PREVALENCE AND CHARACTERIZATION OF THE MECHANISMS OF MACROLIDE, LINCOSAMIDE, AND STREPTOGRAMIN RESISTANCE

AMONG ISOLATES OF STREPTOCOCCUS PNEUMONIAE AND VlRlDANS STREPTOCOCCI

Nicole 3. Johnston

A thesis submitted in conformity with the requirements for the degree of Master of Science

Graduate Department of Medical Genetics and Microbiology University of Toronto

1999

@Copyright by Nicole J. Johnston 1999

National Library of Canada

Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques 395 Wellington Street 395, rue Wellington ûîtawaON K I A O W Ottawa ON K1 A ON4 Canada Canada

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or sel1 copies of this thesis in microform, paper or electronic formats.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la fome de microfiche/film, de reproduction sur papier ou sur format électronique.

The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protege cette thèse. thesis nor substantial extracts fiorn it Ni la thèse ni des extraits substantiels may be p ~ t e d or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.

ABST RACT

Background: With the emergence of peniciltin resistence in Strepfococcus

pneumoniae, there has been an associated increase in resistance to the

macrolide (M), lincosamide (L), and streptogramin B (SB) antimicrobials.

Previously, ribosomal modification due to an emB-encoded methylase was the

only known mechanism of MLS, resistance in pneumococci, resulting in cross-

resistance to al1 three classes. Recently. however, a macrolide-specific active

efflux mechanism, encoded by the mef gene, has been reported.

Objectives: Using a large collection of S. pneumoniae isolates from across

Canada, we determined the prevalence of these mechanisms, and how they may

be best detected in the clinical laboratory.

Methods: Of 5029 isolates tested, 147 (2.9%) were found to be erythromycin

resistant and 64 (1.3%) clindamycin resistant by broth microdilution. Alf

erythromycin resistant isolates were screened for MLS resistance mechanisms

by disk susceptibility testing and by PCR, using primers specific for the

ennA-,B-,C-, and mef genes.

Results: Our results demonstrated that 81 (55.1 %) strains possessed the efflux

mechanism based on the presence of the mef gene. Of these, 76 possessed an

M phenotype by disk diffusion, whereas fve demonstrated an MS, phenotype.

Target modification accounted for 57 (38.8%) strains based on the presence of

an e m gene. Fifty-six of these isolates demonstrated an MLS, phenotype and

one isolate an ML phenotype by disk diffusion. Nine isolates (6.1 %) possessed

unusual patterns of resistance to MLS, antibiotics, in addition to lacking both

mef and e n genes. suggesting the presence of novel mechanisrns of resistance

which have not yet been identified.

Nine viridans streptococci were also selected on the basis of MLS,

resistance and negative PCR results for ennA, 8, C, and met Susceptibility

testing demonstrated that al1 possessed an MLS, phenotype. Five of these were

found to be resistant to synercid . One isolate was found to possess the recently

described emTR gene from Group A streptococci. which is the Cnt time this

gene has been identified in any other species.

Conclusions: In this study of erythromycin resistant pneurococci, the

prevalence of known MLS resistance mechanisms was detemined. In S.

pneumoniae, active effiux is the predominant mechanism of MLS resistance,

characterized by resistance to macrolides and susceptibility to lincosamides and

type B streptogramins. Previously, target modification, characterized by cross-

resistance to macrolides, lincosamides, and type 6 streptograrnins, was believed

to be the only mechanism of MLS resistance in S. pneumoniae. Additionally, the

finding of unusual resistance phenotypes in both pneumowcci and viridans

streptococci suggests the presence of potentially novel mechanisms of

resistance.

TABLE OF CONTENTS

1 .O) Introduction ......................................................................................... 1 1 . 1 ) Macroiide. Lincosamide. and Streptogramin (MLS) Antimicrobials ....... 2 1.1 . 1) Spectnirn of Activity ........................................................................... 2 1.1.2) Structure and Mode of Action of the MLS Antimicrobials ................... 3 1.2) Acquired Mechanisrns of Resistance .................................................... 4 1.2.1 ) Ribosomal Target Modification - The MLS, Resistance Phenotype ... 4 1.2.2) Active Efflux of MLS Antimicrobials .................................................... 11

........................................................................... 1.2.3) Enzyme Inactivation 19 2.0) Objectives ............................................................................................ 25 3.0) Y aterials and Methods ........................................................................ 26 3.1 ) Isolates .................................................................................................. 26 3.1 . 1) Group Identification of Viridans Streptococcal lsolates ...................... 27 3.2) Susceptibility Testing ............................................................................ 27 3.2.1) Broth Microdilution ............................................................................. 27 3.2.2) Disk Susceptibility Testing ................................................................. -28 3.3) DNA Isolation ........................................................................................ 29 3.3.1 ) Genomic DNA Isolation ...................................................................... 29 3.3.2) Plasmid DNA Isolation ........................................................................ 30 3.4) PCR ....................................................................................................... 31 3.4.1) e m A Y -B. 4. and mef PCR ................................................................ 31

....................................................................................... 3.4.2) ermTR PCR 31 3.4.3) vet&atWvatC/satA PCR .................................................................... -33 3.4.4) vgb ?CR ............................................................................................. 33 3.5) Pulsed Field Gel Electrophoresis .......................................................... 34

.................................................................................. 3.6) Southern Blotting -34 3.6.1 ) Sandwich Method .................................... .... ....................................... 34 3.6.2) Dot Blot Method ................................................................................ -35 3.7) Probing for ermA. -B. -C. and mef genes .............................................. 35 4.0) Results ................................................................................................ -35 4.1) Group Identification of Viridans Streptococcal lsolates ......................... 35 4.2) Susceptibility Data - Broth Microdilution and Disk Susceptibility

Testing .................................................................................................. -36 4.3) PCR ....................................................................................................... 43 4.3.1 ) emA. -8. -C. and mef PCR ................................................................ 43 4.3.2) emTR PCR ........................................................................................ 47 4.3.3) vatlvatWvatC/satA PC R ..................................................................... 49

............................................................................................ 4.3.4) vgb PCR -49 4.4) Pulsed Field Gel Electrophoresis .......................................................... 50 4.5) Hybridization Resuits Using emA. -B. -C. and mef probes ................... 50 5.0) Discussion .......................................................................................... -58 6.0) Future Studies ..................................................................................... 63 7.0) References .......................................................................................... 67

iii

LIST OF TABLES

Table 1 . Type of MLS resistance and phenotypic patterns of resistance ..... 13

Table 2 . MLS resistance mechanisms among various genera ..................... 14

Table 3 . Primer sequences used in this study for the detection of known MLS resistance mechanisms and sequencing .................... 32

Table 4 . Characterization of 147 erythromycin-resistant S . pneumoniae ............ by broth microdilution. disk susceptibility testing. and PCR 44

LIST OF FIGURES

Figure 1. Structure of the emC mRNA of S. aumus ................................... 8

Figure 2. Susceptibility testing of S. bovis BSV 421 by disk diffusion using erythromycin and clindamycin disks ................................. .38

Figure 3. Susceptibility testing of S. mutans BSV 134 by disk diffusion using erythromycin and clindamycin disks ................................... 39

Figure 4. Susceptibility testing of S. millen BSV 377, harbouring ermTR. by disk diffusion using erythromycin and clindamycin disks ........ .41

Figure 5. Susceptibility testing of S. pyogenes 02C1110, harbouring emTR, by disk diffusion using eiythromycin and clindamycin disks ............................................................................................. 42

Figure 6. Distribution of mef and em genes acwrding to the MIC ............................................................................. of erythromycin 45

Figure 7. PCR analysis demonstrating the presence of emTR in one MLS, resistant isolate of S. milleri ................................................ 48

Figure 8. Pulsed field gel electrophoresis of selected empositive and mef-positive S. pneumoniee ........................................................ .52

Figure 9. Pulsed field gel electrophoresis of novel MLS resistant isolates and selected erythromycin susceptible isolates of

........................................................................... S. pneumoniae -53

Figure 10. Analysis by southem blot of the PFGE gel from figure 8, containing selected ermBpositive and mef-positive pneumococcal isolates. and probed with enn8 amplicon ............ 54

Figure 11. Analysis by southem blot of the PFGE gel from figure 8, containing selected em5gositive and mef-positive pneumococcal isolates, and probed with mef amplicon ............. .55

Figure 12. Analysis by southern blot of the PFGE gel from figure 9, wntaining selected em54mef-negative novel isolates and selected erythromycin susceptible isolates. and probed with mef amplicon. ....................................................................... 56

Figure 1 3. Analysis by southem blot of the PFGE gel from figure 8, containing selected em8Jmef-negative novel isolates and selected erythromycin susceptible isolates. and probed with enn8 amplicon ....... .... . . . . . ....... ..... . . ... . . . . .. . .... .. . . . .. . . . . . ... .. .. . ... . -57

1 .O) INTRODUCTION

The macrolide. lincosamide, and streptogramin (MLS) antimicrobials are

chernically distinct, yet functionally related antibiotics which inhibit pmtein

synthesis by binding to 23s rRNA in the 50s subunit of the ribosome

(Femandez-Munoz et al.. 1971). The modifications which result in acquired

resistance to these three classes of antimicrobials include (i) target site

modification, (ii) altered antirnicrobial transport, and (iii) enzymatic inactivation

(Weisblum 1995).

Macrolides are the most commonly used antibiotics for community

acquired pneumonia, and are an important alternative for the treatment of Gram-

positive infections in patients allergic to penicillin. The lincosamide class,

principally clindamycin, has a spectrum of activity similar to the macrolides, but is

particulariy valuable for the treatment of otitis media and osteomyelitis (Mims et

al., 1993). The streptogramins, which have been available in Europe for the past

few decades, are used as mainly as antistaphyiococcal agents (Allignet et al.,

1 998). Synercid (dalfapristin-quinuprisün) is a new injectable streptogramin that

has just recently been approved in North America for the treatment of multi-drug

resistant infections caused by such organisms as methicillin resistant

Staphyiococcus aureus (MRSA), vancomycin resistant Entemcoccus (VRE), and

penicillin resistant Streptococcus pneumoniae (PRSP).

The development of resistance to the macrolides in S. pneumoniae,

Group A streptococci, and the viridans streptococci is problematic. as the

development of therapeutic alternatives has not kept up with the development of

resistance in these organisms. Detemination of the prevalence of MLS

resistance, and the identification of both known and potentially novel resistance

mechanisms, is necessary to study the epiderniology of MLS resistance in

Canada. Presently, the antibiotics used in routine testing by clinical laboratories,

as recommended by the National Cornmittee for Clinical Laboratory Standards

(NCCLS, 1997). does not include lincosamides, as macrolide resistance has

been shown to result in cross-resistance to the lincosamides (Quintilliani, Jr. and

Courvalin, 1 995). However, the discovery of a macrolide-specific efflux

mechanism in streptococci may affect these recommendations, as these isolates

are susceptible to lincosamides. Thus, clindamycin therapy may prove valuable

for the treatment of infections caused by a subset of macrolide resistant

organisms.

1 .l) MACROLIDE, LINCOSAMIDE, AND STREPTOGRAMIN (MLS)

ANTIMICROBIALS

1 .l .l) Spectrum of Activity

The MLS classes of antibiotics have a relatively broad spectrum of activity

which includes Gram-positive cocci (staphylococci, streptococci, and

enterococci), Gram-negative cocci, anaerobes, and bacilli. Additionally, these

antibiotics have favourable activity against Haemophilus, Legionella, Chlamydia,

and Campylobacfer. Gram-negative bacilli are generally inherently resistant as a

result of imperrneability of the cell wall to these antibiotics (Leclercq and

Courvalin, 1991 ).

1.1.2) Structure and Mode of Action of the MLS Antimicrobials

A) Macrolides

Macrolides are comprised of a 14-, 15-, or 16-membered lactone ring

structure with a minimum of two amino andlor neutral sugars (Leclercq and

Couwalin, 1991). After binding to 23s rRNA, macrolides inhibit protein synthesis

by blocking the translocation step, thereby preventing the release of tRNA

following peptide bond formation (Mims et al.. 1993). This class consists of the

1Cmembered macrolides eryairomycin, oleandornycin, and clarithromycin; the

1 Smembered macrolides azithromycin or 4"-epiazithromycin; and the 1 6-

membered macrolides spiramycin, josamycin, tylosin, and rosaramicin

(Andremont et al.. 1986). The three respective classes differ in their

pharrnacokinetic properties as well as in their responses to bacterial resistance

(Leclercq and Courvalin, 1 991 ).

B) Lincosamides

The lincosamides are compounds which do not possess a lactone ring

and are alkyl derivatives of proline (Leclercq and Courvalin, 1991). After binding

to the 50s ribosomal subunit, the lincosamides inhibit protein synthesis by

inhibiting peptide bond formation, though the precise mechanism is not well

understood (Mims et al., 1993; Weisblum 1 995). The most commonly known

lincosamides include celesticetin, lincomycin, and clindamycin, although the

latter is what is most widely used clinically.

C) Streptogramins

The streptogramins are a unique class of antibiotics in that they consist of

two components, type A and type 6, which when combined exert a synergistic

inhibitory effect on sensitive cells. The type A compounds are polyunsaturated

cyclic peptolides, whereas type B cornpounds are cyclic hexadepsipeptides.

Type A and B streptogramins inhibit protein synthesis by blocking peptide bond

formation through the inhibition of substrate attachment to the A and P sites,

thereby inhibiting peptide chain elongation. Synergistic inhibition arises from

conformational changes on the peptidyltransferase center by type A

components, which in tum increases ribosomal affinity for type 6 streptogramins.

The synergistic effect inhibits both the early and late stages of protein synthesis

(Cocito, 1979). Type A compounds indude dalfopristin (RP54476) (streptogramin

A), virginiamycin M 1 , pristinamycins II (1 IA, l l B), ostreogrycins (A, G), vemamycin

A, and mikamycin A. Compounds of the type B class include: quinupristin

(RP57669) (streptogramin B), virginiamycins S (SI, S2, S3, S4), pristinarnycins I

(IA, IB, IC), ostreogrycins B (81, 82, B3), vemamycins (Ba, BP, By, Ba), and

mikamycin IA (Cocito ,1979, Cocito et al., 1997).

1.2) ACQUIRED Y ECHANISMS OF RESISTANCE

A summary of the various MLS resistance phenotypes is shown in

Table 1. The known MLS resistance genes and corresponding mechanisms are

summarized in Table 2.

1.2.1) Ribosomal Target Modification - The MLS, Resistance Phenotype

Cross-resistance to al1 three classes occurs as a result of a

methyltransferase (rnethylase) which is encoded for by a class of genes,

designated em for erythromycin resistance methylase. S-adenosylmethionine is

used as the methyl donor to modify an adenine residue in 23s rRNA to form

either N ornono- or dimethyladenine (Weisblum 1995). The MLS antibiotics

interact competitively when binding to the 505 subunit. with only one molecule

being able to bind per 50s subunit, suggesting that the binding sites either

overiap or functionally interact (Fernandez-Munoz et al., 1 971 ). It is believed

that rRNA methylation effects a conformational change within the ribosome

which results in cross-resistance to macrolides, lincosamides. and type B

streptogramins. The type A streptogramins are unaffected and, as a result.

synergy between the A and B components against MLS,-resistant organisms is

maintained (Leclercq and Courvalin, 1991).

Footprinting experiments, which utilize antibiotic probes to localize dnig

binding sites, have enabled identification of the precise site of rnethylation at

position A2058 of 23s RNA domain V in Eschenchia coli containing emC. The

nucteotides within this highly conserved peptidyltransferase region are protected

by bound MLS antibiotics when treated with dimethyl sulfate (DMS) and

kethoxal, agents which derivatize purines and pyrimidines in single-stranded

DNA or RNA. Methylation of this region has also been identified in S. aureus

strains possessing emA, em6, and emC genes. as well as in Bacillus

stearothemophilus strains possessing the meth ylase of the erythromycin-

producer Streptomyces erythreus (Skinner et al., 1983; Thakker-Varia et al.,

1985).

A) Constitutive or Inducible Expression of MLS, Resistance

Expression of MLS, resistance may be either constitutive or inducible

(Weisblum 1995). In staphylococci, constitutive and inducible resistance can be

distinguished by disk susceptibility testing. When expression is constitutive,

resistance is obsewed for al1 macrolides, lincosamides. and type 6

streptogramins. Type A streptogramins and the synergistic compounds are

unaffected. With inducible expression, however, resistance is observed for 14-

and 15-membered macrolides only. The 16-membered macrolides, the

lincosamides. and the type B streptogramins remain active, but resistance to

these antibiotics can be induced when in the presence of a 14- or 15-mernbered

macrolide. Phenotypically. inducible expression can be detected by the

presence of a D-shaped zone of inhibition around 16-membered macrolides,

lincosamides, and type B streptogramins when placed in the proximity of a disk

impregnated with a 14- or 1 5-membered macrolide. In streptococci, however,

constitutive and inducible expression are not always discemible by disk

susceptibility testing because al1 macrolides, lincosamides, and type B

streptogramins can act as inducers to varying degrees. This explains the variety

of resistance phenotypes observed by disk susceptibility testing. In some

streptococcal isolates, inducible resistance can be characterized by cross-

resistance to al1 three classes (Quintilliani Jr., and Courvalin, 1995).

A) Regulation of MLS, Resistance: Translational Attenuation

The regulation of MLS, resistance can be explained by a mechanism

termed translational attenuation (Horinouchi and Weisblum, 1980). In the

presence of erythromycin, conformational transitions in a region of the mRNA

upstream of the ermC methylase gene activate previously inactive mRNA,

resulting in translation of the methylase gene. Inducible expression is not

dependent upon the class of e m gene but is instead determined by the

sequence of a regulatory region, referred to as a control peptide, leader peptide,

or leader sequence, located upstream of the methylase gene (Figure 1). The

regulatory region adjacent to the ennC gene in staphylococci has been

characterized and found to enwde a 1Camino acid control peptide. Both genes

are CO-transcribed in a single mRNA characterized by four inverted repeats that

form two stem-loop structures in the absence of erythromycin. In this inactive

conformation, both the ribosomal binding site and initiation codon for the

methylase gene are sequestered, preventing translation of the methylase. Thus,

only the region corresponding to the control peptide is able to be translated.

When present, erythromycin binds to the ribosomes involved in the synthesis of

the control peptide. causing them to stall. Ribosomal stalling is believed to

induce conformational rearrangement of the mRNA, resulting in the dissociation

of segments 1 + 2 and 3 + 4. and the consequent association of segments 2 + 3,

thereby freeing the flbosomal binding site (Shine-Dalgamo-2; SD2) for the

methylase. Once free, SD2 can then be recognized by the ribosomes, enabling

translation of the methylase and the subsequent modification of other ribosomes,

rendering them resistant to MLS, antibiotics. A similar model has been proposed

for emA from the staphylococcal transposon Tn554 and ermG of Bacillus

sphaericus (Dubnau, 1984; Leclercq and Couwalin, 1991; Mayford and

Weisblum, 1985). Constitutive expression anses from any point mutations or

deletions within the stemloop regions that result in the association of segments

2 + 3, and subsequently enable translation of the methylase (Mayford and

Weisblum 1985).

Figure 1: Structure of the ennC mRNA of S. aumus.

Control Peptide

5' Inactive Conformation

Active Conformation

Figure 1: In the inactive conformation, the mRNA is characterized by two stem-

loop structures which sequester the ribosomal binding site and initiation codon

for the methylase. The active conformation is characterized by unsequestering

of the stem-loop structures, either due to mutations or the presence of

erythromycin, such that the methylase can be translated (modified frorn Leclercq

and Courvalin, 1991 ).

C) Origin and Distribution of enn Genes

Approximately 30 enn genes have been described in both Gram-positive

and Gram-negative genera, as well as in actinomycetes that produce antibiotics

(Weisblum 1995). The MLS, phenotype, characterized by cross-resistance to

macrolides, lincosamides, and type 6 streptogramins. has subsequently been

detected in Staphylococcus spp. (Thakker-Varia et al., 1985; Lampson and

Parisi, 1 986), Enterococcus spp. (Leclercq and Courvalin, 1 991 ), Streptococcus

spp. (Courvalin et al.. 1972; Dixon and Lipinski, 1974; Gilmore et al., 1982;

Horinouchi et al., 1983) , Bacillus spp. (Monod et al., 1986; Monod et al., 1987),

Bactemides spp. (Salaki et al., 1976, Shoemaker et al., l985), Lactobacillus spp.

(Rinckel and Savage, 1 990; Axelsson et al., 1 988), Corynebacterium diptheriae

(Coyle et al.. 1 979), Clostridium spp. (Wilkens and Thiel, 1973),

Pmpionibactetium spp. (Eady et al., 1989), and in various Entembacteriaceae

(Arthur et al., 1987).

Hybridization studies and sequence cornparisons of the various e m

genes have lead to the distinction of eight e m gene classes which include ermA

and emC (from S. aureus), ennAM (from Streptococcus sanguis), ennF (from

Bacteroides fragilis), ennD (from Bacillus lichenifonnis), emG (from Bacillus

sphaetfcus, as well as emE and ennA'from the erythromycin producers

Streptomyces ewhreus and Adhmbacter spp. respectively (Arthur et al., 1987,

Leclercq and Courvalin, 1991 ). Varying degrees of similarity have been

obsewed among the different e m genes, however, the distribution of e n genes

is generally species specific and approximately 30 variant etm genes have been

identified to date (Leclercq and Courvalin, 1991, Seppala 1998).

D) MLS, Resistance and Streptococci

MLS, resistance is generally associated with self-transferable plasrnids of

various sites harbouring the emAM (ennB) gene. Some e m genes have been

located in the chromosomes of strains not harbouring plasmids and are

transferred on conjugative transposons (Leclercq and Courvalin, 1991 ;

Shoemaker et al., 1985). In streptococci, MLS, resistance plasmids have been

found in al1 species with the exception of S. pneumoniae. However, transfer of

MLS, resistance in the absence of plasmids has been observed in S.

pneumoniae, Streptococcus bovis, as well as in groups A, B, F, and G

streptococci. In S. pneumoniae BM4200, however, the emAM gene was

identified on a 25.3 kb conjugative transposon, Tn1545 (Courvalin and Carlier,

1986). Unlike other transposons, Tn7545 is not flanked by terminal inverted

repeats, it lacks variable base pairs at each end, and it does not duplicate the

target DNA upon insertion. It is self-transferable into other Gram-positive

bacteria and is able to transpose into numerous sites. Recently, a second e m

gene, designated ermTR, has been iden Wied in Streptococcus pyogenes

(Seppala et al., 1998).

Previously, target modification was long believed to be the only

mechanism of MLS, resistance in streptococci. Since then, an active efflux

mechanism has been identified and characterized. Target modification and

eflux have been the only mechanisms identified in streptococci to date (Cooksey

et al., 1989; Leclercq and Couivalin, 1991 ; Poyart-Salmeron et al.. 1991 ).

1.2.2 ) Active Efflux of MLS Antimicrobials

A) Efflux in Staphylococci: The MS Resistance Phenotype

Efflux of both macrolides and streptogramins was first described in

staphylococci and was found to be due to an ATP-binding transport pump with

specficity for 14- and 15-membered macrolides and type B streptogramins, but

not for 16-membered macrolides or the lincosamides. This energydependent

pump maintains intracellular antibiotic concentrations below those required for

binding to ribosomes (Goldman et al., 1990). The resultant MS resistance

phenotype, which conferred inducible resistance to erythromycin and the

streptogramin. pnstinamycin 1, but not to lincamycin. was first reported several

yean ago in multiply-resistant strains of S. aumus isolated in Hungary (Janosi

and Ban, 1982). A similar MS phenotype, charaderized by resistance to

erythromycin and virginiamycin S and susceptibility to clindamycin, was

subsequently reported six years later among clinical isolates of coagulase-

negative staphylococci in the USA (Jenssen et al., 1987). In 1989, this

phenotype was reported in 1 10 human skin isolates of coagulase-negative

staphylococci, obtained in the UK from 1987 to 1988 (Ross et al., 1989).

Susceptibility testing of 16 other antibiotics failed to reveal any other resistance

markers associated with the MS phenotype, although an association with

penicillin resistance was noted but did not occur in al1 cases. Subsequently, Ross

et al. demonstrated the active efflux of erythromycin from cells of S. aureus

RN4220 and deduced the sequence of a 488-amino acid protein (MsrA) which

contained two ATP-binding motifs bearing homolog y to the ATP-binding

transport proteins from Gram-negative bacteria and eukaryotic cells (Ross et al.,

1990). Macrolide-producing organisms such as Streptomyces ambofaciens (a

spiramycin producer). Streptomyces themotoIemns (a carbomycin producer)

and Streptomyces fmdiee (a tylosin producer) have been found to possess emux

deteminants bearing sequence homology to MsrA and other ATP-binding

transport proteins, suggesting that resenroirs for these resistance deterrninants

were present and that horizontal transmission of these genes may occur in

nature (Schoner et al., 1992).

In a distribution study characterizing the incidence of erythromycin efflux

and erythromycin ribosomal methylases in staphylococci, Eady et al. reported

that of 221 strains of clinically significant coagulase-negative staphylococci, 73

(33%) isolates harboured the msrA gene (Eady et al., 1993). The common

isolation of these organisrns from human skin led the authors to propose skin as

the likely reservoir of MS-resistant strains. Previously, msrA had hitherto been

unrecognized in the UK as a significant cause of erythromycin resistance in

medically-important staphylococci. However, the relative prevalence of these

mechanisms was not determined in this study which was biased in favour of the

selection of strains possessing an MS phenotype (Eady et al., 1993).

Table 1. Type of MLS Resistance and phenotypic patterns of resistance.

Mechanism of Phenotype Susœptibility Resistance

1 4- 1 5- 16- Lin SB SA SA+R - . . .. - Mac Mac Mac

Target modification MLS, . ,- R R S R R S S

MLS- R R S S S S S

Efflux MS R R S S R S S

M R R S S S S S

Inactivation hl (~-1 R R S S S S S

hl (G-I R S R S S S S

L S S S R S S S

SA S S S S S R R

SB S S S S R S S

ICMac, 14-mernbered macrolide; 1 5-Mac, 1 Smembered rnacrolide; 1 6-Mac, 16- membered macrolide; Lin, lincosamides; SB, type B streptogramins. SA, type A streptogramins; S,,, synergistic combinations of type A and type B streptogramins. R, resistant; S, susceptible.

Table 2. MLS resistance mechanisms among various genera.

Mechanism Gene Gene proâuct Host

Target enn Modification AB,C

AM (8) AM (B)

TR o, G, J,K

G GT

A, CD, CX ennBP

A

Efflux

ribosornal methylase Staphylococcus Enterococcus Streptococcus

S.pyogenes, S. milleri Bacill us

Ba ctemides Lactobacillus

Covnebacteflum djphthetiae Clostriciium perfnngens

Propionibactetiurn various Enterobacteriaciae

msrA ATP-dependent pump Staphylococcus

meWA ATPdependent pump Streptococcus, Enterococcus

W ATP-dependent pump Staphylococcus vgaB

Enzyme emA erythromycin esterase Inactivation ere B

E. coli E. coli

mphA macrolide phosphotransferase Streptomyces lividans mphB E. coli

mgt rnacrolide glycosyltransferase Streptomyces vendargensis

IinA IinA '

vat satA vatB vatC

lincosamide

streptogramin A

S. haemolyücus S. aureus

Staphylococcus E. faecium

Stap hylococcus Staphy/ococcus

W b streptogramin B hydrolase Staphylococcus vgb6 Staphylococcus

vgb-l i ke E. faecium

Subsequently, Wondrack et al. confirmed the presence of an msrA-like

gene in one strain of S. eureus possessing both an active emux mechanism in

addition to a rnacrolide-specific inactivating enzyme (Wondrack et al., 1996).

Additionally, one strain of Staphylococcus xylosus possessing an erythromycin

resistance deteminant (msrB) 100% homologous to the carboxy-terminal ATP-

binding cassette of MsrA has been described (Milton et al., 1992).

8) Effiux in Staphylococcl: The S Resistance Phenotype

In recent years. two genes have been identified encoding putative ATP-

transporter genes which confer resistance to type A streptogramins (SgA) and

related compounds (pristinamycin IIA, virginiamycin M, mikamycin A, synergistin

A, and dalfopristin) (Allignet and El Solh, 1992. Allignet et al., 1997). The first

gene identified, vga, encodes a 522-amino acid protein, VgA, of 60 kDa which

demonstrates significant homology with the ATP-binding domains of several

proteins.

Two ATP-binding domains are present in VgA which combine the A and B

motifs, and like the MsrA protein, lack the long hydrophobic stretches believed to

represent potential membrane-spanning domains (Allignet and El Solh, 1992). In

contrast with the MsrA protein, however, the two ATP-binding domains of VgA

are not separated by a typical O-linker sequence which are believed to function

in tethering the interacting domains of the proteins (Wootton and Dnimmond,

1989). Efflux studies have not been carried out on the staphylococcal isolates

harbouring this gene. Rather, the determination of effiux as the mechanism of

streptograrnin A resistance in these isolates was based on significant sequence

identity with other known effiux proteins.

Another sta ph ylococcal gene has been recentl y iden tified , vgaB, which

encodes a 552-amino acid protein of approximately 61 kDa and bears the most

homology with the 1572 bp vga gene (58.8% nucleotide identity, 48.3% identical

amino acids, 70.4% similar amino acids). Like VgA, Vga8 also contains two

ATP-bindings domains sharing 38.8% identical and 39.1 % similar amino acids

respectively with the former (Allignet et al., 1997).

C) Efflux in Streptococci: The M Resistance Phenotype

Until recently, the MsrA efflux pump in staphylococci was believed to be

the only known efflux mechanism with specificity for any of the MLS

antimicrobials. Although an energy-dependent mtr effîux system has been

reported in gonococci, similar to the mexABoprK efflux system in Pseudomonas

aemginosa and the acrAB and -EF pumps of E. coli, it is not specific for

macrolides (Hagman et al.. 1 995).

Until recently, active effîux had not been described in streptococci.

However, clinical isolates of Streptococcus pyogenes bearing a novel M

phenotype, characterized by resistance to macrolides with susceptibility to

lincosamides and type B streptogramins, were being reported in Finland

(Seppala et al., 1 993), Australia (Stingemore et al., l989), the United Kingdom,

and North America (Coonan and Kaplan, 1994; Phillips et al., 1990; Sutdiffe et

al., 1996-A). Similady, a study of pneumococcal isolates recovered from the

middle ear and sinuses of children in the United States reported the same M

phenotype (Nelson, 1994). Sutcliffe et al. likewise found this same phenotype in

pneumococcal and Group A streptococcal isolates obtained from France,

Ireland, Sweden. and various part of the United States (Sutcliffe et al., 1996-A).

Evaluation of these isolates revealed the presence of a novel mechanism, not

mediated by target modification and distinct from any known e m genes. Instead,

they reported the finding of an efflux system with specificity for macrolides only

which appeared distinct from the MsrA efflux system responsible for

erythromycin and type B streptogramin resistance in staphylococci (Sutcliffe et

al., 1996-A).

The gene responsible for macrolide effiux in streptococci has

subsequently been cloned and sequenced. The determinant in S. pyogenes

strains with an M phenotype. mefA for macrolide emux, encodes a novel

hydrophobic 44.2-kDa protein with homology at the amino acid level to other

efflux proteins (Clancy et al., 1996; Sutcliffe et al., 1996-6). Since both S.

pyogenes and S. pneumoniae strains with the M phenotype were shown to efflux

erythromycin, it was dernonstrated that S. pneumoniae possessed a mefA-like

gene, designated mefE, which bears 90% homology with mefA. The presence of

mefA in S. pyogenes and mefE in S. pneumoniae confers resistance to 14- and

1 à-membered macrol ides, with susceptibility to 1 6-mem bered macrolides,

lincosamides, and type 6 streptogramins (Tait-Kamradt et al., 1997).

The presence of the mef gene has also been reported in erythromycin-

resistant group B and viridans streptococci bearing an M phenotype and has

been shown to possess the meE gene (Tait-Kamradt et al., 1997). Likewise,

meE has also been reported in a Philadelphia hospital in clinically-signifiant

strains of Enterococcus faecium that are moderately resistant to erythromycin

and susceptible to clindamycin. The mef gene found in E. faecium was found to

be identical to meb (Fraimow and Knob, 1997).

lsolates demonstrating an M phenotype are easily distinguishable from

MLS, resistant isolates by susceptibility testing in the routine laboratory using

erythromycin and clindamycin disks, both alone, and in close proximity to each

other. Inducible MLSB resistance is discemible by the presence of a D-shaped,

or blunted, zone of inhibition surrounding the cfindamycin disk in the presence of

erythromycin. In some streptococci. inducible resistance is characterized by

cross-resistance to al1 three classes. In contrast, erythromycin-resistant isolates

with an M phenotype demonstrate a fully susceptible zone of inhibition

surrounding a clindamycin disk, despite the proximity of an erythromycin disk

(Shortridge et al., 1996).

Like the MS phenotype, the M phenotype is not restricted to a single

geographical location and has also been reported in South Africa (Klugman and

Koornhof, l988), Finland (Kataja et al., 1998) and Canada (Johnston et al.,

1998). Reports of the prevalence of the M phenotype are varied, with rates of

85% (Sutcliffe et al., 1996-A), 42% (Shortridge et al., 1996), and 56% (Johnston

et al., 1998) in three studies involving macrolide-resistant pneumococci, and as

high as 95% in one study looking at the prevalence of mef among group C

streptococci (Seppala et al., 1998). The differences among these prevalence

rates may be influenced by different antibiotic prescribing patterns among

different parts of the wodd.

1.2.3) Enzyme lnactivation

Enzymes which modify antibiotics and thereby render them inactive have

been described for macrolides, lincosamides. as well as both type A and B

streptogramins. Several enzymes and their respective genes have been

identified in both Gram-positive and Gram-negative organisms with specificity

against one particular antimicrobial or class of antimicrobials. In streptomcci,

however, inactivation of any MLS antimicrobials has not been described.

A) Macmlide lnactivation

Evidence of macrolide inactivation was first detected in Streptomyces, and

subsequently, in Pseudomonas aeruginosa and Lactobacillus spp.. however, the

respective enzymes and genes were not investigated (Feldman et al., 1964;

Flickinger et al.. 1 975).

The first report to identify a macrolide-specific enzyme described the

finding of a plasmid-mediated esterase confemng high-level resistance in E. coli

(Barthelemy et al., 1984; Ouinissi et al.. 1985; Andremont et al., 1986). The

macrolide resistance phenotype observed, with susceptibility to lincosamides

and streptogramins, was found to be due to an erythromycin esterase,

designated emA, which hydrolyzes the lactone ring of the antibiotic (Barthelemy

et al., 1984). Strains possessing this gene were found to inactivate the 14-

membered macrolides erythromycin and oleandomycin but none of the other

commercially available macrolide, lincosamide, or streptogramin antibiotics

(Andremont et al., 1986). The emA gene was detected in strains of E. coli,

Klebsiel!a pneumoniae, Entembcter agglomerans, and in one coliforni isola te

(Andremont et al., 1986). indicating its dissemination in nature. Similady,

another erythromycin esterase, designated ereB, was also reported arnong

various Enterobacteriaceae (Arthur et al., 1986; Arthur et al., 1987).

Recently, Wondrack et al. reported a strain of S. eumus with a macrolide-

specific inactivating enzyme which results in an inactivation product identical to

that observed in E. coli strains containing the EreA or EreB esterase (Wondrack

et al., 1996). However, the Gram-positive esterase predominantly hydrolyzes 14-

and 16-membered macrolides, in wntrast with the Gram-negative esterases

which have substrate specificity for 14- and 1 Sniembered macrolides only.

Although inactivation by esterases has been described for various memben of

the family Enterobacteriaceae, this report was the first to describe a macrolide-

specific inactivation deteminant, and more specifically, an esterase in a Gram

positive organism (Wondrack et al., 1996).

In addition to macrolide-specific esterases, both a glycosyltransferase and

phosphotransferase have also been described. Resistance to macrolides was

identified in Sfmpfomyces lividans and Streptomyces vendargensis a result of a

glycosyltransferase, encoded by the mgt gene, that specifically inactivates

macrolides. (Jenkins and Cundliffe, 1991 ; Kuo et al., 1989).

Additionally, both a type I and a type II macrolide 2'-phosphotransferase

have been demonstrated in E. coli with specificity for 14- and 16-membered

macrolides. High-level resistance is demonstrated with 14-membered

macrolides, whereas low-level resistance is observed with the 16-membered

macrolides. High-level expression has been shown to be dependent on h o

genes, mphA and mm which encode the macrolide 2'-phosphotransferase 1 and

an unidentified hydrophobic protein respectively (Noguchi et al., 1995).

Macrolide resistance due to the type II macrolide 2'-phosphotransferase in E. coli

is conferred by the mphB gene (Kono et al.. 1992; Noguchi et al., 1996; O'Hara

et a1.,1 989).

B) Lincosamide Inactivation

In 1969, Argoudelis et al. first reported the finding of the lincosamide-

specific inactivating enzyme, 3linwsamide û-phosphotransferase, and

subsequently, a 3-lincosamide O-nucleotidyltransferase in Streptomyces

(Argoudelis and Coats, 1 969; Argoudelis and Coats, 1971 ). The genes encoding

these enzymes were not investigated.

A sirnilar enzyme was discovered by Dutta et al. who reported the finding

of a 4-lincosamide O-nucleotidyltransferase in Streptococcus ubens, encoded by

the linA gene. However, the location of this determinant was not known (Dutta

and Devriese. 1982). Brisson-Noel et al. similarly reported the finding of this

same enzyme in S. haemolyticus (Brisson-Noel et al., 1987). A similar enzyme

was described by Brisson-Noel et al. from S. aureus which modified the dnig in

the same manner but was localized to a different plasmid and the gene

designated IinA' (Dutta and Devriese, 1982; Brisson-Noel et al., 1988).

Recently, a new resistance gene, &B. conferring resistance to lincomycin

by inactivation was identified in one isolate of E. faecium demonstrating high

levels of resistance to clindamycin and lincomycin (MICs > 128 pglml). The

resistance gene. linB. was distinct from linA and linAt, responsible for the

inactivation of clindamycin and lincomycin in staphylowcci (Bozdogan et al.,

1997-A).

C) Streptogramin Inactivation

Two enzymes with specificity for streptogramins have been detected in S.

aumus. Evidence of streptogramin inactivation has also been detected in

Lactobacillus spp., Clostridum perfnngens, and in the streptogramin-producers

Streptomyces diastaticus, Streptomyces loidensis, and Streptomyces olivaceus,

however, the enzymes present in these organisms were not investigated further

(Courvalin et al.. 1985; Fierro et al., 1989). Since then, four acetyltransferases

and two hydrolases have been detected and characterized that modify type A

and type B streptogramins respectively. thereby rendering them inactive.

D) Streptogramin A Inactivation

De Meester et al. Srst identified a streptogramin A û-acetyltransferase

responsible for the modification of the M cornponent of virginiamycin by the

acetylation of a hydroxyl group, followed by the rapid degradation of the 0-

acetylated product (De Meester and Rondelet. 1976).

Subsequently. a streptogramin A-specific acetyltransferase fmm S.

eureus, designated vat for virginiamycin A acetyltransferase, was described and

found to encode resistance to A-type compounds of streptogramin antibiotics

(Allignet et al., 1993). The vat gene is iocated on the same plasmids as the

previously described vge gene, believed to encode an ATP-binding protein

involved in active transport (Allignet and El Solh. 1992).

A sirnilar acetyltransferase with specificity for type A streptogramins was

also identified around the same time in E. faecium. Hybridization studies of satA

and the vat acetyltransferase observed in S. aumus did not demonstrate

sequence hornology, indicating that satA was distinct (RendeFournier et al.,

1993).

Su bsequently, another staphylococcal streptogramin A acetyltransferase

has been identified, designated vatB. Amino acid analysis of VatB with Vat and

SatA, encoded by the staphylococcal and enterococcal plasmids respectively,

demonstrates 47.4 and 58.4% identity. Analysis of the nucleotide sequence of

vatB exhibited 53.3% nucleotide identity with vat and 52.6% identity with saM.

Recently, a fourth acetyltransferase with specificity for type A

streptogramins, designated vatC, was isolated from S. cohnii subsp. cohnii and

found to be similar to the other three streptogramin A acetyltransferases: Vat

(24.3 kDa; 69.8% identical amino acids and 83.5% similar amino acids), VatB

(23.3 kDa; 58.2% identical amino acids and 77.4% similar amino acids), and

SatA (23.3 kDa; 66.0% identical amino acids and 77.4% similar amino acids). All

four acetyltransferases possess 48 identical amino acids as well as a repeated

sequence comprising an isoleucine patch (Allignet et al., 1998).

E) Streptogramin 8 Inactivation

Le Goffic et al. subsequently identified the presence of a pristinamycin 1A

hydrolase in S. aureus which was found to split the lactone ring of pristinamycin

I A into a linear molecule which has lost its antibiotic acüvity (Le Goffic et al.,

1977). Similar enzymes have also been reported in lysates of Actinoplenes

missouriensis and Streptomyces mifakaensis which likewise inactivate the B

components of virginiamycin antibiotics by cleavage of the lactone ring (Hou et

al., 1970; Kim et al., 1974).

The first gene encoding resistance to virginiamycin antibiotics to be

cloned and sequenced was from an S. aureus plasmid. encoding a virginiamycin

6 hydrolase (AIIignet et al., 1988). The S. aumus vgb gene is similar to the 35

kDa streptogramin B hydrolase previously detected in A. missouriensis (Allignet

et a1.J 988).

Until recently, satA was the only streptogramin resistance deteninant to

be identified in enterococci. Bozdogan and Leclercq identified the presence of a

vgb-like gene in one isolate of E. faecium found to be resistant to quinupristin-

dalfopristin (MIC = 16 pglmL). The fragment obtained was nearly identical to vgb

with the exception of 50 nucleotides. This has been the only enterococcal

isolate described to date possessing a streptograrnin resistance determinant

other than satA (Bozdogan et al., 1997-8).

Recently, a second virginiamycin B hydrolase, designated vgb8, has

been identified which encodes a 295amino acid lactonase (Allignet et al., 1998).

No signifiant similarities were detected between the two SgB hydrolases. Vgb

and VgbB, and other peptide sequences in the data banks.

The genes vat, vga, and vgb have been found to occur on the same

plasmid, with vat wntiguous to vgb. Of 48 staphylococcal isolates examined by

Allignet et al., each camed either vga or a combination of two or three genes:

vga8-vat8, vga-vat, or vga-vat-vgb (Allignet et al.. 1998). The reason why these

genes are seemingly cotranscribed is not known. However, while the plasmids

harbouring vat, vga, and vgb are not transferable by conjugation, the plasmid

carrying vatB is conjugative. None of the 7 staphylococcal isolates in which vat8

was identified possessed a vgb gene (Allignet et al., 1998).

To date, streptogramin resistance determinants have only been identified

and characterized in staphylococd and enterococci. However, with the

multiplicity of plasmids and genes encoding resistance to both type A and B

streptograrnin components and the synergistic mixtures of the two, care rnust be

exercised when ernploying these antibiotics in animal feed, as well as in the

administration of these antibiotics for the treatment of infections caused by

staphylococci and multidrug-resistant Gram-positive organisms (Allignet et al.,

1998).

2.0 OBJECTIVES

Our laboratory obtained 5029 isolates of S. pneumoniae as part of an

ongoing crossCanada surveillance study looking at levels of antimicrobial

resistance among clinically significant organisms. Given that the incidence of

penicillin resistance has been increasing in pneumococci, and that erythromycin

resistance is frequently associated with resistance to the former, our objectives

were threefold: firstly, to deterrnine the prevalence of resistance to MLS

antimicrobials among erythromycin-resistant pneumococci; secondly. to

characterize the mechanisms of resistance to MLS antimicrobials in

erythromycin-resistant pneumococci; and thirdly, to identify potential new

mechanisms of MLS resistance. Additionally. a subset of erythromycin-resistant

viridans streptococci possessing unusual resistance patterns to MLS antibiotics

were selected and characterized for potential new rnechanisms of MLS

resistance.

3.0) MATERIALS AND METHODS

3.1) lsolates

A total of 5029 clinical isolates of S. pneumoniae was obtained from 1993

to 1996 from a cross-canada suiveillance study involving 1 13 hospital and

private laboratories in al1 ten provinces. Of these, 147 were found to be

erythromycin-resistant by broth microdilution and were selected for further

investigation. Additionally, 422 viridans streptococci. isolated from sterile sites,

were obtained between 1995 and 1997 as part of the same study. Of these, 121

were found to erythromycin-resistant by broth microdilution. Frorn this su bset,

nine viridans streptococci were selected for fumer study based on unusual

resistance patterns to MLS antibiotics. In total, 147 pneumococci and nine

viridans streptococci were characterized further to determine the prevalence of

known MLS resistance mechanisms. as well as the identification of potential new

resistance mechanisms.

The following organisms were used as wntrols for the following genes: E.

coli RN7951 (ennA), S. pneurnoniae 3585 (ennAIWB), S. aureus (ennC). S.

pneumoniae 02J1175 (mefE), S. pneumoniae ATCC 49619 (negative control), S.

pneumoniae 6303 (negative control), S. pyogenes 02C1110 (ennTR), S. aumus

BM3002 (vga, vgb, vat), E. coli DBI O (satA).

3.1 .l ) Group Identification of Viridans Streptococcus lsolates

The nine viridans streptococci with unusual MLS resistance patterns were

identified to the group level by standard biochemical tests as recommended in

the Manual of Clinical Microbiofogy (Ruoff, 1395). The following tests were

performed to confimi laboratory identification of these isolates: viridans

streptococci were distinguished from S. pneumoniae by optochin resistance and

the bile solubility test, from S. pyogenes by the pyrrolidonyl arylamidase (PYR)

test, and from enterococci by the PYR and bile esculin tests. The following tests

were utilized to identify the isolates to the group level: esculin hydrolysis,

mannitol fermentation, sorbitol fermentation, urea hydrolysis, and the Voges-

Proskauer test.

3.2) Susceptibility Testing

3.2.1) Broth microdilution

Susceptibility testing was carried out by broth microdilution and disk

diffusion according to the National Cornmittee for Clinical Laboratory Standards

guidelines (NCCLS, 1997). Broth microdilution was performed to determine

minimum inhibitory concentrations (MICs) to the following MLS antimicrobials:

erythromycin, clindarnycin (Sigma, Oakville, Ont.), quinupristin (S,), dalfopristin

(SA), synercid (dalfopristin-quinupnsün) (SA+ SB), and pristinamycin (pristinarnycin

IA +UA) (Rhone-Poulenc-Roter, Collegeville, Pa). Micmdilution panels were

incubated at 37OC in air for 24 hours. lsolates which failed to grow in ambient air

were subsequently retested and grown in 5% CQ for 24 hours. Pristinamycin

was induded to compare MlCs with the values obtained for synercid, as MlCs

for pristjnamycin are within a two-fold dilution lower than those for synercid .

Susceptibility to erythromycin and clindamycin was based on the following

breakpoints according to the NCCLS guidelines: susceptible MIC i; 0.25 pg/mL;

intermediate MIC = 0.5 pg/mL; and a resistant MIC r 1 pglmL. As breakpoints for

quinupristin, dalfoprisün. and synercid were not available by NCCLS, the

following tentative breakpoints for synercid were supplied by the manufacturer:

susceptible MIC s 1 pglmL; intemediate MIC = 2 WmL; and a resistant MIC r 4

pglmL. MlCs to dalfopristin are almost exclusively resistant in streptococci as a

result of their in herent resistance to streptogramin A compounds. Quinu pristin

breakpoints were not available from the manufacturer, however, MlCs of 8 pg/mL

or greater were considered resistant based on personal communication with the

manufacturer.

3.2.2) Disk Susceptibility Testing

MLS resistance phenotypes were detemined by disk diffusion using

erythromycin (1 5 pg), clindamycin (2 pg) (Oxoid, Nepean, Ont.), quinupristin (7.5

pg), dalfopristin (7.5 pg), and synercid (1 5 pg) (Rhone-Poulenc-Rorer). Cultures

were grown for 18 to 21 houn on Columbia agar plates (Medprep. Que.)

supplemented with 5% sheep blood. After this time, suspensions were made to

a turbidity equivalent to a No. 0.5 McFarland standard in sterile saline solution.

Plates were inoculated with this suspension, pemitted to dry, inoculated with

antibiotic disks, and incubated within 15 minutes of placement of the disks. Zone

sizes were detemined following 24 hours incubation in 5% CO2 according to

NCCLS guidelines (NCCLS. 1997). Evidenœ of inducible MLSB resistance was

tested for by placing clindamycin and quinupristin disks 10-1 5 mm respectively

from an erythrornycin disk. The following breakpoints were used to detenine

susceptibility: 1) for erythromycin, susceptible 2 21 mm, intemediate = 16 - 20

mm, and resistant 5 15 mm; 2) for clindamycin, susceptible 2 19 mm.

intermediate = 16 -1 8 mm, and resistant < 15 mm; 3) for quinupristin, breakpoints

are not available, although preliminary data from Rhone-Poulenc-Rorer

examined 10 isolates of S. pneumoniae and found that the average zone size for

these isolates was 13.84 mm (penonal communication), resistance was defined

by zone diameters s 1 1 mm; 4) for dalfopristin, breakpoints do not exist owing to

intrinsic resistance; 5) for synercid, the following tentative breakpoints have been

provided by the manufacturer: susceptible 2 19mrn, intermediate 16-1 8 mm, and

resistant 5 15 mm.

3.3) DNA Isolation

3.3.1) Genomic DNA Isolation

Genomic DNA was isolated from pneumococcal isolates by the method

of Smith et al. (Smith et al., 1993). To isolate genomic DNA from virîdans

streptococci, the same procedure was used with the following modifications: the

pellet obtained from centrifugation of a 1.5 mL ovemight culture was

resuspended in a lysis mixture consisting of RNase, mutanolysin, and lysozyme

added to a lysis buffer composed of 50 mM glucose, 25 mM Tris, pH 8.0, 10 mM

EDTA, pH 8.0, and 150 mM NaCI) and incubated at 37OC for 1 hour. At this time.

10% SDS was added to each tube, mixed by inversion, and kept at room

temperature for 10 minutes. To this. 50 PL of 10 mg/mL proteinase K was added

and the tubes incubated at 45OC for at least one hour.

Alternatively, genomic and plasrnid DNA were also obtained by a rapid

lysis method for use as template DNA for PCR. A loopful of organism was

inoculated into a 1.5 mL microcentrifuge tube containing 1 mL of lysis buffer

made from the following: 100 mM NaCI, 10 mM Tris-HCI (pH 8.3), 1 mM EDTA

(pH 8.0). and 1 % Triton X 100. The suspension was boiled for 10 minutes, snap-

cooled on ice for 5 minutes, and subsequently spun down to remove cell debris.

For a 25 pl PCR reaction, 5 pL of the supernatant was used as template.

3.3.2) Plasmid DNA Isolation

Plasmid isolation from E. coli was perfomed as previously described

(Bimboim and Doly, 1979). Plasmid isolation was also performed by the

Quantum Prepm plasmid miniprep kit (Bio-Rad, Mississauga, Ont.) and by the

QlAfilter plasmid midi kit (Qiagen, Mississauga, Ont.) according to the

manufacture& instructions. For staphylococcal plasmid isolation, 10 PL of 1

mglmL lysostaphin pet 100 pL of lysis mixture was added to lyse the

staphylococcal cell well using either kit.

3.4) ?CR

The following concentrations were used for al1 PCR reactions in a final

volume of 25pL: 0.5 pL of a 20 pmol primer stock, 2.5 pL of a 1 mM dNTP

solution, 2.5 PL of 10X PCR buffer, and 0.1 pL of Taq polymerase (20 UlpL).

PCR was carried out in a Perkin-Elmer 9600 Themocyder. The primen used in

this study are found in Table 3.

3.4.1) emA, -8, 4, and mef PCR

Multiplex PCR was pe~ormed using primers specific for ermA, emB

(ennAM), emC. and mef (Sutcliffe et al., 1996). The following parameters were

used: 1) initial denaturation for 3 min. at 93OC; 35 cycles of annealing for 1 min.

at 5g°C, elongation for 1 min. at 72OC. denaturation for 1 min. at 93OC; and a final

elongation for 5 min. at 72OC. A magnesium concentration of 4 mM was

employed for the multiplex reaction, although a magnesium concentration of 2

mM was used for the rnef primer set alone (Sutcliffe et al., 1996).

3.4.2) enn TR PCR

Primers ermTRA and ermTRB, designed to amplify an approxirnately 400

bp region of the gene, were employed to enable detection of ermTR in those

pneumocaccal isolates and viridans streptococcal isolates with an MLS,

phenotype, but that were negative by PCR for emA, em8, and ermC (primer

sequence kindl y provided by Joyce Sutcliffe, Pfizer Central Resea rch Centre,

Groton, Connecticut). The following PCR conditions were employed: 1 ) initial

denaturation for 3 min. at 94OC; 2) 35 cycles of denaturation for 30 s at 94OC,

Table 3. Primer sequences used in this study for PCR detection of known MLS

resistance genes and for sequencing.

Primer name

emA1

ennA2

em81

emB2

Sequence (5'3') TCTAAAAAGCATGTAAAAGAA

4

ClT CGA TAG T lT A T AAT ATT AGT

GAA AAG GTA CTC AAC CAA ATA

AGT AAC GGT ACT TAA ATT GTT TAC L

ermC1

emC2

ermTRU

errnTRA

emTW

1

1 mef 7 1 AGT ATC ATT AAT CAC TAG TGC 1

TCA AAA CAT AAT ATA GAT AAA

GCT AAT ATT GTT TAA ATC GTC AAT

GCA TAA GGA GGA GTT AA GAA GiT TAG ClT TCC TAA

GCC TTC AGC ACC TGT CTT AAT TGA T

em7TRD TCA GTA ACA TTC GCA TG

-

mef2

sat&at&atWvatCl

sat/i/aVitatB/vatC2

vgb 7

vgb2

-

lTC l T C TGG TAC T H A A G ~ ~

AT(A/TIC) ATG AA(T/C) GGI GCI AA(CT) CA(TC) (AC)GI ATG

iCC (GIAIT)AT CCA IAC (A/G)TC (AIG)TT ICC

AAA ACG GAG GGG ATA GAA TG

TAA TTG CAT GAG GTC GAG CG

annealing for 30 s at 94OC, elongation for 1 min. at 72OC; and a final elongation

for 5 min. at 72OC. A magnesium concentration of 1.5 mM was used in al1

reactions.

For sequencing of the ermTR gene found in S. milleri, primers were

designed to amplify as much of the emTR structural gene, in addition to the two

upstream leader peptide regions, as possible. The primers ermTRC and

ennTRD amplified an 835 bp fragment comprising rnost of leader peptide 1, al1 of

leader peptide 2. and the majority of the emTR structural gene, with the

exception of the predominantly AT-rich terminus. The same parameters used for

PCR with primers ennTRA and ennTRB were employed.

3.4.3) vaWati3hatC/satA PCR

Degenerate primen, M and N, were used (Allignet et al., 1996) which

were designed to amplify a 147 bp product representing conserved regions of

motifs III and IV from the streptogramin A acetyltransferases vat, vatB, and vatC

from S. aureus and satA from E. faecium. Low stringency PCR was canied out

under the following conditions: 1) initial denaturation at 95OC for 5 min.; 2) 35

cycles of denaturation at 95OC for 30 s, annealing at 40°C for 2 min., elongation

at 72OC for 1 min. 30 s; 3) final annealing at 4OoC for 4 min.; and 4) final

extension at 72OC for 12 min. A magnesium concentration of 1.5 mM was used

in al1 reactions.

3.4.4) vgb PCR

Primers were designed in our laboratory to amplify an approximately 700

bp region within the virginiamycin B hydrolase gene, vgb. from S. aureus. The

conditions used were as follows: 1) initial denaturation at 94OC for 3 min.; 2) 35

cycles of denaturation at 94OC for 30 s, annealing at 52OC for 30 s, elongation at

7Z°C for 1 min.; and 3) a final elongation at 72OC for 5 min. A final magnesium

concentration of 1.5 mM was used.

3.5) Pulsed Field Gel Electrophoresis

Pulsed field gel electrophoresis (PFGE) (Murray et al., 1990) with the

CHEF DRll apparatus (Bio-Rad) and Smel digestion were performed on 8-12

representative isolates of each: MLS, phenotype (em positive), M phenotype

(mef positive). susceptible strains (em negative. mef negative), and resistant

strains (em negative, mef negative). The following S. pneumoniae strains 3585

(ermAM), 0251 175 (mefE), and ATCC 4961 9 were used as controls.

Modifications included a lysis time of 2 h and the following electrophoretic

parameters: pulse times 0.2 - 35 s, temperature 14OC, 200 volts for 21 h.

3.6) Southern Blotting

3.6.1) Sandwich Method

Southem blotting of the PFGE gels was perfomed as previously

described (Southem, 1975). The transfer was left to proceed ovemight and the

DNA fixed to the membranes by 1 min. exposure in a UV crosslinker

(Stratagene). The gels were subsequently restained in ethidium bromide to

confimi the transfer of the DNA bands to the membranes. The blots were then

rinsed in dH,O to rernove any traces of agame and excess salt and were stored

in sealed plastic bags at 4OC until ready for use in hybridization studies.

3.6.1) Dot Blot Method

Dot blot hybridization was performed on the 8-12 representative isolates

with the addition of plasmid DNA from strains E. coli RN7951 (emA) and S.

aumus RN4220 (emC) for ptobing with ennA and ermC amplicons. The DNA

was prepared for blotting as previously described (Southem, 1975) and

transferred to nitrocellulose membranes (3M) by vacuum suction using a 96-well

apparatus (San brook et al., 1 989).

3.7) Probing for ermA. - B. -C, and mef genes

All probes were purified using the QlAquick PCR purification kit (Qiagen).

Hybridization and detection was performed by enhanced chemiluminescence

using the €CL direct nucleic acid labelling system (Amersharn Life Science,

Oakville, Ont.). The Mots prepared from the PFGE gels were screened for

emB(AM) and mef using probes generated by PCR. The dot blots. which

contained the same representative isolates with the addition of plasmids

harbouring emA and ennC were screened with probes generated by PCR for

emA and emC. Additionally, a 16s PCR proâuct, representing a conserved

region of pneumococcal16S rRNA, was used as a probe to confimi the

presence of pneumococcal DNA on the blot.

4.0) RESULTS

4.1) Group Identification of Viridans Streptococcal lsolates

Of the nine viridans streptococci found to lack an e m or mef gene, eight

were presumptively identified to the group level based on standard biochemical

testing. Based on positive reactions with the various substrates used. one of

these isolates was found to be S. bovis, two belonged to the S. milleri group, one

to the S. mutans group, and four to the S. M i s group.

4.1) Susceptibility Data: Broth Microdilution and Disk Susceptibility Testing

Of 5029 isolates S. pneumoniae tested, 147 (2.9%) were found to be

erythromycin-resistant by broth microdilution. Of these, 64 (1.3%) were found to

be clindamycin-resistant. No erythromycin susceptible, clindamycin resistant

streptococci have been identified to date. All erythromycin resistant isolates were

subsequently screened by disk diffusion to detect already known and potentially

novel MLS phenotypes among randomly selected, unbiased S. pneumoniae

isolates, as well as selected isolates of viridans streptococci. Both methods were

found to be very reliable at detecting the various MLS phenotypes.

The predominant phenotype detected among these isolates was the M

phenotype, with 77 isolates detected by disk diffusion and 78 detected by broth

microdilution. The MLS, phenotype was the second most commonly identified

phenotype with 61 isolates detected by disk diffusion, but only 51 detected by

broth microdilution. An ML phenotype was identified among three isolates by

disk diffusion and nine by broth microdilution based on quinupristin levels c; 4

pglmL by broth microdilution. An MS phenotype was identified among six

isolates screened by disk diffusion and nine isolates screened by broth

microdilution. The following isolates were identified as MS resistant by both

methods: 442, 1914, 2669, 2859, 2867, and 6131. The following three isolates

were identified as possessing an MS phenotype by broth microdilution only:

2189,2636 (quinupristin MlCs = 8 pgImL), and 7488 (quinupristin MlCs 16

pg/mL). Of these, isolates 21 89 and 2636 demonstrated M phenotypes and

7488 an MLS, phenotype by disk diffusion. Of twelve eiythromycin susceptible

pneumococci, two were foond to be resistant to quinupristin alone with MlCs of 8

pg/mL and 16 pg/mL respectively.

Of the nine viridans streptococci tested, six demonstrated a definite MLS,

phenotype based on resistant zone sizes to erythromycin, clindamycin, and

quinupristin. In total. six isolates demonstrated a definite MLS, phenotype based

on resistance to erythromycin, clindamycin, and quinupristin by both methods.

Of the rernaining three isolates, S. bovis 421, demonstrated resistance to

erythromycin, susceptibility to clindamycin, and slightly reduced susceptibility to

quinupristin, suggesting the presence of an M or possibly an MS phenotype

(Figure 2). By broth microdilution. this isolate possessed a distinct MS

phenotype. However, when a clindamycin and a quinupristin disk were placed

within 20 mm of the erythromycin disk, D-shaped zones of inhibition were

observed around clindamycin and quinupristin, indicating inducible resistance in

the presence of eryüiromycin, which was undetectable by both methods.

Another isolate, S. mutans BSV 134, demonstrated resistant zone sizes to

erythrornycin and clindamycin, but susceptibility to quinupristin, suggesting an

ML phenotype (Figure 3). This isolate likewise possessed an ML phenotype by

broth microdilution. However, when both the clindamycin and quinupristin disks

were placed in close proximity to the erythromycin disk, a D-shaped zone of

Flgun 2. Susceptibility testing of S. bovis BSV 421 by disk diffusion using

eiythromycin and dindamycin disks.

Flgun 2: Oemonstration of inducible clindamycin resistance (top left disk) nihm

placed in close pmximity to an erythromycin disk (top right). Zone of inhibition

around clindamycin disk aione (bottom left) mis susceptible when not in

ciose proximity to an erythromydn disk (bottom right).

Flgun 3. Susceptiôiîity testing d S. mulMs 8SV 134 by disk difbion using

erlyIhromycin and clindam ycin disks.

Flgun 3: Demonstratbn of dindamycin resistance (top left disk and top right

disk) end e w r m ycin eryütromycin resistance (bottom left disk and bottom dght

disk). InduciMe resistence to quinupristin (streptogramin 6) not shown.

inhibition was observeci around both the clindamycin and quinupristin disks,

indicating inducible resistance in the presence of erythromycin.

In the third isolate, S. millen' BSV 377, this organisrn demonstrated

intermediate resistance to erythromycin. but complete resistance to clindamycin

based on the absence of any zone of inhibition, as well as resistance to

quinupristin (Figure 4). Similarly, by broth microdilution, this isolate was only

intemediately resistant to erythromycin but expressed high level resistance (264

pg/mL) to clindamycin. Interestingly, when both clindamycin and quinupristin

disks were placed within close proximity to an erythromycin disk, no evidence of

any induction was observed. The erythromycin zone size did not blunt and

continued to dernonstrate intemediate resistance to ewhrornycin and high-level

resistance to clindamycin based on the absence of a zone of inhibition

surrounding the clindamycin disk. This phenotype is in stark contrast with the

emTR phenotype observed in S. pyogenes, whereby erythromycin resistance is

characterized by a small resistant zone size and clindamycin appears active in

vitro, characterized by a susceptible zone size, but is inducibly resistant in the

presence of erythrornycin (Figure 5). The phenotype displayed by the latter is

the same as that observed in staphylococci possessing ermA, which is not

surprising owing to the 80% homology between ermTR and emA, which are two

rnost highly related e m genes.

Resistance to synercid was also screened for. despite only recently

having been approved in North America for therapeutic use for multidrug-

Flgun 4. Susceptibility t d n g of S. m1W BSV 377, harbouring ennTR, by disk

diffusion using erythromydn and clindamydn disks.

Flgw 4: Demonstraton of the wiusual resîstence pattern by S. milleri BSV 377

harbouring enTl?. The zone size sumwndlng the eiythromycin disk (Mt)

exhibits intemediate level resistance, whereas high-levd clindamycin resistance

c m be detected by the lack of any zone of inhibition around the clindamycin disk

(right). No evidence of induction can be detected even when the two disks are

Maiin close proximity to each other.

Flgun 5. Suscepbibility testing of S. p- OX1110, haburing m T R , by

disk diffosim using eryairomycin and dindamycin disks.

Flgun 5: Demanstretbn of the typicai resistance pattern by S. pyogenes

haibouring ennTR. Etythromycin resistence is chamcterized by a srnail zone of

inhibition (top and bottom left), whereas clindamycin appears to be susceptible in

aie absence of erythromycin (top right) but is induciMy resistant, characteriteci

by a Munted tom of inhibition (bottom right), when an erythrompin disk is

pîaced within close pfoxîmity.

resistant infections. as streptogramins have been routinely used in animal feed

here for years. All pneumococci tested, with the exception of one. were found to

be susceptible to synercid, whereas five of the nine viridans streptococci were

found to be resistant by both disk diffusion and broth microdilution.

4.3) PCR

4.3.1) emA, -8, -C, and mef PCR

Multiplex PCR. using primen specific for emA, emB (ermAM), emC,

and mef, yielded results generally predicthre of the observed MLS, and M

phenotypes. Characterization of the erythmmycin resistant S. pneumoniae

isolates by broth microdilution, disk diffusion, and PCR is summarized in Table 4.

By broth microdilution, ewhromycin resistance was consistently found to be

greater among those isolates possessing an e m gene (MIC, r 64 pglmL, MIC,

r 64 pg/mL) compared to those with mef (ME, = 4.0 pglmL, MIC, = 32 pglmL),

thus, also proving to be generally predictive of whether resistance is due to

target modification or active efflux (Figure 6).

In cornparison with the resistance genes detected. there was excellent

correlation between disk diffusion and broth microdilution at predicting those

isolates possessing an M phenotype due to mef. Of the 82 rnef genes detected

in total, 76 were identified among the 77 isolates with an M phenotype by disk

diffusion and 78 by broth microdilution. One isolate. SPN 2636, possessing an

M phenotype by disk diffusion but lacking a mef gene, was found to possess an

MS phenotype by broth microdilution and may represent a novel mechanism of

Table 4. Characterization of 147 erythromycin-resistant S. pneumoniae by broth

microdilution. disk susceptibility testing, and PCR.

Resistance Suscepti bility test

phenotype method

Resistance genes

detected

Broth Disk ennA,-8,-C rnef none microdilution diffusion

-

Total 147 147 57 82 9

a MLS,: macrolide/linwsamide/streptogramin,-resistant. ML: macrolidellincosamide-resistant; lincosamidelstreptogramin,- susceptible. M: macrolide-resistant; lincosarnidelstreptogramin,-susceptible. MS: ma~f~lide/~tfept~gramin~-resi~tant; lincosamide susceptible

%ne constitutive MLS, isolate possessed both e m and mef genes

Figure 6. Distribution of mef and e m genes according to the MIC of

erythromycin.

Oenn - 1 mef + Oerm - 1 mef -

0.5 1 2 4 8 16 32 6 4 '

Erythromycin MIC (pglml)

broth microdilution was found to be MLS, resistant by disk diffusion and

possessed an e m gene.

60th mechanisms were found to occur in one isolate, SPN 779. which

was found to possess both rnef and enn, despite possessing an MLS,

phenotype by both methods. The rnef gene was also identified in five isolates

(1914,2669,2859,2867, and 6131) demonstrating an MS phenotype which

accounted for the observed macrolide resistance, but failed to account for the

streptogramin resistance found in these isolates. An additional MS isolate, SPN

442, demonstrated intermediate level resistance to erythromycin and resistance

to quinupristin by both methods, and lacked both mef and em. These findings

suggest the presence of an independent streptogramin resistance mechanism.

Of the 57 e m genes detected, 56 were identified among isolates with an

MLS, phenotype, whereas one e m gene was detected in one isolate, SPN

7638, demonstrating an ML phenotype by both susceptibility methods. This

suggested that SPN 7638 was in fact MLS, cross-resistant and that resistance to

quinupristin was not induced. Two isolates with an ML phenotype detected by

both methods, SPN 2960 and SPN 8265, were found to lack both mef and em.

By broth microdilution, six additional isolates were identified as ML resistant

(633,2048,2831,6459,6515, and 7218); however, by disk diffusion they

possessed an MLS, phenotype and by PCR were found to harbour an e m gene.

In total, nine isolates were identified which did not possess either mef or

an e m gene. Five isolates (1 178,3843,6549,6990,6996) found to possess an

MLS, phenotype, characterized by complete cross-resistance to al1 three classes

by disk diffusion. demonstrated either apparent clindamycin susceptibility in

some strains. or a lower level of resistance (< 32 pglmL) in others than found in

isolates harbouring etmB (MICM 2 64 CcglmL) when tested by broth microdilution.

Two isolates (SPN 2960 and SPN 8265) were found to possess an ML

phenotype. and one isolate (SPN 442) an MS phenotype, by both susceptibility

test methods. whereas one isolate (SPN 2636) demonstrated an MS phenotype

by broth microdilution but an M phenotype by disk diffusion.

4.3.1) ermTR PCR

Of the nine pneumococci and nine viridans streptococci found to lack

emA, 4, -C, and mef, only one isolate of S. millen gp. was found to possess

the wmTR gene which has, until now, only ever been identified in Group A

streptococci to date (Figure 7).

A) Sequence Analysis of an 835 bp ermTR Fragment from S. milleri group.

Interestingly, while the one S. milledgp. isolate was found to contain the

same e n gene as is commonly found in S. pyogenes, it's phenotypic resistance

pattern was rnarkedly different from that observed in the latter. The phenotype in

S. pyogenes can be characterized by resistance to erythromycin based on a

small zone site, although larger than observed with ennB(AM), and apparent

susceptibility to clindamycin (personal observations and personal communication

with Joyce Sutcliffe. Pfizer Central Research. Groton, Connecticut.). However,

when both disks are within close proximity to each other. clindamycin is induced

by erythromycin to become resistant. l ndividual colonies which are inducibly

Figure 7. PCR analysis dernonstrating the presence of ennTR in one MLS,-

resistant isolate of S. millefi

Lane: 1 - 1 kb ladder 2 - plP524 (negative control) 3 - pAT15 (negative control) 4 - S. pyogenes 02C1110 (positive control) 5 - S. pyogenes 8595 (positive control) 6 - ATCC6303 (negative control) 7 - ATCC 4961 9 (negative control) 8 - S. mitis BSV 1 00 9 - S. mutans BSV 134

10 - S. millen BSV 150 1 1 - S. bovis BSV 188 12 - S. mi!is BSV 205 13 - S. mitis BSV 223 14 - S. mitis BSV 247 15 - S. milleri BSV 377, ermTR+ 1 6 - S. ~ O V ~ S BSV 42 1 17 - nongroupable BSV 442 18 - negative reagent control

resistant can be seen extending up to and beyond the clindamycin disk. In this

particular isolate of S. milleri gp., however, the resistance pattern was markedly

different. In contrast with S. pyogenes, the organism exhibited only intenediate

level resistance to erythromycin, yet full resistance to clindamycin based on the

absence of any zone of inhibition. When the disks were placed within close

proximity to each other, however, no change in phenotypic expression was

observed. Sequence analysis of the 835 bp amplicon generated from the

genomic DNA of this isolate demonstrated the finding of two mutations: one in a

noncoding region between the ribosomal binding site and the start codon for the

methylase structural gene, and the other within leader peptide 2, located

upstream from the methylase gene, resulting in an amino acid switch from

isoleucine to asparagine.

4.3.3) vaükat#vatC/satA PCR

PCR was perfonned using degenerate primers specific for the four known

streptogramin A acetyltransferases described to date. None of the erm negativel

mef negative pneumococci or viridans streptococci were found to possess any of

these genes. Consequently, the synercid resistance observed in one

pneumococcus and five viridans streptococci is not due to any of these

streptogramin acetyltransferases.

4.3.4) vgb ?CR

The eighteen etm negativelmef negative pneumococci and viridans

streptococci, as well as the two erythromycin susceptible pneumowcci resistant

to quinupristin, were screened by PCR for the presence of the virginiamycin B

hydrolase to sccount for the observed streptogramin 6 resistance levels

observed in al1 isolates. None of these were found to possess the vgb gene.

4.4) Pulsed Field Gel Electrophoresis

PFGE dernonstrated that, of 42 strains tested, 40 were clonally distinct

(Figures 8 and 9). Lanes 5 and 27 appear to be the sarne as are lanes 19 and

20. Thus, the isolates selected from each group tmly represented a random,

unbiased representation of pneumococci from across Canada for determination

of the true prevalenœ of MLS resistance mechanisms.

4.5) Hybridization Results Using emA, -8, -C, and rnef Probes

Hybridization studies on selected isolates supported the ?CR findings in

that only those positive for enn8 by PCR hybridized with the emB probe (Figure

IO), but not with emA, emC, and mef probes, whereas only those positive for

mef by PCR hybridized with a mef probe (Figure 1 1 ). Erythromycin susceptible

strains and resistant strains which were ennwmef negative did not hybridize with

any of the probes, and erythromycin resistant emi8 negativelmef negative

isolates were negative by probing for both genes (Figures 12 and 13). Thus,

PCR was reliable in characterizing the two major mechanisms of resistance. The

presence of nine isolates which did not yield amplicons by PCR and did not

hybridize with em and mef suggests the presence of novel genes or

mechanisms of resistance.

Dot blot hybridization studies of the two viridans isolates possessing an

inducible MLS, phenotype demonstrated that the cross-resistance to al1 three

antimicrobials was not due to emA, -0, 4, or -TRp suggesting the presence of a

novel e m gene, or as yet unidentifid mechanism (data not shown).

Figure 8. Pulsed-field gel electrophoresis of selected erm-positive, mef-positive

S. pneumoniae.

1 - lambda ladder 2 - 3585 (ermB positive control) 3 - 0251 175 (mef positive control) 4 - ATCC 49619 (negative control) ennB positive S. pneumonlae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 Il - 2831 12- 6139 13 - 6515 14 - 6823 15 - 7218 16 - 7638

mef positive S. pneumoniae 17 - 719 18 - 836 19 - 958 20 - 1219 21 - 1781 22 - 191 23 - 2183 24 - 2471 25 - 3108 26 - 6673 27 - 7701 28 - 7732

Figure 9. Pulsed-field gel electrophoresis of novel MLS-resistant isolates and

selected erythromycin susceptible isolates of S. pneumoniae.

1 - lambda ladder 2 - 3585 (erm8 positive control) 3 - 025 1 1 75 (mef positive control) 4 - ATCC 4961 9 (negative control) em8-/mef- novel S. pneumoniae 5 - 442 6 - 1178 7 - 2960 8 - 3843 9 - 6549 I O - 6990 1 1 - 6996 12 - 8265

erythrornycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 -2697 20 - 3248 21 - RB (susceptible control) 22 - ATCC 6303 (susceptible control)

Figure 10. Analysis by southern blot of the PFGE gel from Figure 8 containing

selected emSpositive and mef-positive pneumococcal isolates, and probed with

ermS amplicon.

1 2 3 4 5 6 7 8 9 10 11 121314 15161718t920 2122232425 26 2728

1 - lambda ladder 2 - 3585 (erm8 positive control) 3 - 02J1175 (met€ positive control) 4 - ATCC 49619 (negative control) ermB positive S. pneumoniae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 11 - 2831 12- 6139 13 - 6515 74 - 6823 15 - 7218 16 - 7638

mef positive S. pneumoniae 17 - 719

Figure II. Analysis by southern blot of the PFGE gel from Figure 8 containing

selected emB-positive and mefipositive pneumococcal isolates, and probed with

mef amplicon.

1 2 3 4 5 6 7 8 9 10 11 12 13 1415 16 17181920 2122232425 26 2728

W . * œ- m

1 - lambda ladder 2 - 3585 (emB positive control) 3 - 02J 1 175 (mefE positive control) 4 - ATCC 496 19 (negative control) e r . 6 positive S. pneumoniae 5 - 633 6 - 800 7 - 1242 8 - 1346 9 - 1503 10 - 2707 Il - 2831 12- 6î39 13 - 6515 14 - 6823 15 - 7218 16 - 7638

mef positive S. pneumoniae 17 - 719 18 - 836 19 - 958 20 - 1219 21 - 1781 22 - 191 23 - 2183 24 - 2471 25 - 3108 26 - 6673 27 - 7701 28 - 7732

Figure 12. Analysis by southern blot of the PFGE gel from Figure 9 containing

selected emB-lmef-negative novel pneumococcal isolates and selected

erythromycin susceptible isolates, probed with mef amplicon.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

1 - lambda ladder 2 - 3585 (emB positive control) 3 - 025 1 175 (met€ positive control) 4 - ATCC 4961 9 (negative control) errnB/mef- novel S. pneumoniae 5 - 442 6 - 1178 7 - 2960 8 - 3843 9 - 6549 I O - 6990 1 1 - 6996 12 - 8265

erythromycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 - 2697 20 - 3248 21 - R6 (susceptible control) 22 - ATCC 6303 (susceptible control)

Figure 13. Analysis by southern blot of the PFGE gel from Figure 9 containing

selected emS-lmef-negative novel pneumococcal isolates and selected

erythromycin susceptible isolates, probed with emB amplicon.

1 2 3 4 5 6 7 8 9 10 11 1213 741516 1718 19202122

1 - lambda ladder 2 - 3585 (em8 positive control) 3 - 02J 1 175 (mefE positive control) 4 - ATCC 4961 9 (negative control) em8-/mef- novel S. pneumoniae 5 - 442 6-1178 7 - 2960 8 - 3843 9 - 6549 10 - 6990 11 - 6996 12 - 8265

erythromycin susceptible S. pneumoniae 13 - 1060 14 - 1753 15 - 1967 16 - 2199 17 - 2330 18 - 2468 19 - 2697 20 - 3248 21 - R6 (susceptible control) 22 - ATCC 6303 (susceptible control)

5.0) DISCUSSION

This study is the first report to characterize the MLS resistance

mechanisms present among an unbiased collection of 147 erythromycin resistant

pneumococcal isolates obtained from across Canada. Antibiotic susceptibility

studies. combined with PCR and hybridization studies, enabled effective

characterization of both known as well as potentially novel MLS resistance

mechanisms. The macrolide-specific active efflux rnechanism, characterized by

the presence of the mef gene, was easily identified among 76 isolates with an M

phenotype (out of 77 detected by disk diffusion and 78 detected by broth

microdilution), and was found to be the predominant mechanism of erythromycin

tesistance among S. pneumoniae. Ribosomal modification due to e n was

identified arnong 57 isolates, 56 of which possessed an MLS, phenotype (out of

61 detected by disk diffusion and 51 by broth microdilution) and one with an ML

phenotype (out of 3 detected by disk diffusion and 9 by broth microdilution). One

strain was found to harbour both genes, yet possessed an MLS, phenotype by

both susceptibility methods, indicating that this phenotype is the dominant

phenotype when both rnechanisms are present within the same isolate. This is

the first report of both genes being detected in S. pneumoniae. A potential

reason for the discrepancy observed in detecting the various MLSB phenotypes

by both susceptibility methods compared with the results obtained by PCR,

notably regarding clindamycin and quinupfistin MICs, can be attributed to the

difference in incubation conditions as defined by NCCLS. For streptococci, disk

susceptibility plates are incubated in CO,, whereas broth microdilution panels are

incubated in 4. Broth microdilution panels are only incubated in C0,when the

organism fails to grow in the presence of O,. Consequently, the effect of CO2 on

either clindamycin or quinupristin induction, whether due to pH changes or

enhanced growth of the organism in the presence of 5% CO,, often results in a

more resistant phenotype (personal observation). Based on the PCR findings,

however, disk diffusion appean to be the more reliable indicator of the

underiying resistance mechanism.

Five isolates, also found to possess met demonstrated resistance to

streptogramin B. A sixth isolate. also demonstrating an MS resistance

phenotype, only demonstrated intermediate-level resistance to erythromycin and

lacked the mef gene, but was resistant to streptogramin B. This particular

finding, in addition to the identification of two ewhromycin susceptible

pneumococcal isolates with resistance to streptogramin 6, suggests that there is

possibly a novel mechanisrn of streptogramin B resistance in S. pneumoniae. It

is detectable by both broth microdilution and disk diffision among isolates which

are resistant to emhromycin only, but may be undetected in those isolates

possessing ennB and the resultant MLS, phenotype. The observed macrolide

resistance in five of these isolates is clearly due to the mef gene present, as it is

unlikely that two mechanisms of macrolide resistance wuld result in MlCs as low

as 1 pgImL. Bordedine intemediate resistance in one isolate, possessing an

MS phenotype but lacking the mef and ennB gene, was observed by both broth

microdilution and disk diffusion. It is possible that this isolate is inherently less

susceptible erythromycin and is not due to a novel macrolide resistance

mechanism. The finding of streptogramin B resistance among two erythromycin

susceptible pneumococci. however, suggests that the observed streptogramin

resistance is a streptogramin-specific mechanism. and is not part of a macrolide-

streptogramin specific efflux pump. as is found in staphylococci.

It would seem unlikely that the mechanism responsible for the observed

streptogramin B resistance is due to ribosomal modification, owing to the fact

that the shared binding sites of the three classes would involve the macrolides

and lincosamides to soma degree (Leclercq and Courvalin, 1991 ). Disk

approximation tests did not reveal induction of resistance to either macrolides or

lincosamides in the presence of a streptogramin B disk.

The detection of nine pneumococcal isolates in total demonstrating

varying degrees of resistance to al1 three classes of MLS antibiotics. but lacking

any the known streptococcal MLS resistance genes (emB, emTR, and mef),

suggests the presence of additional resistance mechanisms. Hybridization

studies confinned that the negative results obtained by PCR are not simply ?CR

artifacts, but that these strains are in fact resistant on the basis of an unknown

resistance gene(s). In addition to the MS isolate which demonstrated bordedine

erythromycin resistance, one isolate was found to possess an M phenotype,

suggesting an unknown macrolide resistance mechanism, whereas five isolates

demonstrated an MLS, phenotype, characterized by high level cross-resistance

to al1 three classes, and two isolates demonstrated an ML phenotype. However,

since the rernaining ML isolates were found to be MLS, resistant by disk

diffusion and contained an e m gene. both of these phenotypes can be attributed

to ribosomal target modification sinœ quinupristin resistance is observed in the

presence of an erythromycin disk. The apparent streptogramin B susceptibility in

these isolates indicates that quinupristin is not an effective inducer of methylase

synthesis in these particular isolates. Thus, the finding of these same

phenotypes among isolates lacking any of the known e m genes, suggests the

presence of a novel em gene. Similarly. two of the nine viridans streptococci.

found to lack any known stieptococcal MLS resistance genes, possessed

unusual phenotypes by disk diffusion characterized as being MS and ML

resistant, respectively. However, the disk approximation method gave evidence

of erythromycin induction resulting in zones of inhibition around both clindamycin

and streptogramin disks characterized by a blunted edge nearest the

erythromycin disk, providing some support for the idea of a variant enn gene

among pneumowcci and viridans streptococci. It is also possible that this enn

gene is inherent in streptococci and is now upregulated in these particular

isolates, resulting in expression. It seems unlikely that the mechanism of

resistance in these seven isolates is either efflux or enzymatic inactivation, owing

to the fact that the three classes are structurally and functionally dissimilar.

Overlapping binding sites on the ribosome is the only feature shared in comrnon

among the three classes. Whife active efflux remains a remote possibility,

enzyme inactivation is unlikely, as al1 known MLS modifying enzymes are

specific to a particular antibiotic class and structure.

Of the nine viridans streptococci screened further due to unusual

resistance patterns, five isolates demonstrated resistance to synercid . Each of

these isolates was also found to possess an e m gene. However, the presence

of streptogramin B resistance does not confer resistance to the synergistic

combination, thereby suggesting that the obsewed synercid resistance is

instead due a putative streptograrnin A resistance rnechanism. The MlCs

obtained for dalfopristin were not useful in detecting a putative rnechanism due

to the inherent resistance to type A streptogramins found in streptococci. Further

biochemical studies are warranted. The finding of synercid resistance among

Canadian streptococci is particularly disturôing in light of the fact that this drug

has only recently been approved for use in North America. Unfortunately,

streptogramins have been used in Canadian animal feed for decades and may

have provided the selective pressure for the emergence of a novel streptogramin

resistance genelmechanism.

Finally, one additional isolate, S. milleri 377, was found to possess the

recently described emTR gene, which has only ever before been found in S.

pyogenes until now. Interestingly, the phenotypic appearance of the S. millefi

isolate was found to be markedly different fmm Group A streptococci harbouring

ermTR, which can be characterized as moderately erythromycin resistant and

clindamycin sensitive in vitro, but inducibly resistant to clindamycin in the

presence of etythromycin. In S. mikn, however, resistance to erythromycin falls

on the breakpoint for intemediate resistance, whereas high level clindamycin

resistance is observed. Disk approximation testing fails to demonstrate any level

of induction of erythromycin by clindamycin. This phenotype may be due to

three possible reasons. Firstly, it is possible that the expression of emTR in S.

miïen is different owing to a different host background. Secondly, it is possible

that a lincosamidsspecific resistance mechanism may account for the high level

clindamycin resistance observed. Finally, it is also possible that either of the two

mutations found upstream of the emTR methylase may result in changes in

induction specificity.

In this population-based study of clinical S. pneumoniae isolates from

across Canada, we found that 55.1 % of al1 macrolide resistant isolates were

resistant due the macrolide efffux pump, characterized by the M phenotype by

antibiotic susceptibility methods. This proportion was lower than that reported by

Sutcliffe (85% M phenotype) and higher than that reported by Shortridge (42% M

phenotype). However, both of these previous studies evaluated selected, non-

population based collections of isolates. Resistance due to target modification,

characterized by both the MLS, and ML phenotypes, accounted for 38.8% of

isolates. Nine isolates (6.1 %) demonstrated unusual resistance patterns and did

not possess either mef or e m genes, suggesting putative novel mechanisms.

These findings more closely reflect the true proportion of each mechanism in S.

pneumoniae, as well as the potential finding of other novel MLS resistance

genes.

6.0) Future Studies

As most streptogramin resistance is due to modifying enyzmes,

elucidating this mechanism may best be approached by various biochemical

assays in which quinupristin is used as substrate to screen for inactivation of the

drug. Detedion of enzymatic activity can by screened for by scanning

spectrophotometry. Modified dnig can be screened for either by thin-layer

chromatography. or by high pressure liquid chromatography, depending upon

the sensitivity required to enable detection. Altematively, the organism can be

grown ovemight and the wncentrated cell suspension added in a predetermined

aliquot to a microtiter plate and grown ovemight in various concentrations of the

drug. Following centrifugation. a portion of the supematant can be spotted ont0

sterile disks which are subsequently applied to plates swabbed with a

susceptible control strain to obtain confluent growth. Zone sires are then

compared with zone sizes produced from disks containing medium plus drug

alone versus disks containing medium plus drug inoculated with the isolate

containing the putative modifying enzyme. If the mechanism proves not to be a

modifying enzyme, active efflux can be screened for by radiolabeling quinupristin

and monitoring the uptake of drug into cells growing exponentially. Active efflux

can be determined following the addition of a metabolic inhibitor of proton motive

force, such as sodium arsenate or carbonyl cyanide m-chlomphenylhydrazone

(CCCP), and a measure of the radioactivity found in the supernatant, determined

by liquid scintillation counting . A decrease in the amount of radioactivity in the

culture supematant following the addition of the metabolic inhibitor, indicating

accumulation of the drug within the cell, is indicative of the dissipation of an

active efflux pump.

To determine whether or not the mechanism of resistance is in fact

ribosomal target modification, a methyltransferase assay can be perfonned to

detect the methylation of an adenine residue in the conserved peptidyl

transferase region using radiolabeled methionine as substrate. Alternatively,

target modification may also be detecteâ in a reconstituted translation assay in

which ribosomes isolated from MLS, resistant strains are screened for resistance

to inhibition when challenged with erythromycin, compared with those results

obtained using ribosomes from an erythromycin sensitive control. While this

method has been demonstrated successfully using staphylococcal ribosomes, a

previous atternpt at extrading functional ribosomes from MLS, resistant

pneumococci proved unsuccessful (Sutcliffe 1996). Failing these methods.

isolation of the putative e m gene can be screened for by shotgun cloning of 5 kb

pieces of genomic ONA into an MLS,-susceptible mutant E. coli (DB1 O), followed

by selection on plates containing erythromycin and a selectable resistance

marker wntained on the shuttle vector. The putative resistance determinant

must be located on the chromosome in both the pneumococci and viridans

streptococci, as plasmids wuld not be detected in any of these pneumococcal

isolates or the MU,-inducible S. mufans 134 and S. bovis 421, despite several

attempts at plasmid isolation. Theoreticaliy, only those transformants expressing

the cloned methylase will grow on plates containing erythromycin. A second

resistance marker, contained on the shuttle vector, must be selected for in

addition to erythromycin resistance due to the likelihood of spontaneous

erythromycin resistant revertants, frequently observed with this particular host

strain, which possesses an unknown cell wall mutation that results in

susceptibility to MLS antibiotics. Successful expression of Gram-positive MLS

resistance deteminants has been achieved in this particular host strain.

however, in light of the fact that expression of a methylase obtained from a

Gram-positive organism may be unsuccessful in a Gram-negative host. Bacillus

subtilis has been successfully shown to express methylase genes cloned frorn

Gram-positive organisms (Katz et al., 1987).

7.0) REFERENCES

Allignet, J., Loncle, V., Mazodier, P., and N. El Solh. (1988). Nucleotide

sequence of a staphylococcal plasmid, vgb, encoding a hydrolase inactivating

the 6 components of virginiamycin-like antibiotics. Plasmid, 20:271-275.

Allignet, J., and Na El Solh. (1992). Sequence of a staphylococcal plasmid

gene, vga. encoding a putative ATP-binding protein involved in resistance to

virginiamycin A-like antibiotics. Gene. 1 17:45-51.

Allignet, J., V. Loncle, C. Simenel, M. Delepierre, and N. El Solh. (7993).

Sequence of a staphylococcal gene, vat, encoding an acetyltransferase

inactivating the A-type compounds of virginiamycin-like antibiotics.

Gene 1 3O:W -98.

Allignet, J., and Na El Solh. (1995). Diversity among the Gram-positive

acetyltransferases inactivating streptogramin A and stnicturally relûted

compounds and characterization of a new staphylococcal determinant, vatB.

Antimicrobial Agents and Chemotherapy, 39:2027-2036.

Allignet, J. S. Aubert, A. Morvan, and N. El Solh. (1996). Distribution of genes

encoding resistance to streptograrnin A and related compounds among

staphylocacci resistant to these antibiotics. Antimicrobial Agents and

Chemotherapy. 40:2523-2528.

Allignet, J., Loncle, V., and N. El Solh. (1997). Characterization of a new

staphylococcal gene, vba0, encoding a putative ABC transporter conferring

resistance to streptogramin A and related compounds. Gene, 202: 133-1 38.

Allignet, J., N. Liassine, and N. El Solh. (1998). Characteriration of a

staphylococcal plasmid related to pu61 10 and canying two novel genes, vatC

and vgb6, encoding resistance to streptogramins A and 6 and similar antibiotics.

Antimicrobial Agents and Chemotherapy, 42: l794-Iï98.

Andremont, A., O. Gerbaud, and P. Courvalin. (1 986). Plasmid-mediated high-

level resistance to erythromycin in Escherichia coli. Antimicrobial Agents and

Chemotherapy, 29:515-5 18.

Argoudelis, A.D., and J.H. Coats. (1 969). Microbial transformation of

antibiotics. II. Phosphorylation of linwsamycin by Streptomyces species. Journal

of Antibiotics. 22(7):341-343.

Argoudelis, A.D., and J.H. Coats. (1 971 ). Microbial transformation of

antibiotics. V. Clindamycin ribonudeotides. 93(2):534-535.

Arthur, M., D. Autissier, and P. Courvalin. (1986). Analysis of the nucleotide

sequenœ of the ereB gene encoding the erythromycin esterase type II. Nucfeic

Acids Research, 14: 4987-4999.

Arthur, M., A. Andremont, and P. Courvalin. (1987). Distribution of

erythromycin esterase and rRNA methylase genes in members of the family

Enterobacteriaceae highly resistant to erythromycin. Antimicrobial Agents and

Chemotherapy, 31 404409.

Axelsson, L X , S.I. Ahme, M.C. Andersson, and S.R. Stahl. (1988).

Identification and cloning of a plasmid-encoded erythromycin resistance

determinant from Lactobacillus reuted. Plasmid, 20: 1 71 -1 74.

Barthelemy, P., Dm Autissier, Ga Gerbaud, and P. Courvalin. (1984). Enzymic

hydrolysis of erythromycin by a strain of Eschenchia cdi: a new mechanism of

resistance. Journal of Antibiotics, 37: 1692-1 696.

Birnboim, HaCm and J. Doly. (1979). A rapid alkaline extraction procedure for

screening recombinant plasmid DNA. Nucleic Acids Research 7: 151 3-1 523.

Bozdogan, B., L. Berrezouga, and R Leclercq. (1997). A new resistance

gene, linB. confemng resistance to lincomycin by inactivation in Entemcoccus

feecium HM1 025, abstract C-66, p. 57. In Abstracts of the 37n lnterscience

Conference on Antimicrobial Agents and Chemotherapy 1997. American Society

for Microbiology, Washington, D.C.

Bozdogan, B., and R. Leclercq. (1 997-8). lntrinsic and acquired resistance to

dalfopristin (streptogramin A) in Entemcoccus spp., abstract C-79, p. 59. In

Abstracts of the 37" lnterscience Conference on Antimicrobial Agents and

Chemotherapy 1997. Amencan Society for Microbiology, Washington. D.C.

Brisson-Noel, A. and P. Courvalin. (1 987). Nucleotide sequence of the gene

IinA encoding resistance to lincosamides in Staphylococcus haemolyticus. Gene

30: 1 57-3 66.

Brisson-Noel, A., P. Delrieu, D. Samain, and P. Courvalin. (1988). Inactivation

of lincosamide antibiotics in Staphylococcus. Journal of Biological Chemistry

263:15880-15887.

Burridge, Ra, C. Warren, and 1. Phillips. (1986). Macrolide, lincosamide and

streptogramin resistance in Campylobacter jejunüco/i. Journal of Antimicrobial

Chemotherapy, 17:315-321.

Clancy, J. J. Petitpas, Fm Dib-Hajj, W. Yuan, M o Cronan, A.V. Kamath, Je

Bergeron, and J.A. Retsema. (1 996). Molecular cloning and funciional analysis

of a novel macrolide-resistance deteminant, mefA, from Streptococcus

pyogenes. Molecular Microbiology, 22(5):867-879.

Cocito, Cm (1979). Antibiotics of the virginiamycin family, inhibitors which contain

synergistic components. Microbiological Reviews, 43: 145-1 98.

Cocito, Cm, M o Di Giambattista, Em Nyssen, and P. Vannuffel. (1997). Inhibition

of protein synthesis by streptogramins and related antibiotics. Journal of

Antimicrobial Chemotherapy, 39, Suppl. A, 7-13.

Cooksey, R e C o , Swenson, J.M., Clark, N.C., and Cm Thomsberry. (1989). DNA

hybridization studies of a nucleotide sequence horologous to transposon

Tn 1545 in the 'Minnesotan strain of multiresistant S?mptococcus pneumoniae

isolated in 1977. Diagnostic Microbiology and lnfectious Diseases 1 2: 1 3-1 6.

Coonan, KoM, and E.L. Kaplan. (1 994). In vitro susceptibility of recent North

American Group A streptococcal isolates to eleven oral antibiotics. Pediatric

lnfectious Oiseases Journal, 1 3:630-635.

Courvalin, P., C. Carlier, and YAm Chabbert. (1972). Plasmid-linked

tetracycline and ewhromycin resistance in group D Streptococcus. Annales

Institut Pasteur (Paris). 1 23:755-759.

Courvalin, P., H. Ounissi, and M. Arthur. (1 985). Multiplicity of macrolide-

lincosamide-streptogramin antibiotic resistance determinants. Journal of

Antimicrobial Chemotherapy, l6:gl -1 00.

Courvalin, P. and C. Cariier. (1986). Transposable multiple antibiotic resistance

in Streptococcus pneumoniae. Molecular and General Genetics 205:291.

Coyle, M.B., B.H. Minshen, J.A. Land, and P.C. Hsu. (1979), Erythromycin

and clindamycin resistance in Corynebacterium diphthenae from skin lesions.

Antimicrobial Agents and Chemotherapy, 1 6:525-527.

De Meester, C., and J. Rondelet. (1976). Microbial acetylation of M factor of

virginiamycin. Joumal of Antibiotics, 29(l2): 1297-1305.

Dixon, J.M.S., and A.E. Lipinski. (1 974). Infections with &hemolytic

Streptococcus resistant to lincomycin and erythrornycin and observations on

zonal-pattern resistance to lincomycin. Joumal of lnfectious Diseases, I30:35l-

356.

Dutta, G.N., and L.A. Devriese. (1982). Resistance to macrolides, lincosamide,

and streptograrnin antibiotics and degradation of lincosamide antibiotics in

streptococci from bovine mastitis. Joumal of Antimicrobial Chemotherapy,

1 0:403-408.

Eady, E.A., J.I. Ross, J.H. Cove, K.T. Holland, and W.J. Cundliffe. (1989).

Macrolide-lincosamide-streptogramin B (MLS) resistance in cutaneous

propionibacteria: definition of phenotypes. Joumal of Antimicrobial

Chemotherapy. 23:493-502.

Eady, E.A., J.I. Ross, J.L. Tipper, C.E. Walters, J.H. Cove, and W.C. Noble.

(1 993). Distribution of genes encoding eqtthromycin ribosomal methylases and

an erythrornycin efflux pump in epidemiologically distinct groups of

staphylococci. Joumal of Antirnicrobial Chemotherapy, 3 1 :211-217.

Feldman, LI., I.K. DiIl, C.E. Holmlund, H.A. Whaley, E.L. Patterson, and N.

Bohonos. (1964). Microbial transformations of macrolide antibiotics.

Antimicrobial Agents and Chemotherapy, 54-57.

Fernandez-Munoz, R., R.E. Monron, R. Torres-Pinedo, and D. Vasquez.

(1 971 ). Substrate- and antibiotic-binding sites at the peptidyl-transferase centre

of Escherichia col/ ribosomes. Studies on the chloramphenicol. lincomycin and

erythromycin sites. European Journal of Biochemistry, 23: 185-1 93.

Fierro, J.F., C. Vilches, Cm Hardisson, and JA. Salas. (1 989). Streptogramin-

inacüvating activity in three producer streptomycetes. FEMS Microbiology

Letters, 58:243-246.

Flickinger, M. and D. Perlman. (1 975). Microbial degradation of erythmmycin A

and B. Journal of Antibiotics, 28:307-311.

Fraimow, H., and Cm Knob. (1997). Amplification of macrolide efflux pumps msr

and meffrorn Enterococcus faecium by polymerase chah reaction, abstr. A-125,

p.22. In Prugram and Abstracts of the 97n General Meeting of the American

Society for Microbiology . American Society for Microbidogy , Washington, D.C.

Gilmore, M.S., O. Behnke, and J.J. Ferretti. (1982). Evolutionary relatedness

of MLS resistance and replication function sequences on streptococcal antibiotic

resistance plasmids, p. 174-1 76. In O. Schlessinger (ad.) , Microbiology - 1982.

American Society for M icrobiolog y. Washington. D.C.

Goldman, R.C., and J.O. Capobianco. (1 990). Role of an energy-dependent

efflux pump in plasmid pNE24-mediated resistance to 14- and 15-rnembered

macrolides in Staphylococcus epidemidis. Antimicrobial Agents and

Chemotherapy. 34: 1973-1 980.

Hagman, K.E., W.P. Pan, B.G. Spratt, J.T. Balthazar, R.C. Judd, and W.M.

Shafer. (1 995) Resistance of Neissena gonorrhoeae to antimicrobial agents is

modulated by the mtrRCDE efflux system. Microbiology, 141 :611-622.

Horinouchi, S., W.H. Byeon, and B. Weisblum. (1983). A complex attenuator

regulates inducible resistance to macrolides, lincosamides, and streptogramin

type B antibiotics in Streptococcus sanguis. Journal of Bacteriology, 154: 1252-

1262.

Horinouchi, S., and B. Weisblum. (1980). Posttranscriptional modification of

mRNA conformation: mechanism that regulates eryüiromycin-induced

resistance. Proceedings of the National Academy of Science. USA. 77(12):7079-

7083.

Hou, C.T., Perlman, Dm, and Schallock, M.R. (1 970). Microbial transformation

and properties of peptide antibiotics. VI. Purification and properties of a peptide

lactonase hydrolyzing dihydrostaphylomycin S. Journal of Antibiotics. 70:35-42.

Janosi, 1.. and E. Ban. (1 982). Localization of the gene(s) determining inducible-

type macrolide and streptogramin B resistance on the penicillinase plasrnid of

isolates of an epidemic of Staphylococcus eureus strain. In Curent

Chemotherapy and Immunotherapy, Vol. II. Proceedings of the 1 2" ln ternational

Congress of Chemotherapy, Florence, Italy, 1 981 (Periti, P. and Grassi, G.G.,

Eds.), 91 8-91 9. American Society for Microbiology, Washington, DC.

Janosi, Lm, Y. Nakajima, and Ha Hashimoto. (1 990). Characterization of

plasmids that confer inducible resistance to 1Cmembered macrolides and

streptogramin type B antibiotics in Staphylococcus aureus. Microbiology and

Immunology. 34:723-735.

Jenkins, G., Zalacain M., and E. Cundliffe. (1989). Inducible ribosomal RNA

methylation in Streptomyces lividans, conferring resistance to lincomycin.

Journal of General Microbiology 1 35:3281-3288.

Jenkins, G., and E. Cundliffe. (1991). Cloning and characterization of two

genes from Streptomyces lividens that confer inducible resistance to lincomycin

and macrolide antibiotics. Gene, 1 08:55-62.

Jenssen, W.D., S. Thakker-Varia, D.T. Dubin and M.P. Weinstein. (1987).

Prevalence of macrolides-lincosamides-streptograrnin B resistance and erm

gene classes among clinical strains of staphylococci and streptococci.

Antimicrobial Agents and Chemotherapy 31 : 883-888.

Johnston, N.J., J.C. de Azavedo, J.O. Kellner, and D.E. Law. (7998).

Prevalence and charactenzation of the mechanisms of macrolide, lincosamide,

and streptogramin resistance in isolates of Streptococcus pneumoniae.

Antimicrobial Agents and Chemotherapy, 42: 2425-2426.

Kataja, J., H. Seppala, M. Skumik, Hm Sarkkinen, and P. Huovinen. (1998).

Different erythromycin resistance mechanisms in group C and group G

streptococci. Antimicrobial Agents and Chemothera py, 42: 1493-1 494.

Katz, L., D. Brown, K. Boris, and J. Tuan. (1987). Expression of the macrolide-

lincosamide-streptogramin-B-resistance methylase gene, emE, from

Streptomyces egdhraeus in Eschenchia coli results in N 6-monomethylation and

N ', N 64imethylation of ribosomal RNA. Gene 55:319-325.

Kim, C.H., N. Otake, and H. Yonehara. (1974). Studies on mikarnycin B

lactonase. 1. Degradation of mikamycin B Streptomyces mitakaensis. Joumal of

Antibiotics, 27:903-908.

Klugman, K.P., and H.J. Koornhof. (1988). Dnig resistance patterns and

serogroups or serotypes of pneumococcal isolates from cerebrospinat fluid or

blood, 1979-1986. Journal of Infectious Diseases, 1 58:956-964.

Kono, M, K. O'Hara, and T. Ebisu. (1992). Purification and characterization of

macrolide P'phosphotransferase type II from a strain of Eschenchia coli highly

resistant to macrolide antibioücs. FEMS Microbiology Letters, 76:89-94.

Kuo, M.S., D.G. Chirby, A.D. Argoudelis, J.I. Cialdella, J.H. Coats, V.P.

Marshall. 1989. Microbial glycosylation of erythromycin A. Antirnicrobial Agents

and Chemotherapy, 33:2089-2091.

Lampson, B.C., and J.T. Parisi. (1986). Naturally occurring Sfaphylococcus

epidermidis plasmid expressing constitutive macrolide-linwsamide-streptogramin

B resistance contains a deleted attenuator. Joumal of Bacteriology, 166:479-

483.

Le Goffic, Fm, M.L. Capmau, J. Abbe, C. Cerceau, A. Dublanchet, and J.

Duval. (1 977). Plasmid-mediated pristinamycin resistance: PH1 A, a

pristinamycin 1 A hydrolase. Annales Microbiologie (Paris). Nov.-Dec.

128 6~471-474,

Leclerçq, R., and P. Courvalin. (1991). Bacterial resistance to macrolide,

lincosamide. and streptogramin antibiotics by target modification. Antimicrobial

Agents and Chemotherapy, 35: 1267-1 272.

Levy, SB. (1 992). Active efflux mechanisms for antimicrobial resistance.

Antimicrobial Agents and Chemotherapy, 36:695-703.

Mayford, M., and B. Weisblum. (1 985). Messenger RNA from Staphylococcus

aureus that specifies macrolide-lincosamide-streptogramin resistance:

demonstration of its conformations and of the leader peptide it encodes. Journal

of Molecular Biology 1 85:769-780.

McMuny, LM., A.M. George and S.& Levy. (1 994). Active efflux of

chloramphenicol in susceptible Eschenchia coli strains and in multiple-antibiotic

resistant (Mar) mutants. Antimicrobial Agents and Chemotherapy, 38: 542-546.

Milton, E.D., C.L. Hewitt, and C.R. Hamood. (1992). Cloning and sequencing

of a plasmid-mediated erythrornycin resistance determinant from Staphylococcus

xyîosus. FEMS Microbiology Letten. 97: 141 -1 47.

Mims, C.A., J.H.L. Playfair, I.M. Roitt, Dm Wakelin, R. Williams, R.M.

Anderson. (1993). Medical Microbology. Mosby Europe Limited, London.

Monod, M., C. Denoya, and D. Dubnau. (1986). Sequence and properties of

plM 13, a macrolide-lincosamide-streptogramin B resistance plasmid from

Bacillus sphaericus. Journal of Bacteriology, 167: 1 38-1 47.

Monod, M., S. Mohan, and Dm Dubnau. (1987). Cloning and analysis of emG,

a new macrolide-lincosamide-streptogramin B resistance plasmid from Bacillus

sphaericus. Journal of Bacteriology, 169340-350.

Murray, B.E., K.V. Singh, J.D. Heath, B.R. Shanna, and G.M. Weinstock.

(1 990). Cornparison of genomic DNAs of different enterococcal isolates using

restriction endonucleases with infrequent recognition sites. Journal of Clinical

Microbiolog y 28:2059-2063.

National Committee for Clinical Laboratory Standards (NCCLS). 1997.

Methods for dilution antimicrobial susceptibility tests for bacteria that grow

aerobically, 4th ed. Approved standard M2-A6 and M7-A4. National Committee

for Clinical Laboratory Standards, Villanova, Pa.

Nelson, C.T., €.O. Mason, Jr., and S.L. Kaplan. (1994). Activity of oral

antibiotics in middle ear and sinus infections caused by penicillin-resistant

Streptococcus pneumoniae: implications for treatment. Pediatric lnfectious

Diseases Journal, 1 3: 585-589.

Nikaido, H. (1994). Prevention of dnig access to bactenal targets: pemeability

barriers and active efflux. Science, 264:382-388.

Noguchi, N., A. Emura, H. Matsuyama, K. O'Hara, M. Sasatsu, and M. Kono.

(1 995). Nucleotide sequence and characterization of erythromycin resistance

deteminant that encodes rnacrolide 2'-phosphotransfene I in Eschenchia coli.

Antimicrobial Agents and Chemotherapy, 39:2359-2363.

Noguchi, N., J. Katayama, and K. O'Hara. (1996). Cloning and nucleotide

sequence of the mphB gene for macrolide 2'ghosphotransferase II in

Escherichia coli. FEMS Microbiology Letters. 144: 1 97-202.

O'Hara, K. T. Kanda, K. Ohmiya, T. Ebisu, and M. Kono. (1989). Purification

and characterization of a macrolide 2'-phosphotransferase frorn a strain of

Eschenchia coli that is highly resistant to erythromycin. Antimicrobial Agents and

Chemtherapy, 33: 1 354-1 357.

Ouinissi, H., and P. Courvalin. (1985). Nucleotide sequence of the gene ereA

encoding the ery&hromycin esterase in Escherichia coli. Gene, 35271-278.

Phillips, O., O. Parratt, G.V. Orange, 1. Harper, H. McEwan, and N. Young.

(1 990). Erythromycin-resistant Streptococcus pyogenes. Journal of Antimicrobial

Chemotherapy, 25:723-724.

PoyartSalmeron, C., P. TrieuCuot, C. Carlier, and P. Courvalin. (1991).

Nucleotide sequences specific for Tn I 5 6 l i ke conjugative transposons in

pneumococci and staphylowcci resistant to tetracycline. Antimicrobial Agents

and Chemotherapy, 35: 1657-1 660.

Quintilliani, Jr., R. and P. Countalin. (1996). Mechanisms of resistance to

antimicrobial agents. In Manual of Clinical Microbiology, ed. Murray et al. ASM

Press, Washington, D.C. 1 308-1 326.

Rende-Fournier, R., R Leclercq, M. Galimand, J. Duval, and P. Courvalin.

(1993). Identification of the satA gene enooding a streptogramin A

acetyltransferase in Entemcoccus faecium BM4145. Antimicrobial Agents and

Chemotherapy, 37:2 1 1 9-21 25.

Rinckel, L.A., and D.C. Savage. (1 990). Characterization of plasmids and

plasmid-borne macrolide resistance from Lactobacillus sp. Strain 100-33.

Plasmid 23: 1 1 9-1 25.

Ross, J.E., A.M. Farrell, E.A. Eady, J.H. Cove, and W.J. Cundliffe. (1989).

Characterisation and molecular cloning of the novel macrolide-streptogramin 6

resistance determinant from Stephy/ococcus epidennidis. Journal of

Antimicrobial Chemotherapy ,24: 851 -862.

Ross, J.I., E.A. Eady, J.H. Cove, W.J. Cundliffe, S. Baumberg, and J.C.

Wootton. (1 990). lnducible erythromycin resistance in staphylococci is encoded

by a member of the ATP-binding transport supergene family. Molecular

Microbiology. 4: 1207-1 2 14.

Ross, J.E., €.Am Eady, J.H. Cove, and S. Baumberg. (1995). Identification of a

chrornosomally encoded ABC-transport system with which the staphylococcal

MsrA may interact. Gene, 153:93-98.

Ruoff, K. (1995). Streptococcus. p. 299-307. In "Manual of Clinical

Microbiology". ed. Murray et al. ASM Press, Washington. D.C.

Salaki, J.R., Ra Balck, F.P. Tally, and J.W. Kislak. (1976). Bacteroides fragilis

resistant to the administration of clindamycin. American Journal of Medicine

60~426428.

Sanbrook, J., E.F. Fritsch, and T. Maniatis. (1 989). Molecular cloning: a

laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor,

N.Y.

Schoner, B. M. Geistlich, P. Rosteck, Jr., R.N. Rao, E. Seno, K. Cox,

S. Burgett, and C. Hershberger. (1 992). Sequence similarity between

macrolide-resistance determinants and ATP-binding transport proteins. Gene,

1 1 5:93-96.

Seppala, H. , A. Nissinen, Q. Yu, and P. Huovinen. (1993). Resistance to

erythromycin in Group A streptococcus. New England Journal of Medicine,

3262929297.

Seppala, H., M. Skurnik, H. Soini, M. Roberts, and P. Huovinen. (1998). A

novel erythromycin resistance methylase gene (ennTR) in Streptococcus

pyogenes. Antimicrobial Agents and Chemotherapy 42:257-262.

Shoemaker, N.B., E.P. Guthrie, A.A. Salyers, and J.F. Gardner. (1985).

Evidence that the clindamycin-erythromycin resistance gene of the Bacteroides

plasmid pBG4 is on a transposable element. Journal of Bacteriology 162:626-

632.

Shorbidge, V.D., R.K. Flamm, N. Ramer, J. Beyer, and S.K. Tanaka. (1996).

Novel mechanism of macrolide resistance in Streptococcus pneumoniae.

Diagnostic Microbiolog y and lnfectious Diseases, 26:73-78.

Skinner, R., E. Cundliffe, and F.J. Schmidt. (1983). Site of action of a

ribosomal RNA methylase responsible for resistance to ewhromycin and other

antibiotics. Journal of Biological Chemistry 258: 1 2702-1 2706.

Smith, A.M., K.P. Klugman, T.J.Coffey, and B.G. Spratt. (1993). Genetic

diversity of penicillin-binding protein 20 and 2X genes from Streptococcus

pneumoniae in South Africa. Antimicrobial Agents and Chemotherapy 37:1938-

1 944.

Southern, E.M. (1975). Detection of specific sequences among DNA fragments

separated by gel electrophoresis. Journal of Molecular Biology 98:503-17.

Stingemore, Na, G.R.J. Francis, M. Toohey, and D.B. McGechie. (1989). The

emergence of elyairomycin resistance in Streptococcus pyogenes in Fremantle,

Western Australia, Medical Journal of Australia, 150:626-631.

Sutcliffe, J., A. Tait-Kamradt, and L. Wondrsck. (1 996-A). Streptococcus

pneumoniae and Streptococcus pyogenes resistant to macrolides but sensitive

to clindamycin: a common resistance pattern mediated by an afflux system.

Antimicrobial Agents and Chemotherapy, 40: 181 7-1 824.

Sutcliffe, J., Tm Grebe, A. Tait-Kamradt, and Lm Wondrack. (1996-8). Detection

of erythromycin-resistance determinants by PCR. Antimicrobial Agents and

Chemotherapy, 40:2562-2566.

TaitXamradt, A., J. Clancy, M. Cronan, Fm Dib-Hajj, Lm Wondrack, W. Yuan,

and J. Sutcliffe. (1 997). mefE is necessary for the erythromycin-resistant M

phenotype in Streptococcus pneumoniae. Antimicrobial Agents and

Chemotherapy, 41 :2251-2255.

'Thakker-Varia, S., A.C. Ranzini, and D.T. Dubin. (1985). Ribosomal RNA

methylation in Staphylococcus aumus and Escherichia colk effect of the "MLSn

(erythromycin resistance) methylase. Plasmid 14: 1 52-1 61 .

Weisblum, B. (1 995). Erythromycin resistance by ribosome modification.

Antirnicrobial Agents and Chemotherapy 39:577-585.

Wilkins, T.D., and Tm Thiel. (1 973). Resistance of some species of Clostndium

tu clindamycin. Antimicrobial Agents and Chernotherapy 13:884-887.

Wondmck, Lm, M. Massa, B.V. Yang, and J. Sutcliffe. (1996). Clinical strain of

Staphylococcus aureus inactivates and causes efflux of macrolides.

Antimicrobial Agents and Chernotherapy, 40:992-998.

Wootton, J-C. and M.H. Drummond. (1989). The Q-linker: a class of

interdomain sequences found in bacterial rnultidomain regulatory proteins.

Protein Engineering, 2535-543.