. - № 4. - P.343-347. Kato A., Kiyotomi K., Sakai Y., Yoshida T., Nagai Y. The paramyxovirus , Sendai virus, V-protein encodes a luxury function required for viral pathogenesis // EMBO J. – 1997. – Vol.16. - N13. - P.578-587.Kawahara Y., Kwak S., Sun H., Ito K., Hashida H., Aizawa H., Jeong S.Y., Kanasawa I. Human spinal motoneurons expressed low relative abundance of GluR2 mRNA: an implication for excitotoxity in ALS // J. Neuorochem. – 2003. – Vol.85. - N3. - P.680-689.

Kawasaki F., Collins S.C., Ordway R.W. Synaptic calcium-channel function in Drosophila: analysis and transformation rescue of temperature-sensitive paralytic and lethal mutations of cacophony // J. Neurosci. - 2002. – Vol.22. - N14. - P.5856-5864.

Keegan L.P., Gerber A.P., Brindle J., Leemans R., Gallo A., Keller W., O′Connell M.A. The properties of a tRNA-specific adenosine deaminase from Drosophila melanogaster support on evolutionary link between pre-mRNA editing and tRNA-modification // Mol. Cell. Biol. – 2000. – Vol..20. - N3. - P.825-833.Keller W., Wolf J., Gerber A. Editing of messenger RNA precursors and of tRNA by adenosine to inisine conversion // FEBS Lett. – 1999. – Vol.452. - N1-2. - P.71-76. Kempken F., Mullen J.H., Pring D.R., Tang H.V. RNA editing of Sorghum mitochondrial atf6 transcripts changes 15 amino acids and generates a carboxy-terminus identical to yeast // Curr. Genet. – 1991. – Vol. 20. - P.417-422.

Kim U.G., Lowenhaupt K., Schwartz T., Rich A. The interaction betweeb Z-DNA and the Zab domain of dsRNA-dependent adenosine deaminase characterized using fusion nucleases // J.Biol.Chem. – 1999. – Vol. 274. - N27. - P.19081-19086.

Kim U.G., Wang Y., Sanford T., Zebg Y., Nishikura K. Molecular cloning of cDNA for dsRNA agenosine deaminase, a candidate enzyme for nuclear RNA editing // PNAS. – 1994. – Vol.91. - № 24. - P.11457-11461.

Kinoshita K., Honjo T. Linking CSR with SHM. // Nat. Rev. Mol. Cell. Biol. – 2001. – Vol.2. - N7. - P.493-503.

Klein K.G., Olson C.L., Donelson J.E., Engman D.M. Molecular comparison of the mitochondrial and cytoplasmic hsp70 of Trypanosoma cruzi, brucei and Leichmania major // J. Microbiol. Eukaryot. – 1995. - Vol.42. - № 5. - P. 473-476.

Knight R.D., Freeland S.J., Landweber L.F. Rewiring the keyboard: evolvability of the genetic code // Nat.Rev. Genet. – 2001. - Vol.2. - N1. - P.49-58.

Knight S.W., Bass B.L. The role of RNA editing by ADARs in RNAi // Mol. Cell. – 2002. - Vol.10. - N4. - P.809-817.

Koller J., Muller U.F., Scmidt B., Missel A., Kruft V., Stuart R., Goringer H.U. Trypanosoma brucei a BP21. An arginine-rich mitochondrial protein that binds to guide RNA with hight affinity // Journal Biological Chemistry. – 1997. - Vol.272. - № 6. – P. 2449-2457.

Konstantinov Y.M., Moller I.M. A leucin motif in the amino acid sequence of subunit 9 of the mitochondrial ATPase, and other hydrophobic membrane proteins, that is highly conserved by editing // FEBS Lett. – 1994. - Vol.354. - № 3. – P.245-247.

Kortenbruck G., Berger E., Speckmann E.J., Musshoff U. RNA editing at the Q/R site for the GLUR2, GLUR5, and GLUR6 in hippocampus and temporal cortex from epileptic patients // Neurobiol. Dis. – 2001. - Vol.8. - - N3. - P.459-468.

Koslowsky D.J., Bhat G.J., Read L.K., Stuart K. Cycles of progressive realignment of gRNA with mRNA in RNA editing // Cell. – 1991. - Vol.67. - № 3. – P.537-546.

Koslowsky D.S., Yahampath G. Mitochondrial mRNA 3'-cleavage/polyadenylation and RNA-editing in Trypanosoma brucei are independent events // Molecul. Biochem. Parasitol. – 1997. - Vol.90. - № 1. – P. 81-94.

Kubo T., Mikami T. A duplicated sequence in sugarbeet mitochondrial transcripts is differentially edited: analysis of orfB and it's derivative orf324 mRNAs // BBA. – 1996. - Vol.1307. - № 3. - P.259-262.

Kubo N., Takano M., Nishiguchi M., Kadowaki K. Mitochondrial sequence migrated downstream to a nuclear V-ATPase B gene is transcribed but non-functional // Gene. – 2001. - Vol.271. - N2. - P.193-201.

Kudla J., Igloi G., Metzlaff M., Hagemann R., Kossel H. RNA editing in tobacco chloroplasts leads to formation of a translatable psbL messenger RNA by a C-to-U substitution within the initiation codon // EMBO J. – 1992. - Vol.11. - P.1099-1103.

Kugita M., Kaneko A., Yamamoto Y., Takeya Y., Matsumoto T., Yoshinaga K. The complete nucleotide sequence of the hornwort (Anthoceros formosae) chloroplast genome: insight into the earliest land plants // Nucl. Acid. Res. - 2003a. - Vol.31. - N2. - P.716-721.

Kugita M., Yamamoto Y., Fujikawa T., Matsumoto T., Yoshinaga K. RNA editing in hornwort chloroplast makes more than half the genes functional // Nucl. Acid. Res. - 2003b. - Vol.31. - N9. - P.2417-2423.

Kung S.S., Chen Y.C., Lin W.H., Chen C.C., Chow W.Y. Q/R RNA editingof the AMPA receptoer subunit 2 (GRIA2) transcript evolves no later then the appearence cartilaginous fiches // FEBS Lett. – 2001. - Vol.509. - N2. - P.277-281.

Kurihara-Yonemoto S., Handa H. Low temperature affects the processing pattern and RNA editing status of the mitochondrial cox2 transcripts in wheat // Curr. Genet. – 2001. - Vol.40. - N3. – P.203-208.

Kyrabayashi A., Ueshima R. Complete sequence of the mitochondrial DNA of the primitive opisthobranch gastropod Pupa strigosa: systematic implication of the genome organization // Mol. Biol. Evol. – 2000. – Vol.17. - N2. – P.266-277.

Laforest M.J., Roewer I., Lang B.F. Mitochondrial tRNAs in the lower fungus Spizellomyces punctatus: tRNA editing and UAG "stop"- codons recognized as lencine // Nucl. Acid. Res. – 1997. – Vol.25. - № 3. - P.626-632.

Lai F., Chen C.X., Carter K.C., Nishikura K. Editing of glutamate receptor B subunit ion channel RNAs by four alternatively spliced DRADA2 dsRNA adenosine deaminase // Mol. Cell. Biol. – 1997. - Vol.17. - № 5. - P.2413-2424.

Lai F., Drakas R., Nishikura K. Mutagenic analysis of dsRNA adenosine deaminase, a candidate enzyme for RNA editing of glutamate-gated ion channel transcripts // J. Biol. Chem. – 1995. – Vol.270. - № 29. - P.17098-17105.

Lai M.M. The molecular biology of hepatits delta virus // Annu. Res.Biochem. – 1995. - Vol.64. – P 259-286.

Lau P.P., Villanueva H., Kobayashi K., Nakamuta M., Chang B.H., Chan L. A DnaJ protein, apobec1-binding protein-2, modulates ApoB mRNA editing // J. Biol. Chem. – 2001. - Vol.276. - N49. - P.46445-46452.

Lamattina L., Weil G.H., Grienenberger J.M. RNA editing at a splising site of NADH degydrogenase subunit 1V gene transcript in wheat mitochondria // FEBS Lett. – 1989. - Vol.258. – P.79-83.

Landweber L.F., Gilbert W. Phylogenetic analysis of RNA editing – a primitive genetic phenomen // PNAS. - 1994. - Vol.91. - № 3. - P.918-921.

Landweber L.F, Gilbert W. RNA-editting as a source of genetic variation // Nature. – 1993. - Vol.363. - P.179- 182.

Landweber L.F, Kari L. The evolution of cellular compyting: nature΄s solution to a computional problem // Biosystems. – 1999. - Vol.52. - N1-3. - P.3-13.

Lavrov D.V., Brown W.M., Boore J.L. A novel type of RNA editing occurs in the mitochondrial tRNA of the centipede Lithobius forficatus // PNAS. – 2000. – Vol.97. - N25. - P.13738-13742.

Lau P.P., Chang B.H., Chan L. Two-hybrid cloning identifies an RNA-binding proteinm, GRY-RBP , as a component of apobec1 editosome // Bioch. Biophys. Res. Commun. – 2001. – Vol.282. - N4. - P.977-983.

Laxminarayana D., Khan I.U., Kammer G. Transcript mutations of the alpha regulatory subunit of protein kinase A and up-regulation of the RNA editing gene transcript lupus T lymphocytes // Lancet. – 2002. – Vol.360. - N9336. - P.842-849.

Lee C.J., Kong H., Manzini M.C., Albuquerque C., Chao M.V., McDermott A.B. Kainate receptors expressed by a subpopulation of developing nociceptors rapidly switch from high to low Ca+2 permeability // J. Neurosci. – 2001. – Vol.21. - N13. - P.4572-4581.

Leeuwen F.W., Kleijn D.P., Hurk H.H., Neubauer A., Sonnemans M.A., Slujis J.A., Koycu A. Frameshift mutants of beta amyloid precursor protein and ubiquitin-B in Alzheimer's and Down patients // Science. – 1998. – Vol.279. - № 5348. - P.242-247.

Lee S.Y., Lee S.T., Chang K.P. Transkinetoplastidy – a novel phenomen involving bulk alteration of mitochondrion-kinetoplast DNA of a trypanosomatid protozoan // J. Protozool. – 1992. – Vol.39. - N 1. - P.190-196.

Lehmann K.A., Bass B.L. DsRNA adenosine deaminases ADAR1 and ADAR2 have overlapping specificities. // Biochemistry. – 2000. – Vol..39. - N42. - P.12875-12884.

Lei M., Samuel C.E. Adenovirus VAI RNA antagonizes the RNA-editing activits of the ADAR adenosine deaminase // Virilogy. – 1998. – Vol.245. - № 2. - P.188-196.

Leung S.S., Koslowsky D.J. Interaction of mRNAs and gRNAs involved in trypanosome mitochondria RNA editing: structure probing of an mRNA bound to its cognate gRNA // RNA. – 2001. - Vol.7. - N12. - P.1803-1816.

Leung S.S., Koslowsky D.J. RNA editing in T.brucei: characterization of gRNA U-tail interactions with partially edited mRNA substrates // Nucl. Acid. Res. – 2001. - Vol.29. - N3. - P.703-709.

Levitan A., Xu Y.X.., Ben-Dov C., Ben-Shlomo H., Zhabg Y., Michaeli S. Characterization of a novel trypanosomatid small nucleoar RNA // Nucl. Acid. Res. – 1998. - Vol.26. - № 7. – P.1775-1783.

Liao W., Hong S.H., Chan B.H., Rudofph F.B., Clark S.C., Chan L. Apobec-2, a cardiac- and skeletal muscle-specific member of the cytidine deaminase supergene family // Bioch.Bioph.Res.Commun.- 1999. – Vol.260. - N2. - P.398-404.

Liang X.H., Liu L., Michaeli S. Identification of the first trypanosome H/ACA RNA that guides pseudouridine formation on rRNA // J. Biol. Chem. – 2001. - Vol.276. - N43. – P. 40313-40318.

Lieber M. Antibody diversity: a link between CSR and SHM // Curr. Biol. – 2000. - Vol.10. - N21. – P.R797-R800.

Lin F.M., Lee C.M., Wang N.C., Chao M. Initiation of RNA replication of cloned Taiwan-3 isolate of HDV genotype III in cultured cells // Bioch. Biophys. Res. Comm. – 2003. - Vol.306. - N4. – P.966-972.

Linden D., Sjoberg A., Asp L., Carlsson L., Oscarsson J. Direct effects of growth hormone on production and secretion of ApoB from rat hepatocytes // Am. J. Physiol. Endocr. Metab. – 2000. - Vol.279. - N6. - E1335-E1346.

Lipowsky G., Bischoff F.R., Izaurralde E., Kutay U., Schefter S., Gross H.J., Beier H., Gerlich D. Coordination of tRNA nuclear export with processing of tRNA // RNA. – 1999. - Vol.5. - N4. - P.539-549.

Liu M.M., Zhu M., Schartt M.D. Sequence dependent hypermutation of immunoglobulin heavy chain in cultered B-cells // PNAS. – 1997. – Vol.94. - N10. - P.5284-5289

Liu Y., George C.X., Patterson J.B., Samuel C.E. Functionally distinct dsRNA-binding domaing associated with alternative splice site variants of the interferon-inducible dsRNA – specific adenosine deaminase // J. Biol. Chem. – 1997. - Vol.272. - № 7. - P. 4419-4428.

Liu Y., Samuel C.E. Editing of glutamate receptor subunit B pre-mRNA by splice-site variants of interferon-inducible dsRNA-specific adenosin deaminase ADAR1 // J.Biol.Chem. – 1999. - Vol.274. - N8. - P.5070-5077.

Liu Y., Wolf K.S., Samuel C.E., Jacobs B.L. Vaccinia virus E3L interferon resistance protein inhibits the interferon-induced adenosin deaminase A-to-I editing activity // Virology. – 2001. - Vol.289. - N2. - P.378-387.

Liu Y., Lei M., Samuel C.E. Chimeric dsRNA-specific adenosin deaminase ADAR1proteins reveal functional selectivity of dsRNA-binding domains from ADAR1 and protein kinase PKR // PNAS. – 2000. - Vol.97. - N23. - P.12541-12546.

Lonergan K.M., Gray M.W. Editing of transfer RNA in Acanthamoeba costellanii mitochondria // Science. - 1993. – Vol.259. - № 5096. – P.812-816.

Lorentz A., Plonne D., Schulze H.P., Dargel R. Dexamethasone enhanced by insulin, but not by thyroid hormones stimulates apolipoprotein B mRNA editing in cultured rat hepatocytes depending on the developmental stage // FEBS Lett. – 1996. – Vol.391. - № 1-2. – P.57-62

Lowe D.L., Jahn K., Smith D.O. Glutamate receptor editings in the mammalian hippocampus and avian neurons // Mol. Brain. Res. – 1997. - Vol.48. - № 1. – P.37-44.

Lu B.W., Hanson M.R. A Single Homogenous Form of ATP6 Protein Accumulates in Petunia Mitochondria Despite the Presense of Differentially Edited atp6 Transcript // Plant. Cell. – 1994. - Vol.6. - P.1955-1968.

Lu B., Wilson R.K., Phreaner C.G., Mulligan R.M., Hanson X. Protein polymorphism generated by differential RNA editing of Plant mitochondrial rps12 gene // Mol. Biol. Cell. – 1996. – Vol.16. - № 4. - P.1543-1549.

Lu M.Z., Smith A.E., Wang X.R. RNA editing in gymnospers and it's impact on the evolution of the mitochondrial cox1 gene // Plant. Mol. Biol. -.1998. – Vol.37. - № 2. - P.225-234.

Lutz K.A., Maliga P. Lack of conservation of editing sites in mRNA that encode subunits of the NAD(P)H dehydrogenase complex in plastid and mitochondria of Arabidopsis thaliana // Curr. Genet. – 2001. – Vol..40. - , N3. - P.214-219.

Lye L.F., Chen D.H., Suyama Y.Selective import of nucledar-encoded tRNA into mitichondria of the protozoan Leichmania tarentolae // Mol. Biochem. Parasitol. – 1993. – Vol.58. - № 2. - P.233-245.

Ma E., Tucker M.C., Chen Q., Haddad G.G. Developmental expression and enzymatic activity of pre-mRNA deaminase in D.melanogaster // Brain. Res. Mol. Brain. Res. – 2002. – Vol.102. - N1-2. – P.100-104.

Maas S., Kim Y., Rich A. Sequence, genomic organization and functional expression of the murine tRNA-specific adenosine deaminase ADAT1 // Gene. – 2000. - Vol.243. - N1-2. - P.59-66.

Mangeat B., Turelli P., Caron G., Friadli M., Perrin L., Trono D. Broad antiretroviral defence by human APOBEC3G through lethal editing of nascent reverse transcripts // Nature. – 2003. - May 28 [Epub ahead of print].

Maslov D.A., Nawathean P., Scheel J. Partial kinetoplast–mitochondrial gene organisation and expression in the respiratory deficient plant trypanosomatid Phytomonas serpens // Molecul. and Biochem. Parasitol. – 1999. – Vol.99. - P.207-221 .

Maslov D.A., Avila H.A., Lake J.A., Simpson L . Evolution of RNA editing in kinetoplastid protozoa // Nature. – 1994. – Vol.368. – P.345-348. .

Maas S., Melcher T., Seeburg P.H. Mammalian RNA-dependent deaminases and edited mRNAs // Curr. Opin. Cell. Biol. – 1997. – Vol.9. - № 3. – P.343-349.

Maas S., Melher T., Herb A., Seeburg P.H., Keller W., Krause S., Higuchi M., O'Connell M.A. Structural requirement for RNA editing in glutamate receptor pre-mRNAs by recombinant dsRNA adenosine deaminase. // J. Biol. Chem. – 1996. – Vol.271. - № 21. – P.12221-12226

Maas S., Patt S., Schrey M., Rich A. Underediting of GluR-B mRNA in malignant gliomas // PNAS. – 2001. - Vol.98. - N25. – P.14687-14692.

MacGinnitie A.J., Anant S., Davidson N.O. Mutagenesis of apobec-1, the catalytic subunit of the mammalian apolipoprotein B mRNA editing enzyme, reveals distinct domains that mediate cytosine nucleoside deaminase RNA binding, and RNA editing activity // J. Biol.Chem. – 1995. – Vol.270. - №24. - P.14768-14775.

Mahendran R., Spottswood M.S., Ghate A., Ling M.L., Jeng K., Miller D.L. Editing of the mitochondrial smale subunut rRNA in Physarum polycephalum // EMBO J. – 1994. – Vol.13. - N1. – P.232-240.

Marchfelder A., Brennike A., Binder S. RNA-editing is required for efficient excision of tRNA (Phe) from precursors of plant mitochondria // J. Biol. Chem. – 1996. – Vol. 271. - № 4. – P.1898-1903.

Marechal-Dronard L., Cosset A., Remacle C., Ramamonjisoa D., Deitrich A. A single editing event is a prerequisite for efticient processing of potato mitochondrial phenylalanine tRNA // Mol. Biol. Cell. – 1996. – Vol.16. - № 7. – P.3504-3510.

Marechal-Dronard L., Kumar R., Remacle C., Small I. RNA editing of larch mitochondrial tRNA (His) precursors is a prerequisite for processing // Nucl. Acid. Res. – 1996. - Vol.24. - №16. – P.3229-3234.

Mayer M., Schiffer S., Marchfelder A. TRNA 3’-processing in plants: nuclear and mitochondrial activities differ // Biochemistry. – 2000. – Vol.39. - N8. – P.2096-2105.

McGormick-Graham M., Romero D.P. A Single telomerase DNA is sufficient for the synthesis of variable telomeric DNA repeats in ciliates of the genus Paramecium // Mol. Cell. Biol. – 1996. - Vol.16. - № 4. - P.1871-1879.

McManus M.T., Adler B.K., Pollard V.W., Hajdyk S.L. Trypanosoma brucei guide RNA poly(U) tail is stabilized by cognate mRNA // Mol. Cell. Biol. – 2000. – Vol.20. - N3. - P.883-891.

McManus M.T, Shimamura M, Grams J, Hajdyk S.L. Identification of candidate mitochondrial RNA editing ligase from T.brucei // RNA. – 2001. – Vol.7. - N2. - P.167-175.

Meffre E., Catala N., Seltz F., Ficher A., Nussenzweig M.C., Durandu A. Somatic ypermutation shapes the antibody repertuare of memory B cellsin human // J. Exp. Med. – 2001. – Vol.194. - N3. – P.375-378

Mehta A., Kinter M.T., Sherman N.E., Driscoll D.M. Molecular cloning of apobec-1 complementation factor, a novel RNA-binding protein involved in the editing of apolipoprotein B mRNA // Mol.Cell.Biol. – 2000. - Vol.20. - N5. - P.1846-1854.

Mehta A., Driscoll D.M. Identification of domains in apobec1 complementation factor required for RNA binding and apoB mRNA editing // RNA. – 2002. – Vol.8. - N1. - P.69-82.

Meli M., Albert-Fournier B., Maurel M.C. Recent findings in the modern RNA world // Int. Microbiol. – 2001.

– Vol.4. - N1. - P.5-11.

Michel F., Umesono K., Oseki H. Comparative and functional anatomy of group 11 catalitic introns – a review. // Gene. – 1989. – Vol.82. – P.5-30.

Miller D., Mahendran R., Spottswood M., Ling M., Wang S., Yang N., Costandy H. RNA editing in mitochondria of Physarum polycephalum. // RNA editing: The alteration of protein coding sequences of RNA /by ed. Benne R. – London: Publ.Ellis Horwood Ltd. – 1993. – P.87-103.

Melcher T., Maas S., Higuchi M., Keller W., Seeburg P.H. Editing of alpha-amino-3-hydroxy-5-methylisoxazole-U-propionic acid receptor Glu-RB pre-mRNA in vitro reveals site-selective adenosine to inosine conversion // J. Biol. Chem. – 1995. - Vol.270. - № 15. - P.85-89.

Militello K.T., Read L.K. Coordination of kRNA editing and polyadenilation in Trypanosome brucei mitochondria: complete editing is not required for long poly-A tract addition // Nucl. Acid. Res. – 1999. - Vol.27. - N5. - P.1377-1385.

Minegishi Y., Lavoie A., Cunnigham-Rundles C., Bedard P.M., Hebert J., Cote L., Dan K., Sedlak D., Buckley R.H., Fisher A., Durandy A., Conley M.E. Mutations in AID in patient with hyper IgM syndrome // Clin. Immunol. – 2000. – Vol.97. – N3. – P.203 -210.

Missel A., Goringer H.U. Trypanosoma brucei mitochondria contain RNA helicase activity // Nucl. Acid. Res. – 1994. – Vol.22. - № 20. - P.4050-4056.

Mittaz L., Antonarakis S.E., Higuchi M., Scott H.S. Localization of a novel human RNA-editing deaminase (hRED2 or ADARB2) to chromosome 10p15 // Hum. Genet. – 1997. – Vol.100. - № 3-4. - P.398-400.

Miyamoto T., Obokato J., Sugiura M. Recognition of RNA editing sites is directed by unique proteins in chloroplast: biochemical identification of cis-acting elements and trans-acting factors involved in RNA editing in tobacco and pea chloroplasts // Mol. Cell. Biol. – 2002. – Vol.22. - N19. - P.6726-6734.

Miyata Y., Sugiura C., Kobayashi Y., Hagiwara M., Sugita M. Chloroplast ribosomal S14 protein transcript is edited to create a translation initiation codon in the moss Physcomitrella patens // BBA. – 2002. – Vol..576. - - N3. - P.346-349.

Morl M., Dorner M., Paabo S. C to U editing and modifications during the maturation of the mitochondrial tRNA (Asp) in marsupials // Nucl. Acid. Res. – 1995. – Vol.23. - № 17. – P.3380-3384.

Morse D.P., Aruscavage P.J., Bass B.L. RNA hairpins in noncoding regions of human brain and Caenorhabditis elegans mRNA are edited by adenosine deaminases that act on RNA // PNAS. – 2002. – Vol. 99. - N12. - P.7906-7911.

Mrowka C., Schedl A. Wilms’ tumor supressor gene WT1: from structure to renal pathophysiologic features // J. Am. Soc. Nephrol. – 2000. – Vol.11 (Suppl 16:S). - P.106-115.

Mu J.J., Chen D.S., Chen P.J. The conserved serin 177 in the delta antigen of HDV is one putative phosphorilation site and is required for efficient viral RNA replication // J. Virol. – 2001. – Vol.75. - N 19. - P.9087-9095.

Mukhopadhyay D., Anant S., Lee R.M., Kennedy S., Viskochil D., Davidson N.O. CU editing of neurofibromatosis 1 mRNA occurs in tumors that express both the type II transcript and apobec-1, the catalytic subunit of the apoB mRNA editing enzyme // Am. J. Hum. Genet. – 2002. – Vol.70. – N1. - P.38-50.

Muller U.F., Goringer H.U. Mechanism of the gBP21-mediated RNA/RNA annealing reaction: matchmaking and charge reduction // Nucl. Acid. Res. – 2002. – Vol.30. - N2. - P.447-455.

Muller U.F., Lambert L., Goringer H.U. Annealing of RNA editing substrates faciliated by gRNA-binding protein gBP21 // EMBO J. – 2001. – Vol..20. - N6. – P.1394-1404.

Mulligan R.M., Leon P., Walbot V.Transcriptional and posttranscriptional regulation of maize mitochondial

gene expression // Mol . Cell. Biol. – 1991. - Vol.11. - P.533-543.

Mulligan R.M., Maliga P. RNA Editing in Mitochondria and Plastids // A Look Beyong Transcription: Mechanims Determing mRNA and Translation in Plants / Eds. Bailiey-Serres J., Gallie D.R. – Baltimore: Amer. Soc. Plant. Physiol. – 1998. - P.153-161.

Mukhopadhyay D., Plateroti M., Anant S., Nassir F., Samarut J., Davidson N.O. Thyroid hormone regulates hepatic triglyceride mobilization and ApoB mRNA editing in a murine model of congenital hypothyroidism // // Endocrinology. – 2003. – Vol.144. - N2. - P.711-719.

Mundel C., Schuster W. Less of RNA editing of rps1 sequence in Oenothera mitochondria // Curr. Genet. – 1996. – Vol..30. - № 5. - P.455-460.

Muramatsu M., Kinochita K., Fagarasan S., Yamada S., Shinkai Y., Honjo T. Class switch recombinational hypermutation require activation-induced cytidin-deaminase (AID), a potential RNA-editing enzyme // Cell. - 2000. – Vol.102. - N5. - P.553-563.

Muramatsu M., Sankaranand V.S., Anant S., Sugai M., Kinochita K., Davidson N.O., Honjo T. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in GCs B-cell // J. Biol. Chem. – 1999. – Vol.274. – N26. – P.18470-18476.

Nagalla S.R., Barry B.J., Spindel E.R. Cloning of complementary DNA encoding the amphibian bombesin—like peptides Phe8 and Leu8 phyllolitozin from Phyllomeduga Sauvagei: patential role of U to C RNA editing in generating neuropeptide diversity // Mol. Endocrinol. – 1994. - Vol.8. - №8. - P.943-951.

Nagaoka H., Muramatsu M., Yamamura N., Kinoshita K., Honjo T. AID-directed hypermutation in the immunoglobuli Smu region: implication in a common step of CSR and SHM // J. Exp. Med. – 2002. - Vol.195. - N4. - P.529-534.

Nagent J.M., Palmer J.D. RNA-mediated transfer of the cox2 gene from the mitochondrion to the nucleus during flowering plant evolution // Cell. – 1991. - Vol.66. - P.473-481.

Nakajima Y., Mulligan R.M. Heat stress results in incomplete C-to-U editing of maize chloroplast mRNAs and correlates with changes in chloroplast transcription rate // Curr. Genet. – 2001. - Vol.40. - N3. - P.209-213.

Nakazono M., Ito Y., Tsutsumi N., Hirai A. The gene for a subunit of an ABC-type heme transporter is transcribed together with the gene for subunit 6 of NADH dehydrogenase in rice mitochondria // Curr. Genet. 1996. - Vol.29. - № 5. – P. 412-416.

Navaratnam N., Bhattacharya S., Fujino T., Patel D., Jurmus A.L. Evolutionary origins of apoB mRNA editing: catalysis by a cytidine deaminase that has acquired a novel RNA-binding motif at its active site // Cell. -1995. - Vol.81. - № 2. - P.187-195. Nishikura K., Kim U. Double-stranded RNA adenosine deaminase : a potential agent for RNA editing ?

// RNA-editing /Ed. R.Benne. – London: Publ. Ellis Horwood Ltd. – 1993. - P.180-193.

Niswender C.M., Herrick-Davis K., Dilley G.E., Meltzer H.Y., Overholser J.C., Stockmeier C.A., Emeson R.B., Sanders-Buch E. RNA editing of the human serotonin 5-HT2C receptor : alterations in suicide and implication for serotoninergic pharmacotherapy // Neuropsyhopharmacology. – 2001. - Vol.24. - N5. - P.478-491.

Noguchi E., Shibasaki M., Inudou M., Kamioka M., Yokouchi Y., Yamakawa-Kobayashi K., Hamagushi H., Matsui A., Arinami T. Association between a new polymorphism in the AID (AICDA) gene and atopic asthma and the regulation of total serum IgE levels // J. Allerg. Clin. Immun. – 2001. - Vol.108. - N3. - P.382-386.

Notsu Y., Masood S., Nishikawa T., Kubo N., Akiduki G., Nakazono M., Hirai A., Kadowaki K. The complete sequence of the rice (Oryza sativa L) mitochondrial genome: frequent DNA sequence acquisition and loss during the evolution of flowering plants // Mol. Gen. Genomics. – 2002. - Vol.268. - N4. - P.434-445.

Novo F.J., Kruszewski A., MacDermot K.D., Goldsprink G., Gorecki D.C. Editing of human alpha-galactosidase RNA resulting is a pyrimidine to purine conversation // Nucl. Acid. Res. – 1995. - Vol.23. - № 14. - P.2636-2640.

O'Connell M.A., Gerber A., Keller W. Purification of human dsRNA-specific editase 1 (hRED1) involved in editing of brain glutamate receptor B pre-mRNA // J. Biol. Chem. – 1997. - Vol.272. - № 1. - P. 473-478.

Oda K., Yamato K., Ohta E., Nakamura Y., Takemura M., Nozato N., Akashi K., Kancgae T., Ogura Y., Koh-chi T., Ohyama K. Gene organization deduced from the complete sequence of liverwort Marchantia po-lymorpha mitochondrial DNA – a primitive form of plant mitochondrial genome // J.Mol.Biol. – 1992. - Vol.223. - P.1-7 .

Ohyama K., Ogura Y., Oda K., Yamato K., Ohta E., Nakamura Y., Takemura M., Nozato N., Akashi K., Kanegae T., Yamada Y. Evolution of organeller genomes in Evolution of life. Fossils molecules and culture. /Eds. Osawa S. @ Honjo T. - Berlin: Publ. Springer – Verlag. – 1991. -P.187-198.

Okazaki I., Yoshikawa K., Kinoshita K., Muramatsu M., Nagaoka H., Honjo T. AID deaminase links CSR and SHM // Ann. N.Y. Acad. Sci. – 2003. - Vol.987. - P.1-8.

Okazaki I., Kinoshita K., Muramatsu M., Yoshikawa K., Honjo T. The AID enzyme induces CSR in fibroblasts // Nature. – 2002. - Vol.416. - N6878. – P.340-345.

Olsen L.C., Aasland R., Wittner C.U., Krokan H.E., Helland D.E. Molecular cloning of human uracil-DNA glycosylase , a highly conserved DNA repair enzyme // EMBO J. – 1989. - Vol.8. - P. 3121-3125.

Oppegard L.M., Kabb A.L., Connell G.J. Activation of gRNA directed editing of a cytochrome–b mRNA // J. Biol. Chem. – 2000. - Vol.275. - N43. - P.33911-33919.

Oximoto R., Wolstenholme D.R. A set of tRNA that lack either the TpsiC arm or dihydrouridine arm: towards a minimal tRNA adaptor // EMBO J. – 1990. - Vol.9. - № 10. - P.3405-3411.

Oyoshi T., Kawai K., Sugiuama H. Efficient C2’alpha–hydroxylation of deoxyribose in protein–induced Z-form DNA // J. Am. Chem. Soc. – 2003. - Vol.125. - N6. - P.1526-1531.

Pak B.J., Pang S.C. Developmental regulation of the translational repressor Nat-1 during cardiac development // J. Mol. Cell. Cardiol. – 1994. - Vol.3. - N9. - P.1717-1724.

Palazzo S.S., Panigrahi A.K., Igo R.P., Salavati R., Stuart K. Kinetoplastid RNA editing ligases: complex association, characterization, and substrate requirements // Mol. Biochem. Parasitol. – 2003. - Vol.127. - N2. -P.161-167.

Panigrahi A.K., Gygi S.P., Ernst N.L., Igo R.P., Palazzo S.S., Schnaufer A., Weston D.S., Carmean N., Salavati R, Aebersold R., Stuart K.D. Association of two novel proteins, TbMP52 and TbMP48, with the T.brucei RNA editing complex // Mol. Cell. Biol. - 2001a. - Vol.21. - N2. - P.380-389.

Panigrahi A.K., Schnaufer A., Carmean N., Igo R.P., Gygi S.P., Ernst N.L., Palazzo S.S., Weston D.S., Aebersold R., Salavati R., Stuart K.D. Four related proteins of the T,brucei RNA editing complex // Mol. Cell. Biol. - 2001b. - Vol.21. - N20. - P.6833-6840.

Panigrahi A.K., Schnaufer A., Ernst N.L., Wang B., Carmean N., Salavati R., Stuart K. Identification of novel component of T.brucei editosome // RNA. - 2003a. - Vol.9. - N4. - P.484-492.

Panigrahi A.K., Allen T.E., Stuart K., Haynes P.A., Gygi S.P. Mass spectrometric analysis of the editosome and other multiprotein complexes in T.brucei // J. Am. Soc. Mass. Spectr. - 2003b. - Vol.14. - N7. - P.728-735.

Papavasiliou F.N., Schatz D.G. SHM of Ig-genes: merging mechanism for genetic diversity // Cell. – 2002. - Vol.109. - Suppl : S35-44.

Paquin B., Laforest M.J., Forget L., Roewer I., Wang Z., Longcore J., Lang B.F. The fungal mitochondrial genome project: evolution of fungal mitochondrial genomes and their gene expression // Curr. Genet. – 1997. - Vol.31. - № 5. - P.380-395.

Patton D.E., Silva T., Bezamilla F. RNA editing generates a diverse array of transcript encoding squid Kv2 K+- channels with altered functional properties // Neuron. – 1997. - Vol.19. - № 3. - P. 711-722.

Peeters N.M., Hanson M.R. Transcript abundance supercedes editing efficiency as a factor in developmental variation of chloroplast gene expression // RNA. - 2002. - Vol.8. - N4. - P.497-511.

Pelletier M., Miller M.M., Read L.K. RNA-binding properties of the mitochondrial Y-box protein RBP-16. // Nucl. Acid. Res. – 2000. - Vol.28. - N5. - P.1266-1275.

Pelletier M., Xu Y., Wang X., Zahariev S., Pongor S., Aletta J.M., Read L.K. Arginine methylation of a mitochondrial gRNA RNA binding protein from T.brucei // Mol. Biochem. Parasitol. – 2001. - Vol.118. - N1. - P.49-59.

Pelletier M., Read L.K RBP-16 is a multifunctional gene regulatory protein involved in editing and stabilization of specific mitochondrial mRNAs in T.brucei // RNA. – 2003. - Vol.9. - N4. - P.457-468.

Peris M., Simpson A.M., Grunstein V., Liliental V.E., Frech G.C., Simpson L. Native qel analysis of ribonucleoprotein complexes from a Leichmania tarentolae mitochondrial extract // Mol. Biochem. Parasitol. - 1997. - Vol.85. - №1. - P.9-24.

Perrotta G., Cavallotti A., Quagliariello C. Reduced requirement for RNA editing in the mitochondrial cox3 transcript of Olea europaeal // Curr. Genet. – 1997. - Vol.31. - № 2. - P.185-189.

Peters N.T., Rohrbach J.A., Zalevski B.A., Byrkett C.M., Vaughn J.C. RNA editing and regulation of Drosophila 4f-rnp expression by sas-10 antisense readthrough mRNA transcripts // RNA. – 2003. - Vol.9. - - N6. - P.698-710.

Petersen S., Casellas R., Reina-San-Martin B., Chen H.T., Difilippantonio M.J., Wilson P.C., Hanitsch L., Celeste A., Muramatsu M., Pilch D.R., Redon C., Reid T., Bonner W.M., Honjo T., Nussenzweig M.C., Nussenzweig A. AID is required to initiate Nbs1/gamma-H2AX focus formation and mutations at sites of class switching // Nature. – 2001. - Vol.414. - N6864. - P.660-665.

Petersen-Mahrt S.K., Harris R.S., Neuberger M.S. AID mutates E.coli suggesting a DNA deamination mechanism for antibody diversification // Nature. – 2002. - Vol.418. - N6893. - P.99-103.

Petersen-Mahrt S.K., Neuberger M.S. In vitro Deamination of cytosine to uracil in ssDNA by ApoB editing complex catalytic subunit 1 (Apobec1) // J. Biol. Chem. – 2003. - Vol.278. - N22. - P.19583-19586.

Petschek J.P., Mermer M.J., Scheckelhoff M.R., Simone A.A., Vaughn J.C. RNA-editing in Drosophila 4f-rnp gene nuclear transcripts by multiple A-to-G coversions // J. Mol. Biol. – 1996. - Vol.259. - № 5. - P.885-890.

Petzelt C., Joswig G., Mincheva A., Lichter P., Stammer H., Werner D. The centrosomal protein antrosomin A and the nuclear protein centrosomih B derive from one gene by post-transcriptional processes involving RNA editing // J. Cell. Sci. – 1997. - Vol.110. - № 20. – P.2573-2578.

Phreaner C.G., Williams M.A., Milligan R.M. Incomplete editing of rps12 transcripts results in the synthesis of polymorphic polypeptides in plant mitochondria // Plant. Cell. – 1996. - Vol.8. - №1. - P.107-117.

Piller K.J., Decker C.J., Rusche L.N., Sollner-Webb B. Trypanosoma brucei mitochondrial guide RNA-mRNA chimera-forming activity cofractionates with an editing-domain-specific endonuclease and RNA ligase and mimicked by heterologous nuclease and RNA ligase // Mol. Cell. Biol. – 1995. - Vol.15. - №6. - P.2925-2932

Piller K.J., Rusche L.N., Cruz-Reyes J., Sollner Webb B. Resolution of the RNA editing gRNA-directed endonuclease from two other endonucleases of Trypanosoma brucei mitochondria // RNA. – 1997. - Vol.3. - № 3. - P.279-290.

Piller K.J., Rusche L.N., Sollner-Webb B. Trypanosoma brucei RNA editing. A full round of uridilate insertional editing in vitro mediated by endonuclease and RNA ligase // J. Biol. Chem. – 1996. - Vol.271. - № 9. - P.4613-4619.

Pollard V.W., Harris M.E., Hajduk S.L. Native mRNA editing complexes from Trypanosoma brucei

mitochondria // EMBO J. – 1992. – Vol.11. - № 22. - P.4429-4438.

Pollard V.F., Hajduk S.L. Trypanosoma equiperdum minicircles encode three distinct primary transcripts which exhibit guide RNA characteristics // Mol. Cell. Biology. – 1991. – Vol.11. - N3. - P.1668-1675.

Pollard V.W., Rohrer S.P., Michelo Hi E.F., Hancock K., Hajduk S.L. Organization of minicircle genes for guide RNAs in Trypanosoma brucei // Cell. – 1990. – Vol. 63. - № 4. - P.783-790.

Polson A.G., Ley H.L.- 3rd, Bass B.L., Casey J.L. HDV RNA editing is highly specific for the amber/W site and is suppressed by HDAg // Mol. Cell. Biol. – 1998. – Vol.18. - N4. - P.1919-1926.

Poulson H., Nillson J., Damgaard C.K., Egebjerg J., Kjems J. GRM mediated the export of ADAR1 through a nuclear export signal within the Z-DNA binding domain // Mol. Cell. Biol. – 2001. – Vol.21. - N22. – P.7862-7871.

Price R.D., Weiner D.M., Chang M.S., Sanders-Buch E. RNA editing of human serotonin 5-HT2C receptor alters receptor-induced activation of G13 protein // J. Biol. Chem. – 2001. - Vol.276. - N48. - P.44663-44668.

Rabinovici R., Kabir K., Chen M., Su Y., Zhang D., Yang J.H. ADAR1 is involved in the development of microvascular lung injury // Circ. Res. – 2001. – Vol.88. - N10. - P.1066-1071.

Raitskin O., Cho D.S., Sperling J., Nishikura K., Sperling R. RNA editing activity is associated with splicing factors in InRNP particles: The nuclear pre-mRNA processing machinery // PNAS. – 2001. - Vol.98. - N12. - P.6571-6576.

Ramanathan Y., Song L., Mathews M.B., Tolias P.P. Functional cloning of genes encoding dsRNA binding protein // Methods. – 2003. – Vol.30. - N4. - P.348-352.

Read L.K., Fich W.R., Muthiani A.M., Stuart K. Maxicircle DNAand edited mRNA sequences of closly related trypanosome species: implication of RNA editing for evolution of maxicircle genome // Nucl. Acid. Res. - 1993a. – Vol.21. - N17. - P.4073-4078 .

Read L.K., Jacob A.N., Muthiani A.M., Stuart K. Sequences of three Trypanosoma congolense maxicircle genes allow prediction of regions encoding transcripts that undergo extensive RNA editing // Mol. Biochem. Parasitol. - 1993b. – Vol..60. - N 2. – P.337-341.

Reed M.L., Hanson M.R. A heterologous maize rpoB editing site is recognized by transgenic tobacco chloroplasts // Mol. Cell. Biol. – 1997. – Vol.17. - №12. - P.6948-6952.

Reed M.L., Lyi S.M., Hanson M.R. Edited transcript compete with unedited mRNAs for trans-acting editing factors in higher plant chloroplasts // Gene. - 2001b. - Vol.272. - N1-2. - P.165-171.

Reed M.L., Peeters N.M., Hanson M.R. A single alteration 20 nt 5’ to an editing target inhibits chloroplast RNA editing in vivo // Nucl. Acid. Res. - 2001a. - Vol.29. - N7. - P.1507-1513.

Reenan R.A., Hanrahan C.J., Barry G. The mle (napts) RNA helicase mutation in drosophila results in a splicingcatastrophe of the para Na+ channel transcript in region of RNA-editing // Neuron. – 2000. – Vol..25. - N1. - P.139-149.

Reenan R.A. The RNA world meets behavior: AI prer-mRNA editing in animals // Trend. Genet. – 2001. - Vol.17. - N2. –P. 53-56.

Riley G.R., Corell R.A., Stuart K. Multiple guide RNA for identical editing of Trypanosoma brucei apocytochrome-b mRNA have an unusual minicircle location and are developmentally regulated // J. Biol. Chem. – 1994. - Vol.269. - № 8. - P.6101-6108.

Rosenthal J.J., Bezanilla F. Extensive editing of mRNAs for the squid delayed rectifier K+-channel regulates subunit tetramerization // Neuron. – 2002. - Vol.34. - N5. - P.743-757.

Rueter S..M., Dawson T.R., Emeson R.B. Regulation of alternative splicing by RNA editing // Nature. – 1999. - Vol.399. - N6731. – P.75-80.

Ruf S., Kossel H. Tissue-specific and differential editing of the two ycf3 editing sites in maize plastids //

Curr. Genet. – 1997. - Vol.32. - №1. - P.19-23.

Rusch L.N., Cruz-Reyes J., Piller K.J., Sollner-Webb B. Purification of a functional enzymatic editing complex from Trypanosoma brucei mitochondria // EMBO J. – 1997. - Vol.16. - № 13. - P. 4069-4081.

Rusche L.N., Piller K.J., Sollner-Webb B. Guide RNA-mRNA chimeras, which are potential RNA editing intermediates, are formed by endonuclease and RNA ligase in a Trypanosoma mitochondrial extract // Mol. Cell. Biol. – 1995. - Vol.15. - № 6. - P.2933-2941.

Salavati R., Panigrahi A.K., Moroch B.A., Palazzo S.S., Igo R.P., Stuart K. Endoribonuclease activities of T.brucei mitochondria // Mol. Biochem. Parasitol. – 2002. – Vol.120. - N1. - P.23-31.

Samuel C.E. Antiviral action of interferons // Clin. Microbiol. Rev. – 2001. - Vol.14. - N4. - P.778-809.

Sanchez A., Trappier S.G., Mahy B.W., Peters C.J., Nichol S.T. The virion glycoproteins of Ebola viruses are encoded in two reading frames and are expressed through transcriptional editing // PNAS. – 1996. – Vol.93. - № 8. - P.3602-3607.

Sasaki Y., Kozaki A., Ohmori A., Iguchi H., Nagano Y. Chloroplast RNA editing required for functional acetyl-CoA carboxylase in plants // J. Biol. Chem. – 2001. – Vol.276. - N6. - P.3937-3940.

Sasaki T., Yukawa Y., Miyamoto T., Obokato J., Sugiura M. Identification of RNA editing sites in chloroplast transcript from the maternal and paternal progenitors of tobacco (Nicotiana tabacum): comparative analysis shows the involvement of distinct trans-factors for ndhD editing // Mol. Biol. Evol. – 2003. – Vol.20. - N7. - P.1028-1035.

Sato S., Wong S.K., Lazinsky D.W. HDV minimal substrates competent for editing by ADAR1 and ADAR2. // J. Virol. – 2001. - Vol.75. - N18. - P.8547-8555.

Saunders L.R., Barber G.N. The dsRNA binding protein family: critical roles, diverse cellular functions. // FASEB J. – 2003. - Vol.17. - N9. - P.961-983.

Scadden A.D., Smith C.W. Specific cleavage of hyper-edited dsRNA // EMBO J. - 2001a. - Vol.20. - N15. - P.4243-4252.

Scadden A.D., Smith C.W. RNAi is antagonized by AI hyper-editing // EMBO Rep. - 2001b. - Vol.2. - N12. - P.1107-1111.

Schaub M., Keller W. RNA editing by adenosine deaminases generates RNA and protein diversity // Biochimie. – 2002. - Vol.84. - N8. - P.791-803.

Schmid B., Read L.K., Stuart K., Goringer H.U. Experimental verification of the secondary structures of guide-RNA-pre-mRNA chimeric molecules in Trypanosoma brucei // Europ. J.Biochem. – 1996. - Vol.240. - N 3. - P.721-731.

Schmitz-Linneweber C., Regel R., Du T.G., Hupfer H., Herrmann R.G., Maier R.M. The plastid chromosome of Atropa belladonna and its comparison with that of Nicotiana tabacum: the role of RNA editing in generating divergence in the process of plant speciation // Mol. Biol. Evol. - 2002. - Vol.19. - N9. - P.1602-1612.

Schmitz-Linneweber C., Tillich M., Herrmann R.G., Maier R.M. Heterologous, splicing-dependent RNA editing in chloroplasr: Allotetraploidy provides trans-factor // EMBO J. - 2001a. - Vol.20. - N17. - P.4874-4883.

Schnaufer A., Panigrahi A.K., Panicucci B., Igo R.P., Wirtz E., Salavati R., Stuart K. An RNA ligase essential for RNA editing and survival of the bloodstream form of T.brucei // Science. – 2001. - Vol.291. - N5511. - P.2159-2162.

Schneider A. Unique aspects of mitochondrial biogenesis in trypanosomatids // Int. J. Parasitol. – 2001. - Vol.31. - N13. – P.1403-1415.

Schock I., Marechal-Drouard L., Marchfelder A., Binder S. Processing of plant mitochondrial tRNA Gly and tRNA Ser (GCU) is independent of RNA-editing // Mol. Gen. Genet. – 1998. - Vol.257. - № 5. - P.554-560.

Schurer H., Schiffer S., Marchfelder A., Morl M. This is the end: processing, editing and repair at the tRNA 3’-terminus // Biol. Chem. – 2001. - Vol.382. - N8. - P.1147-1156.

Schuster W., Heisel R., Wissinger B., Brennice A. RNA editing in the cytochrome b locus of the higher plant Oenpthera berteriana includes a U-to-C transition // Mol.Cell.Biol. – 1990. – Vol.10. - P.2428-2431.

Schuster W.,Temes R., KnoopV., Heisel R., Wissinger B., Brennice A. Distribution of RNA editing sites in Oenothera mitochondrial mRNAs and rRNAs // Curr.Genet. – 1991. - Vol.20. - P.397-404.

Schwartz T., Lowenhaupt K., Kim Y.G., Li L., Brown B.A., Herbert A., Rich A. Proteolytic dissection of Zab , the Z-DNA-binding domain of human ADAR1. // J.Biol.Chem. – 1999. - Vol.274. - N5. – P.2899-2906.

Seeburg P.H. RNA-helicase participates in editing game // Neuron. – 2000. - Vol.25. - N2. - P.261-263.

Seeburg P.H A-to-I editing: new and old sites, functions and speculation // Neuron. – 2002. - Vol.35. - N1. - P.17-20.

Seiwert S.D., Stuart K. RNA-editing: transfer of genetic information from gRNA to precurcor mRNA in vitro. // Science. – 1994. - Vol.266. - №5182. - P.114-117.

Sharma P.M., Bowman M., Madden S.L., Rauscher F.J.-3th, Sukumar S. RNA editing in the Wilms’ tumor susceptibility gene, WT1 // Gen. Dev. – 1994. - Vol.8. - N6. - P.720-731.

Shaw J.M., Feagin J.E., Stuart K., Simpson L. Editing of kinetoplastid of mitochondrial mRNAs by uridine addition and deletion generates conserved amino acid sequences and AUG initiation codons // Cell. – 1988. - Vol.53. - № 3. - P.401-411.

Shendure J., Church G.M. Computational discovery of sense-antisense transcription in the human and mouse genomes // Genome Biol. – 2002. - Vol.3. - N9. – P. research 0044.

Sheu G.T. Initiation of HDV replication: HDV RNA encoding the large delta antigen cannot replicate // Gen. Virol. – 2002. - Vol.83. - NPt10. - P.2507-2513.

Shields D.C., Wolfe K.H. Accelerated evolution of sites undergoing mRNA editing in plant mitochondria and chloroplasts // Mol. Biol. Evol. – 1997. - Vol.14. - № 3. - P.344-349.

Shimoda M., Morita S., Obata Y., Sotomaru Y., Kono T., Hatada I. Imprinting of a small nucleolar RNA gene on mouse chromosome 12 // Genomics. – 2002. - Vol.79. - N4. - P.483-486.

Shu H.H., Stuart K., Goringer H.U. Guide RNA molecules not engaged in RNA editing form ribonucleoprotein complexes free of mRNA // BBA. – 1995. - Vol.1261. - № 3. - P.349-359.

Simpson L. The genomic organization of guide RNA genes in kinetoplastid protozoa: several conundrums and their solutions // Mol. Biochem. Parasitol. – 1997. - Vol.86. - № 2. - P.133-141.

Simpson L., Emeson R.B. RNA-editing // Annu. Rev. Neurosci. – 1996. - Vol.19. - P.27-52.

Simpson L., Maslov D.A. Ancient origin of RNA editing in kinetoplastid protozoa // Curr. Opin. Genet. Devel. – 1994. - Vol.4. - № 6. - P.887-894.

Simpson L., Maslov D.A., Blum B. RNA editing in Liechmania mitochondria // RNA editing . The alteration of protein coding sequences of RNA /Ed. Benne R. – London: Publ. Ellis Horwood Ltd. – 1993. - P.53-85.

Simpson L., Show J. RNA editing and the mitochondrial cryptogenes of kinetopastid protozoa // Cell. - 1989. - Vol.57. - N3. - P.355-366.

Simpson A.G., Lukes J., Roger A.J. The evolutionary history of kinetoplastids and their kinetoplasts // Mol. Biol. Evol. – 2002. - Vol.19. - N12. - P.2071-2083.

Siqueira S.F., Dias S.M., Hardouin P., Pereira F.R., Lejeune B., de Souza A.P.Transcription of succinate dehydrogenase subunit 4 (sdh4) gene in potato: detection of extensive RNA-editing and co-transcription with cox3 gene // Curr. Genet. – 2002. - Vol.41. - N4. - P.282-289.

Slobf P., Benne R. RNA editing in kinetoplastid parasites: what to do with U? // Trend. Microbial. – 1997. -

Vol.5. - № 5. - P.189-195.

Slominski A., Pisarchik A., Zbytek B., Tobin D.J., Kauser S., Wortsman J. Functional activity of seritoniergic and melatoninergic system expressed in the skin // J. Cell. Physiol. – 2003. - Vol.196. - N1. - P.144—153.

Smith L.A., Peixoto A.A., Hall J.C. RNA-editing in the Drosophila DMCA1A calcium-channel alpha 1 subunit transcript // J.Neurogenet.- 1998. – Vol.12. - N4. - P.227-240.

Sodhi M.S., Burnet P.W., Makoff A.J., Kerwin R.W., Harrison P.J. // Mol. Psyhiatry. – 2001. - Vol.6. - N4. - P.373-379.

Sowden M.P., Eagleton M.J., Smith H.C. Apolipoprotein B RNA sequence 3' of the mooring sequence and cellular sources of auxiliary factors determine the location and extent of promiscuos editing // Nucl. Acid. Res. – 1998. - Vol. 26. - № 7. - P.1644-1652.

Sowden M.P, Ballatori N., Jensen K.L., Reed L.H., Smith H.C. The editosome for cytidine to uridine mRNA editing has a native complexity of 27S: identification of intracellular domains containing active and inactive editing factors // J. Cell. Sci. – 2002. - Vol.115. - NPt5. - P.1027-1039.

Sowden M.P, Smith H.C. Commitment of ApoB RNA to the splicing pathway regulates cytidine-to-uridine editing site utilization // Bioch. J. – 2001. - Vol.359. - N Pt3. – P.697-705.

Sper-Whitis G.L., Moody J.L., Vaughn J.C. Universality of mitochondrial RNA editing in cytochrom-c oxidase subunit-1 (cox-1) among the land plants // BBA. – 1996. - Vol.1307. - № 3. - P.301-308.

Stapleton M., Carlson J., Brokstein P., Yu C., Champe M., George R., Guarin H., Kronmiller B., Pacleb J., Park S., Wan K., Rubin G.M., Celnicer S.E. A Drosophila full-length cDNA resource // Genom. Biol. – 2002. - Vol.3. - N12. – P. research 0080.

Storb U., Peters A., Klotz E., Kim N., Shen H.M., Haskett J., Rogerson B., O’Brien R., Martin T.E. Immunoglobulin transgenes as targets for somatic hypermutation // Int. Dev. Biol. – 1998. - Vol.42. - N7. - P.977-982.

Stuart K. RNA-editing: trypanosoma rewrite the genetic code // Verh. K. Acad. Geneeskd. Belg. – 1998. - Vol. 60. - № 1. - P. 63-74.

Stuart K., Kable M.L., Aleen T.E., Lawson S. Investigating the mechanism and machinery of RNA-editings // Methods. – 1998. - Vol.15. - N 1. – P.3-14 .

Stuart K. The RNA editing process in Trypanosome brucei // Semin. Cell. Biol. - 1993b. – Vol. 4. - № 4. - P. 251-260.

Stuart K. RNA editing in mitochondria of african trypanosomes // RNA editing . The alteration of protein coding sequences of RNA / Ed.Benne R. – London: Publ.Ellis Horwood Ltd. - 1993а. – P.25-52.

Stuart K., Allen T.E., Heidman S., Seiwert S.D. RNA editing, in kinetoplastid protozoan // Microbiol. Mol. Biol. Rev. – 1997. - Vol. 61. - № 1. - P. 105-120.

Stuart K., Feagin J.E. Mitochondrial DNA of kinetoplastids // Int.Rev.Cytol. – 1992. - Vol.141. – P. 65-68.

Stuart K., Panigrahi A.K. RNA editing: complexity and complication // Mol. Microbiol. – 2002. - Vol.45. - N3. P.591-596.

Sugiura M. The chloroplast genome // Essays. Biochem. – 1995. - Vol.30. – P. 49-57.

Sutton C.A., Zoubenko O.V., Hanson M.R., Maliga P. A plant mitochondrial sequence transcribed in transgenic tobacco chloroplasts is not edited // Mol. Cell. Biol. – 1995. - Vol.15. - № 3. - P.1377-1381.

Szymanski M, Barciszewska M, Erdman VA, Barciszewski J. Are 5S rRNA primary transcipts edited? Bioch Mol Boil Int 1995, v.37, N3, pp.413-422.

Tajinda K., Carroll J., Roberts C.T. Regulation of insulin-like growth factor I receptor activity by wild-type and mutant versions of the WT1 tumor suppressor // Endocrinology. – 1999. - Vol.140. - N10. - P.4713-4724.

Takano H., Abe T, Sakurai R., Moriyama Y., Miyzawa Y., Nozaki H., Kawano S., Sasaki N., Kuroiwa T. The complete DNA sequence of the mitochondrial genome of Physarum polycephalum // Mol. Gen. Genet. – 2001. - Vol.264. - N5. - P.539-545.

Takano H., Kawano S., Kuroiwa T. No editing of mitochondrial plasmid transcripts in mitochon- dria of Physarum that have an RNA-editting system // DNA Res. – 1997. - Vol. 4. - №1. - P. 67-71.

Takuma H., Kwak S., Yoshizava T., Kanazawa I. Reduction of GluR-2 RNA-editing, a molecular change that increases calcium influx through AMPA receptors, selective in the spinal ventral gray of patients with amiotrophic lateral sclerosis // Ann. Neurol. – 1999 . -Vol.46. - N6. - P.806-815.

Taylor J., Zeng H.Q., Fu T.B., Turner J., Ryu W.S., Bayer M., Netter H., Lazinski D. Conversion in RNA genome HDV // 18 th EMBO Annual Symposium on RNA. - Abstract book 1992. - P.69-70.

Thiemann O.H., Maslov D.A., Simpson L. Disruption of RNA editing in Leichmania Tarentolae by the loss of minicircle-encoded guide RNA genes // EMBO J. – 1994. - Vol.13. - N23. – P.5689-5700.

Thomson M.C., Macfarlane J.L., Beagley C.T., Wolstenholme D.R. RNA-editing of mat-R transcripts in maize and soybean increases similarity of the encoded protein to fungal and bryophyte group II intron maturases: evidence that mat-R encodes a functional protein // Nucl. Acid. Res. – 1994. - Vol.22. - № 25. - P.5745-5752.

Tomita K., Uede T., Watanabe K. RNA-editing in the adaptor stem of squid mitochondrial tRNA (Tyr). // Nucl. Acid. Res. – 1996. - Vol. 24. - № 24. - P. 4987-4991.

Tonkin L.A., Saccomanno L., Morse D.P., Brodigan T., Krause M., Bassm B.L. RNA editing by ADARs is important for normal behavior in Caenorhabditis elegans // EMBO J. – 2002. - Vol.21. - N22. - P.6025-6035.

Tsudzuki T., Wakasugi T., Sugiura M. Comparative analysis of RNA editing sites in higher plant chloroplast // J. Mol. Evol. – 2001. - Vol.53. - N4-5. - P.327-332.

Vaitilingom M., Stupar M., Greinenberger J.M., Gualberto J.M. A gene coding for an RPS2 protein is present in the mitochondrial genome of several cereals, but not in dicotyledons // Mol. Gen. Genet. – 1998. - Vol.258. - N5. - P.530-537.

Van Tang H., Pring D.R., Muza F.R., Yan B. Sorghum mitochondrial orf25 and a related chimeric configuration of a male—sterile cytoplasm // Curr. Genet. – 1996. - Vol. 29. - № 3. – P. 265-274.

Vanchiere S.A., Bellini W.S., Moyer S.A. Hypermutation of the phosphoprotein and altered mRNA editing in the hamster neurotropic strein of meosles virus // Vorology. – 1995. - Vol. 207. - № 2. - P. 555-561.

Villegas J., Muller I., Arredondo J., Pinto R., Burzio L.O. A putative RNA editing from U to C in a mouse mitochondrial transcript // Nucl. Acid. Res. – 2002. - Vol.30. - N9. - P.1895-901.

Visiers I., Hassan S.A., Weinstein H. Differences in conformational properties of the second intracellular loop (IL2) in 5HT(2C) receptors modified by RNA editing can account for Gprotein coupling efficiency // Protein. Eng. – 2001. - Vol.14. - N6. - P.409-414.

Visomirski-Robic L.M., Gott J.M. Accurate and efficient insertional RNA editing in isolated physarum mitochondria // RNA. – 1995. - Vol.1. - № 7. – P. 681-691.

Visomirski-Robic L.M., Gott J.M. Insertional editing of nascent mitochondrial RNAs in Physarum // PNAS. - - 1997. - Vol. 94. - № 9. – P. 4324-4329.

Vogel J., Hubschmann T., Borner T., Hess W.R. Splicing and intron-internal-RNA-editing of tRNK-matK transcripts in barley plastids: support for matK as an essential splice factor // J. Mol. Biol. – 1997. - Vol.270. - № 2. – P. 179-187.

Vokobori S., Paabo S. Transfer RNA editing in land snail mitochondria // PNAS. – 1995. -Vol. 92. - № 22. - P. 10432-10435.

Volchkov V.E., Becker S., Volchkova V.A., Ternovoj V.A., Kotov A.N., Netesov S.V., Klenk H.D. GP mRNA

of Ebola virus is edited by the Ebola virus polymerase and by T7 and vaccina virus polymerases // Virology. - - 1995. – Vol. 214. - № 2. - P. 421-430.

Volchkov V.E., Chepurnov A.A., Volchkova V.A., Ternovoj V.A., Klenk H.D. Molecular characterization of guinea pig-adapted variants of Ebola virus // Virology. – 2000. - Vol.277. - N1. - P.147-55.

Volchkov V.E., Volchkova V.A., Muhlberger E., Kolesnikova L.V., Weik M., Dolnik O., Klenk H.D. Recovery of infectious Ebola virus from complementary DNA: RNA editing of the GP gene and viral cytotoxicity // Science. - 2001. - Vol.291. - N5510. - P.1965-1969.

Voyiaziakis E., Ko C., Orourke S.M., Huang L.S. Genetic control of hepatic apoB-100 secretion in human apoB transgenic mouse strains // J. Lipid. Res.- 1999. - Vol.40. - N11. - P.2004-2012.

Wada Y., Nakasawa M., Abe T., Tamai M. Ectopic transcription and the possibility of RNA editing of the human arrestin gene // Jpn. J. Ophtalmol. – 1999. - Vol.43. - N4. - P.295-299.

Wakasa C., Iwatsuki K., Ohashi K., Nakamura K., Kai C. Sequence analisys of the genes encoding the phosp- hoprotein of recent isolates of canine distemper virus in Japan. // J.Veter.Med.Sci. – 2000. - Vol.62. - N1. - P.97-101.

Wakasugi T., Hirose T., Horihata M., Tsudzuki T., Kossel H., Sugiura M. Creation of a novel protein—coding region of the RNA level in back pine chloroplasts: the pattern of RNA editings in the gymnosperm chloroplast is different from that in angiosperm // PNAS. – 1996. - Vol.93. - №16. - P.8766-8770.

Wang S.S., Mahendran R., Miller D.L. Editing of cytochrome-b mRNA in Physarum mitochondria // J.Biol.Chem. – 1999. - Vol.274. - N5. - P.2725-2731.

Wang Q., O’Brien P.J., Chen C.X., Cho D.S., Murray J.M., Nishikura K. Altered G protein-coupling functions of RNAediting isoform and splicing variant serotonin 2C receptors // J.Neurochem. – 2000. - Vol.74. - N3. - P.1290-1300.

Wang Q., Khillan J, Gadue P, Nishikura K. Requirement of the RNA editing deaminase ADAR1 gene for embr yonic erythropoiesis // Science. – 2000. - Vol.290. - N5497. - P.1765-1768.

Wang B., Salavati R., Heidman S., Stuart K. A hammerhead ribozyme substrate and reporter for in vitro kinetoplastid RNA editing // RNA. – 2002. - Vol.8. - N4. - P.548-554.

Wang B., Ernst N.L., Palazzo S.S., Panigrahi A.K., Salavati R., Stuart K. TbMP57 is a 3’ terminal uridyl transferase (TUTase) of the T.brucei editosome // Mol. Cell. - 2003b. - Vol.11. - N6. – P.1525-1536.

Wang B., Ernst N.L., Palazzo S.S., Panigrahi A.K., Salavati R., Stuart K. TbMP44 is essential for RNA editing and structural integrity of the editosome in T.brucei // Eukaryot. Cell. - 2003a. - Vol.2. - N3. - P.578-587.

Weiner A.M., Maizels N. tRNA-like structures tag the 3'-ends of genomic RNA-molecules for replication: implications for the origin of Protein synthesis // PNAS. – 1987. - Vol. 84. - P.7383-7387.

Williams M.A., Kutcher B.M., Mulligan R.M. Editing site regonition in plant mitichondria: the importance of 5'-flanking sequence // Plant. Mol. Biol. – 1998. - Vol. 36. - № 2. - P. 229-237.

Wilkinson M.F., Shyu A.B. Multifunctional regulatory proteins that control gene expression in both the nucleus and cytoplasm // Bioessay. – 2001. - Vol.23. - N9. - P.775-787.

Wilson R. K., Hanson M.R. Preferential RNA editing of specific sites within transcripts of two plant mitochondrial genes does not depend on transcriptional context or nuclear genotype // Curr. Genet. – 1996. - Vol. 30. - № 6. - P. 502-508.

Winter D.B., Gearhart P.J. Dual enigma of somatic hypermutation of immunoglobulin variable genes: targeting and mechanisms // Immun. Rev. – 1998. - Vol.162. - P.89-96.

Woese C.R. Interpreting the universal phylogenetic tree // PNAS. – 2000. -Vol.97. - N15. - P.8392-8396.

Woese C.R., Guptar R. Are archebacteria merely derived “procariotes”? // Natutre. – 1981. - Vol.289. - N5793. - P.95-96.

Wolf J., Gerber A.P., Keller W. TadA, essential tRNA-specific adenosine deaminase from Escherichia coli // EMBO J. – 2002. - Vol.21. - N14. - P.3841-3851.

Wong S.K., Lazinsky D.W. Replicating HDV RNA is edited in the nucleus by the small form of ADAR1 // PNAS. – 2002. - Vol.99. - N23. - P.15118-15123.

Wong S.K., Sato S., Lazinski D.W. Elevated activity of the large form of ADAR1 in vivo: very efficient RNA editing occur in the cytoplasm // RNA. – 2003. - Vol.9. - N5. - P.586-598.

Wong S.K., Sato S., Lazinski D.W. Substrate recognition by ADAR1 and ADAR2 // RNA. – 2001. - Vol.7. - N6. - P.846-858.

Xie Y., Nassir F., Luo L., Buhman K., Davidson N.O. Intestinal lipoprotein assembly in Apobec1 (-/-) mice reveals subtle alteration in triglyceride secretion coupled with a shift to larger lipoproteins // Am. J. Physiol. Gastrointest. Liver. Physiol. – 2003, Jun 19, [Epub ahead of print].

Yamanaka S., Poksay K.S., Arnold R.S., Innerarity T.L. A novel translational repressor mRNA is editing extensively in livers containing tumors caused by the transgene expression of the apoB mRNA—editting enzyme // Genes. Dev. – 1997. - Vol. 11. - № 3. – P. 321-333.

Yamanaka S., Poksay K.S., Driscoll D.M., Innerarity T.L. Hypereditings of multiple cytidines of apolipoprotein B mRNA by apobec-1 requires auxiliary protein(s) but not a mooring sequence motif // J. Biol. Chem. – 1996. - Vol. 271. - № 19. – P. 11506-11510.

Yamazaki N., Ueshima R., Terrett J.A., Yokobori S., Kaifu M., Segawa R., Kobayashi T., Numachi K., Ueda T., Nishikawa K., Watanabe K., Thomas R.H. Evolution of pulmonate gastropod mitochondrial genomes: comparisons of gene organizations of Euhadra, Cepala and Albinaria , and implication of unusual tRNA secondary structures // Genetics. – 1997. - Vol.145. - №3. – P.749-758 .

Yang J.H., Sklar P., Axel R., Maniatis T. Purification and charactirization of a human RNA adenosine deaminase for glutumate receptor B pre-mRNA editing // PNAS. – 1997. - Vol.94. - № 9. - P.4354-4359.

Yang J.H., Luo X., Nie Y., Su Y., Zhao Q, Kabir K, Zhang D, Rabinovici R. Widespread inosine-containing mRNA in lymphocytes regulated by ADAR1 in response to inflammation // Immunology. – 2003. – Vol.109. - N1. - P.15-23.

Yang Y., Ballatori N., Smith H.C. ApoB mRNA editing and the reduction in synthesis and secretion of the atherogenic risk factor , apoB-100 can be effectively targeted through TAT-mediated transduction // Mol. Pharmacol. – 2002. - Vol.61. - N2. - P.269-276.

Yang Y., Sowden M.P., Yang Y., Smith H.C. Intracellular traffing determinants in APOBEC1, the catalytic subunit for cytidine-to-uridine editing of ApoB mRNA // Exp. Cell. Res. – 2001. -Vol.267. - N2. - P.153-164.

Yasuhira S., Simpson L. Guide RNA and guide RNA genes in the cryptobiid kinetoplastid protozoan, Trypanoplasma borreli // RNA. – 1996. - Vol.2. - № 11. – P. 1153-1160.

Yasuhira S., Simpson L. Phylogenetic affinity of mitochondria of Euglena gracilis and kinetoplastids using cytochrome oxidase I and hsp60 protein // J. Mol. Evol. – 1997. - Vol.44. - № 3. – P. 341-347.

Yi-Brunizzi H.Y., Stephens O.M., Beal P.A. Conformational changes that occur during an RNA editing adenosine deamination reaction // J. Biol. Chem. – 2001. - Vol.276. - N41. - P.37827-37833.

Yin S., Ho C.K., Shuman S. Structure-function analysis of T4 RNA ligase // J. Biol. Chem. – 2003. - Vol.2787. - N20. - P.17601-17608.

Yoshikawa K., Okazaki I.M., Eto T., Kinoshita K., Nagaoka H., Honjo T. AID enzyme-induced hypermutation in an actively transcribed gene in fibroblasts // Science. – 2002. - Vol.296. - N5575. - P.2033-2036.

Yokobori S., Paabo S. Poleadenilation creates the discriminator nucleotide of chicken mitichondrial tRNA (tyr) // J. Mol. Biol. – 1997. - Vol. 265. - № 2. – P. 95-99.

Yoshinaga K., Iinuma H., Masuzawa T., Uedal K. Extensive RNA editing of U to C in addition to C to U

substitution in the rbcL transcripts of hornwort chloroplasts and the origin of RNA editing in green plants // Nucl. Acid. Res. – 1996. - Vol. 24. - № 6. – P. 1008-1013.

Yoshinaga R., Kakehi T., Shima Y., Iinuma H., Masuzawa T., Ueno M. Extensive RNA editing and possible double-stranded structures determining editing sites in the atpB transcripts of hornwort chоroplasts // Nucl. Acid. Res. – 1997. - Vol. 25. - № 23. – P. 4830-4834

Zabaleta E., Monras A., Hernould M., Suharsono X., Araya A. Transgenic male-sterile plant induced by an unedited atp 6 gene is restored to fertility by inhibiting its expression with antisense RNA // PNAS (USA) - - 1996. - Vol.23. - № 20. - P. 11259-11263.

Zeltz P., Kadowaki K., Kubo N., Maier R.M., Hirai A., Kossel H. A promiscuous chloroplast DNA fragment is transcribed in plant mitochondria but the encoded RNA is not edited // Plant. Mol. Biol. – 1996. - Vol.31. - № 3. - P. 647-656.

Zhang Z., Carmichael G.G. The fate of dsRNA in the nucleus: a p54-nrb-containing complex mediates the nuclear retention of promiscuously A-to-I editing RNAs // Cell. – 2001. - Vol.106. - N4. - P.465-475.

Zhuo D., Nyuyen-Lowe H.T., Subramanian S., Bonen L. The S7 ribosomal protein gene is truncated and overlaps a cytochrome C // Plant. Mol. Biol. – 1999. - Vol.40. - N1. - P.91-97.

Zito F., Kyras R., Choquet Y., Kossel H., Wollman F.A. Mutations of cytochrome b6 in Chlamydomonas reinhardii disclose the function significance for a proline to leucine conversion by petB editing in maize and tobacco // Plant. Mol. Biol. – 1997. - Vol.33. - № 1. – P.79-86.