Deep Brain Stimulation of the Subthalamic and Entopeduncular … · 2013-12-13 · 25. Effects of STN-DBS on zif268 expression in the basal ganglia of VEH-treated rats 91 26. Effects

Deep Brain Stimulation of the Subthalamic and

Entopeduncular Nuclei in an Animal Model of Tardive

Dyskinesia.

by

Meaghan Claire Creed

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy

Graduate Department of Pharmacology and Toxicology University of Toronto

© Copyright by Meaghan Creed, 2012.

ii

Deep brain stimulation of the subthalamic and entopeduncular nuclei in an animal model of tardive

dyskinesia.

Meaghan C Creed

Doctor of Philosophy

Department of Pharmacology and Toxicology University of Toronto

2012

Abstract

Deep brain stimulation (DBS) has emerged as a potential intervention for

treatment-resistant tardive dyskinesia (TD). Despite promising case reports, no

consensus exists regarding optimal stimulation parameters, neuroanatomical target

for DBS in TD, or mechanisms underlying its anti-dyskinetic effects. We used

vacuous chewing movements (VCMs) in rats treated chronically with haloperidol

(HAL) as a TD model to address some of these issues.

We show that acute DBS applied to the subthalamic nucleus (STN) or the

entopeduncular nucleus (EPN) suppresses VCMs without affecting locomotor

activity. Using immediate early gene mapping with zif268 as an index of neuronal

activity, we found that STN-DBS induced decreases in activity throughout the basal

ganglia, whereas EPN-DBS increased activity in projection regions. While chemical

inactivation of the STN or EPN with the GABAA agonist muscimol also suppressed

VCMs, muscimol infusion did not mimic the changes in neuronal activity induced by

DBS, suggesting that DBS is not equivalent to functional inactivation.

iii

We next examined the contribution of serotonin (5-HT) and dopamine (DA) to

the anti-dyskinetic effects of DBS. Decreasing 5-HT transmission pharmacologically

or with serotonergic lesions decreased VCMs. Using microdialysis and zif268

mapping, we determined that STN- but not EPN-DBS decreased 5-HT release and

activity of raphe neurons. However, when the decrease in 5-HT induced by STN-

DBS was prevented by pre-treating rats with fluoxetine or fenfluramine, we found

that decreasing 5-HT is not necessary for the anti-dyskinetic effects of DBS. STN-

DBS transiently increased striatal DA release in intact rats only, whereas EPN-DBS

had no effect on DA release. Moreover, pharmacologically elevating DA levels did

not suppress VCMs. Together these findings lead us to conclude that increased DA

release does not contribute to the anti-dyskinetic effects of DBS.

Finally, we compared depressive- and anxiety-like behaviours induced by

chronic DBS of the EPN and STN, since adverse psychiatric effects of DBS have

become a significant clinical concern. STN-DBS but not EPN-DBS induced

depressive-like behaviour in a learned helplessness task.

We established that the chronic HAL VCM model preparation may be used to

explore mechanisms underlying anti-dyskinetic and psychiatric effects of DBS, and

provided the first investigations into these mechanisms.

iv

Acknowledgements

I would like to express my sincere appreciation and gratitude to my

supervisor, Dr. José Nobrega, for his patience, encouragement and for the

thoughtful guidance he has provided throughout my doctoral program and during the

write-up of this thesis. Through our valued discussions and Dr. Nobrega’s advice, I

have learned several important lessons about the workings of academic research; I

am truly fortunate to have had him as a mentor.

It would not have been possible to complete this thesis without the excellent

assistance of Mustansir Diwan and Roger Raymond, who patiently answered all

manner of technical questions and have been a great source of personal support

over the past four years. I would like to extend earnest thanks to Dr. Clement

Hamani for his expert review and input throughout the development of this project,

and particularly during manuscript preparation. Likewise, I would like to thank Dr.

Paul Fletcher for his excellent professional and scientific advice, and for allowing me

access to specialized laboratory equipment, without which several experiments in

this project would not have been possible.

Finally, I would also like to thank my thesis committee members, Drs.

Stephen Kish and Susan Fox, for their thoughtful suggestions during the formation of

this project.

v

Table of Contents

List of Tables vii

List of Figures viii

List of appendices xii

Introduction 1

A) Literature review 1

1. Tardive dyskinesia 1

1.1 Clinical significance of Tardive dyskinesia 1

1.2 Animal models of TD 2

1.3 Theories of TD pathology 4

1.4 Treatments for TD 11

2. Deep brain stimulation 14

2.1 Deep brain stimulation for TD in the clinic 14

2.2 Psychiatric effects of DBS in the clinic 18

2.3 Mechanisms underlying the motor effects of DBS 21

2.3.1 - DBS inactivates or normalizes activity

of the target nucleus 22

2.3.2 – Glutamatergic and GABAergic effects of DBS 25

2.3.3 Effects DBS on brain monoamines 28

2.3.3.1 - Effects of DBS on Dopamine (DA) 28

2.3.3.2 - Effects of DBS on Serotonin (5-HT) 31

B) Thesis Objectives 34

C) Thesis Outline 35

vi

General Methodology 37

1. Subjects 37

2. Haloperidol treatment 37

3. VCM assessments 37

4. Surgical procedures 39

5. Electrode localization 39

6. DBS protocol 41

7. In situ hybridization 43

Chapter 1: Deep brain stimulation of the subthalamic or

entopeduncular nucleus attenuates vacuous chewing

movements in a rodent model of tardive dyskinesia 45

1. Introduction 46

2. Materials and methods 48

3. Results 50

4. Discussion 60

5. Statement of significance 63

Chapter 2: Early gene mapping after deep brain

stimulation in a rat model of tardive dyskinesia:

Comparison with transient local inactivation 64

1. Introduction 65


3. Results 71

vii

4. Discussion 99


Chapter 3: Contribution of serotonin to the effectiveness

of deep brain stimulation in a rodent model of tardive

dyskinesia: comparison of the STN and EPN 106

1. Introduction 107


3. Results 115

4. Discussion 140


Chapter 4: Contribution of dopamine to the effectiveness

of deep brain stimulation in a rodent model of tardive

dyskinesia 146

1. Introduction 147


3. Results 152

4. Discussion 160


Chapter 5: Comparison of chronic STN- and EPN-DBS on

depressive- and anxiety-like behaviour in rats 164

1. Introduction 165

viii


3. Results 172

4. Discussion 190


General Discussion 196

Conclusions and future directions 204

References 206

Appendix 1: Creed-Carson et al., Behavioural Brain Research. 2011.

ix

List of Tables

1. Summary of clinical trials of DBS for TD (pg. 17)

x

List of Figures

1. Basal ganglia circuitry in TD 6

2. VCM development after HAL treatment 38

3. Representative pictomicrographs showing electrode placement 40

4. DBS procedure 42

5. Electrode localization 51

6. Effects of STN-DBS on VCMs 53

7. Effects of EPN-DBS on VCMs 55

8. Effect of inert electrodes on VCM levels 57

9. DBS on open field activity 59

10. Effects of chronic HAL on zif268 levels 72

11. Representative pictomicrograph illustrating zif268 expression

in VEH- and HAL-treated rats 73

12. Localization of electrode and cannula tips 74

13. Effects of EPN-DBS on VCMs 76

14. Effects of EPN muscimol infusion on VCMs 77

15. Effects of STN-DBS on VCMs 79

16. Effects of STN muscimol infusions on VCMs 80

17. Effects of EPN-DBS on zif268 expression in the basal

ganglia of VEH-treated rats 82

18. Effects of EPN-DBS on zif268 expression in the basal

ganglia of HAL-treated rats 83

19. Effects of EPN muscimol infusions on zif268 expression

in the basal ganglia of VEH-treated rats 84

xi

20. Effects of EPN muscimol infusions on zif268 expression

in the basal ganglia of VEH-treated rats 85

21. Effects of EPN-DBS on zif268 expression in the motor

cortex and thalamus of VEH-treated rats 86

22. Effects of EPN-DBS on zif268 expression in the motor

cortex and thalamus of HAL-treated rats 87

23. Effects of EPN muscimol infusions on zif268 expression in

the motor cortex and thalamus of VEH-treated rats 88

24. Effects of EPN muscimol infusions on zif268 expression in

the motor cortex and thalamus of VEH-treated rats 89

25. Effects of STN-DBS on zif268 expression in the basal

ganglia of VEH-treated rats 91

26. Effects of STN-DBS on zif268 expression in the basal

ganglia of HAL-treated rats 92

27. Effects of STN muscimol infusions on zif268 expression in

the basal ganglia of VEH-treated rats 93


the basal ganglia of VEH-treated rats 94

29. Effects of STN-DBS on zif268 expression in the motor

cortex and thalamus of VEH-treated rats 95

30. Effects of STN-DBS on zif268 expression in the motor

cortex and thalamus of HAL-treated rats 96

31. Effects of STN muscimol infusions on zif268 expression

in the motor cortex and thalamus of VEH-treated rats 97

xii


the motor cortex and thalamus of HAL-treated rats 98

33. Confirmation of 5,7-DHT lesions with HPLC 116

34. Confirmation of 5,7-DHT lesions with C11-DASB binding 117

35. Reducing brain 5-HT content suppresses HAL-induced VCMs 119

36. Reducing brain 5-HT activity suppresses HAL-induced VCMs 121

37. Effects of 5-HT2A or blockade on HAL-induced VCMs 123

38. Effect of DBS on zif268 expression in the DRN 125

39. Effect of DBS on zif268 expression in the MRN 126

40. Effect of DBS on 5-HT release in the CPu 128

41. Effect fluoxetine pre-treatment on STN-DBS efficacy

in HAL-treated rats 131

42. Effect fluoxetine pre-treatment on STN-DBS efficacy

in VEH-treated rats 132

43. Effect fluoxetine pre-treatment on EPN-DBS efficacy in

HAL-treated rats 133

44. Effect of fluoxetine pre-treatment on EPN-DBS efficacy in

VEH-treated rats 134

45. Effect fenfluramine pre-treatment on DBS efficacy 136

46. Effect DOI pre-treatment on DBS efficacy 137

47. Effect of serotonergic pharmacomanipulation on open field activity 138

48. Confirmation of the effects of serotonergic manipulations of

5-HT release 139

49. Effect of DBS on striatal DA release 153

xiii

50. Effects of DBS on zif268 expression in the SNc 155

51. Effects of DBS on zif268 expression in the VTA 156

52. Effects of L-Dopa on HAL-induced VCMs 158

53. Effects of L-Dopa on HAL-induced hypo-locomotion 159

54. Effect of chronic STN-DBS on learned helplessness performance 173

55. Effect of chronic EPN-DBS on learned helplessness performance 174

56. Effect of chronic DBS on time spent in open arms of the

elevated plus maze 176

57. Effect of chronic DBS on entries made into open arms in

elevated plus maze 177

58. Effect of chronic DBS on exploratory activity in elevated plus maze 178

59. Effect of chronic DBS on ambulatory activity 180

60. Effect of chronic STN-DBS on trkB gene expression 182

61. Effect of chronic EPN-DBS on trkB gene expression 183

62. Effect of chronic STN-DBS on BDNF gene expression 184

63. Effect of chronic EPN-DBS on BDNF gene expression 185

64. zif268 expression following acute DBS in the hippocampus

and associated areas 187

65. zif268 expression following acute DBS in limbic areas 188

66. zif268 expression following acute DBS in brain stem nuclei 189

67. Basal ganglia circuitry in TD with DBS applied 203

xiv

List of appendices

Appendix 1. Creed-Carson et al., Behavioural Brain Research. 2011

1

Introduction

A) Literature Review

1. Tardive dyskinesia

1.1 Clinical significance of Tardive dyskinesia

The term “tardive dyskinesia” was first introduced in 1964 (Faurbye et al.,

1964). Tardive dyskinesia (TD) is a potentially debilitating movement disorder

characterized by abnormal involuntary movements of the head, neck, face, tongue

and jaw, and in extreme cases, may involve the limbs or extremities (Margolese et

al., 2005; Marsalek, 2000; Soares and McGrath, 1999). TD is induced by chronic

therapy with classic antipsychotic medications (APDs), such as haloperidol (HAL), at

a rate of approximately 5% per year of treatment (Yassa and Jeste 1992; Glazer,

Morgenstern et al. 1993). Advanced age and length of treatment with APDs are the

most significant risk factors for TD (Correll and Schenk 2008; Tenback and van

Harten 2011), and TD is cited as a leading cause of patient non-compliance with

their medication (Fenton, Blyler et al. 1997; Fenton and Kane 1997; Dolder, Lacro et

al. 2002). While second-generation APDs are associated with a lower incidence of

TD, motor complications have still been reported, and the mechanisms conferring

their superior side effect profile remain unclear (Jeste and Glick 2000; Jeste,

Okamoto et al. 2000; Margolese, Chouinard et al. 2005; de Leon 2007). Moreover,

second generation APDs are associated with rapid weight gain or potentially fatal

complications, such as diabetic keto-acidosis (Casey and Keepers, 1988; de Boer

and Gaete, 1992), and as a result first generation antipsychotics remain in clinical

use.

2

Considering the large proportion of already affected APD-treated patients and

the growing spectrum of conditions for which APDs are prescribed, TD remains a

major clinical concern. The potential irreversibility of adverse motor side effects and

interference with patient medication compliance mean that TD is also a significant

ethical concern (Glazer, Morgenstern et al. 1990). In order to optimize therapies for

TD, its underlying pathophysiological mechanisms must be better understood.

Clinical studies examining the pathophysiology of TD have not lead to coherent

theories of TD pathology, possibly because studies of TD are necessarily performed

in patients with underlying schizophrenia, and heterogeneity in APD treatment. For

this reason, the several animal models of TD have been developed in order to better

understand its underlying pathology.

1.2 Animal models of TD

The use of animal models has significantly contributed to the understanding

of TD pathology, and has been used to establish proof-of-concept for surgical

interventions and pharmacotherapies for TD (Goetz, Klawans et al. 1983; Tanner

and Klawans 1986). The two commonly used models of TD are the APD-treated rat

and APD-treated non-human primate.

In rodents, long-term administration of classical APDs, such as HAL, leads to

a syndrome of vacuous chewing movements (VCMs), which are jaw movements in

the vertical plane, not directed at a specific object, accompanied or not by tongue

protrusions. These VCMs occur at a frequency of 5-10 per minute, and are

considered analogous to orofacial dyskinesias occurring in human TD (Gunne,

Andersson et al. 1986; Turrone, Remington et al. 2002). Shorter HAL treatment

3

times have also been used to model TD (Egan, Ferguson et al. 1996; Egan, Hurd et

al. 1996; Marchese, Casu et al. 2002; Marchese, Bartholini et al. 2004). However,

VCMs emerging in the first 3 weeks of HAL treatment are pharmacologically and

functionally distinct from late VCMs, which arise only after prolonged treatment. It

has been suggested that early occurring VCMs may more accurately model EPS

associated with acute HAL treatment, and so attention must be paid in interpreting

data from HAL-treated rat studies (Egan, Ferguson et al. 1996; Marchese, Casu et

al. 2002; Marchese, Bartholini et al. 2004). Considerations when using this model

are that continuous HAL administration (through intramuscular depot of decanoate

formulations) produces stronger VCMs compared to daily, dose-equivalent drug

administration (Turrone et al., 2002). This phenomenon is proposed to be related to

D2 receptor occupancy, since continuous administration via osmotic minipumps also

produces high levels of VCMs (Turrone, Remington et al. 2003; Turrone, Remington

et al. 2003; Turrone, Remington et al. 2005).

Two additional rodent models have also been used to model TD, although

they are used with much less frequency. In guinea pigs exposed to classical APDs,

abrupt withdrawal and challenge with dopaminergic agonists triggers orofacial

movements, although this model lacks the delayed time course and spontaneous

occurrence of TD (Klawans and Rubovits, 1972). In a few studies, administration of

presynaptic monoamine depleting agent reserpine was used to model TD. After

acute (3 days) or chronic (4-6 weeks) reserpine treatment, VCMs, protrusions and

facial twitches arise and may persist for up to 2 months following withdrawal

(Bergamo, Abilio et al. 1997; Kostrzewa, Huang et al. 2007). However, the validity

of this model is controversial, as it does not mimic the etiology or time course of

4

motor symptoms in patients or the gradual emergence of spontaneous VCMs

(Blanchet et al., 2012).

An alternative model is the non-human primate model of TD. Primates

develop grimacing and tongue protrusions similar to clinical TD, after chronic

treatment with classical antipsychotics (Gunne and Barany 1976; Casey 1984). This

model is considered a homologous model, since it has high predictive validity, and

models the etiology, biological basis, symptoms, response to treatment, and time

course as well as unique features such as individual susceptibility in TD (Kulkarni

and Naidu, 2001). However, non-human primates are prohibitively expensive and

time-consuming to work with.

The similar time course of development of motor symptoms and individual

susceptibility to TD are unique to the non-human primate model, although both the

non-human primate and rodent models of TD are highly similar to clinical TD in

etiology, symptoms and response to treatment (Casey 2000). In this thesis we have

used the chronic HAL-treated rat model of TD. As discussed above, this model

shares a common cause of induction, time course to emergence of motor symptoms

and appearance of oral dyskinesias with human TD patients. The chronic HAL

model also exhibits predictive validity, as it has been used to test new

pharmacotherapies and surgical interventions for the treatment of TD (Goetz,

Klawans et al. 1983; Tanner and Klawans 1986). Animal models have also enabled

the study of pathological mechanisms that may underlie the motor symptoms of TD,

reviewed below.

5

1.3 Theories of TD pathology

Despite extensive neuroimaging and biochemical studies on animal models of

TD and human patients, the mechanisms underlying the development of

antipsychotic-induced motor symptoms are not clear. A much lower incidence of TD

with atypical antipsychotics has lead to several hypotheses which attempt to explain

this reduced liability of atypical APDs. Pharmacogenetic studies have identified

polymorphisms in glutamate (Liou, Wang et al. 2007), and monoamine (Segman,

Goltser et al. 2003; Guzey, Scordo et al. 2007) receptors as risk factors for TD.

Based on these animal and clinical studies, several theories have been proposed,

including induction of reactive oxygen species, excessive glutamatergic

transmission, GABA insufficiency, dopamine hypersensitivity as well as alterations in

other neurotransmitter systems. A hypothetical scheme depicting how the basal

ganglia circuitry may be altered in TD is shown in figure 1. However, there is no

theory of TD pathogenesis that is consistently supported by clinical evidence

(Casey, 2004).

6

Figure 1. Basal ganglia circuitry in TD. This hypothetical wiring diagram shows

the normal state of the basal ganglia, adapted from Albin et al 1990 and Redgrave et

al., Nature Reviews Neuroscience 11, 760-772 (November 2010) (Left). While the

mechanisms underlying the pathology of TD are incompletely understood, we

speculate that chronic dopamine D2 antagonism results in hyper-sensitivity of the

indirect basal ganglia output pathway. Over-activity of glutamatergic projections

from the STN to the SNc is thought to lead to excitotoxic damage to dopaminergic

neurons of the SNc. Moreover, increased activity of glutamatergic projections from

the STN to SNr would increase inhibition of SNc mediated by the SNr. Both of these

changes would reduce dopamine outflow from the SNc to CPu, which further

increases activity of the indirect pathway.

7

Excessive GLU transmission leads to excitotoxicity, which in turn induces

localized neuron damage or neurodegeneration. Activity-dependent plastic

changes, increased IEG expression and increased excitatory synapses in chronically

HAL-treated rats as described above, supports the idea of excessive GLU

transmission in localized brain regions. Striatal excitotoxicity has been proposed to

underlie VCM development in rats (Andreassen, Ferrante et al. 1998; Andreassen

and Jorgensen 2000), which in turn is thought to be due to overactive cortical

glutamatergic input (Gunne and Andren 1993; Hamid, Hyde et al. 1998), although

apoptosis of striatal neurons has also been implicated (Mitchell, Cooper et al. 2002).

Consistent with this, increased levels of striatal glutamate have been described in

rats chronically treated with HAL (Moghaddam and Bunney, 1993), which was not

observed after chronic treatment with the atypical APD clozapine (See and

Chapman, 1994).

Excitotoxic degeneration of neurons outside the striatum has also been

described following chronic HAL treatment in rats. Specifically, excitotoxic

degeneration of a subpopulation of neurons in the substantia nigra has been found

and is thought to be due to overactivity of glutamatergic projections from the STN

(Andreassen, Ferrante et al. 2003a, Andreassen and Jorgensen 2000). Also,

degeneration of GABAergic neurons projecting from the substantia nigra/globus

pallidus complex to thalamus have also been described (Gunne and Andren, 1993).

The mechanisms underlying HAL-induced increased GLU release are not known,

but two leading hypotheses are that HAL binds to a butyrophenome regulatory site

on NMDAR to increase GLU currents. A second hypothesis is that HAL, a small,

lipophilic molecule, induces excitotoxicity directly by interfering with the electron

8

transport chain and disrupting mitochondrial cellular energy metabolism (Beal,

1992).

In addition to the glutamatergic hypotheses discussed above, several

neurotransmitters have been implicated in motor effects of chronic APDs.

Excitotoxicity has also been observed in GABAergic neurons from SN/GP to the

thalamus (Gunne and Andren, 1993). And, as described above, GABAergic MSNs

in the striatum are selectively lost in TD. These findings, along with reports that

chronic HAL-treatment in non-human primates reduces the GABA-synthesizing

enzyme, glutamic acid decarboxylase in the SN, GP and STN (Gunne and

Haggstrom, 1983), has lead to the GABA insufficiency hypothesis. This hypothesis

suggests that decreased inhibitory, GABA-mediated transmission in the basal

ganglia may underlie TD (Andreassen and Jorgensen 2000; Andreassen and

Jorgensen 2000; Casey 2000).

Another leading hypothesis of TD pathology is dopamine D2 receptor

hypersensitivity. Polymorphisms in dopamine D2-like receptors have been

associated with increased risk of TD in pharmacogenetic studies (Gunne and

Andren 1993; See and Chapman 1994; Chen, Wei et al. 1997; Steen, Lovlie et al.

1997; Hamid, Hyde et al. 1998; Basile, Masellis et al. 1999; Lovlie, Daly et al. 2000;

Hori, Ohmori et al. 2001; Liao, Yeh et al. 2001; Kaiser, Tremblay et al. 2002;

Segman, Goltser et al. 2003; Liou, Liao et al. 2004; Liou, Lai et al. 2006; Srivastava,

Varma et al. 2006; Dolzan, Plesnicar et al. 2007; Guzey, Scordo et al. 2007; Liou,

Wang et al. 2007; Zai, De Luca et al. 2007; Zai, Hwang et al. 2007; Bakker, van

Harten et al. 2008; Al Hadithy, Ivanova et al. 2009; Rizos, Siafakas et al. 2009). It

has been suggested that the nigrostriatal DA system becomes more sensitive to DA

9

as a consequence of chronic D2 antagonism (Kapur and Remington 2001; Casey

2004), which is manifest as a selective up-regulation of D2 receptors (Stock and

Kummer 1981; Sanci, Houle et al. 2002; Casey 2004). Atypical APDs exhibit a

lower in vivo occupancy of D2 receptors, and are associated with a lower incidence

of TD (Meltzer, Bastani et al. 1989; Meltzer, Matsubara et al. 1989; Meltzer and

Gudelsky 1992; Casey 1997). D2 receptors are located both post-synaptically

throughout the basal ganglia and pre-synaptically as somatodendritic inhibitory

autoreceptors. Chronic HAL treatment leading to upregulation of these

autoreceptors could account for the observed decrease in number of spontaneously

active SNc neurons after haloperidol treatment in vivo (Chiodo and Bunney,

1983). Upregulation of D2 receptors is observed after chronic treatment of D2

antagonists (Burt, Creese et al. 1977; Clow, Jenner et al. 1979; Clow, Jenner et al.

1979; Owen, Cross et al. 1980), and in vivo D2 receptor occupancy has been linked

to VCM emergence in HAL-treated rats (Kapur, Zipursky et al. 2000; Wadenberg,

Kapur et al. 2000; Crocker and Hemsley 2001). However, while a certain level of D2

occupancy may be necessary for inducing VCMs, it is not sufficient to induce the

VCM syndrome (Turrone, Remington et al. 2003; Turrone, Remington et al.

2003) and increased D2 occupancy following HAL treatment does not correlate with

VCM severity (Turrone, et al., 2002). Evidence from PET studies of antipsychotic-

treated patients also argues against the dopamine D2 receptor supersensitivity

hypotheses. While Silvestri et al. reported upregulated D2 binding after chronic ADP

treatment as measured by 11C-raclopride binding (Silvestri et al., 2000), the absence

of upregulation has also been reported (Blin, Baron et al. 1989; Andersson,

Eckernas et al. 1990; Adler, Malhotra et al. 2002). Moreover, while Silvestri et al.

10

reported a significant correlation between D2 occupancy and TD severity (Silvestri,

et al., 2000), other studies have failed to find an association between D2 density and

dyskinesias (Andersson, Eckernas et al. 1990; Adler, Malhotra et al. 2002). In

addition to its effects on D2 receptors, HAL may alter the DA system by inducing

excitotoxic damage of dopaminergic neurons of the SN (Andreassen and Jorgensen,

2000), leading to decreased DA tone in the nigrostriatal system (Gunne et al.,

1984).

Multiple lines of evidence have implicated the 5-HT system in TD pathology.

In addition to several pharmacogenetic studies implicating 5-HT2 receptors in TD

susceptibility (Chong, Tan et al. 2000; Segman, Heresco-Levy et al. 2000; Basile,

Ozdemir et al. 2001; Segman, Heresco-Levy et al. 2001; Zhang, Zhang et al. 2002;

Herken, Erdal et al. 2003; Segman, Goltser et al. 2003; Lattuada, Cavallaro et al.

2004; Malhotra, Murphy et al. 2004; Deshpande, Varma et al. 2005; Reynolds,

Templeman et al. 2005; Boke, Gunes et al. 2007; Guzey, Scordo et al. 2007; Gunes,

Dahl et al. 2008; Al-Janabi, Arranz et al. 2009; Hsieh, Chen et al. 2010), the lower

incidence of TD with atypical antipsychotics has been ascribed to their 5-HT2

antagonism (Kapur et al., 1999; Meltzer and Nash, 1991; Stahl, 1999) and there is a

suggestion that concomitant treatment with serotonin-increasing drugs may

precipitate or exacerbate TD in APD-treated patients (Dubovsky and Thomas 1996;

Leo 1996; Gerber and Lynd 1998; Birthi, Walters et al. 2010). Dopaminergic inputs

to the striatum regulate 5-HT receptor gene expression, and 5-HT2 receptors

modulate DA transmission in the basal ganglia via 5-HT2 receptors on the

somatodendritic surface of DA neurons (Pazos, Probst et al. 1987; Alex and Pehek

2007; Di Matteo, Pierucci et al. 2008; Di Giovanni, Esposito et al. 2010). Chronic

11

HAL treatment leads to inhibited striatal 5-HT2C mRNA expression, which is thought

to be mediated by interference with D2 receptor signalling (Numan et al., 1995).

However, Wolf et al. showed an adaptive increase in 5-HT2C coupling to G-proteins

as a result of repeated HAL administration, which was limited to the striatum (Wolf et

al., 2005). It is not clear how this increase in coupling is mediated, but it is thought

to involve post-translational modifications of the 5-HT2C receptor (Wolf, et al., 2005).

In the striatum, 5-HT2C receptors are located on medium spiny interneurons, which

regulate information outflow to the STN and GPe (Ward and Dorsa, 1996).

Intrastriatal infusion of the 5-HT2A/2C agonist mCPP induces orofacial dyskinetic

movements (Eberle-Wang et al., 1996). 5-HT2C receptors are also located on GABA

interneurons in the SNr which project to the pars compacta (SNc) (Eberle-Wang, et

al., 1996). This provides a potential mechanism whereby 5-HT2C could mediate

inhibition of DA cellular activity in the SNc, which is the main source of DA

projections to the striatum (Wichmann and DeLong, 2003). Antagonism of these 5-

HT2C receptors, for example by atypical antipsychotics, would thus increase DA

release to the striatum, compensating for DA deficiency described by Andreassen

and Jorgensen (Andreassen and Jorgensen, 2000). In agreement with this

mechanism, antagonism of 5-HT2C receptors (Naidu and Kulkarni 2001; Naidu and

Kulkarni 2001; Kostrzewa, Huang et al. 2007) and administration of atypical

antipsychotics, such as clozapine, suppress HAL-induced VCMs (Gerlach, Lublin et

al. 1996; Miller, Mohr et al. 1998). Moreover, 5HT2 antagonism prevents HAL-

induced immediate early gene induction in the CPu (Wirtshafter 1998; Young,

Bubser et al. 1999) and up-regulation of D2 receptors (Szczepanik and Wilmot,

1997).

12

1.4 Treatments for TD

Based partially on emerging theories of TD pathogenesis, several classes of

pharmacotherapies have been studied for their ability to reduce or suppress APD-

associated dyskinesias. Generally, such medications can be classified into

antioxidants, neuropeptides, GABA-mimetics, calcium channel blockers and

cholinergic drugs.

As discussed above, one leading theory of TD is that HAL treatment leads to

neurodegeneration, either directly through the induction of oxidative stress, or via

chronic blockade of D2 inhibitory dopamine (DA) receptors on glutamatergic

terminals in the striatum, which leads to glutamate-dependent excitotoxicity. Based

on this hypothesis, calcium channel blockers, glutamatergic antagonists and GABA

mimetics have been proposed to reduce excessive neuronal excitation and treat the

symptoms of TD. While the glutamate NMDA receptor antagonist dose-dependently

reduces HAL-induced VCMs in rats (Andreassen, Aamo et al. 1996; Naidu and

Kulkarni 2001; Konitsiotis, Tsironis et al. 2006), there is no evidence that glutamate

antagonism improves TD symptoms in the clinic (Soares and McGrath, 1999).

Similarly, GABA mimetics or calcium channel blockers, while effective in animal

models (Tamminga, Thaker et al. 1989; Gao, Kakigi et al. 1994; Peixoto, Abilio et al.

2003; Bishnoi, Chopra et al. 2008), show an overall lack of effect on TD symptoms,

as uncovered by meta-analyses of clinical trials (Cates, Lusk et al. 1993; Soares and

McGrath 1999; Soares and McGrath 2001; Soares, Rathbone et al. 2004). Vitamin

E treatment has been suggested to prevent oxidative damage which may underlie

TD symptoms (Elkashef and Wyatt, 1999), and while Vitamin E treatment may

13

prevent further deterioration of symptoms, no clinical improvement was seen,

relative to placebo (Soares and McGrath 1999; Soares and McGrath 2001).

Pharmacological manipulations of cholinergic and serotonergic have also

been suggested to alleviate symptoms of TD. Atypical antipsychotics carry a

reduced risk of TD and switching medication to atypical from classical APDs is

associated with improvement of TD symptoms (Raja, Azzoni et al. 1999; Margolese,

Chouinard et al. 2005). Atypicals affect a variety of neurotransmitter systems, but

their reduced liability has been ascribed to their antagonism at 5-HT receptors

(Haberfellner 2000; Khan and Farver 2000; Meltzer 2004) and their ability to

increase cortical acetylcholine (ACh) release (Seeman 2002; Meltzer 2004).

While no clinical trials have examined the efficacy of serotonin antagonists in

TD, this approach has been suggested (Kostrzewa et al., 2007). Several pre-clinical

studies have shown that 5-HT2 antagonists (Naidu and Kulkarni 2001; Ikram, Samad

et al. 2007), 5-HT3 antagonists (Naidu and Kulkarni, 2001) and 5-HT1 agonists

(Bubser and Deutch 2002; Jackson, Al-Barghouthy et al. 2004; Rosengarten,

Bartoszyk et al. 2006; Haleem, Samad et al. 2007) effectively suppress HAL-induced

VCMs.

Meta-analyses have found that cholinergic drugs show a slight but non-

significant effect on TD symptoms, which may be related to differential effects of

ACh precursors and cholinesterase inhibitors (Chouinard and Steinberg 1982;

Caroff, Campbell et al. 2001; Tammenmaa, Sailas et al. 2004). ACh precursors may

not effectively be converted to ACh because of the underlying damage to cholinergic

interneurons in the striatum that occurs in TD (Miller and Chouinard 1993; Grimm,

Chapman et al. 2001; Kelley and Roberts 2004), whereas cholinesterase inhibitors

14

may improve symptoms of TD directly, but increasing cholinergic transmission.

While a single pilot study has validated the effectiveness of cholinesterase inhibitors

in TD (Caroff et al., 2001), further studies are on-going to confirm this effect.

Despite this long history and variety of experimental therapies, no satisfactory

pharmacotherapy to date has been clinically approved to treat TD (Feltner and

Hertzman 1993; Soares and McGrath 1999; Schrader, Peschel et al. 2004).

However, recently deep brain stimulation (DBS) has been proposed as a surgical

therapy for severe, treatment-refractive TD.

2. Deep brain stimulation

2.1 Deep brain stimulation for TD in the clinic

Deep brain stimulation (DBS) is a surgical therapy whereby electrical current

is passed through electrodes implanted in the brain, to stimulate a highly localized

population of neurons. In the late 1980s, it was discovered that application of

electrical current to the subthalamic nucleus attenuated the motor symptoms of PD,

and DBS has since become an established treatment for this disease (Limousin,

Pollak et al. 1995; Limousin, Greene et al. 1997; Krack, Hariz et al. 2010). DBS has

been improved by the development and implantation of internal pacemakers to

deliver stimulation and potential targets for stimulation has been expanded to include

other areas of the basal ganglia-thalamo-motor cortex loop (Bronstein, Tagliati et al.

2011). Recently, DBS has been successfully applied in over 80 000 patients with

several motor and psychiatric disorders, including Parkinson's disease primary and

secondary dystonias, essential tremor, obsessive-compulsive disorder, Gilles de

Tourette’s syndrome, depression and addictive disorders (Collins, Lehmann et al.

15

2010; Krack, Hariz et al. 2010; Lozano, Snyder et al. 2010; Holtzheimer and

Mayberg 2011; Tierney, Sankar et al. 2011).

Case studies have shown promising results of DBS applied to cases of TD

and to tardive dystonia, a syndrome which is also induced by chronic therapy with

classical APDs but differs from tardive dyskinesia in terms of motor features

(Trottenberg, Paul et al. 2001; Eltahawy, Feinstein et al. 2004; Schrader, Peschel et

al. 2004; Damier, Thobois et al. 2007; Kosel, Sturm et al. 2007; Kefalopoulou,

Paschali et al. 2009). The involuntary movements associated with tardive dystonia

are slow, more painful and involve twisting of several body parts (Simpson 2000;

Fernandez and Friedman 2003), whereas TD is characterized by jerky, rapid

movements usually confined to the orobuccal area, as described above. Prior to the

advent of DBS, pallidal lesions and thalamic lesions were applied with success for

TD (Wang, Turnbull et al. 1997; Weetman, Anderson et al. 1997; Vitek, Zhang et al.

1998; Hillier, Wiles et al. 1999). The first case of DBS applied for TD reported a

significant improvement in the Burke-Fahn-Marsden Dystonia Rating Scale

(BFMDRS) score from 42 pre-operatively to 11 at 6 months after surgery. In the

same study, no effect on motor function was reported after thalamic DBS in the

same patient (Trottenberg et al., 2001). The outcomes of a series of case studies of

DBS applied for TD are summarized in Table 1. In the only clinical trial of DBS in TD

published to date, improvement in extrapyramidal symptoms rating scale (ESRS)

scores ranged from 44% to 75%, with 61% average improvement, whereas

abnormal involuntary movement (AIMS) score improved an average of 56% (range:

33%-69%) after 6 months of continuous DBS (Damier, Thobois et al. 2007). The

first 10 out of 18 identified subjects showed marked symptomatic improvement, and

16

the trial was terminated according to a 2-step open Fleming procedure. Mood

improvement was reported in two patients, with no change in medication or cognitive

status reported in any patient.

While still a small body of literature, DBS is suggested to be a safe and

effective therapy for TD, although major complications included are generally

hardware-related and include infection, haemorrhage and lead fractures (Welter et

al., 2010). Involuntary postural muscle contractions have also been reported after

DBS, which is managed by adjusting stimulation parameters (Schrader et al., 2004).

Interestingly, secondary dyskinesias and dystonias, such as TD were more resistant

to therapeutic effects of DBS than primary dyskinesias and dystonias. Moreover, the

subthalamic nucleus has been argued to be an alternative target for the treatment of

tardive syndromes (Schrader, et al., 2004). In a small case series, Sun et al report

more immediate and pronounced symptomatic improvement than GPi-DBS, which is

achieved at a lower stimulation frequency and amplitude (Sun et al., 2007). The

ability to achieve therapeutic effects at lower stimulation frequency and intensity is

significant, given that this may extend stimulator battery life and decrease the need

for follow-up surgery.

To date, no clinical trails have examined the efficacy of STN-DBS in TD, nor

have the two targets been compared clinically for TD or tardive dystonia. This

project will allow us to directly evaluate the efficacy of DBS applied to both the STN

and EPN in a rodent model of TD, and to compare the stimulation parameters and

frequency necessary for optimal anti-dyskinetic effects in this model.

17

Reference Patient Intervention Follow-Up Outcome

Trottenberg et al., 2001

Female, 70 years

Bilateral GPi DBS 130Hz, 2mA, 100μsec

6 months 78% improvement BFMDRS


Female, 70 years




Female, 70 years




Male, 30 years




Male, 59 years



Eltahawy et al., 2004

Female, 53 years

Bilateral GPi DBS 40Hz, 2.6V, 210μsec


Schrader et al., 2004

Female, 64 years

Left unilateral GPi DBS 180Hz, 5.5V, 60μsec

5 months 78% improvement BFMDRS 73% improvement AIMS

Kosel et al., 2007

Female, 62 years

Bilateral GPi DBS

18 months 35%improvement BFMDRS

Kefalopoulou et al., 2009

Male, 42 years

Bilateral GPi DBS 185Hz, 2.5V, 250μsec

6 months 91% improvement BFMDRS 77% improvement AIMS

Table 1. Summary of case reports examining DBS applied to tardive

dyskinesia.

18

2.2 Psychiatric effects of DBS in the clinic

An emerging concern with clinical DBS is the occurrence of adverse

psychiatric effects (Krack, Hariz et al. 2010; Meissner, Frasier et al. 2011). The

majority of clinical cases of DBS have been applied in patients with PD, and while

depression occurs in as many as 35–40% of PD patients (Cummings 1992;

Reijnders, Ehrt et al. 2008), several clinical trials have reported increased incidence

of depression following DBS (Takeshita, Kurisu et al. 2005; Temel, Kessels et al.

2006; Appleby, Duggan et al. 2007). Depression contributes substantially to

disease burden in movement disorders (Schrag et al., 2000; Schrag, 2004) and

DBS-associated psychiatric effects may have a greater influence on a patient’s

quality of life than does the overall improvement in motor function (Troster et al.,

2003).

There is a general consensus that DBS applied to the STN carries an

increased risk of cognitive and psychiatric symptoms compared to GPi-DBS, and

that when risk factors for psychiatric complications, such as history of depression or

impulsivity are present, the GPi may be a favourable target (Albanese, Piacentini et

al. 2005; Chang and Chou 2006; Capelle, Blahak et al. 2010). While it is true that

improved mood has been reported in a patient with GPi-DBS applied for TD (Kosel

et al., 2007), some large-scale clinical trials have failed to report a difference in

cognitive and psychiatric outcomes between patients (Okun, Fernandez et al. 2009;

Burdick, Foote et al. 2011).

Clinically, STN-DBS applied in cases of PD patients have reported increased

impulsivity several months post-operatively (Saint-Cyr, Trepanier et al. 2000;

Houeto, Mallet et al. 2006; Frank, Samanta et al. 2007). Cognitive dysfunction in

19

the domains of verbal fluency, executive function (Pillon, Ardouin et al. 2000; Saint-

Cyr, Trepanier et al. 2000; Smeding, Speelman et al. 2006), and psychomotor speed

(Zahodne, Okun et al. 2009; Follett, Weaver et al. 2010), have been reported after

STN-DBS. Impaired cognitive performance has been suggested to contribute to the

lower improvement in quality of life measures following STN-DBS compared to GPi-

DBS, despite similar improvement in mood and motor symptoms (Zahodne, Okun et

al. 2009; Bronstein, Tagliati et al. 2011). Increased anger, as assessed with the

visual analogue mood scale, has also been reported following DBS. Anger scores

do not differ between STN- and GPi-DBS and was not related to medication

reduction (Okun, Green et al. 2003; Burdick, Foote et al. 2011). Interestingly,

thalamic deep brain stimulation in this same study was not associated with

increased anger (Burdick et al., 2011). In a direct comparison of STN- and GPi-

DBS, there was a significant (17 out of 159 patients) development of impulse control

disorders, although the incidence was not different between GPi- and STN-DBS

groups (Moum et al., 2012). Pre-operative history of impulse-control disorders in

predictive of suicide attempts following, which are increased by 17 fold following

STN-DBS (Voon, Krack et al. 2008). However, depression without suicide attempts

has also been frequently reported following STN-DBS (Saint-Cyr, Trepanier et al.

2000; Houeto, Mallet et al. 2006; Frank, Samanta et al. 2007). While some studies

have reported no difference between STN- and GPi-DBS in mood sequelae (Okun,

Fernandez et al. 2009; Zahodne, Okun et al. 2009), a recent comparative study of

299 patients reported differential effects, with STN-DBS (N=147) worsening and

GPi-DBS (N=152) improving mood (Follett, Weaver et al. 2010). A pre-operative

history of depression and impulsivity has been found to predict post-operative

20

depression and suicide, regardless of disability improvement (Okun, Fernandez et

al. 2009). It has been suggested that DBS may reveal symptoms that may have

been present before DBS onset (Bronstein, Tagliati et al. 2011).

Interestingly, early clinical trials of GPi-DBS alone in PD patients consistently

fail to reveal changes in mood or cognitive function as a result of DBS (Fields,

Troster et al. 1999; Straits-Troster, Fields et al. 2000). However, it has been

suggested that these early studies lack the statistical power to detect changes in

mood scales (Bronstein, Tagliati et al. 2011), and that the increased use of the STN

as the preferred target for PD has lead to a reporting bias of STN-DBS adverse

outcomes. However, trials investigating GPi-DBS applied to dystonia have found no

change in cognitive function or mood (Halbig, Gruber et al. 2005; Gruber,

Trottenberg et al. 2009) or have instead reported improved mood and executive

function (Pillon, Ardouin et al. 2006; Kosel, Sturm et al. 2007), suggesting that

underlying PD pathology may contribute to the adverse mood outcome after DBS.

Large-scale clinical trials comparing GPi- and STN-DBS for PD have reported

DBS-induced changes in verbal fluency, impulsivity, anger, depression and suicide,

and with the exception of cognitive function, outcomes do not differ between the two

stimulation targets. Generally, the adverse effects of DBS are most pronounced

when the electrode contact is located ventrally (Ardouin, Pillon et al. 1999; Okun,

Green et al. 2003; Okun, Fernandez et al. 2009; Okai, Samuel et al. 2011). It is

currently thought that DBS-induced neuropsychiatric symptoms are largely transient,

treatable, and potentially preventable (Voon, Kubu et al. 2006; Temel, Tan et al.

2009) and that altering stimulation parameters can mitigate DBS-induced psychiatric

effects (Bronstein, Tagliati et al. 2011).

21

Few studies have examined the mechanisms underlying the induction of

psychiatric effects, although it has been suggested that the small size of the STN

relative to the GPi means that at behaviourally effective stimulation parameters,

current spread would affect limbic and associative subregions of the STN more

readily than in the GPi (Okun and Foote, 2005). Alternatively, as will be discussed in

the following section, STN-DBS inhibits firing of serotonergic neurons and decreases

5-HT release in the hippocampus and prefrontal cortex (Temel, Boothman et al.

2007). This decrease in 5-HT has been implicated in the induction of depressive-like

behaviour in a forced swim test model of depression, as these performance deficits

were completely prevented by pre-treatment with a selective serotonin reuptake

inhibitor (Temel, Boothman et al. 2007).

As mentioned above, the majority of clinical investigations discussed above

have been conducted in patients with Parkinson’s disease who are treated with

dopamine agonists or dopamine replacement in addition to receiving DBS. Since

PD, L-DOPA and DA agonists are all associated with some risk of psychiatric

complications (Ceravolo, Frosini et al. 2010; Archibald, Clarke et al. 2011; Bronstein,

Tagliati et al. 2011; Kirsch-Darrow, Marsiske et al. 2011; Leentjens 2011; Okai,

Samuel et al. 2011) it becomes important to disentangle the mechanisms of DBS-

induced adverse psychiatric effects from disease pathology or pharmacotherapy.

2.3 Mechanisms underlying the anti-dyskinetic effects of DBS

Despite its increasingly widespread clinical application, the mechanisms

underlying the therapeutic effects of DBS remain unclear, although several non-

mutually exclusive theories have been proposed. Early hypotheses regarding the

22

mechanism of DBS posited that it was equivalent to inactivation of the target

structure. This theory emerged from observation that clinically, chronic DBS has

benefits on motor symptoms similar to the benefits achieved by surgical lesioning of

the target nucleus (Benabid, Pollak et al. 1987; Gross and Lozano 2000; Benabid,

Chabardes et al. 2009). While it was assumed that DBS inactivated the target

structure, complex effects of DBS, including an up-regulation of activity in the

stimulated site, and changes in activity distal from the target region have been

reported. These changes in neuronal activity may be the result of altered release of

inhibitory and excitatory neurotransmitters induced by DBS. Moreover, while the

motor effects of STN- and EPN-DBS are difficult to distinguish in pre-clinical models

(Meissner et al., 2004), it is clear that these two interventions may work through

different biological mechanisms. Basic studies examining DBS mechanisms have

predominantly focused on the MPTP- treated primate or unilateral 6-OHDA lesioned

rat model of Parkinson's disease. Likewise, the majority of clinical DBS studies have

been conducted in PD patients.

2.3.1 - DBS inactivates or normalizes activity of the target structure

Early hypotheses regarding the mechanism of DBS posited that it was

equivalent to inactivation of the target structure. This theory emerged from

observation that clinically, chronic DBS has benefits on motor symptoms similar to

the benefits achieved by surgical lesioning (Benabid, Pollak et al. 1987; Gross and

Lozano 2000). While it was assumed that DBS inactivated the target structure,

complex effects of DBS, including an up-regulation of activity in the stimulated site,

and changes in activity distal from the target region have been reported.

23

In vitro electrophysiological studies have generally reported that HFS of the

STN or GPi suppresses firing of rate of the target structure (Rattay 1986; McIntyre

and Grill 1999; Kiss, Mooney et al. 2002; Magarinos-Ascone, Pazo et al. 2002;

Garcia, Audin et al. 2003). This finding has been replicated in vivo, at stimulation

parameters found to alleviate dyskinetic symptoms in animal models of PD (Boraud,

Bezard et al. 1996; Benazzouz, Gao et al. 2000; Benazzouz, Gao et al. 2000).

Consistent with the inactivation hypothesis, lesions and chemical inactivation of the

STN or EPN with GABA agonists also relieves dyskinesias in animal models of PD

(Aziz, Peggs et al. 1991; Mehta and Chesselet 2005; Mehta, Menalled et al. 2005)

and dystonia (Gernert, Hamann et al. 2000; Harnack, Hamann et al. 2004; Sander

and Richter 2007; Hamann, Sander et al. 2010). Both the suppression of neuronal

firing and alleviation of motor symptoms are frequency-dependent, with higher

frequencies (up to 300Hz) being more effective than lower frequencies (Dostrovsky

and Lozano, 2002). Depolarization block has been proposed to account for the

inhibition of the target structure as a result of DBS. It has been reported that high

frequency stimulation of the STN reduces excitability of STN neurons by activation of

calcium-dependent potassium currents that limit spontaneous activity (Bevan and

Wilson, 1999), and that prolonged inactivation of voltage-gated sodium and calcium

channels occurs (Beurrier, Bioulac et al. 2001; Shin, Samoilova et al. 2007; Shin and

Carlen 2008). However, the long time course of recovery and the fact that firing is

inhibited, not abolished, argue against depolarization block as a mechanism of

inactivation (Benazzouz, Piallat et al. 1995; Benazzouz, Gao et al. 2000; Benazzouz

and Hallett 2000).

24

Another theory that explains the similar effects of DBS and lesions is that both

interventions disrupt pathological patterns of neuronal activity in the basal ganglia

that are associated with different movement disorders (Albin, Young et al. 1989;

Redgrave, Rodriguez et al. 2011). Microelectrode recordings have established that

movement disorders are characterized by abnormal firing patterns of neurons in

distinct nodes of the basal ganglia. Specifically, both dystonia and PD are

characterized by overactivity and irregular burst firing of the subthalamic nucleus

(Schrock, Ostrem et al. 2009; Remple, Bradenham et al. 2011) and of the GPi

(Vitek, Chockkan et al. 1999; Hutchison, Lang et al. 2003; Merello, Cerquetti et al.

2004; Starr, Rau et al. 2005; Tang, Moro et al. 2007; Chan, Starr et al. 2011).

Similar to ablation, DBS of the STN or EPN interrupt this abnormal firing pattern in

basal ganglia thalamocortical circuits that is related to dyskinetic symptoms

(Benazzouz and Hallett 2000; Liu, Chen et al. 2008). DBS can modulate firing rate

and normalize irregular burst firing patterns of basal ganglia nuclei (Montgomery and

Baker 2000; Chang, Shi et al. 2007). Any stimulation delivered at frequencies higher

than the endogenous or pathological activity of the target structure would silence

information encoded by pathological bursting activity, which would also explain the

greater efficacy of DBS at higher stimulation frequencies (>100Hz) than at lower

frequencies (Dostrovsky and Lozano 2002; Birdno and Grill 2008; Johnson,

Miocinovic et al. 2008). This mechanism would also explain why different movement

disorders respond optimally to different DBS frequencies (Vitek 2008; Stavrinou,

Boviatsis et al. 2011), since the frequency of pathological neuronal firing in basal

ganglia thalamocortical loops differs between movement disorders.

25

As discussed, DBS may inhibit this pathological outflow of the basal ganglia,

either by inhibiting firing altogether or by normalizing pathological firing patterns. In

addition to these DBS-effects on the cell body of stimulated region, inactivation or

activation has been reported at sites distal from the target structure. Since

myelinated axons are more excitable than cell bodies, DBS may have distinct effects

on efferent projections, afferent projections and en passant connections of the target

structure (Baldissera, Lundberg et al. 1972; Gustafsson and Jankowska 1976;

Dostrovsky, Levy et al. 2000; McIntyre and Grill 2002). As a result of this functional

decoupling between cell body and axon, distal effects of DBS may be due to

polysynaptic connections or to antidromic axonal activation (Nowak and Bullier,

1998), and are likely mediated by changes in excitatory or inhibitory neurotransmitter

release from target areas innervated by affected axons.

2.3.2 – Glutamatergic and GABAergic effects of DBS

Another possible mechanism by which DBS may lead to inhibition of the

target structure is the excitation of inhibitory afferents from the GPe or CPu in the

case of the EPN and STN, respectively. Afferent inputs have a low threshold for

activation (Baldissera, Lundberg et al. 1972; Jankowska, Fu et al. 1975; McIntyre

and Grill 1999; Dostrovsky, Levy et al. 2000). The release of GABA from terminal

regions of these afferents has been described in vitro (Moser, Gieselberg et al.

2003; Li, Qadri et al. 2004), and would have an inhibitory influence on the stimulated

structure (Boraud, Bezard et al. 1996; Dostrovsky, Levy et al. 2000; Wu, Levy et al.

2001).

26

Excitation of efferent connections, leading to an overall increase in output

from the stimulated nucleus has also been described. Projections from the GPi to

the thalamus are GABAergic, in vivo electrophysiology studies have reported

increased GABA and consequent reduced activity in the thalamus of non-human

primates during GPi DBS (Anderson, Postupna et al. 2003; Zhao, Zhou et al. 2007),

and in 6-OHDA lesioned rats (Bruet, Windels et al. 2003; Windels, Carcenac et al.

2005). Similarly, projections from the STN to the GPi and SNr are glutamatergic,

and increased GLU has been reported in both of these nuclei (Windels, Bruet et al.

2000; Windels, Bruet et al. 2003), along with increased activity of these target

regions (Jech, Urgosik et al. 2001; Anderson, Postupna et al. 2003; Maurice, Thierry

et al. 2003) during STN-DBS. Interestingly, this increase in glutamate in projection

areas was not observed with lesions of the STN (Windels, Bruet et al. 2000),

consistent with the hypothesis that the activation of efferent axons are separate from

and independent of effects on the cell body of neurons. Moreover, increases in both

glutamate and GABA in projection areas vary as a function of stimulus frequency

(Moro et al., 2002).

The effects of STN-DBS on glutamatergic projections from the target structure

may also exhibit neuroprotective effects. Excessive glutamate release from the

STN, which is overactive in PD, may induce glutamate-dependent excitotoxicity and

neurodegeneration in STN projection areas (Benazzouz and Hallett 2000; Lozano,

Dostrovsky et al. 2002). Therefore, inhibiting glutamatergic output of the STN with

DBS may be neuroprotective in STN projection areas, such as the SN and CPu. No

studies have yet examined the neuroprotective effects of EPN-DBS in animal

models.

27

Both chronic STN-DBS and kainic acid lesion of the STN increased survival of

SNc neurons (by 20-24% more than shams) after 7 months, without inducing

changes in neuronal numbers in intact subjects (Wallace et al., 2007). Similar

effects have been reported in 6-OHDA-lesioned rats (Maesawa, Kaneoke et al.

2004; Temel, Visser-Vandewalle et al. 2006). Subchronic STN-HFS restores

tyrosine hydroxylase (TH) expression and number of TH-positive neurons in the

striatum (Spieles-Engemann, Behbehani et al. 2010; Khaindrava, Salin et al. 2011),

and in the SNc (Temel, Visser-Vandewalle et al. 2006) after 6-OHDA lesion. In a

separate study, Harnack et al, reported that 5 days of STN-DBS applied after 6-

OHDA lesion produced a 50% decrease in nigral cell loss relative to SHAM-

stimulated animals, whereas lesioning of the STN produced a 24% decrease

(Harnack et al., 2008). Arguing that DBS is not simply recapitulating a lesion effect,

STN-DBS is associated with increased nigrostriatal BDNF (Spieles-Engemann,

Behbehani et al. 2010), and while this increased BDNF does not alter cell

proliferation, it does promote the survival of existing neurons (Khaindrava et al.,

2011). In agreement with this protective mechanism, STN-DBS has been shown to

halt or slow degeneration of DA neurons in clinical cases of PD (Carvalho and

Nikkhah 2001; Krack, Batir et al. 2003; Hilker, Portman et al. 2005; Charles, Dolhun

et al. 2012). The potential neuroprotective ability of STN-DBS is intriguing, since this

would support applying DBS early in the course of PD, rather than reserving it for

severe cases.

Aside from decreasing GLU release in STN projection areas and decreasing

Glu-mediated excitotoxicity, DBS alters GLU and GABA in other brain regions, in a

frequency-dependent manner (Lee, Blaha et al. 2006). These effects are likely due

28

to poly-synaptic connections between the target and afferent regions, but may also

be indirect affects of DBS-induced alterations of modulatory neurotransmitter

release.

DBS-induced alterations in GABAergic and GLU transmission may contribute

to its anti-dyskinetic effects and neuroprotective effects, and may influence neuronal

activity in brain regions distal from the target nuclei. The widespread effects of DBS

on brain stem nuclei such as the VTA, SNc, raphe and locus coeruleus, which are

the source of dopaminergic, serotonergic and noradrenergic innervation to several

brain areas, respectively, may alter function of these modulatory neurotransmitters.

2.3.3 Effects DBS on brain monoamines

2.3.3.1 - Effects of DBS on Dopamine (DA)

As mentioned above, DBS initially increases GLU release in the SNc, which

enhances activity of dopaminergic neurons (Lee, Blaha et al. 2006). Moreover,

glutamatergic projections from the STN provide excitatory drive to SNr neurons

(Redgrave et al., 2011). STN inactivation following DBS is therefore expected to

decrease GABAergic inhibition from the SNr to SNc, which would also enhance the

activity of SNc neurons. This mechanism suggests that STN-DBS has a net effect of

increasing striatonigral DA release. STN-DBS influences dopaminergic activity at

the striatal level as well (Mintz, Hammond et al. 1986; Jaffer, van der Spuy et al.

1995), as GLU in the CPu facilitates DA release pre-synaptically (Cheramy, Barbeito

et al. 1990; Rosales, Flores et al. 1994).

Clinically, a reduction of L-DOPA on the order of approximately 50% is

possible with STN-DBS, although this varies widely (Moro et al., 1999). L-DOPA

29

reduction is not possible with EPN-DBS (Hilker, Benecke et al. 2009; Evidente,

Premkumar et al. 2011), consistent with the lack of observed effect of EPN-DBS on

DA release or metabolism in intact of 6-OHDA-lesioned rats (Meissner, Paul et al.

2000; Paul, Reum et al. 2000). In the clinic, the motor effects of STN-DBS resemble

those of L-DOPA (Benazzouz, Gao et al. 2000; Lacombe, Carcenac et al. 2007),

depend on a functioning DA system (Limousin, Krack et al. 1998; Breit, Schulz et al.

2004) and are less pronounced in the presence of systemic dopamine antagonists

(Jabre et al., 2008). Clinically, no changes in DA release, as measured by

raclopride displacement with PET has been reported with DBS (Abosch, Kapur et al.

2003; Hilker, Portman et al. 2005). Preclinical studies, however, have revealed that

the effects of chronic HFS may be linked to subtle changes in membrane

polarization of STN neurons, and to subtle neurochemical changes which include

altered dopamine release, metabolism, transporter expression and uptake rates in

different basal ganglia nuclei (Bruet et al., 2001).

In intact rats, STN-DBS reverses changes in gene expression and cellular

deficits in basal ganglia output nuclei induced by DA depletion (Salin, Manrique et al.

2002). Specifically, GAD, enkephalin, substance P and cFos were normalized

following behaviourally effective DBS (Salin, Manrique et al. 2002). Microdialysis

and electrophysiology studies have further linked STN-DBS to dopamine. STN-DBS

increases the firing rate of SNc neurons (Benazzouz et al., 2000) and leads to

increased DA (~30%) release in the striatum (Bruet, Windels et al. 2001; Meissner,

Reum et al. 2001; Lee, Blaha et al. 2006). Other studies have reported no increase

in DA, although methodological differences such as variations in DBS frequency and

amplitude may mean DA increases are below the limit of detection for microdialysis.

30

Pre-treatment with a DA uptake inhibitor did not enhance the DA release, but pre-

treatment with the MAOi did, suggesting that increased DA release followed by rapid

metabolism accounts for the dopaminergic effects of STN-DBS (Meissner, Harnack

et al. 2002; Meissner, Harnack et al. 2003; Bergmann, Winter et al. 2004).

Confirming these metabolic effects, levels of two primary DA metabolites, DOPAC

and HVA, are consistently found to be elevated following STN-DBS (Winter, Lemke

et al. 2008; Walker, Koch et al. 2009). Moreover, DA release induced by STN-DBS

is synergistic with increased DA release following L-DOPA administration (Navailles

et al., 2010), and is observed in brain areas innervated by the mesolimbic DA

system as well as the striatonigral system (Navailles, Benazzouz et al. 2010;

Navailles and De Deurwaerdere 2011).

Fast scan cyclic voltammetry is a more sensitive means of measuring DA,

and using this technique, both a phasic and tonic increase in DA has been reported

following STN-DBS (Lee, Blaha et al. 2006). The phasic effect on DA release is

transiently increased in response to transient increases in action potential firing in

the STN (Lee, Blaha et al. 2006). This transient increase is thought to be mediated

by glutamatergic projections from the STN to SNc, since these connections show an

initial increase in activity following DBS-onset (Lee, Blaha et al. 2006). GLU from

neuronal and glial sources may play a facilitatory role on GLU release directly acting

with D2R in the CPu (Walker et al., 2009). It has also been proposed that

stimulation of dopaminergic fibers passing near the STN may directly influence DA

release (Lee, Blaha et al. 2006). Specifically, stimulation of the MFB induces a

robust increase in striatal DA release, which is 3x more pronounced than STN-DBS

(Covey and Garris, 2009). However, this DA increase follows different kinetics than

31

MFB stimulation (Manley, Kuczenski et al. 1992; Paul, Reum et al. 2000) and DBS

applied to the zona incerta, which is immediately above the STN and would also

affect proximal fiber tracts, does not alter striatal DA release (Covey and Garris

2009; Pazo, Hocht et al. 2011). Another likely mechanism of DA increase is the

inhibition of glutamatergic projections from the STN and GP to the SNr. Since the

SNc is under tonic inhibitory GABAergic control by the SNr, this inhibition of

glutamatergic projections by STN-DBS would inhibit the SNr, ultimately disinhibit

SNc firing, leading to increased and sustained DA release (Wichmann and DeLong

2003; DeLong and Wichmann 2009; Redgrave, Rodriguez et al. 2011). While the

STN also sends glutamatergic projections to the GP and onto the SNr, the GP is

likely not involved in the DBS-induced DA release, since ibotenic acid or kainic acid

lesions of this structure did not alter the DA response (Covey and Garris 2009; Pazo,

Hocht et al. 2011).

2.3.3.2 - Effects of DBS on Serotonin (5-HT)

The effects of DBS on 5-HT has been less well studied than the effects of DA,

GLU or GABA, although there are several lines of evidence that implicate 5-HT in

the effects of DBS. Clinically, DBS, particularly STN-DBS has been linked to

psychiatric symptoms associated with serotonergic dysfunction, such as impulsivity,

depression and increased suicidal thoughts and behaviour (Mann 2003; Cowen

2008; Temel, Tan et al. 2009). While DA is the primary modulatory neurotransmitter

of the basal ganglia, 5-HT modulates activity of basal ganglia nuclei directly at the

terminal area via receptor interactions (Navailles and De Deurwaerdere 2011), and

32

indirectly by modulating activity of DA neurons in the SNc (Naidu and Kulkarni 2001;

Di Matteo, Pierucci et al. 2008; Di Giovanni, Esposito et al. 2010).

Pre-clinical studies in intact and 6-OHDA-lesioned rats have found that STN-

DBS inhibits firing of dorsal raphe neurons in vivo (Temel, Boothman et al. 2007).

Consistent with this inhibition of raphe activation, decreased 5-HT release has been

reported in the hippocampus (~55% decrease relative to baseline) and prefrontal

cortex (~70% decrease relative to baseline), which are preferentially innervated by

the MRN and DRN, respectively (Navailles, Benazzouz et al. 2010; Tan, Janssen et

al. 2011). This decrease occurred with unilateral and bilateral DBS, and persisted

after DBS ceased. Changes in 5-HT release are closely time-locked to changes in

raphe neuron firing (Kalen, Strecker et al. 1988; Sharp, Bramwell et al. 1989) and 5-

HT neuron inhibition and 5-HT release were inhibited immediately after DBS-onset.

This suggests that STN-DBS inhibits firing of raphe neurons which leads to

decreased 5-HT release in brain areas innervated by the DRN, including the basal

ganglia (Lavoie and Parent 1990; Shin, Samoilova et al. 2007; Navailles, Benazzouz

et al. 2010). To date, no studies have examined the effects of EPN-DBS on 5-HT

neuron firing or on 5-HT release.

The mechanism by which STN-DBS leads to inhibition of dorsal raphe

neurons is currently an area of active investigation. Anterograde tracing has

identified targets of the STN in the DRN (Nakanishi, Kita et al. 1987; Kita and Kitai

1994), although this is controversial and proposed to be afferents from the zona

incerta rather than the STN (Peyron, Petit et al. 1998). However, an inhibition of

GLU afferents to the DRN as a result of STN-DBS would decrease excitatory drive

to serotonergic raphe neurons. Other theories posit that the effect of STN-DBS on

33

DRN neurons is poly-synaptic, involving connections from the STN to the mPFC,

LHb or SNr, which in turn make contact with DRN neurons (Varga, Szekely et al.

2001; Hajos, Gartside et al. 2003; Varga, Kocsis et al. 2003; Kirouac, Li et al. 2004).

This decrease in 5-HT may contribute to the dyskinetic effects of STN-DBS. STN-

DBS reverses hypolocomotion induced by systemic administration of the 5-HT2

agonist, DOI (Hameleers, Blokland et al. 2007). In addition to reversing the

locomotor effects of 5-HT agonists, and there are case reports of 5-HT antagonists

alleviating dyskinesias in patients with TD (Margolese and Ferreri 2007;

Peritogiannis and Tsouli 2011) and PD (Huot et al., 2011).

As mentioned above, the vast majority of studies examining DBS

mechanisms have been conducted in PD models. As DBS becomes increasingly

applied for more neurological and psychiatric disorders, disentangling mechanisms

of DBS from underlying pathology becomes even more important. In order to

optimize treatment, predict patient response and understand possible adverse

effects of DBS, the mechanisms underlying its therapeutic and psychiatric effects in

other disease models must be understood. To this end, an objective of the current

project was to suggest possible mechanisms underlying the anti-dyskinetic effects of

DBS in a rodent model of TD.

34

B) Thesis Objectives As outlined in the preceding section, understanding the mechanisms underlying the

anti-dyskinetic effects of DBS must be understood in order for this therapy to

be optimized in the clinic. With this overall goal, the objectives of the current

project were:

1) To establish if DBS of the STN or EPN effectively suppresses HAL-induced motor

symptoms in an animal model of TD and compare the optimal target and

stimulation parameters.

2) To investigate neurochemical substrates that might contribute to anti-dyskinetic

DBS effects, with a particular focus on the serotonergic system.

35

C) Thesis Outline

Question 1. Does DBS reduce VCMs in an animal model of TD?

1.1 Does deep brain stimulation attenuate motor symptoms in an animal

model of tardive dyskinesia?

1.2 STN vs. EPN: What is the optimal stimulation target and frequency?

Question 2. Is DBS equivalent to functional inactivation?

2.1 Effects of muscimol infusion into STN and EPN (effect on VCMs)

2.2 Immediate early gene mapping after DBS and muscimol

Question 3. Contribution of 5-HT to the motor effects of DBS

3.1 DBS effects on serotonin release

5.1.1 Microdialysis: 5-HT release in caudate-putamen after STN or

EPN DBS

5.1.2 Immediate early gene mapping: induction of zif268 in raphe after

STN or EPN DBS

3.2 Decreasing or antagonizing 5-HT neurotransmission reduces VCMs

independently of DBS

5.2.1 Effects of 5,7-DHT lesions on VCMS, independently of DBS

5.2.2 Effects of acute raphe silencing with 8-OH-DPAT on VCMs

5.2.3 Effects of 5-HT2 antagonism on VCMs

3.3 Is decreased 5-HT necessary for the motor effects of DBS?

3.3.1 Effects of preventing DBS-induced decreases in striatal 5-HT:

results with Fluoxetine.

36

3.3.2 Effects of preventing DBS-induced decreases in striatal 5-HT:

results with Fenfluramine and DOI pre-treatment

Question 4. Contribution of DA to the motor effects of DBS

4.1 What is the effect of STN- and EPN-DBS on the DA system?

4.1.1 Microdialysis: Effects of STN or EPN DBS on striatal DA release

4.1.2 IEG mapping after STN or EPN DBS Microdialysis

4.2 Increasing DA does not influence VCMs independently of DBS

4.2.1 L-DOPA has no effect on VCMs

Question 5. Does chronic DBS induce psychiatric-like effects?

6.1 Does DBS alter performance in a learned helplessness task?

6.2 Does DBS alter performance in an elevated plus maze?

6.3 Does DBS alter expression of TrkB, BDNF or BDNF protein levels in the

hippocampus?

37

General Methodology 1. Subjects

All procedures were approved by the Animal Care Committee at the Centre

for Addiction and Mental Health and complied with Canadian Council on Animal

Care (CCAC) and NIH standards and guidelines. Rats were maintained on a 12

hour light cycle, with onset at 7am and offset at 7pm, rats had ad libitum access to

food (Purina rat chow) and water.

2. Haloperidol treatment

Rats initially weighing 200-250g received either HAL treatment (21 mg/kg, i.p. once

every three weeks) or sesame oil VEH. Haloperidol-decanoate formulation was

used, which is known to result in constant plasma levels in the 1.1–1.5 mg/kg range

(Turrone et al., 2002) and reliably induce progressive increases in VCMs, as shown

in figure 2.

3. VCM assessments

VCM assessments were done by placing a rat on a pedestal (26cm diameter, 50cm

high), lined with absorbent paper. VCMs are defined as purposeless movements

made in the vertical plane, which were not directed at any object, with or without

tongue protrusion. Jaw tremors or bursts of movements were counted as one VCM.

VCM assessments were two minutes long, and were preceded by a two minute

acclimation period to the pedestal. VCM assessments were made weekly during

HAL treatment, and starting one week after DBS surgery.

38

Figure 2. VCM development after HAL treatment. Chronic treatment with HAL

induced VCMs, which stabilized by approximately 8 weeks of treatment. VCM levels

remained between 0-2 in VEH-treated rats.

39

4. Surgical implantation of DBS electrodes

Male, Sprague-Dawley rats (N=88) initially weighing 400-450g were anesthetized

with ketamine/xylazine (100/7.5 mg/kg i.p.) and had polymide-insulated stainless

steel monopolar electrodes (250 μm in diameter with 0.6 mm of surface exposed)

bilaterally implanted into the STN (AP −3.8 mm; ML + 3.5 mm; DV −8.0) or EPN (AP

−3.6 mm; ML + 3.6 mm; DV −7.8 mm) according to the atlas of Paxinos and Watson

(Paxinos and Watson, 1986). Anodes were connected to a bone screw over the

somatosensory cortex, the electrodes were secured to the skull using multiple bone

screws and dental cement. Sham surgery controls were anesthetized and had holes

drilled into the skull but were not implanted with electrodes.

5. Electrode localization

After sacrifice, brains were removed and flash frozen on dry ice. Brains were

sectioned coronally, and 20 µm sections were processed with cresyl violet stain to

visualize electrode tracts. Slides were fixed overnight in 10% paraformaldehyde

vapour. The following day, slides were dehydrated in graded ethanols before cresyl

violet staining followed by contrast in dilute acetic acid solution. Slides were

coverslipped and analyzed for electrode placement. Representative

pictomicrographs showing correct electrode placement are shown in figure 3.

40

Figure 3. Representative pictomicrographs showing placement of electrodes.

Electrodes implanted in the STN (left) or EPN (right) are shown. Pictomicrographs

were generated following cresyl violet staining.

41

6. DBS Protocol

Starting 1 week after surgery DBS was applied using a portable stimulator

(Model 6510, St Jude Medical, Plano, Texas) set to deliver 100 μA, 90 μs pulse

width at 130Hz. Choice of these stimulation settings was guided by two

considerations. First, when electrode diameter and exposed surface are taken into

account, we estimated that current intensities in the 100–300 μA range would

generate a charge density that approximates that which is used in humans (Hamani,

Diwan et al. 2009; Creed, Hamani et al. 2011; Hamani, Machado et al. 2011).

Second, preliminary observations indicated that currents higher than 100 μA induced

motor effects in some animals (i.e. forelimb dyskinesias in the STN group and motor

contractions in the EPN group).

For chronic experiments (Chapter 5), DBS was applied for 4 hours per day,

for twenty-one consecutive days. A photograph of a rat undergoing DBS is shown in

figure 4.

42

Figure 4. DBS procedure. Freely moving rats underwent DBS via a handheld

stimulator connected to surgically implanted electrodes.

43

7. In situ hybridization

In situ hybridization was used to quantify gene expression. At the conclusion

of the behavioural experiments, rats were sacrificed. Brains were removed and flash

frozen, and then sliced in a cryostat at 20µm thickness. Hybridization was

performed using 35S-UTP labeled riboprobes complementary to the target gene, and

to promoter sequences for the T7 RNA polymerase. Using the NCBI BLAST Tool,

the sequences were checked for homology with the rat genome and found to be

specific for their respective transcripts. Probes were diluted to a concentration of

200,000 cpm/µl in hybridization solution containing: 50% formamide, 35%

Denhardt’s solution, 10% dextran sulfate, 0.1X SSC, salmon sperm DNA (300µg/ml),

yeast tRNA (100µg/ml), and DTT (40µM). Slides were incubated in plastic mailers

overnight at 60°C. After hybridization, sections were rinsed in 4X SSC at 60°C,

treated in RNase A (20µg/ml) solution at 45°C for 40 min, washed with agitation in

decreasing concentrations of SSC containing 5g/L sodium thiosulfate, dipped in

water, dehydrated in 70% ethanol, and air-dried. The slides were exposed to Kodak

BioMax film for 6 days at 4°C along with calibrated radioactivity standards. Probe

specificity was confirmed by testing labelled sense and scrambled probes, both of

which produced no measurable signal on film.

Densitometric analyses were performed with MCID 7.0 software (InterFocus,

Leiton, UK). Prior to sampling, illumination level was adjusted for every film to

ensure consistent background readings across all films. Standard curves obtained

from calibrated radioactivity standards were used to convert raw optical density

values to radioactivity levels in microcuries per gram of tissue (μCi/g). Brain regions

were analyzed across 8 sections per animal, delineation of the structures was done

44

visually, according to the atlas of Paxinos and Watson (1986). Readings were first

averaged across all sampling windows in a section and then across all sections to

produce a final density value for each region for each animal.

45

Chapter 1

Does DBS reduce VCMs in an animal model of TD?

This chapter has been published as:

Creed MC, Hamani C, Nobrega JN. Deep brain stimulation of the

subthalamic or entopeduncular nucleus attenuates vacuous chewing

movements in a rodent model of tardive dyskinesia. European

Neuropsychopharmacology. Volume 21, Issue 5, May 2011, Pages

393–400.

Statement of author contributions:

All experiments were designed by MC and JN. All experimental work

and data analyses were conducted by MC. JN and MC wrote the

manuscript. CH reviewed the manuscript and gave expert opinion.

46

1. Introduction

Tardive dyskinesia (TD) is a persistent and debilitating hyperkinetic

movement disorder associated with long-term treatment with classical antipsychotic

drugs. Risk of developing TD increases by approximately 5% per year of treatment

and constitutes a major limitation of antipsychotic therapy (Glazer, Morgenstern et

al. 1990; Glazer, Morgenstern et al. 1993). While the incidence of TD is much lower

with newer atypical antipsychotics (Correll and Schenk 2008), they carry risks of

their own, including agranulocytosis, excessive weight gain, diabetes and potentially

fatal metabolic complications (Haddad and Sharma, 2007). Thus classical

antipsychotic medications are still used, and TD remains a significant clinical

problem (Remington 2007).

A number of diverse pharmacological treatments have been attempted with

varying degrees of efficacy on TD symptoms. In all, the management of TD remains

challenging (Soares and McGrath 1999). For patients with persistent TD that is not

responsive to pharmacological treatments, there has been a resurgence of interest

in deep brain stimulation (DBS) as a therapeutic intervention, following positive

outcomes in other movement disorders. In the specific case of TD, recent case

reports have also produced promising results (Eltahawy, Feinstein et al. 2004;

Schrader, Peschel et al. 2004; Kosel, Sturm et al. 2007; Kefalopoulou, Paschali et

al. 2009). A recent prospective multicenter study using double-blind evaluation in

the presence and absence of DBS also reported significant reduction of TD

symptoms at 6 months in the first 10 patients treated (Damier, Thobois et al. 2007).

To date, DBS trials for TD have mostly focused on the internal globus pallidus

(GPi) as a key basal ganglia output station (Albin, Young et al. 1989; Damier,

47

Thobois et al. 2007). However, the subthalamic nucleus (STN) has been suggested

as an alternative (Sun, Chen et al. 2007). Indeed STN-DBS has been widely used

for the treatment of other movement disorders associated with basal ganglia

pathology, particularly Parkinson's disease (Kitagawa, Murata et al. 2000; Murata,

Kitagawa et al. 2003; Murata, Maruoka et al. 2007; Del Sorbo and Albanese 2008;

Benabid, Chabardes et al. 2009). Other points of uncertainty refer to optimal

stimulation parameters (e.g. frequency and intensity of stimulation) and the

comparative effectiveness of unilateral vs. bilateral stimulation at different

anatomical targets (Schrader, Peschel et al. 2004). In this context investigating DBS

effects in animal models of TD could prove particularly informative.

In several species including rats and mice, chronic treatment with haloperidol

(HAL) or other first-generation antipsychotic drugs induces a well-characterized

syndrome of vacuous chewing movements (VCMs), which has a number of features

analogous to human TD (Tamminga, Thaker et al. 1989; Turrone, Remington et al.

2002). In the present study we assessed the effects of DBS applied to the

entopeduncular nucleus (EPN, the rodent homologue of the globus pallidus internus)

or the subthalamic nucleus (STN) on VCMs induced by long-term HAL treatment.

We examined the efficacy of different current frequencies applied bilaterally to either

anatomical target. We also compared the effectiveness of unilateral vs. bilateral

stimulation of both targets. Results suggest that high frequency stimulation of either

the EPN or STN significantly decreases the incidence of oral dyskinesias induced by

chronic haloperidol.

48

2. Materials and Methods

2.1 Drug treatment

Male Sprague-Dawley rats initially weighing 200-250g (Charles River,

Quebec) received either haloperidol decanoate (HAL; 21mg/Kg i.m. N= 68) or

sesame oil vehicle (N=22) as described in section 2 of general methodology. VCM

assessments were conducted once a week in a quiet room as described in section 3

of general methodology.

2.2 Surgery

After 12 weeks of HAL treatment, rats were anesthetized with

ketamine/xylazine (100/7.5 mg/kg i.p.) and underwent surgical implantation of

stimulating electrodes into the STN or EPN, as described in section 4 of general

methodology. A second group of control animals had electrodes implanted into

either the STN or EPN, but no current was passed through the electrodes at any

time.

2.3 DBS protocol

DBS was applied using a handheld stimulator, as described in appendix 1

section 6. During the DBS sessions, rats were initially given a 2-min acclimation

period on the observation pedestal followed by a 2-min baseline VCM assessment.

Thereafter, stimulation was delivered for 2 min at each of the following conditions:

(a) bilateral 130 Hz; (b) bilateral 60 Hz; (c) bilateral 30 Hz; (d) left unilateral 130 Hz;

and (e) right unilateral 130 Hz. The order of these 5 stimulation conditions was

randomized for each subject, with at least 20 seconds between them. After

49

stimulation was turned off, an additional 2-min observation was conducted to assess

recovery of the behaviour. Tests were conducted on two days with each animal

receiving 2 trials at each of the 5 stimulation conditions.

2.4 Open field tests

After completion of VCM assessments, locomotor activity was assessed in an

open field. Rats were placed in automated activity chambers (Med Associates, St.

Albans, VT) for a 2 min acclimation period before the onset of DBS (for animals

implanted with electrodes). Horizontal activity was then recorded for 10 minutes

during 130Hz DBS, following which rats were returned to the home cage.

2.5 Verification of electrode placements

Placements were verified using cresyl violet staining, as described in section 5 of

general methodology. Only rats with histologically verified electrode placements

were included in the final analyses.

2.6 Statistical Analyses

All statistical analyses were conducted using SPSS, version 19.0. Bilateral and

unilateral data were analyzed separately using two-factor ANOVAs with repeated

measures on the factor Frequency, followed where appropriate by paired or

unpaired t tests for two group comparisons.

50

3. Results

As expected, VCMs developed after initiation of HAL treatment and continued

to rise in frequency until approximately 7-8 weeks of treatment in most animals.

VCM counts for the three weeks immediately prior to surgery were averaged and

served as a pre-surgery VCM baseline measure. When the first post-surgery VCM

assessments were compared to the pre-surgery baseline no significant differences

were observed (Figs. 6 and 7), and inert electrodes had no effect on VCMs (figure

8), indicating that surgery or presence of electrodes in the target structure had no

effect on VCMs counts.

3.1 Electrode localization

Electrode placement was determined with cresyl violet staining. Only rats with

correct electrode placements were included in the analyses. It was not possible to

find a consistent pattern of DBS effects for rats with electrode placements outside

the two target areas (open circles in Fig 5). We did observe that DBS in rats with

electrodes within the internal capsule, but outside the EPN, appeared to produce

reductions of VCMs. However, given the proximity of these electrodes to the

intended target, it was not possible to rule out the possibility that such effects were

due to current spread to the EPN.

51

-1.80 -2.12 -2.30 -2.56

-3.60 -3.80 -4.16 -4.30 -4.52 -4.80 -5.20

-2.80 -3.14 -3.30-1.80 -2.12 -2.30 -2.56

-3.60 -3.80 -4.16 -4.30 -4.52 -4.80 -5.20

-2.80 -3.14 -3.30-1.80 -2.12 -2.30 -2.56

-3.60 -3.80 -4.16 -4.30 -4.52 -4.80 -5.20

-2.80 -3.14 -3.30

Figure 5. Electrode localization. Electrode placements for all animals that

completed the study. Filled circles indicate placement within the STN and EPN,

open circle indicate placements outside the two target areas. Note that only animals

with both electrodes placed within the STN or EPN were included in the final data

analyses. The number at the top of each panel corresponds to distance from

bregma in mm, according to the atlas of Paxinos and Watson (Paxinos and Watson,

1986).

52

3.2 Effects of bilateral STN stimulation

As shown in Figure 2, HAL-treated animals that received bilateral STN DBS

at 30Hz, 60Hz or 130Hz showed significant reductions in VCM counts (Frequency

main effect F=17.79 p< 0.001; Frequency X Drug, F=16.98 p < 0.001). Stimulation

at each of the tested frequencies resulted in significant decreases in VCMs

compared to the no-stimulation post-surgery baseline (30Hz: -40.2%, p<0.01; 60Hz:

-46.4%, p<0.0001; 130Hz: -61.7% p< 0.001) (Fig. 6). In addition, mean VCM

scores for the 130 Hz condition were significantly lower than those for the 30Hz

condition (p< 0.001) (Fig. 6).

53

0

2

4

6

8

10

12

14

16N

umbe

r of V

CM

s

VEH N=6HAL N=10

surg

ery

1-3 4-6 7-9 10-12 No DBS 130Hz 60Hz 30Hz Left Right Recovery

Weeks of treatment Bilateral DBS Unilateral DBS(130 Hz)

STN

*** #*** ** ** **

0

2

4

6

8

10

12

14

16N

umbe

r of V

CM

s

VEH N=6HAL N=10VEH N=6HAL N=10

surg

ery



STN

*** #*** ** ** **

Figure 6. Effects of STN-DBS on VCMs. Values are means ± sem. The order of

the 5 stimulation conditions (bilateral 30, 60 and 130Hz; unilateral right, unilateral left

130Hz) was randomized for each rat. Note that due to randomization of conditions,

the recovery period followed different stimulation conditions. Bilateral STN-DBS at

all frequencies tested significantly reduced VCMs relative to baseline * p < 0.05, ** p

< 0.01, *** p <0.001, paired t tests. Bilateral 130 Hz DBS reduced VCMs to a

greater extent than 30Hz stimulation (# p = 0.003, independent t-test).

54

3.3 Effects of bilateral EPN stimulation

Similarly to what was observed in the STN group, bilateral EPN-DBS

significantly reduced VCMs at all frequencies tested when compared to the no-

stimulation baseline (30Hz: -48.9%, p<0.001; 60Hz: -49.0%, p<0.001; 130Hz: -

50.8%, p= <0.001) (Fig. 7). No significant differences were observed among the

three stimulation frequencies (Fig. 7).

3.4 Effects of unilateral stimulation

Unilateral stimulation of either the right or the left STN was associated with

significantly fewer VCMs relative to baseline (right = -38.5%, p=0.021; left = -35.5%,

p=0.014) (Fig. 3). A similar pattern was observed in the EPN (Fig. 7): unilateral

stimulation of either the right or the left EPN significantly reduced VCM counts

relative to baseline (right = -48.1%, p=0.011; left = -36.5%, p=0.045). In both STN

and EPN, 130Hz bilateral stimulation appeared to be more effective than 130Hz

unilateral stimulation (Figs. 6 and 7). However the differences were not statistically

significant in either case.

3.5 DBS effects in vehicle controls

As shown in figures 6 and 7, DBS applied bilaterally or unilaterally to either

the STN or EPN induced no significant VCMs in vehicle-treated controls, irrespective

of frequency used.

55

0

2

4

6

8

10

12

14N

umbe

r of V

CM

s



surg

ery

EPN VEH N=7HAL N=9

*** *******

**

0

2

4

6

8

10

12

14N

umbe

r of V

CM

s



surg

ery

EPN VEH N=7HAL N=9VEH N=7HAL N=9

*** *******

**

Figure 7. Effects of EPN DBS on VCMs. Values are means ± sem. The order of

5 stimulation conditions (bilateral 30, 60 and 130Hz; unilateral right, unilateral left

130Hz) was randomized for each subject. Because of randomization the recovery

period did not always follow the same stimulation condition. Bilateral DBS of the

EPN significantly reduced VCMs in HAL-treated animals at all frequencies tested

relative to baseline (*** p <0.001, paired t tests). There were no significant

differences between stimulation frequencies for either HAL- or VEH-treated rats.

Unilateral EPN stimulation significantly reduced VCM counts relative to baseline

(* p < 0.05, ** p < 0.01, paired t tests).

56

3.6 Surgery controls

Animals that underwent sham surgery exhibited similar levels of VCMs in the

three assessments prior to surgery (HAL mean = 10.78 ± 1.75, N=6; VEH

mean=1.25 ± 0.37; N=4) as they did after surgery (HAL mean = 11.36 ± 1.45; VEH

mean = 1.37 ± 0.38). Likewise, HAL-treated animals that were implanted with

electrodes but that never received DBS showed similar levels of VCMs prior to

(mean STN=11.83 ± 0.17 N=2; mean EPN=9.17 ± 0.17 N=2) and after surgery

(mean STN=9.00 ± 1.68; mean EPN=9.50 ± 1.32) (Fig. 8).

57

0

2

4

6

8

10

12

14

SHAM STN EPN

Pre-Surgery Post-SurgeryN

umbe

r of V

CM

s

16

0

2

4

6

8

10

12

14

SHAM STN EPN

Pre-Surgery Post-SurgeryN

umbe

r of V

CM

s

16

Figure 8. Effect of inert electrodes on VCM levels. All groups are HAL-treated.

Rats had sham surgery, or electrodes implanted in the EPN or STN, but at no point

had stimulation delivered through the electrodes. VCMs were not affected by the

presence of inert electrodes in the target nuclei.

58

3.7 Effect of stimulation on open field activity

As expected, HAL-treated animals showed less ambulatory activity in the

open field than vehicle-treated animals (Fig. 9). Following a 2 X 2 factorial ANOVA,

the total activity score of HAL-treated animals was lower than that of their VEH-

treated counterparts in all cases (p < 0.05, independent t tests), except for HAL-

treated rats receiving EPN DBS; this group did not differ from its stimulated VEH-

EPN counterpart (p >0.05) and showed significantly higher activity than either HAL-

SHAM or HAL-STN rats (p <0.05 in both cases) (Fig.9).

59

Figure 9. DBS effects on open field activity. Values are means ± sem. Animals

were run in an activity chamber once with a 2-min acclimation period followed by 10

min of 130 Hz DBS. HAL-treated groups were generally less active than VEH-

treated groups across time intervals, but there was no significant main effect of

Target and no Target × Treatment interaction. * p < 0.05, HAL-treated vs.

corresponding VEH-treated group. # p < 0.05, compared to either HAL-SHAM or

HAL-STN groups.

60

4. Discussion

The main finding of this study was that DBS applied to either the EPN or the

STN effectively reduced the number of VCMs in HAL-treated rats. These effects

were not due to an overall effect of DBS on motor activity levels, as shown by open

field results. In vehicle-treated controls DBS at the settings used did not induce

dyskinetic orofacial movements, whether applied bilaterally or unilaterally to either

anatomical target.

In most dystonic syndromes, the rate and timeframe for improvement

following DBS is variable, with some patients showing immediate improvement and

others taking months. In the present study we were specifically interested in the

acute effects of DBS, in part because in the clinic motor abnormalities are often seen

to decrease nearly immediately after DBS onset (McIntyre, Savasta et al. 2004;

McIntyre, Savasta et al. 2004). In the specific case of TD, immediate alleviation of

motor symptoms has been reported (Schrader, et al., 2004).

VCM levels were similar before surgery and in the first postoperative

assessments prior to DBS in animals implanted with EPN or STN electrodes. Along

with the lack of effect on VCMs in animals with inert electrodes, this rules out the

possibility that surgery or mere insertion of electrodes could have played a role in

the observed results. Also, the observed effects of DBS on VCMs was not due to

nonspecific suppression of motor activity; open field data indicated that in the EPN

group DBS seemed to actually counter the general hypo-activity induced by HAL.

The main intent of the present study was to provide an initial assessment of

the viability of the HAL VCM model to investigate DBS effects, and thus our study

did not address mechanistic possibilities for the observed effects. While DBS of the

61

GPi has been the mainstay of surgical treatments for TD (Eltahawy, Feinstein et al.

2004; Schrader, Peschel et al. 2004; Damier, Thobois et al. 2007; Kosel, Sturm et al.

2007; Kefalopoulou, Paschali et al. 2009), it has been argued that the STN-DBS

may be at least as effective and may be clinically practical (Sun, et al., 2007).

Controlled clinical trials have not yet been conducted to support the superiority of

either target in TD. Here we have compared DBS of the STN and EPN in a model

system, and our results fail to demonstrate significant functional differences between

these two neuroanatomical targets. Interestingly, our results suggest that frequency

of stimulation did play a different role in the effects of stimulation at each target. In

the STN, DBS at 130Hz was significantly more effective than at 30Hz, whereas no

differences across frequencies were apparent in animals receiving EPN stimulation.

Although similar effects have not been clearly demonstrated in patients with TD, the

present findings are largely consistent with the DBS literature in dystonia and

Parkinson’s disease. In both conditions, frequencies above 100Hz appear to be

optimal for alleviation of motor symptoms after STN stimulation (Moro, Esselink et al.

2002; Kleiner-Fisman, Herzog et al. 2006). In contrast, the ideal frequency for pallidal

stimulation in patients with dystonia is still controversial. While most centers use

frequencies in the 130Hz range, others have recently suggested that 60Hz would be

equally effective (Alterman et al., 2007).

Another consideration is the possibility that brain tissue may adapt to

stimulation frequency over time (Volkmann, 2004). Our results suggest that with

EPN, but not STN stimulation, the frequency of stimulation can be varied in order to

avoid habituation and this would not sacrifice efficacy. Although caution must

always be exerted in extrapolating data from animal models to humans, our results

62

suggest that pallidal DBS at lower frequencies would be effective in TD. Also of

interest was the clear effectiveness of unilateral DBS when applied to either

anatomical target. This is consistent with clinical reports in TD patients (Schrader, et

al., 2004). Yet, in the case of the STN, but the EPN, our results seem to suggest a

stronger effect of bilateral vs. unilateral DBS on VCMs.

Because of its dramatic results, clinical application of DBS has advanced

much more quickly than preclinical knowledge (McIntyre, Savasta et al. 2004;

McIntyre, Savasta et al. 2004). In order to optimize the applications of DBS for TD,

preclinical investigations will be needed to help elucidate the mechanisms underlying

the effects of DBS in this disorder. Here we show that DBS applied bilaterally or uni-

laterally to either the EPN or the STN significantly reduced VCMs in rats undergoing

long-term HAL treatment. The present model has permitted us to behaviourally

characterize the effects of DBS at different frequencies and anatomical targets, and

may thus provide a very useful preparation for the study of neuronal mechanisms

underlying these effects.

63

5. Statement of Significance. In this chapter, we confirm our hypothesis that DBS

of the STN or EPN selectively suppresses HAL-induced VCMs without effecting

general motor activity. These experiments establish the model system for

subsequent experiments. Moreover, we determined that 130Hz DBS, delivered

bilaterally, attenuated VCMs most effectively and was comparably efficacious in the

STN and EPN. For this reason, these DBS parameters were used in subsequent

investigations explore the mechanisms underlying the anti-dyskinetic and psychiatric

effects of DBS.

64

Chapter 2

Question 2. Is DBS equivalent to functional inactivation?

This project has been published as:

Creed MC, Hamani C, Nobrega JN. Early gene mapping after deep

brain stimulation in a rat model of tardive dyskinesia: comparison with

transient local inactivation. European Neuropsychopharmacology.

Volume 22, Issue 7, July 2012, Pages 506-517.



and data analyses was conducted by MC. JN and MC wrote the


65

1. Introduction

Deep brain stimulation (DBS) is a clinical procedure whereby electrical

current is passed through surgically-implanted electrodes in the brain. Over the last

decade, DBS applied to the subthalamic nucleus (STN) or internal globus pallidus

(GPi) has been successfully used to treat several movement disorders, including

Parkinson’s disease and dystonia (Blomstedt, Fytagoridis et al. 2009; Elble 2009;

Moro, Lozano et al. 2010; Cacciola, Farah et al. 2011; Lubarr and Bressman 2011;

Ostrem, Racine et al. 2011). Recently, DBS has also been used to treat patients

with tardive dyskinesia (TD), a disorder induced by chronic therapy with classical

antipsychotic drugs (Eltahawy, Feinstein et al. 2004; Schrader, Peschel et al. 2004;

Damier, Thobois et al. 2007; Sun, Chen et al. 2007; Sun, Chen et al. 2007). TD is

characterized by abnormal, involuntary movements of the head, neck, face and jaw,

which can persist for a prolonged time after medication withdrawal (Casey 1985;

Casey 2004). While patients often respond to pharmacotherapy, a number of

patients remain resistant to drug interventions and have recently been considered

candidates for DBS surgery.

Despite its therapeutic success, mechanisms underlying the efficacy of DBS

remain unclear. DBS has been suggested to be functionally equivalent to local

inactivation of target nuclei. In line with this notion, microelectrode recordings have

demonstrated that DBS can suppress output of the stimulated structure (Benazzouz,

Gao et al. 2000; Dostrovsky, Levy et al. 2000). Furthermore, local tissue inactivation

via infusion of the GABAergic agonist muscimol into the STN alleviates motor

symptoms in patients with PD (Levy et al., 2001) as well as in pre-clinical models of

PD (Mehta and Chesselet 2005; Mehta, Menalled et al. 2005). However, it has also

66

been demonstrated that DBS influences brain regions at sites distal from the site of

stimulation (Su, Ma et al. 2001; Schulte, Brecht et al. 2006). One initial approach to

address the role of local vs. distal processes in DBS effects would be to map

neuronal activity in nodal points through the basal ganglia following DBS.

While preclinical work on DBS and dyskinesias has primarily focused on

parkinsonian models, we have recently shown that DBS of the STN or

entopeduncular nucleus (EPN, the rodent homologue of the GPi) effectively

suppresses antipsychotic drug-induced orofacial dyskinesias (Creed et al., 2011).

The target behavior, often referred to as vacuous chewing movements (VCMs),

develops in the course of chronic exposure to classical antipsychotic drugs such as

haloperidol (HAL)(Turrone, et al., 2002) and seems to be equally susceptible to DBS

applied to the EPN or STN (Chapter 1). The first objective of the present study was

to verify whether DBS effects in the HAL VCM model are equivalent to chemical

inactivation of the same areas. To this end we compared the behavioral effects of

local muscimol infusions into the STN or EPN with those of DBS in these targets. A

second objective was to compare regional brain changes induced by STN-DBS to

those induced by EPN-DBS, using the immediate early gene zif268 as a marker of

neuronal activation (Cole, Saffen et al. 1989; Davis, Taub et al. 1997; Creed, Hamani

et al. 2011) and finally to compare zif268 activity maps after DBS to those obtained

after muscimol for each of the two anatomical targets.

67

2. Experimental Procedures

2.1 Subjects

Male Sprague-Dawley rats initially weighing 200–250 g (Charles River,

Quebec) (VEH = 27, HAL=54) were used for all experiments. All procedures were

approved by the Animal Care Committee at the Centre for Addiction and Mental

Health and complied with Canadian Council on Animal Care (CCAC) and NIH

standards and guidelines.

2.2 Experimental design

2.2.1 DBS Experiments.

Fifty-four rats were used in these experiments. Twenty-seven rats underwent

chronic HAL treatment prior to surgery, while the remaining twenty-seven received

vehicle treatment. Within each of these treatment groups, 10 animals underwent

electrode implantation into the STN, 10 had electrodes implanted in the EPN, and 7

underwent sham surgery. All animals were used for behavioural testing and zif268

analysis.

2.2.2 Muscimol infusion experiments

Eight-eight rats were used in these experiments. Of the 48 HAL-treated rats,

half had cannulae implanted above the STN, and half implanted above the EPN. Of

the 24 rats in each condition, half had muscimol infusions while the remaining half

had saline infusion only, and served as control groups for zif268 and behavioural

comparisons. Likewise, of the 40 VEH-treated rats, 20 were assigned to STN and

20 to the EPN-cannulae condition. Within each condition, 12 received muscimol

68

infusion, while 8 served as saline controls. Final group sizes after corrected for

misplaced cannulae and attrition are given in figures 13-16.

2.3 Drug treatment

After one week acclimation to the housing facility, rats were randomly

assigned to receive either haloperidol decanoate (HAL; 21 mg/kg i.m. N = 68) or

sesame oil vehicle (N = 22) as described in section 2 of the general methods.

2.4 VCM assessments

VCM assessments were conducted once a week in a quiet room, beginning

one week before the first HAL injection, as described in section 3 of the general

methods.

2.5 Surgical procedures

After 12 weeks of HAL treatment, rats were implanted with stimulating

electrodes, as described in section 4 of the general methods. We have previously

demonstrated that inert electrodes implanted in either the STN or EPN had no effect

on VCMs or other motor behaviour. Therefore in the present study, sham DBS

controls were anesthetized and had holes drilled into the skull but were not

implanted with electrodes. For infusion experiments, bilateral stainless steel guide

cannulae (C313G Guide 22 GA, Plastics One, Roanoke, VA) were implanted

bilaterally, immediately dorsal to the STN or EPN and secured to the skull with

dental cement.

69

2.6 DBS protocol

Starting 1 week after surgery DBS was applied using a handheld stimulator

(Model 6510, St Jude Medical, Plano, Texas) set to deliver a 100 μA current (130

Hz, 90 μs pulse width), as described in section 6 of the general methods. During the

DBS sessions, rats were initially given a 2-min acclimation period on the observation

pedestal followed by a 2-min baseline VCM assessment. Thereafter, DBS was

applied and VCMs were assessed immediately after DBS onset, and again after 30

and 60 minutes of continuous DBS. After 60 min of continuous stimulation, DBS

was turned off and animals were returned to their home cages.

2.7 Muscimol infusions

Starting 1 week after surgery, muscimol (1.0 µg dissolved in 0.2 µL

physiological saline; Sigma Aldrich, Oakville, CA) was infused at 0.1 µL/min using a

Hamilton syringe infusion pump. The cannula was left in situ for a further 2 minutes.

The dose and volume of muscimol was chosen based on previous studies that have

established behaviourally effective muscimol–induced inactivation of the STN

(Mehta et al., 2005) and EPN (Adachi, Hasegawa et al. 2002; Hamann, Sander et al.

2010). Spread of muscimol was determined in pilot studies using local infusion with

cresyl violet die to visualize the volume of tissue affected. Prior to the infusion, rats

were given a 2 minute adaptation period followed by a 2 minute baseline

assessment. VCMs were assessed immediately following muscimol infusion, and at

30 and 60 minutes after infusion. Controls underwent saline infusion. No gross

motor abnormalities were observed after either infusion.

70

2.8 In situ hybridization and densitometric analyses

Hybridization was performed using 35S-UTP labeled riboprobes

complementary to zif-268 according to Genbank # NM_012551, (bases 660-679), 5’-

tcacctatactggccgcttc-3’ and (bases 1062-1043) 5’- aggtctccctgttgttgtgg-3’ , as

described in section 7 of the general methods.

2.9 Verification of electrode and cannula placement

Following behavioral tests, rats were deeply anesthetized electrodes were

localized using cresyl violet staining (section 5 of the general methods). Sacrifice

occurred 75 minutes after onset of DBS or infusion of muscimol. Only animals with

bilateral electrode or cannula placements within the target nuclei (Fig. 12) were

included in the analyses.

2.10 Statistical analyses

Behavioral data were analyzed by repeated measures ANOVAs followed,

where appropriate, by paired or unpaired t tests with false discovery rate (FDR)

adjustments. Regional brain zif268 optical density measurements were first

analyzed by multivariate followed by univariate ANOVAs for each brain region

separately. FDR-adjusted post-hoc t tests were used for group comparisons, where

appropriate. Regression analysis between VCM behavior and zif268 expression in

discrete brain areas was also performed.

71

3. Results

3. 1 Effects on HAL on VCMs and zif268 expression

HAL induced VCMs over the course of 12 weeks, the levels of which

stabilized by approximately 8 weeks of treatment (General methodology, section 2,

Fig 2). Chronic HAL treatment by itself did not induce significant changes in zif268

levels in basal ganglia, except for modest increases in the dorsolateral caudate-

putamen and subthalamic nucleus (p < 0.05 )(Fig 10, 11). Regression analyses

revealed no significant relationship between zif268 expression in any specific brain

area and VCM behavior.

72

Basal ganglia

Motor Cortex

Thalamus

-50 -25 0 25 50 75 100 125 150 175 200

Cpu ACpu DLCpu DMCpu VMCPU VLCpu PVPEPNGPeSTNSNrSNcPPTg

Primary MCPrim MC-PostSecondary MCSec MC-Post

Thal ADThal AMThal AVThal CLThal CMThal LDDMThal LDVLThal MDThal PCThal PFThal PoThal PTThal PVAThal ReThal RhThal VL

% Change in zif268 levels HAL vs. VEH

*

**

*** **

*****

**

****** *

**

Basal ganglia

Motor Cortex

Thalamus

-50 -25 0 25 50 75 100 125 150 175 200



Thal ADThal AMThal AVThal CLThal CMThal LDDMThal LDVLThal MDThal PCThal PFThal PoThal PTThal PVAThal ReThal RhThal VL

% Change in zif268 levels HAL vs. VEH

*

**

*** **

*****

**

****** *

**

Figure 10. Effects of chronic HAL on zif268 levels. Changes in expression of

zif268 in the basal ganglia, thalamus-motor cortex circuit in HAL-treated rats is

shown relative to VEH-treated rats. HAL treatment tended to increase zif268

expression throughout the thalamus, and in the DL CPu and STN. *p<0.05,

**p<0.01, ***p<0.001.

73

Figure 11. Representative photomicrographs illustrating zif268 expression in a

vehicle- and a haloperidol-treated rat.

74

Figure 12. Localization of electrode and cannula tips. Schematic localization of

electrode (circles) and cannula (stars) placements for all animals included in the final

results. Note that animals with placements of one or both electrode or cannulae

outside the intended target were excluded from the analysis and are not shown.

Symbols are meant to represent only tip location, not the extent of tissue effects

induced by electrodes or cannulae. The number at the top of each panel

corresponds to distance from bregma in mm, according to the atlas of Paxinos and

Watson 1986 (reproduced with permission).

75

3.2 Effects of EPN manipulations on VCMs

As shown in Fig 13, EPN-DBS significantly reduced VCMs at all time points

compared to baseline (2 min: −49%, p=0.004; 30 min: −42%, p=0.003; 60 min:

−76%, p=0.001). Likewise, muscimol infusion into the EPN significantly reduced

VCMs at all time points (2 min = 33% p=0.012, 30 min = -42% p=0.016, 60 min = -

37%, p=0.010 Fig. 14). Across the entire 1 hr trial, the overall reduction observed

with EPN DBS was 56.8% ± 6.20 whereas the overall reduction after muscimol was

29.1% ± 7.17 (p < 0.007). Suppression of VCMs by DBS was significantly more

pronounced 60 minutes after intervention compared to muscimol infusion (p=0.007).

Interestingly, in rats that had not been treated with chronic HAL, both DBS and

muscimol infusions tended to increase VCMs, an effect which reached its highest

level at the 30 min time point in both cases.

76

0

2

4

6

8

10

12

Baseline 2 min 30 min 60 min

Num

ber o

f VC

Ms

***###

***###

***###

§

0

2

4

6

8

10

12


Num

ber o

f VC

Ms

***###

***###

***###

§

Figure 13. Effects of EPN-DBS on VCMs. DBS suppressed HAL-induced VCMs

at all time points relative to baseline and transiently induced VCMs in VEH-treated

rats after 30 minutes of stimulation. *** p > 0.01 in comparison with each animal’s

own baseline in HAL-treated rats (paired t tests). # p< 0.05; ### p <0.01 in

comparison with HAL-SHAM or HAL-SAL groups (independent t tests). § p < 0.05,

VEH-SHAM compared to VEH-EPN DBS at 30 min (independent t tests). Group Ns

are indicated in parenthesis.

77

0

2

4

6

8

10

12

14


Num

ber o

f VC

Ms

#

###

###

0

2

4

6

8

10

12

14


Num

ber o

f VC

Ms

#

###

###

Figure 14. Effects of EPN muscimol infusion on VCMs. Muscimol infusion

suppressed VCMs at all time points in HAL-treated rats and increased VCMs at 30

min in VEH-treated rats. *** p > 0.01 in comparison with each animal’s own

baseline in HAL-treated rats (paired t tests). # p< 0.05; ### p <0.01 in comparison

with HAL-SHAM or HAL-SAL groups (independent t tests). § p < 0.05, VEH-SHAM

compared to VEH-EPN DBS at 30 min (independent t tests). Group Ns are

indicated in parenthesis.

78

3.3 Effects of STN manipulations on VCMs

HAL-treated rats that received STN-DBS showed significant reductions in

VCM counts (Fig 15). Stimulation at each time point resulted in significant

decreases in VCMs compared to baseline (2 min: -72%, p=0.005, 30 min: -80%,

p=0.003, 60 min: -72%, p=0.009). Muscimol infusion into the STN also reduced

VCM counts at all time points (2 min: -39%, p=0.016, 30 min: -44%, p=0.006, 60

min: -467%, p=0.009, Fig. 16). Across the entire 1 hr trial the overall VCM reduction

observed with STN DBS was 69.8 ± 11.05%, whereas the reduction seen after

muscimol was 39.4 ± 5.15% (p < 0.007). Relative to muscimol infusion, the

suppression of VCMs by DBS was more pronounced at 2 and 30 minutes after

intervention (p=0.008, p=0.004, respectively. In VEH-treated rats, both DBS and

muscimol tended to increase VCMs 60 min after each manipulation, but this effect

did not reach statistical significance. Over the entire 1 hr observation period, STN-

DBS reduced VCMs to a greater extent than did EPN-DBS (p <0.05), with peak

differences occurring at the 30 minute time point (p=0.001). There were no

differences between STN and EPN muscimol-treated groups.

79

****

**

0

2

4

6

8

10

12


Num

ber o

f VC

Ms

***###

***###

***###

****

**

0

2

4

6

8

10

12


Num

ber o

f VC

Ms

***###

***###

***###

Figure 15. Effects of STN-DBS on VCMs. DBS suppressed HAL-induced VCMs

at all time points. * p <0/05; *** p>0.01 in comparison with baseline in HAL-treated

rats; ### p <0.01 in comparison with HAL-SHAM animals. Group Ns are indicated

in parenthesis.

80

0

2

4

6

8

10

12

14


Num

ber o

f VC

Ms

###### ###*

§

0

2

4

6

8

10

12

14


Num

ber o

f VC

Ms

###### ###*

§

Figure 16. Effects of STN muscimol infusions on VCMs. Muscimol infusion

suppressed at all time points but to a lesser extent than that seen with DBS. * p

<0/05; *** p>0.01 in comparison with baseline in HAL-treated rats; ### p <0.01 in

comparison with HAL-SAL animals. Group Ns are indicated in parenthesis.

81

3.4 Effect of EPN manipulations on zif268 expression

In VEH treated animals, EPN-DBS increased zif268 levels in most areas

examined (Fig 17). This increase was significant in the dorsolateral CPu (35%,

p=0.018) and STN (30%, p=0.015). In HAL-treated rats (Fig 18), EPN-DBS

increased zif268 expression in the GP (65%, p=0.003), SNr (76%, p=0.014) and

SNc (62%, p=0.009), while decreasing zif268 expression in the VP (-34%, p=0.004).

In VEH-treated animals, muscimol infusion into the EPN significantly

increased zif268 expression in most basal ganglia areas, similarly to, but to a higher

extent than the changes observed with DBS (Fig 19).

In HAL-treated rats the effects of muscimol (Fig 20) were different from the

effects seen in VEH rats. While in VEH-treated animals muscimol infusion elevated

zif268 expression in most subdivisions of the CPu, there were no changes in CPu in

HAL-treated rats. In VEH-treated rats, muscimol induced significant increases in the

SNr and SNc, whereas in HAL-treated rats it decreased zif268 expression in these

areas (Fig 20).

In the motor cortex and thalamus, both muscimol infusion and DBS increased

zif268 expression in VEH-treated rats (Fig. 21 and 23), whereas in HAL-treated rats

a general trend towards decreasing zif268 levels was seen after both DBS and

muscimol (Fig. 22 and 24). Although thalamic effects were generally of the same

magnitude in DBS and muscimol treated rats, statistical significance was only seen

with DBS, apparently owing to smaller variability in DBS vs. muscimol treated

groups.

82

-100 -50 0 50 100


% Change Relative to Control

****

******************

-100 -50 0 50 100



****

******************

Figure 17. Effects of EPN-DBS on zif268 levels in the basal ganglia of VEH-

treated rats. In VEH- treated animals, EPN-DBS increased zif268 expression in

most areas examined. Statistical comparisons refer to adjusted t tests comparing %

change from the appropriate non-stimulated or saline-infused control, following

ANOVAS for each brain region. * p < 0.5; ** p < 0.02; *** p <0.01.

83

-100 -50 0 50 100



***

***

******

-100 -50 0 50 100



***

***

******

Figure 18. Effects of EPN-DBS on zif268 levels in the basal ganglia of HAL-

treated rats. In HAL-treated rats, EPN-DBS increased zif268 expression in the

GPe, SNr and SNc, and decreased zif268 expression in the VP. Statistical

comparisons refer to adjusted t tests comparing % change from the appropriate non-

stimulated or saline-infused control, following ANOVAS for each brain region. * p <

0.5; ** p < 0.02; *** p <0.01.

84

-100 -50 0 50 100

Cpu ACpu DLCpu DMCpu VMCPU VLCpu PVPEPNGpeSTNSNrSNcPPTg


******

********

***

*

***

***

******

-100 -50 0 50 100



******

********

***

*

***

***

******

Figure 19. Effects of EPN muscimol infusions on the expression of zif268 in

the basal ganglia of VEH-treated rats. Muscimol infusion into the EPN increased

zif268 in most areas in VEH-treated rats. Statistical comparisons refer to adjusted t

tests comparing % change from the appropriate non-stimulated or saline-infused

control, following ANOVAS for each brain region. * p < 0.5; ** p < 0.02; *** p

<0.01.

85

-100 -50 0 50 100



*****

-100 -50 0 50 100



*****

Figure 20. Effects of EPN muscimol on the expression of zif268 in the basal

ganglia of HAL-treated rats. In HAL-treated animals muscimol did not significantly

change zif268 levels in caudate putamen areas and significantly reduced these

levels in other areas. Statistical comparisons refer to adjusted t tests comparing %

change from the appropriate non-stimulated or saline-infused control, following

ANOVAS for each brain region. * p < 0.5; ** p < 0.02; *** p <0.01.

86

-100 -50 0 50 100 150


Thal ADThal AMThal AVThal CLThal CMThal LDDMThal LDVLThal MDThal PCThal PFThal PoThal PTThal PVAThal ReThal RhThal VLThal VMThal VP

% Change from Control

*******

** ***

***

Figure 21. Effects of EPN-DBS on zif268 levels in the motor cortex and

thalamus of VEH-treated rats. In VEH-treated rats, DBS generally increased

zif268 expression. *p < 0.5; **p < 0.02; ***p < 0.01, t tests comparing % change from

the appropriate non-stimulated or saline-infused control mean following ANOVAS for

each brain region.

87

-100 -50 0 50 100 150 200


Thal ADThal AMThal AVThal CLThal CMThal LDDMThal MDThal PCThal PFThal PoThal PTThal PVAThal ReThal RhThal VLThal VM


******

******

******

***

*****

*

-100 -50 0 50 100 150 200




******

******

******

***

*****

*

Figure 22. Effects of EPN muscimol infusions on zif268 levels in the motor

cortex and thalamus of VEH-treated rats. In VEH-treated rats, muscimol infusion

tended to increase zif268 expression. *p < 0.5; **p < 0.02; ***p < 0.01, t tests

comparing % change from the appropriate non-stimulated or saline-infused control

mean following ANOVAS for each brain region.

88

-100 -50 0 50 100 150




*** ***

***

-100 -50 0 50 100 150




*** ***

***

Figure 23. Effects of EPN-DBS on zif268 levels in the motor cortex and

thalamus of HAL-treated rats. In HAL-treated rats a general trend towards

decreasing zif268 levels was seen after DBS. *p < 0.5; **p < 0.02; ***p < 0.01, t tests

comparing % change from the appropriate non-stimulated or saline-infused control

mean following ANOVAS for each brain region.

89

-100 -50 0 50 100




***

-100 -50 0 50 100




***

Figure 24. Effects of EPN muscimol infusions on zif268 levels in the motor

cortex and thalamus of HAL-treated rats. In HAL-treated rats, a general trend

towards decreasing zif268 levels was seen after muscimol infusion. *p < 0.5;

**p < 0.02; ***p < 0.01, t tests comparing% change from the appropriate non-

stimulated or saline-infused control mean following ANOVAS for each brain region.

90

3.5 Effect of STN manipulations on zif268 expression

In VEH-treated animals, STN-DBS reduced zif268 expression in the posterior

CPu (-27%, p=0.005), EPN (-92%, p<0.001), GPe (-99%, p<0.001), STN (-25%,

p=0.033), SNr (-99%, p<0.001) and SNc (-89%, p<0.001) (Fig 25). A similar general

trend toward decreased zif268 was seen after muscimol infusions in VEH rats (Fig

26), although these were of lesser magnitude than the DBS effects and did not reach

statistical significance. In HAL-treated rats, STN-DBS resulted in strong and

consistent decreases in zif268 levels in all basal ganglia regions (Fig 28).

In VEH rats, STN-DBS tended to increase zif268 expression throughout the

motor cortex and thalamus, although some thalamic nuclei showed modest

decreases (Fig. 29). Muscimol data followed a similar but less consistent pattern

(Fig. 30). In HAL-treated rats DBS had no clear effects on motor cortical regions, but

consistently reduced zif268 levels in thalamic nuclei (Fig. 31). The pattern observed

after muscimol infusions was in the opposite direction, with small to moderate

increases in zif268 levels seen in most thalamic nuclei (Fig. 32).

91

-100 -50 0 50 100



**

***

******

*********

**

-100 -50 0 50 100



**

***

******

*********

**

Figure 25. Effects of STN-DBS on zif268 expression in the basal ganglia of

VEH-treated rats. In VEH- treated animals, STN-DBS increased zif268 expression

in most areas examined. Statistical comparisons refer to adjusted t tests comparing

% change from the appropriate non-stimulated or saline-infused control mean

following ANOVAS for each brain region. * p < 0.5; ** p < 0.02; *** p <0.01.

92

-100 -50 0 50 100


% Change Relative to Control-100 -50 0 50 100



Figure 26. Effects of STN muscimol infusions on zif268 expression in the

basal ganglia of VEH-treated rats. In HAL-treated rats, STN-DBS increased zif268

expression consistently decreased zif268 expression in all areas. Statistical



* p < 0.5; ** p < 0.02; *** p <0.01.

93

-100 -50 0 50 100



******

******

***

******

******

******

*

***

-100 -50 0 50 100



******

******

***

******

******

******

*

***

Figure 27. Effects of STN-DBS on zif268 expression in the basal ganglia of

HAL-treated rats. In HAL-treated rats, STN DBS increased zif268 expression

consistently decreased zif268 expression in all areas. Statistical comparisons refer

to adjusted t tests comparing % change from the appropriate non-stimulated or

saline-infused control mean following ANOVAS for each brain region. * p < 0.5; **

p < 0.02; *** p <0.01.

94

-100 -50 0 50 100

CPu A CPu DL CPu DM CPu VM CPu VL CPu P VP EPN GPeSTN SNrSNcPPTg


***

-100 -50 0 50 100

CPu A CPu DL CPu DM CPu VM CPu VL CPu P VP EPN GPeSTN SNrSNcPPTg


***

Figure 28. Effects of STN muscimol infusions on zif268 expression in the

basal ganglia of HAL-treated rats. In HAL-treated animals muscimol did not

significantly change zif268 levels, except for a 70% increase in the PPTg. Statistical



* p < 0.5; ** p < 0.02; *** p <0.01.

95

-100 -50 0 50 100




****

**

***

**

-100 -50 0 50 100




****

**

***

**

Figure 29. Effects of STN-DBS on zif268 levels in the motor cortex and

thalamus in VEH-treated rats. In VEH-treated rats DBS increased zif268 signals in

the motor cortex and in several thalamic nuclei. *p < 0.5; **p < 0.02; ***p < 0.01, t

tests comparing % change from the appropriate non-stimulated or saline-infused

control mean following ANOVAS for each brain region.

96

-100 -50 0 50 100




****

**

***

**

-100 -50 0 50 100




****

**

***

**

Figure 30. Effects of STN muscimol infusions on zif268 levels in the motor

cortex and thalamus in VEH-treated rats. Muscimol infusions in VEH rats resulted

in inconsistent and variable patterns on zif268 expression, although small to

moderate increases in zif268 levels seen in most thalamic nuclei.*p < 0.5; **p < 0.02;

***p < 0.01, t tests comparing % change from the appropriate non-stimulated or

saline-infused control mean following ANOVAS for each brain region.

97

-100 -50 0 50




***

******

******

***

*****

-100 -50 0 50




***

******

******

***

*****

Figure 31. Effects of STN-DBS on zif268 levels in the motor cortex and

thalamus in HAL-treated rats. In HAL-treated rats, STN-DBS had no clear effects

on motor cortex, but consistently reduced zif268 levels in thalamic nuclei. *p < 0.5;

**p < 0.02; ***p < 0.01, t tests comparing % change from the appropriate non-


98

-100 -50 0 50




***

******

******

***

*****

-100 -50 0 50




***

******

******

***

*****

Figure 32. Effects of STN muscimol infusions on zif268 levels in the motor

cortex and thalamus in HAL-treated rats. In HAL treated rats muscimol infusion

into the STN induced effects that were in the opposite direction to those seen with

DBS (Fig 29), with small to moderate increases in zif268 levels seen in most

thalamic nuclei. *p < 0.5; **p < 0.02; ***p < 0.01, t tests comparing % change from

the appropriate non-stimulated or saline-infused control mean following ANOVAS for

each brain region.

99

4. Discussion

Recently DBS has been demonstrated to reduce antipsychotic induced

dyskinesias both in patients (Eltahawy, Feinstein et al. 2004; Schrader, Peschel et

al. 2004; Damier, Thobois et al. 2007; Sun, Chen et al. 2007) and in animal models

(Degos, Deniau et al. 2005; Creed, Hamani et al. 2011). Despite its demonstrated

clinical effectiveness in movement disorders, the mechanisms by which DBS exerts

its effects remain largely unknown. In this study, we tested the hypothesis that DBS

is functionally equivalent to chemical inactivation in a rodent model of TD, by

comparing the effects of DBS to those of chemical inactivation on two basal ganglia

targets, the EPN and the STN. Our results indicate that the suppression of VCMs by

DBS applied to either the EPN or the STN was significantly more pronounced than

the suppression achieved by chemical inactivation of the same nuclei (Fig 13-16).

As expected, chronic haloperidol led to high and stable VCM levels in the

course of 12 weeks (Fig 2). VCMs were countered by DBS and by muscimol

infusion, an observation that is in line with reported effects of both DBS and

radiofrequency lesions of the STN and GPi in TD (Wang, Turnbull et al. 1997;

Lenders, Buschman et al. 2005; Damier, Thobois et al. 2007; Sun, Chen et al.

2007). However, some important differences were found between DBS and

muscimol manipulations and between the two anatomical targets.

DBS applied to the EPN suppressed HAL-induced VCMs as soon as

stimulation was switched on, and VCMs were further suppressed after 60 minutes of

continuous DBS. Likewise, muscimol infusion into the EPN caused an immediate

and sustained reduction in VCMs, whereas saline infusion had no effect. In VEH-

treated rats, DBS caused a transient increase in VCMs, which was not observed

100

with muscimol infusion. Our DBS results in the EPN are in agreement with previous

reports that DBS of the EPN suppresses motor symptoms in animal models of TD

(Chapter 1) and dystonia (Harnack et al., 2004).

Similarly, DBS or muscimol applied to the STN also decreased HAL-induced

VCMs. However, in the STN the effects of DBS were more pronounced than those

of muscimol infusion, suggesting that while tissue inactivation may have beneficial

effects, its does fully account for the effects of STN-DBS. Interestingly, both DBS

and muscimol applied to the STN in VEH-treated rats caused a slight but significant

induction of VCMs 60 min later. This is consistent with previously reported effects of

muscimol and DBS applied to this region in normal control rats (Mehta and

Chesselet, 2005), see Chapter 1.

Having determined that chemical inactivation and DBS have qualitatively

similar effects on VCM behavior, we examined patterns of neuronal activity induced

by each experimental manipulation, as measured by expression of the immediate

early gene, zif268. HAL-treated rats exhibited higher levels of zif268 in the DL-CPu

and STN, relative to VEH-treated rats. The elevated expression in the DL-CPu is

consistent with the known effects of acute HAL treatment on immediate early gene

expression (MacGibbon, Lawlor et al. 1994; Robertson, Matsumura et al. 1994). On

the other hand, up-regulation of zif268 expression in the STN has not been

previously reported. Current models of basal ganglia functioning suggest that

chronic antagonism of dopamine D2 receptors by HAL could be expected to result in

increased activity of the indirect striatal output pathway, including activation of the

STN.

101

The STN is one of the pace-making centers of the basal ganglia, and sends

excitatory projections to basal ganglia output nuclei and the GP (Plenz and Kital

1999; Nambu, Tokuno et al. 2002; Hamani, Saint-Cyr et al. 2004). We therefore

expected that STN inactivation would decrease activity throughout the basal ganglia.

Consistent with this hypothesis, both muscimol and DBS applied to the STN

decreased zif268 expression in most basal ganglia structures, although this was

more pronounced after DBS (Fig 25-28). Computational modeling has posited that

DBS may alter pathological network activity throughout the entire basal ganglia

circuitry (Vitek, 2008). We suggest that effects of DBS on structures distal from the

target site may have contributed to the more pronounced effects of STN DBS

relative to the effects of chemical inactivation of the STN.

Interactions between HAL treatment and the two types of brain manipulations

were reflected on zif268 expression patterns, and were more pronounced in the EPN

than in the STN. In VEH-treated animals, both muscimol injections and DBS applied

to the EPN tended to elevate zif268 expression in the basal ganglia (Fig 17, 19).

However, in HAL-treated rats, EPN-DBS increased zif268 expression in the GP and

SNr, whereas EPN muscimol infusion had the opposite effect, decreasing zif268

expression in SNc and SNr (Fig 18, 20). This finding may be related to the proximity

and anatomical connectivity between the EPN and SNr, the two primary basal

ganglia output nuclei. Muscimol-induced decreases in zif268 levels in EPN and SNr

could be due to the proximity of the two structures, which are anatomically distinct

but are commonly considered to be a functional unit due to similar cell composition

and inputs (Lafreniere-Roula et al., 2010). By contrast, EPN-DBS induced increases

in zif268 expression in the SNr may suggest a decrease in inhibitory input from the

102

EPN, increased synaptic excitation at terminal fields of the EPN in the SNr, or

compensatory up-regulation since both structures are basal ganglia output stations.

To our knowledge, this is the first study to compare muscimol infusion and

DBS in the VCM model of TD. Generally, the effects of muscimol infusion on VCM

behavior and zif268 expression are consistent with the known effects of ablation of

these structures. We have chosen to use muscimol infusion rather than physical

ablation to achieve functional inactivation without the associated tissue damage,

inflammation and possible compensatory plasticity that may be associated with

lesioning (Padberg et al., 2010). We also took into account the fact that changes in

zif268 levels are time dependent, with peak expression occurring 60 min after the

stimulus (Chaudhuri, Zangenehpour et al. 2000; Bozon, Davis et al. 2002; Farivar,

Zangenehpour et al. 2004). Acute infusions of muscimol in awake, freely moving

rats allowed us to accurately quantify gene expression within a time window that was

relevant for assessing the motor effects of inactivation.

Our findings are consistent with previous studies in drug-naïve rats, in which

STN- and GP-DBS has been shown to suppress activity of local neurons

(Benazzouz and Hallett 2000; Chin and Hutchison 2008). Our results are also in line

with clinical studies that have used functional neuroimaging to explore DBS-induced

changes in brain metabolism. Clinically, STN-DBS and ablation have been

associated with decreased activity of basal ganglia nuclei (Su et al., 2001). Results

from our HAL-treated rats suggest a functional interaction between EPN DBS-

induced changes and HAL-treatment. Clinically, altered metabolism of the basal

ganglia has not been reported in patients with TD (Waddington, O'Callaghan et al.

1995; Szymanski, Gur et al. 1996; Khiat, Kuznetsov et al. 2008), while our results

103

suggest increased basal activity of the STN and DLCPu. One possible explanation

for the discrepancy between our zif268 results and clinical imaging studies is the

relatively low volume of tissue activated, which may not be easily detectable in

humans using conventional neuroimaging methods (Fukuda, Mentis et al. 2001;

Fukuda, Mentis et al. 2001). Moreover, in clinical studies, HAL-induced motor

symptoms are necessarily examined in patients with underlying schizophrenia-

associated brain abnormalities (Vita and De Peri, 2007), and it is not always possible

to isolate the effects of chronic antipsychotic treatment from brain effects associated

with schizophrenia. In the preclinical VCM model, HAL is administered to otherwise

healthy rats, which eliminates confounding schizophrenia-associated pathology.

This study demonstrates the usefulness of early gene mapping in

investigating the effects of focal DBS or muscimol in several brain regions

simultaneously. Zif268 is transcribed in response to calcium influx and, as such, is a

strong indicator of neuronal activity (Chaudhuri 1997; Chaudhuri, Zangenehpour et

al. 2000; Farivar, Zangenehpour et al. 2004; Burkhardt, Constantinidis et al. 2007;

Lee, Verhagen Metman et al. 2007). However, it remains an indirect marker of

neuronal activation. It has been suggested that altered firing pattern of neurons

within the basal ganglia may be a signature of dyskinesias (Burkhardt,

Constantinidis et al. 2007; Lee, Verhagen Metman et al. 2007) and in this regard it is

important to note that examination of zif268 expression does not provide information

about temporal firing rates. Further, several of brain regions examined in this study

are highly heterogeneous, composed of multiple cell types that are functionally

distinct. It will be of interest for future studies to identify neurochemical identities of

cells in brain areas affected by STN and EPN interventions.

104

In summary, we have found that the behavioral effects of DBS in the HAL-

induced VCM model are not fully reproduced by tissue inactivation with muscimol.

Our results further indicate that chronic HAL alters regional zif268 levels, which are

in turn modified by DBS or muscimol applied to either the STN or EPN. These

effects however differed in the two target regions. While the overall effect of STN

DBS was to decrease activity in the basal ganglia circuitry, the effects of EPN-DBS

were generally more restricted to afferent and efferent projection areas from the

target nucleus. The divergent effects of STN vs. EPN manipulations on HAL-

induced zif268 changes suggest that similar behavioral outcomes of DBS in these

two areas may involve different neuroanatomical mechanisms.

105

5. Statement of Significance. Results from this study determined that while

chemical inactivation can mimic the anti-dyskinetic effects of DBS, DBS and

chemical inactivation differentially affect neuronal activity throughout the basal

ganglia-thalamo-cortical loop, as measured by zif268 expression. Moreover, we

observed that while STN-DBS generally decreases zif268 expression in this circuit,

the effects of EPN-DBS are most pronounced in projection areas. This suggests

that DBS is not simply equivalent to functional inactivation, and suggests that EPN-

and STN-DBS may be working through different mechanisms in this model of TD.

106

CHAPTER 3 Question 3. Contribution of 5-HT to the motor effects of DBS

Portions of this work have been published as:

Creed-Carson MC, Oraha A, Nobrega JN. Effects of 5-HT2A and 5-

HT2C receptor antagonists on acute and chronic dyskinetic effects

induced by haloperidol in rats. Behavioural Brain Research, Volume

219, Issue 2, June 2011, pages 273-279.


Experimental work and data analyses was conducted by MC and AO.

All experiments were designed by JN. JN and MC wrote the manuscript.

Creed MC, Hamani C, Bridgman A, Fletcher PJ, Nobrega JN.

Contribution of decreased serotonin release to the antidyskinetic

effects of deep brain stimulation in a rodent model of tardive

dyskinesia: comparison of the subthalamic and entopeduncular nuclei.

Journal of Neuroscience (In press).



and data analyses were conducted by MC. AB assisted with

microdialysis sample collection and selected film reading, PF provided

access to and training for microdialysis equipment. JN and MC wrote

the manuscript. CH reviewed the manuscript and gave expert opinion.

107

1. Introduction

We have demonstrated that DBS of the STN or EPN (the rodent homologue

of the GPi) effectively suppresses HAL-induced VCMs (Chapter 1). However,

despite its widespread clinical application in movement disorders, the mechanisms

underlying the antidyskinetic effects of DBS remain largely unknown. We have

shown that STN- and EPN-DBS influence activity in a variety of brain regions at sites

distal from the stimulation target (Chapter 2), an observation that has also been

made in the clinic (Su, Ma et al. 2001; Breit, Schulz et al. 2004; Schulte, Brecht et al.

2006; Damier, Thobois et al. 2007). DBS also effects several neurotransmitter

systems (Lee, Blaha et al. 2006; Covey and Garris 2009; Navailles, Benazzouz et al.

2010; Feuerstein, Kammerer et al. 2011; Sgambato-Faure and Cenci 2012).

Several lines of evidence implicate the serotonin (5-HT) system in the

symptoms of TD and in the effects of STN-DBS. 5-HT provides extensive

innervation to the basal ganglia where it modulates dopamine neurotransmission

(Alex and Pehek 2007; Di Matteo, Pierucci et al. 2008). The lower incidence of TD

associated with atypical antipsychotics has been ascribed to their 5-HT2 receptor

antagonistm (Meltzer and Nash 1991; Kapur, Zipursky et al. 1999; Stahl 1999), and

antagonism of 5-HT2 receptors suppresses VCMs in rats (Naidu and Kulkarni 2001;

Kostrzewa, Huang et al. 2007). Moreover, symptoms of TD can be exacerbated by

concomitant treatment with selective serotonin re-uptake inhibitors (SSRIs) which

increase synaptic 5-HT levels (Ketai 1993; D'Souza, Bennett et al. 1994; Dubovsky

and Thomas 1996; Sandler 1996; Lauterbach and Shillcutt 1997; Caley 1998).

While the effect of EPN-DBS on 5-HT activity has not been examined, STN-DBS has

been shown to inhibit firing of serotonergic neurons in the dorsal raphe (Temel,

108

Blokland et al. 2005; Temel, Boothman et al. 2007; Hartung, Tan et al. 2011), to

decrease 5-HT release in the hippocampus and prefrontal cortex (Navailles,

Benazzouz et al. 2010) and to counter the motor effects of 5-HT agonists

(Hameleers, Blokland et al. 2007). The objective of the present study was to

examine the possible contribution of the serotonin system to the motor effects of

DBS in the HAL-induced VCM model of TD.

109


2.1 Drug Treatment

Male Sprague–Dawley rats initially weighing 200–250 g (Charles River, Quebec)

received either haloperidol decanoate (HAL, Sandoz Canada, Boucherville, Quebec;

21 mg/kg i.m. N = 68) or sesame oil vehicle (N = 22) as described in section 2 of the

general methods.

2.2 Vacuous chewing movement assessments

VCM assessments were conducted once a week in a quiet room, beginning 1 week

before the first HAL injection as described in section 3 of the general methods.

2.3 VCM assessment in the presence of serotonergic drugs

Each subject was tested after administration of saline or the drug of interest in a

randomized cross-over design by an experimenter blind to treatment group.

Separate groups of rats were administered fluoxetine hydrochloride (Tocris

Bioscience, Ellisville, MO) 10 mg/kg, i.p., (+)-fenfluramine hydrochloride (Sigma-

Aldrich., Oakville, Ontario) 1 mg/kg, i.p. 1 hour prior to VCM assessments. 2,5-

dimethoxy-4-iodoamphetamine (DOI, Sigma-Aldrich, Oakville, Ontario) at a dose of

0.1 mg/kg i.p. was administered 30 minutes prior to VCM assessments. In a

separate group of experiments, 8-hydroxy-DPAT-hydrobromide (8-OH-DPAT, Tocris

Bioscience, Ellisville, MO) dissolved in saline was administered via tail-vein injection

at a dose of 5 μg/kg. VCMs were observed for four minutes after 8-OH-DPAT

administration. Ketanserin was purchased from Tocris (Burlington, Canada) and

M100,907 ((R)-(2,3-dimethoxyphenyl)-[1-[2-(4-fluorophenyl)ethyl]-4-

110

piperidyl]methanol) and SB242,054 (6-choloro-5-methyl-1-[2-(2-methylpyid-5-yl

carbonyl] iodine) from Sigma-Aldrich (Oakville, Canada). Doses for M100,907 (0.5

mg/kg, i.p) and SB242,084 (0.5 mg/kg) were carefully chosen on the basis of

previous work demonstrating their respective ability to effectively block 5-HT2A and

2C-dependent behaviour (Fletcher, 1995) while minimizing effects at non-target 5-

HT2 subtypes in each case.

2.4 Surgery

After 12 weeks of HAL treatment, rats were anesthetized with ketamine/xylazine

(100/7.5 mg/kg i.p.) and underwent electrode implantation as described in section 4

of the general methods. Sham surgery controls were anesthetized and had holes

drilled into the skull but were not implanted with electrodes.

2.5 DBS Protocol

Starting 1 week after surgery DBS was applied using a portable stimulator (St Jude

Medical, Model 6510, Plano, Texas) as described in section 6 of the general

methods.

2.6 Open field tests

After completion of VCM assessments, locomotor activity was assessed in an open

field. Rats were placed in automated activity chambers (Med Associates, St.

Albans, VT) for a 2-min acclimation period before the onset of DBS (for animals

implanted with electrodes). Horizontal activity was then recorded for 15 min during

111

130 Hz DBS, following which rats were returned to the home cage. Animals without

electrodes were also monitored in the activity chamber for 15 min.

2.7 In Situ Hybridization

Hybridization was performed using 35S-UTP labeled riboprobes complementary to

zif-268 according to Genbank # NM_012551, (bases 660-679), 5’-

tcacctatactggccgcttc-3’ and (bases 1062-1043) 5’- aggtctccctgttgttgtgg-3’ and

consensus promoter sequences for either SP6 RNA polymerase. Full details of the

in situ hybridization procedure are described in section 7 of the general methods.

2.8 Microdialysis

For microdialysis experiments, a guide cannula was implanted into the dorsolateral

caudate-putamen (CPu; AP +1.4 mm; ML + 2.4 mm; DV -3.0 mm) during electrode

insertion surgery. After one week of recovery, a microdialysis probe (MAB4.15.4 -4

mm membrane, Scientific Products, North York, ON) was inserted into the target and

perfused with Ringer's solution at a constant flow rate of 0.7 μL/min (microinjection

pump, Hamilton, West Lafayette, Indiana). Following an equilibration period of 5

hours, dialysate samples were collected every 12 min. Baseline levels were defined

as an average of the first five samples collected. DBS was then delivered for one

hour during collection, followed by 96 minutes of recovery. In some experiments,

fluoxetine or fenfluramine were administered 1h prior to DBS onset. Samples were

analyzed in real time using an Antec Leyden LC110 Alexys HPLC system coupled to

a Decade-II electrochemical detection cell (ATS Scientific Inc, Burlington ON).

112

2.9 5,7-dihydroxytryptamine lesions

Procedures were adapted from Fletcher PJ, 1995 (Fletcher, 1995). Rats were

injected i.p. with 10mg/kg desipramine-HCl (sigma) 30 minutes prior to being

anaesthetized with isoflurane. A 30 gauge needle was lowered into the intended

raphe site and 3ug 5,7-dihydroxytryptamine creatine sulphate (5,7-DHT, Sigma)

dissolved in 1% ascorbic acid was injected. Dose refers to the free base. For

combined raphe lesions, the needle was lowered to the MRN (AP -8.0 mm, ML 0

mm, DV -8.0mm) and 2µL of 5,7-DHT was infused over 4 min. The needle was left

in place for a further 2 min, then raised to the DRN (AP -8.0 mm, ML 0 mm, DV -

6.0mm), where the procedure was repeated. For specific lesions of the DRN or

MRN, the needle was lowered to the appropriate site and 0.75µl 5,7-DHT was

infused over 2 minutes; the needle was left in situ for a further 2 min.

2.10 Confirmation of Serotonin Lesions

Serotonin depleting lesions were confirmed using HPLC to determine concentrations

5-HT and its metabolite 5-HIAA. In addition, 11C-DASB binding to the 5-HT

transporter was used to assess 5-HT terminal integrity in smaller areas of the same

brains. Rats were injected with an overdose of pentobarbital before decapitation

and brain extraction. Brains were bisected sagitally off-center from the midline.

Dorsolateral CPu and hippocampus were dissected from the smaller hemisphere,

flash-frozen and stored at -80°C HPLC, whereas the larger hemisphere was flash-

frozen intact for C11-DASB autoradiography.

113

C11-DASB autoradiography

Coronal cryostat sections (20 μm) were cut and thaw-mounted onto Superfrost

slides (Fisher Scientific, Ottawa, ON, Canada). Slides were pre-incubated at 4°C for

20min in buffer containing 0.05M Tris, 0.05M NaCl and 5mM KCl, pH=7.4, before

being transferred to room temperature buffer containing 4nM C11-DASB freshly

synthesized at the CAMH PET Centre for 10 minutes. Non-specific binding was

determined by displacement with 10μM paroxetine. Slides were rinsed for five 60

second intervals in 4°C buffer, dipped in milliQ water for 10 seconds, dried with cool

air and immediately exposed to Kodak Biomax film for 24 hours.

Densitometric analysis was performed using MCID software (InterFocus,

Leiton, UK). A standard curve relating optical density to known quantities of 11 C]

DASB (μCi/g) was created. For any subject, the final binding value for any given

brain region represented an average of multiple readings on 5 brain sections. Brain

regions were defined according to the atlas of Paxinos and Watson (Paxinos and

Watson, 1998). Binding values were averaged for each region and then for each

subject, and group means were compared independently for each of the regions

sampled.

HPLC analyses

Following behavioral tests, lesions were confirmed using HPLC (SP8000 with

25cmx2.6 mm Spherisorb ODS2 column, Spectra Physics) coupled to an ESA

Coulochem II electrochemical detector to measure concentration of 5-HT and its

principal metabolite, 5-hydroxindoleacetic acid (5-HIIA) according to a previously

published method (Wilson et al., 1994). Briefly, samples were injected into a six port

Rheodyne valve fitted with a 100 μL loop. The mobile phase was composed of 0.1M

114

sodium acetate buffer (pH 3.9) containing 130mg/L of octane sulfonate and 3%

methanol, with a flow rate of 1ml/min. Tissue was weighed and sonicated in 1.0ml

ice-cold H2O, then spiked with (100μl 1.0N percholoric acid containing 2μM sodium

bisulfite) before resonification. Samples were centrifuged at 35000x g for 30 min,

the supernatant was removed, filtered (0.45μm) and injected into the column. For

quantification, every third sample was spiked with a cocktail containing standard

amounts of each of the compounds being measured.

2.11 Verification of electrode placement

Cresyl violet staining was used to confirm electrode placement as described in

section 5 of the general methods. Only rats with electrode tips in the STN or EPN

were included in the analyses.

2.12 Statistical Analyses

All analyses were performed using SPSS version 19. VCM results were analyzed

using repeated measures ANOVA followed by Tukey’s post-hoc tests where

appropriate. Data from 8-OH-DPAT experiments were analyzed using paired t tests.

Raphe lesion data were analyzed with one-way repeated measures ANOVA.

Microdialysis data were analyzed using repeated measures ANOVA with treatment

and target as independent factors.

115

3. Results

3.1 Effect of 5,7-DHT lesions on VCMs: confirmation of 5,7-DHT lesions

To determine the effects of decreasing brain 5-HT on HAL-induced VCMs, we

performed 5,-7-DHT lesions in HAL-treated rats. Lesions were confirmed using

HPLC to measure striatal and hippocampal 5-HT content (Fig 33), and by [11C]DASB

autoradiography (Fig 34). Relative to sham-lesioned animals, dorsolateral CPu 5-

HT levels were significantly lower in rats with lesions to the DRN (-36.7%, p<0.0001)

and combined DRN+MRN lesions (-52.5%, P=0.003). Levels of 5-HT in the

hippocampus were significantly decreased in MRN- (-44.4%, p=0.011) and dual-

lesioned rats (-50.5%, p=0.008). In terms of [11C]DASB autoradiography, binding

was decreased in the DRN and dorsolateral CPu of DRN-lesioned animals (DL CPu:

-51.2% , p=0.022, DRN: -73.1%, p<0.0001), while decreased binding in the HC and

MRN was observed in MRN-lesioned animals (HC: -77.7%, p<0.0001, MRN: -72.9%,

p<0.0001). Rats with dual MRN+DRN lesions exhibited decreased binding in all

regions examined (DL CPu: -69.6%, p=0.001, HC: -66.1%, p=0.004, DRN: -68.2%,

p<0.0001, MRN: -69.6%, p<0.0001).

116

Figure 33. Confirmation of 5,7-DHT lesions with HPLC. 5,7-DHT lesions were

confirmed my measuring 5-HT concentration. Rats with lesions of the DRN

exhibited decreased [5-HT] in the DL CPu, whereas MRN-lesioned animals

had lower [5-HT] in the hippocampus. Animals with dual lesions of the DRN

and MRN had decreased [5-HT] in both regions measured. *p<0.01,

**p<0.001

117

0

2

4

6

8

10

12

14

16

18

DRL MRL CPu HCBrain Region

C11

-DA

SB

bin

ding

SHAMDRLMRLDRL + MRL

SHAMDRLMRLDRL + MRL

** ** ** ** *

** ***

SHAMDRNMRNDRN + MRN

DRN MRN0

2

4

6

8

10

12

14

16

18


C11

-DA

SB

bin

ding

SHAMDRLMRLDRL + MRL

SHAMDRLMRLDRL + MRL

0

2

4

6

8

10

12

14

16

18


C11

-DA

SB

bin

ding

SHAMDRLMRLDRL + MRL

SHAMDRLMRLDRL + MRL

** ** ** ** *

** ***

SHAMDRNMRNDRN + MRN

DRN MRN

Figure 34. Confirmation of 5,7-DHT lesions with C11-DASB binding. 5,7-DHT

lesions were confirmed my measuring 5-HT transporter (SERT) binding using

11 C -DASB autoradiography. Rats with DRN lesions exhibited decreased

binding in the DRN and CPu, whereas decreased binding was observed in

the MRN and HC in MRN-lesioned animals. Animals with dual lesions had

lower binding in all regions examined. *p<0.01, **p<0.001

118

3.1 Effect of 5,7-DHT lesions on VCMs

VCMs were assessed prior to surgery, and subsequently 1 and 2 weeks after

surgery. Repeated measures ANOVA indicated a significant effect of time on HAL-

induced VCMs (F=8.75, p=0.002), which was driven by a linear decrease in VCMs

over time (p=0.001). Two weeks after surgery, VCMs were significantly decreased

relative to baseline in the DRN-lesioned animals (-45%, p=0.002) and animals that

received combined DRN+MRN lesions (-37%, p=0.02). VCMs were not different in

MRN-lesioned animals (-6.4%, p=0.719) or in subjects with SHAM lesions (-8.8%,

p=0.171). There was no effect of lesion on VCMs in rats that had not received HAL

(Fig 35).

119

Figure 35. Reducing brain 5-HT content suppresses HAL-induced VCMs.

Animals that received 5,7-DHT lesions of the DRN alone or in combination

with the MRN exhibited lower levels of VCMs two weeks after surgery. Sham

lesions, or lesions of MRN only, did not affect VCM levels. N=6-8/group.

* p<0.05; ** p<0.01.

120

3.2 Effect of 8-OH-DPAT on VCMs

To further determine if decreased 5-HT neuronal activity could effect HAL-

induced VCMs, we administered 8-OH-DPAT, a 5-HT1A receptor agonist, at a dose

previously shown to inhibit serotonergic raphe neuron firing for 8 min after systemic

injection (Blier et al., 1989). Acute treatment with 8-OH-DPAT significantly

decreased HAL induced VCMs by 71.1% (p<0.001). Saline treatment had no

significant effect on VCMs (p=0.174) (Fig 36). There was no significant effect of 8-

OH-DPAT when rats were pre-treated with fluoxetine (p=0.670) or fenfluramine

(p=0.120) pre-treatment, such that no decreases in VCMs were observed (Fig 36).

121

Figure 36. Reducing brain 5-HT activity suppresses HAL-induced VCMs.

Acute administration of 8-OH-DPAT suppressed HAL-induced VCMs.

However, 8-OH-DPAT injections had no effect when rats were pre-treated

with FLX or FEN. N=6-8/group. * p<0.05; ** p<0.01.

122

3.3 Effect 5-HT2 antagonists on VCMs

Overall, acute treatment with 5-HT2 antagonists altered HAL-induced VCMs

(F=6.54, P<0.001). SB242-084 (p<0.006) and ketanserin (p<0.002) but not

M100,907 significantly reduced VCMs in HAL-treated rats (Fig 37).

123

Figure 37. Effects of 5-HT2A or 5-HT2C blockade on HAL-induced VCMs. Each

bar represents mean VCM counts ± SEM in 3 separate determinations.

Compared to vehicle, SB (0.5mg/kg) and ketanserin (1mg/kg, i.p.)

significantly reduced VCMs, while M100,907 (0.5mg/kg, i.p.) had no effect.

*p<0.02, **P<0.006 compared to vehicle.

124

3.4 Effect of DBS on immediate early gene induction in the raphe nucleus

To determine if DBS modifies activity of raphe neurons, we measured

expression of the immediate early gene zif-268. While zif268 expression tended to

be higher in HAL-treated rats relative to vehicle controls, this effect did not reach

significance in either the DRN (p=0.287) or MRN (p=0.144). In contrast, DBS

applied to the STN significantly decreased zif268 expression in the DRN (VEH: -

70.9%, p=0.001; HAL: -77.9%, p<0.0003) and MRN (VEH: -42.5%, p=0.0245; HAL: -

35.3%, p=0.0056). There was no significant effect of EPN-DBS on zif268

expression in either VEH- or HAL-treated rats in either the DRN (Fig 38) or MRN

(Fig 39).

125

Figure 38. Effect of DBS on zif268 expression in the DRN. STN-DBS decreased

expression of the immediate early gene zif268 in the DRN in both HAL- and

VEH-treated rats. N =7-8/group *p<0.05

126

Figure 39. Effect of DBS on zif268 expression in the MRN. STN-DBS decreased

expression of the immediate early gene zif268 in the MRN in both HAL- and

VEH-treated rats, whereas EPN-DBS had no effect. N =7-8/group *p<0.05

127

3.5 Effect of DBS on striatal 5-HT release

We performed in vivo microdialysis to determine if DBS affects 5-HT release

in the CPu. Overall, there was a significant effect of DBS target (F=97.47, p<0.001)

but not of HAL-treatment (F=2.31, p=0.143) on 5-HT release in the DL CPu. STN-

DBS induced a significant reduction of extracellular 5-HT levels in the DL CPu in

both VEH- and HAL-treated rats, whereas EPN-DBS did not alter 5-HT release. The

decreased 5-HT release induced by STN-DBS was progressive, and started

immediately after DBS onset (VEH: -29.0%, p=0.050; HAL: -40.7%, p=0.017),

reaching maximal levels in the sample measured immediately after DBS offset

(VEH: -74.1%, p<0.0001; HAL: -70.5%, p<0.001). 5-HT levels remained decreased

60 minutes after the stimulation period (VEH: -74.1%, p=0.0002; HAL: -59.9%

p=0.0002). In both HAL- and VEH-treated animals undergoing EPN-DBS, 5-HT

levels were not significantly different from baseline at any time point (Fig 40).

128

Figure 40. Effect of DBS on 5-HT release in the CPu. STN-DBS significantly

decreased 5-HT release in the DL CPu in both HAL- and VEH-treated rats.

This decrease occurred immediately after DBS onset and persisted for up to

36 minutes after DBS offset. DBS application is indicated from 60 minutes to

120 minutes. Indication of statistical significance was omitted for clarity.

EPN-DBS had no effect on 5-HT levels. N =7-8/group *p<0.05

129

3.6 Effect of serotonergic drug pre-treatment on VCM-suppressing effects of

DBS

To determine if the decrease in 5-HT release induced by DBS is necessary

for the antidyskinetic effects of DBS, we pharmacologically elevated brain levels of

5-HT by pre-treatment with fluoxetine or fenfluramine prior to the application of DBS.

Given the high concentration of 5-HT2 receptors in the DL CPu, and their implication

in the motor effects of classical antipsychotics (Meltzer and Nash, 1991), we also

examined the effect of pre-treatment with the non-specific 5-HT2 agonist DOI on the

VCM suppressing effects of DBS.

3.6.1 Fluoxetine. There was a significant effect of HAL treatment (F=137.51,

p<0.001) on VCMs, with HAL-treated animals exhibiting higher levels of VCMs than

VEH-treated rats. There was also a significant effect of time (F=25.56, p<0.001) and

a significant interaction between HAL treatment and time (F=39.43, p<0.001). This

interaction was likely due to a decrease in VCMs among HAL-treated rats during

DBS, which was not observed in VEH-treated animals. While there was no

significant main effect of fluoxetine (F=0.35, p=0.554), there was a significant

interaction between fluoxetine and time (F=4.206, p=0.005) and between fluoxetine,

time and haloperidol (F=3.81, p=0.009). Pair-wise comparisons revealed that

among HAL-treated animals undergoing STN-DBS, fluoxetine pre-treatment

attenuated the decrease in VCMs induced by DBS. However, this fluoxetine effect

only achieved statistical significance at the 60 minute time point (Fig 41). There

were no significant effects of fluoxetine in VEH-treated animals undergoing STN-

DBS (Fig 42), or in any animals receiving EPN-DBS (Fig 43, 44). Fluoxetine had no

130

effect on total distance traveled in the open field (Fig 47). At the dosing parameters

used, fluoxetine induced a 60% increase in 5-HT peak release and 5-HT levels

remained elevated for the duration of DBS. The mean increase across the 5 time

points measured was 32.9% relative to baseline (Fig 48).

131

Num

ber o

f VC

Ms

*

0

2

4

6

8

10

12

14

16

18

20

Baseline 0 min 30 min 60 min Recovery

HAL STN-DBS + SalHAL STN-DBS + FLX

Num

ber o

f VC

Ms

*

0

2

4

6

8

10

12

14

16

18

20


HAL STN-DBS + SalHAL STN-DBS + FLX

Figure 41. Effect fluoxetine pre-treatment on STN-DBS efficacy in HAL-treated

rats. DBS suppressed VCMs for the 60 minutes of DBS application. After 60

minutes of STN-DBS, VCM levels were higher after fluoxetine pre-treatment

than after saline pre-treatment N=8.

132

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


VEH STN-DBS + SalVEH STN-DBS + FLX

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


VEH STN-DBS + SalVEH STN-DBS + FLX

Figure 42. Effect fluoxetine pre-treatment on STN-DBS efficacy in VEH-treated

rats. There were no differences between saline and fluoxetine pre-treatment

on VCMs during STN-DBS in VEH-treated rats. N=6.

133

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


HAL EPN-DBS + SalHAL EPN-DBS + FLX

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


HAL EPN-DBS + SalHAL EPN-DBS + FLX

Figure 43. Effect fluoxetine pre-treatment on EPN-DBS efficacy in HAL-treated

rats. DBS suppressed VCMs for the 60 minutes of DBS application in all

HAL-treated groups. Fluoxetine pre-treatment did not alter the efficacy of

EPN-DBS in HAL-treated. N=8.

134

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


VEH EPN-DBS + SalVEH EPN-DBS + FLX

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


VEH EPN-DBS + SalVEH EPN-DBS + FLX

Figure 44. Effect of fluoxetine pre-treatment on EPN-DBS efficacy in VEH-

treated rats. Fluoxetine pre-treatment did not alter the efficacy of EPN-DBS

in VEH-treated rats. N=6.

135

3.6.2 Fenfluramine. There was a significant effect of time (F=12.086, p<0.0001) on

VCM levels, driven by decreased VCMs during DBS. There was no significant effect

of fenfluramine pre-treatment (F=1.425, p=0.250) or interaction between

fenfluramine and time (F=0.810, p=0.541) (Fig 45). Fenfluramine had no effect on

total distance traveled in the open field (Fig 47). At the dosing parameters used,

fenfluramine induced a 286% increase in 5-HT release and 5-HT levels remained

elevated for the duration of DBS. The mean increase across the 5 time points

measured was 279.6% relative to baseline (Fig 48).

3.6.3 DOI. There was a significant effect of time (F=18.04, p<0.0001) on VCM

levels, driven by decreased VCMs during DBS. There was no significant effect of

DOI pre-treatment (F=0.59, p=0.455) or interaction between DOI and time (F=0.69,

p=0.612) (Fig 46). DOI had no effect on total distance traveled in the open field (Fig

47).

136

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14


HAL STN-DBS + SalHAL STN-DBS + FEN

Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14



Figure 45. Effect fenfluramine pre-treatment of DBS efficacy. DBS suppressed

VCMs for the 60 minutes of DBS application. In all HAL-treated groups, VCM

levels were greater during STN-DBS when rats had been pre-treated with

fenfluramine, although these differences did not achieve statistical

significance. N=8.

137

f V

ber o

Num

CM

s

0

2

4

6

8

10

12

14



Num

ber o

f VC

Ms

0

2

4

6

8

10

12

14



Figure 46. Effect of DOI pre-treatment of DBS efficacy. DBS suppressed VCMs

for the 60 minutes of DBS application. VCM levels were greater during STN-

DBS when rats had been pre-treated with DOI, although these differences did

not achieve statistical significance. N=8.

138

Figure 47. Effect of serotonergic pharmacomanipulation on open field activity.

HAL-treated animals exhibited lower levels of spontaneous ambulatory activity.

None of the serotonergic drugs administered prior to DBS influenced activity in the

open field arena.

139

0

100

200

300

400

500

600

0 12 24 48 60 72 84 96 108 120 132 144 156 168 180 192 204 216 228 240

5-H

T R

elea

se (%

Bas

elin

e)

FenfluramineFluoxetine

DBS

Drugadministration

Time (min)

0

100

200

300

400

500

600

0 12 24 48 60 72 84 96 108 120 132 144 156 168 180 192 204 216 228 240

5-H

T R

elea

se (%

Bas

elin

e)

FenfluramineFluoxetineFenfluramineFenfluramineFluoxetineFluoxetine

DBS

Drugadministration

Time (min)

Figure 48. Confirmation of the effects of serotonergic manipulations of 5-HT

release. Pre-treatment with either fluoxetine (160% relative to baseline) or

fenfluramine (386% relative to baseline) elevated 5-HT release. 5-HT release

was significantly higher than baseline at the 72 minute time point in

flenfluramine-treated rats and at the 108 minute time point after fluoxetine

treatment. Indication of statistical significance was omitted for clarity. Levels

remained elevated relative to baseline (fluoxetine: 132.9%, fenfluramine:

279.6%) for the duration of DBS and up to 60 minutes after DBS offset.

140

4. Discussion

Despite its widespread clinical application for the treatment of movement

disorders, the mechanisms underlying the therapeutic effects of DBS remain

unclear. Altered 5-HT function has been implicated in the pathology of TD, and

several effects of DBS on the 5-HT system have been described in pre-clinical

studies. Here we demonstrate that reducing 5-HT neurotransmission, either acutely

with 8-OH-DPAT, or chronically with 5-7-DHT induced depletion of 5-HT, is sufficient

to suppress HAL-induced VCMs. However, pharmacological and microdialysis

studies showed that decreased brain serotonin function does not play a role in

mediating the VCM-suppressing effects of DBS.

The 5-HT system has been implicated in the pathophysiology of TD by

several lines of evidence. Briefly, atypical APDs are associated with much lower

incidences of TD, which has been ascribed to their 5-HT antagonism or inverse

agonism (Meltzer and Nash 1991; Kapur, Zipursky et al. 1999; Stahl 1999).

Moreover, SSRI treatment has been shown to exacerbate or precipitate TD in

patients concomitantly administered antipsychotics. In clinical and pre-clinical

studies, 5-HT receptor antagonism can reduce VCMs (Kostrzewa, et al., 2007). To

determine if reduced 5-HT activity is sufficient to suppress HAL-induced VCMs, we

administered the 5-HT1A inhibitory autoreceptor agonist, 8-OH-DPAT. We observed

VCMs during a window in which the dose and concentration of 8-OH-DPAT used

has previously been shown to completely inhibit the firing of serotonergic neurons

(Blier, et al., 1989). When we examined VCMs during this period of quiescent 5-HT

neurons we found that VCMs were significantly reduced relative to baseline. Further

linking the effects of 8-OH-DPAT to inhibition of 5-HT transmission, the effects of 8-

141

OH-DPAT were abolished by pre-treatment with either fenfluramine or fluoxetine. To

further test the idea that decreased brain 5-HT may be sufficient to suppress VCMs,

we performed selective serotonergic lesions of the raphe nuclei. We report that

while MRN lesions had no effect, DRN or combined DRN+MRN lesions significantly

reduced VCMs. We also determined that 5-HT2C antagonism is sufficient to reduce

HAL-induced VCMs. The 5-HT2 receptor class was chosen because of the high

concentration of 5-HT2 receptors in the CPu, a target site of action of HAL (Di

Giovanni et al., 2006). 5-TH2 receptors were also of interest because of their

abundant post-synaptic distribution in the basal ganglia and because they mediate

the modulatory effects of 5-HT on dopamine (Alex and Pehek 2007; Di Matteo,

Pierucci et al. 2008; Di Giovanni, Esposito et al. 2010). This suggests that

antagonizing 5-HTreceptors or reducing 5-HT in brain areas innervated by the DRN,

which include the basal ganglia, is sufficient to suppress HAL-induced VCMs.

It has been previously shown that STN-DBS inhibits firing of serotonergic

neurons in the dorsal raphe (Temel, Boothman et al. 2007; Hartung, Tan et al. 2011)

and decreases 5-HT release in the hippocampus and prefrontal cortex (Navailles,

Benazzouz et al. 2010). However, to our knowledge, altered 5-HT release in brain

areas implicated in movement control has not been documented. We examined 5-

HT release in the CPu because it is an area of the basal ganglia that receives

extensive serotonergic innervation and because it is a putative site of action of HAL.

Here we show that STN-DBS decreases 5-HT in the DL CPu in both HAL- and VEH-

treated rats, whereas EPN-DBS had no effect. The decrease in 5-HT induced by

STN-DBS is likely due to decreased activation of raphe neurons, which we assessed

by mapping expression of the immediate early zif268. In this experiment, STN- but

142

not EPN-DBS decreased activity of DRN and MRN neurons, while EPN-DBS had no

effect. Based on the inhibition of the raphe neurons, we can speculate that 5-HT

release was decreased in other areas of the basal ganglia as well, since the DRN

provides serotonergic innervation to this collection of nuclei (Di Matteo et al., 2008).

5-HT terminals from the DRN synapse onto dopaminergic and GABAergic neurons

in the GP, STN and SN as well as the CPu (Di Giovanni, Di Matteo et al. 2006; Di

Matteo, Pierucci et al. 2008), and modulation of activity of any of these output nuclei

or basal ganglia nodes could significantly impact on net basal ganglia output.

Having established that decreasing brain 5-HT content or reducing the firing

of dorsal raphe neurons is sufficient to suppress VCMs independently of DBS, and

having found that STN-DBS decreases activity of 5-HT neurons and decreases 5-HT

release in the CPu, we wanted to determine if this decrease in 5-HT release and

function was a necessary component of the mechanism underlying the VCM-

suppressing effects of DBS.

We administered fluoxetine to elevate concentration of extracellular serotonin

one hour prior to DBS, to determine if the VCM-suppressing effects of DBS would

persist without the decrease in brain serotonin. We found that despite preventing

the DBS-induced decrease in brain 5-HT pharmacologically, DBS still suppressed

VCMs. This was particularly true in the case of EPN-DBS, where pre-treatment with

fluoxetine had no effect on VCM levels during DBS. However, in the case of the

STN, VCM levels were slightly but significantly higher after pre-treatment with

fluoxetine than with saline. To further investigate if this decrease in 5-HT really does

contribute to the VCM-suppressing effects of STN-DBS, we used fenfluramine to

achieve higher increases in 5-HT levels. In a further attempt to modulate 5-HT, we

143

administered the 5-HT2 agonist, DOI. There was a slight but non-significant effect of

both fenfluramine and DOI on the VCM-suppressing effects of DBS. Together,

these results suggest that preventing the DBS-induced decrease in 5-HT does not

interfere with the VCM-suppressing effects of STN- or EPN-DBS.

The effect of STN-DBS on the 5-HT system has been studied in preclinical

models, in the context of both motor and cognitive effects (Navailles and De

Deurwaerdere, 2012) however, to our knowledge, this is the first study to compare

the effects of STN- and EPN-DBS on the 5-HT system. Moreover, this is the first

study to examine the basal ganglia, and to attempt to elucidate the contribution of

decreased 5-HT release to the motor effects of DBS. Clinically, both the STN and

GPi have been used effectively to relieve symptoms of treatment-resistant TD and

tardive dystonia (Damier, Thobois et al. 2007; Sun, Chen et al. 2007). Our

observation that EPN-DBS suppresses VCMs in this model despite its lack of effect

on the 5-HT system further strengthens our conclusion that decreasing 5-HT is not a

necessary component of the DBS therapeutic mechanism.

The current findings that preventing 5-HT decreases pharmacologically or by

agonism of post-synaptic 5-HT receptors does not interfere with the motor effects of

DBS may have implications for the treatment of psychiatric side effects that may

accompany DBS (Tan et al., 2011). Our results suggest that treatment with SSRIs

or other drugs that elevate brain 5-HT will not likely have adverse effects on motor

outcome of DBS.

We have shown that decreasing brain 5-HT content with 5,7-DHT lesions or

decreasing activity of serotonergic neurons with the inhibitory autoreceptor agonist

8-OH-DPAT is sufficient to suppress VCMs induced by chronic HAL treatment. We

144

have also demonstrated that STN-DBS decreases 5-HT release in the DL CPu and

inhibits neurons in the dorsal and medial raphe nucleus, while EPN-DBS has no

effect on 5-HT release or raphe neuron activation. Based on our observation that

both STN- and EPN-DBS attenuate VCMs with equal efficacy, despite their

differential effects on the 5-HT system, we conclude that decreases in brain 5-HT is

not a necessary component of the DBS therapeutic mechanism in a model of TD.

145

5. Statement of Significance. Here, we show that DBS applied to the STN, but

not to the EPN, decreases 5-HT release in the CPu and decreases neuronal activity

in the DRN. Decreasing 5-HT transmission through serotonergic lesions,

suppressing firing of dorsal raphe neurons or pharmacological blockade of post-

synaptic receptors decreases HAL-induced VCMs independently of DBS. However,

decreased 5-HT does not appear to be a necessary component of the anti-dyskinetic

effect of DBS.

146

CHAPTER 4

Contribution of DA to the motor effects of DBS

This chapter has not been submitted for publication.

147

1. Introduction.

Deep brain stimulation of the STN and EPN has been applied for several

movement disorders. Several lines of evidence implicate the dopamine system in

TD pathology and in DBS. Dopamine (DA) is the primary regulatory

neurotransmitter of the basal ganglia, and DA depletion or dysregulation leads to the

motor symptoms of PD and levo-dopa induced dyskinesias. Haloperidol is a potent

dopamine D2 receptor antagonist, and one leading theory of TD pathology is that

chronic HAL treatment leads D2 up-regulation and hypersensitivity of the

striatonigral DA system. This hypersensitivity may underlie the dyskinesias

associated with chronic classical APD use (Casey 2004; Margolese, Chouinard et al.

2005). Further implicating DA dysfunction in TD pathology, oxidative damage of

dopaminergic neurons on the SNc (Andreassen and Jorgensen 2000; Andreassen,

Meshul et al. 2001; Andreassen, Ferrante et al. 2003; Andreassen, Waage et al.

2003), along with decreased levels of extracellular dopamine in the striatum

(Kulkarni et al., 2009), have been reported in rats chronically treated with HAL.

Pre-clinical studies have shown that DBS alters striatonigral DA transmission.

STN-DBS has mixed effects on neurons of the SNc. While both inhibitory and

excitatory responses have been recorded in the SNc in response to STN-DBS (Lee,

Blaha et al. 2006), it is thought that STN-DBS induces a net increase in activity of

DA neurons in the SNc (Benazzouz, et al., 2000). In 6-OHDA-lesioned rats, DBS at

high intensity increased striatal DA, with no change in metabolite levels, suggesting

increased activity of SNc neurons (Bruet, Windels et al. 2001; Lee, Blaha et al. 2006;

Starr 2008; Winter, Lemke et al. 2008; Covey and Garris 2009; Walker, Koch et al.

2009). However, other studies report that STN-DBS lead to increases in DA

148

metabolism without influencing total levels of DA in intact rats (Paul, Reum et al.

2000; Meissner, Reum et al. 2001; Pazo, Hocht et al. 2011), suggesting an increase

in DA release with rapid metabolism. STN-DBS also exacerbates behavioural

(Gubellini, Eusebio et al. 2006; Oueslati, Sgambato-Faure et al. 2007) and cellular

(Lacombe, Carcenac et al. 2007; Oueslati, Sgambato-Faure et al. 2007) effects of L-

Dopa treatment in rats. STN-DBS is also less effective in attenuating 6-OHDA

lesion-induced motor symptoms in the presence of post-synaptic DA receptor

antagonists (Starr, 2008). EPN-DBS has been less thoroughly studied, although

microdialysis studies have found no effect of EPN-DBS on DA release in intact or 6-

OHDA-lesioned rats (Meissner et al., 2000).

Clinically, reduction of L-DOPA medication is possible during STN-DBS for

PD, suggesting that DBS may enhance DA transmission (Evidente et al., 2011).

STN-DBS has also been associated with side effects characteristic of dopamine

replacement therapy, such as impulsivity and dopamine-dysregulation syndrome

(Lim, O'Sullivan et al. 2009; Broen, Duits et al. 2011), which further implicates a

dopaminergic mechanism in the motor effects of DBS. However, neuroimaging

studies using PET scanning have failed to detect changes in DA transmission during

DBS (Antonini, Landi et al. 2003; Hilker, Voges et al. 2003), although it has been

suggested that increases in DA release may be too small to detect.

In this series of experiments, we wanted to determine how STN- and EPN-

affect striatal DA release, and to determine if changes in dopaminergic transmission

might contribute to the anti-dyskinetic effects of DBS in an animal model of TD.

149


2.1 Subjects

Male Sprague–Dawley rats initially weighing 200–250 g (Charles River, Quebec)

received either haloperidol decanoate (HAL, Sandoz Canada, Boucherville, Quebec;

21 mg/kg i.m. N = 36) or sesame oil vehicle (N = 16) as described in section 2 of the

general methods.

2.2 Microdialysis

For microdialysis experiments, a guide cannula was implanted into the dorsolateral

caudate-putamen (CPu; AP +1.4 mm; ML + 2.4 mm; DV -3.0 mm) during electrode

insertion surgery. After one week of recovery, a microdialysis probe (MAB4.15.4 -4

mm membrane, Scientific Products, North York, ON) was inserted into the target and

perfused with Ringer's solution at a constant flow rate of 0.7 μL/min (microinjection

pump, Hamilton, West Lafayette, Indiana). Following an equilibration period of 5

hours, dialysate samples were collected every 12 min. Baseline levels were defined

as an average of the first five samples collected. DBS was then delivered for one

hour during collection, followed by 96 minutes of recovery. In a small experiment

(N=2), L-DOPA + benserazide was administered to confirm the time course and

magnitude of L-Dopa-induced DA release was confirmed. Samples were analyzed

in real time using an Antec Leyden LC110 Alexys HPLC system coupled to a

Decade-II electrochemical detection cell (ATS Scientific Inc, Burlington ON).

150

2.3 Verification of electrode placement

Electrode position was verified using cresyl violet staining (section 5 of the general

methods). Only animals with correct placements were included in the analysis.

2.4 L-DOPA treatment

To determine if increasing brain levels of DA independently of DBS may contribute

to the antidyskinetic effect of DBS, we administered of L-DOPA (Sigma, Canada) at

a dose of 6 mg/kg, i.p. with the peripheral dopa-decarboxylase inhibitor, benserazide

(12 mg/kg), which is known to increase striatal DA levels by approximately 160% 45

minutes following injection (Lindgren et al., 2010). Using microdialysis in pilot

animals, we confirmed both the magnitude and time course of this increase. VCMs

were conducted after 12 weeks of HAL or VEH treatment, 40 minutes following an

acute treatment with L-Dopa + benzeraside (section 3 of the general methods).

After completion of VCM assessments, locomotor activity was assessed over 12

minutes in an open field arena (Med associates, St Albans).

2.5 zif268 mapping

To determine the effects of STN- and EPN-DBS on sources of dopaminergic

innervation (the SNc and VTA), a separate group of stimulation-naive rats underwent

one hour of continuous DBS (N=6 shams, 6 STN-DBS, 6 EPN-DBS), after which

they were sacrificed. Brains were removed, flash frozen and sliced into 20µm

sections for further processing. Hybridization was performed as described above,

using 35S-UTP labelled riboprobes complementary to zif268 (according to Genbank

# NM_012551, (bases 660-679), 5’- tcacctatactggccgcttc-3’ and (bases 1062-1043)

151

5’- aggtctccctgttgttgtgg-3’). Full in situ hybridization methods can be found in

section 7 of the general methods.


All analyses were performed using SPSS version 19. VCM results were

analyzed using repeated measures ANOVA followed by Tukey’s post-hoc tests

where appropriate. Data from L-DOPA experiments were analyzed using paired t

tests. Microdialysis data were analyzed using repeated measures ANOVA with

treatment and target as independent factors.

152

3. Results

3.1 Effects of DBS on striatal DA release

There was a significant effect of time (F=3.275, p=0.023) on DA release, as well as a

significant interaction between time, haloperidol treatment and target (F=4.565,

p=0.006). In VEH-treated rats, STN-DBS significantly increased DA release, which

reached significance in the first two intervals after DBS onset (1, p=0.046; 1.12

p=0.024). STN-DBS had no effect in HAL-treated rats. EPN-DBS had no effect on

DA release in VEH-treated rats. In HAL-treated rats, EPN-DBS tended to decrease

DA release, this decrease achieved significance at 1.12 (p=0.0118) and 1.48

(p=0.007). This decrease remained significant for 36 minutes after DBS offset (2,

p=0.0016; 2.12, p=0.0017; p.24 p=0.0062). Indications of significance are omitted

for clarity (Fig 49).

153

VEH STNHAL STNVEH EPNHAL EPN

DBS

0

50

100

150

200

250

300

350

0 12 24 36 48 1 1.12 1.24 1.36 1.48 2 2.12

Time (minutes)

DA

rele

ase

(% B

asel

ine)

VEH STNHAL STNVEH EPNHAL EPN

DBS

0

50

100

150

200

250

300

350

0 12 24 36 48 1 1.12 1.24 1.36 1.48 2 2.12

Time (minutes)

DA

rele

ase

(% B

asel

ine)

Figure 49. Effect of DBS on striatal DA release. In VEH-treated rats, STN-DBS

transiently increased DA release (p=0.024), which returned to baseline levels 48

minutes after DBS onset. STN-DBS had no effect in HAL-treated rats. EPN-DBS

had no effect on DA release in VEH-treated rats. In HAL-treated rats, EPN-DBS

decrease striatal DBS after DBS off-set (p=0.0118). Indications of significance are

omitted for clarity.

154

3.2 Effects of DBS on zif268 expression in the SNc and VTA

STN-DBS decreased zif268 expression in the SNc in both VEH (-89.5%, p<0.001)

and HAL (-94.2%, p<0.001) treated rats (Fig 50). By contrast, EPN-DBS increased

zif268 expression in VEH and HAL treated rats (Fig 50), although only the latter

difference achieved significance (+62.3%, p=0.009). DBS of either the STN or EPN

had no significant effect on zif268 expression in the VTA (Fig 51).

155

****

**

0

5

10

15

20

25

VEH HAL

zif2

68ex

pres

sion

(μC

i/gtis

sue)

SHAM STN-DBS EPN-DBS

Figure 50. Effects of DBS on zif268 expression in the SNc. STN-DBS decreased

zif268 expression in the SNc in both VEH and HAL treated rats. By contrast, EPN-

DBS increased zif268 expression in VEH and HAL treated rats, ***p<0.001.

156

0

2

4

6

8

10

12

14

16

VEH HAL

zif2

68ex

pres

sion

(μC

i/gtis

sue) SHAM STN-DBS EPN-DBS

0

2

4

6

8

10

12

14

16

VEH HAL

zif2

68ex

pres

sion

(μC

i/gtis

sue) SHAM STN-DBS EPN-DBS

Figure 51. Effects of DBS on zif268 expression in the VTA. DBS of either the

STN or EPN had no significant effect on zif268 expression in the VTA.

157

3.3 Effects of L-Dopa on locomotor behaviour

As expected, HAL-treated animals exhibited higher levels of VCMs and lower levels

of ambulatory activity than VEH-treated rats (Fig 52, 53). L-Dopa administered 45

minutes prior to VCM testing did not affect HAL-induced VCMs, or ambulatory

activity, as measured by ambulatory counts or total distance traveled.

158

0

2

4

6

8

10

12

14

HAL VEH

Num

ber o

f VC

Ms

Saline L-DOPA

0

2

4

6

8

10

12

14

HAL VEH

Num

ber o

f VC

Ms

Saline L-DOPA

Figure 52. Effects of L-Dopa on HAL-induced VCMs. HAL-treated animals

exhibited high levels of VCMs, as expected. L-Dopa administered 40 minutes prior

to VCM testing did not affect HAL-induced VCMs.

159

0

500

1000

1500

2000

2500

3000

3500

4000

4500

HAL VEH

Am

bula

tory

Cou

nts

0

1000

2000

3000

4000

5000

6000

HAL VEH

Dis

tanc

e

Saline L-DOPA Saline L-DOPA

0

500

1000

1500

2000

2500

3000

3500

4000

4500

HAL VEH

Am

bula

tory

Cou

nts

0

1000

2000

3000

4000

5000

6000

HAL VEH

Dis

tanc

e

Saline L-DOPA Saline L-DOPA

Figure 53. Effects of L-Dopa on HAL-induced hypo-locomotion. L-Dopa

administered 50 minutes prior to open field testing did not affect HAL-induced

decreases in ambulatory activity, as measured by ambulatory counts (left) or total

distance traveled (right).

160

4. Discussion

The dopaminergic system is critically involved in the mechanism of HAL, and

dysfunction of the striatonigral DA system likely contribute to the induction of TD with

chronic HAL treatment. Moreover, basic and clinical studies have suggested that

STN-DBS may be associated with enhanced DA transmission. We determined that

while STN-DBS transiently increases striatal DA, this increase was not observed in

HAL-treated rats. EPN-DBS had no effect in VEH-treated rats, but tended to

decrease DA in HAL-treated rats, after DBS offset. We also observed that STN-

DBS decreased zif268 expression in the SNc, but not VTA of both HAL- and VEH-

treated rats, whereas EPN-DBS had no effect. Further arguing against the

involvement of a dopaminergic mechanism in the VCM-suppressing effects of DBS,

pharmacological elevation of DA by systemic administration of L-Dopa did not

attenuate VCMs independently of DBS.

While DA release has not been previously studied in HAL-treated rats,

transient increases in DA following STN in intact rats has been reported (Bergmann,

Winter et al. 2004; Lee, Blaha et al. 2006; Lee, Verhagen Metman et al. 2007;

Winter, Lemke et al. 2008; Covey and Garris 2009). Also consistent with previous

reports, EPN-DBS had no effect on striatal DA release (Meissner, Reum et al. 2001;

Meissner, Harnack et al. 2003). The transient nature of DA release may explain why

some pre-clinical studies have failed to find an effect on striatal DA, the

measurement interval may be too small to accurately record an increase.

Alternatively, as it has been suggested, the increased DA may be below the

threshold of detection (Bruet, Windels et al. 2001; Bruet, Windels et al. 2003). This

transient increase can be explained in two ways; increased DA release is due to

161

activation of DA metabolism enzymes, a theory proposed by Meissner et al to

account for the increase in DA metabolites, but not DA following STN-DBS

(Meissner, Harnack et al. 2002; Meissner, Harnack et al. 2003). Another theory is

that the increase in DA release is due to increased GLU from the STN to the SNc,

which would increase activity of this nucleus, specifically of dopaminergic neurons

projecting to the CPu. This STN-DBS-induced increase in SNc glutamate is

transient, with the excitatory drive to the SNc and resultant DA release diminishing

with continuous DBS (Lee, Blaha et al. 2006).

The lack of an effect on DA release in HAL-treated rats is puzzling, but could

be due to the up-regulation of inhibitory D2 auto-receptors that is known to occur

following chronic HAL treatment (Stock and Kummer 1981; Casey and Keepers

1988; Casey 2000; Sanci, Houle et al. 2002), or possible excitotoxic damage of the

SNc as a result of chronic HAL treatment (Andreassen and Jorgensen 2000;

Andreassen, Ferrante et al. 2003). We speculate that initial increases in

extracellular DA as a result of DBS would activate inhibitory autoreceptors on

dopaminergic nerve terminals in the CPu. Activation of these autoreceptors serves

as a feedback loop, and prevents further release of DA by reducing excitability of the

presynaptic, dopaminergic neurons (L'Hirondel, Cheramy et al. 1998; Benoit-

Marand, Borrelli et al. 2001). These receptors are up-regulated as a result of

chronic HAL treatment, which could explain the lack of increased DA in HAL-treated

rats. Alternatively, excitatory drive through scarce glutamatergic projections from the

STN to SNc may underlie increased striatal DA release. As suggested by our zif268

results, chronic HAL treatment may induce overactivity of the STN, which would lead

to excitotoxic damage in its projection areas. This damage has been reported in the

162

SNc following chronic HAL treatment (Andreassen et al., 2003). If dopaminergic

neurons that receive projections from the STN have degenerated, they would not be

responsive to any excitatory drive resulting from STN-DBS, and DA release would

not increase.

We observed that STN-DBS significantly decreased zif268 expression in the

SNc of both HAL- and VEH-treated rats, while EPN-DBS had no effect. While this

decrease in zif268 expression seems incompatible with the observed transient

increase in striatal DA release, inhibitory responses of SNc neurons to STN-DBS

has been reported (Lee, Blaha et al. 2006). This discrepancy may also be due to

the time course of zif268 expression and the transient nature of the increase in DA

release. Finally, the zif268 mapping technique does not allow us to distinguish

between cell types in a target structure, and it is possible that the STN-induced

decrease is reflecting an effect in non-dopaminergic cells of the SNc.

Although our initial studies provided evidence that DBS does not influence DA

release in HAL-treated animals, the DA system is an intuitive target for the treatment

of movement disorders, including TD (Albin, Young et al. 1989; Redgrave,

Rodriguez et al. 2011). For this reason, we wanted to further determine if increased

DA may suppress HAL-induced VCMs. We elevated brain dopamine by

systemically administering L-Dopa, and found that in spite of elevated brain DA,

VCMs were not affected. Consistent with our observation, L-Dopa is not effective in

suppressing TD in the clinic (Feltner and Hertzman 1993; Soares and McGrath

1999; Soares-Weiser and Joy 2003; El-Sayeh, Lyra da Silva et al. 2006). Taken

together, our results suggest that while changes in DA release do not contribute to

the anti-dyskinetic effects of DBS in an animal model of TD.

163

5. Statement of significance. We found that STN-DBS transiently increases

striatal DA release in intact animals, and decreases neuronal activity in the SNc in

both HAL- and VEH-treated rats. EPN-DBS had no effect on DA release or SNc

activity. L-Dopa treatment did not alleviate VCMs. Our results suggest that

increased DA does not contribute to the VCM-suppressing effects of DBS.

164

CHAPTER 6

Does chronic DBS induce psychiatric-like effects?

This chapter has been submitted for publication:

Creed MC, Hamani C and Nobrega JN. Effects of chronic deep brain

stimulation on depressive- and anxiety-like behavior in rats: comparing

entopeduncular and subthalamic nuclei. Brain Stimulation (Under

review).



and data analyses was conducted by MC. JN and MC wrote the


165

1. Introduction

Deep brain stimulation of the subthalamic nucleus or internal globus pallidus

has been routinely used for the treatment of some movement disorders, including

Parkinson’s disease, dystonia and tremor (Blahak, Wohrle et al. 2007; Blahak,

Bazner et al. 2009; Capelle, Blahak et al. 2010; Welter, Grabli et al. 2010). While

the therapeutic effects of DBS in these conditions are clear, clinical trials have also

indicated that DBS can be associated with adverse effects, such as depression,

apathy, anxiety, impulsivity and increased risk of suicide (Albanese, Piacentini et al.

2005; Temel, Kessels et al. 2006; Castelli, Zibetti et al. 2008; Witt, Daniels et al.

2008; Okun, Fernandez et al. 2009; Temel, Tan et al. 2009). The mechanism(s)

underlying these effects remain(s) unclear, and there is as yet no definitive

consensus as to which target, the STN or GPi, has a more benign side effect risk

profile.

In clinical populations, it is difficult to directly assess which target has a more

favourable effect profile (Vitek 2002; Rodriguez, Miller et al. 2005; Okun, Wu et al.

2011). The overwhelming majority of studies assessing psychiatric side effects have

been performed in patients with Parkinson's disease (PD), a condition where

underlying motor or psychiatric pathology may obscure comparisons between STN

and GPi as DBS targets. Moreover, STN-DBS has been more widely applied than

GPi-DBS for the treatment of PD, and as a result, a larger volume of psychiatric

effects that have been reported after STN-DBS than after GPi-DBS. In studies

designed to directly compare DBS targets, it is emerging that STN-DBS may be

associated with more affective side effects than GPi-DBS (Bronstein, Tagliati et al.

166

2011), although this finding has not been consistently reported in all clinical trials

(Okun, Fernandez et al. 2009; Kirsch-Darrow, Zahodne et al. 2011).

The objective of the present study was to compare psychiatric-type effects of

DBS applied to the STN and entopeduncular nucleus (EPN, the rodent homologue

of the GPi), in the absence of motor disturbances or neurological pathology. We

used a learned helplessness protocol to model depressive-like behaviour and an

elevated plus maze task to assess anxiety-like behavior in otherwise healthy rats

that had undergone chronic DBS for three weeks. Since hippocampal brain-derived

neurotrophic factor (BDNF) has been implicated in depressive syndromes, we also

measured BDNF levels as well as gene expression of its receptor, trkB, in the

hippocampus of chronically stimulated rats. Finally, it has been hypothesized that

STN-DBS may have a greater effect than EPN-DBS on brain regions distal from the

target site (Okun et al., 2003), which may in turn contribute to their different

symptom profiles. To address this possibility we used expression the early gene

zif268, a marker of neuronal activity, to compare the effects of acute STN- vs. EPN-

DBS on several brain areas that have been generally implicated in affective

processes and emotional reactivity.

167

2. Methods

2.1 Surgery

Male, Sprague-Dawley rats (N=88) initially weighing 400-450g underwent

implantation of electrodes as described in section 4 of the general methods. Sham

surgery controls were anesthetized and had holes drilled into the skull but were not

implanted with electrodes. Electrode placement was confirmed for each subject

using cresyl violet staining (section 5 of the general methods). Only subjects with

verified electrode placements were included in the analyses.

2.2 DBS protocol

Starting 1 week after surgery DBS was applied using a portable stimulator

(Model 6510, St Jude Medical, Plano, Texas) as described in section 6 of the

general methods. DBS was applied for 4 hours per day, for twenty-one consecutive

days.

2.3 Learned helplessness

Learned helplessness (LH) testing began on the sixteenth day of DBS. In this

paradigm, an initial exposure to uncontrollable stress disrupts the ability to acquire

escape responses when animals are later placed in an escapable stress situation.

The LH protocol was performed over 5 days. Day 1: half of the rats, referred to as

the “stressed” groups (N=8 Shams, 8 STN-DBS, 8 EPN-DBS), were subjected to

inescapable footshocks in sound-attenuated operant boxes (Med Associates, St.

Albans, VT). Both the duration (1.5-60 sec) and the interval between shocks (1 to

30 sec) were programmed to result in a total shock exposure of 25 min per animal.

168

The other half of the rats, the “non-stressed” rats (N=8 Shams, 8 STN-DBS, 8 EPN-

DBS), were placed in the inescapable shock boxes for 25 minutes but did not

receive any shock. On Day 2 all rats underwent 4 hours of DBS, as in the previous

3 weeks. On Day 3-5, all animals underwent escape sessions, one session per day,

following 4 hours of DBS. Testing was conducted in automated shuttle boxes (Med

Associates, St. Albans, Vermont). A central divider provided passage between two

equal size compartments. Each session consisted of 30 trials of escapable

footshock (0.80 mA intensity, 5 sec duration, 90 sec average intertrial interval).

Each trial started with visual (house lights on) and auditory (85 dB white noise), cues

beginning 5 sec before shock onset. Rats could avoid or escape the shock entirely

by moving between compartments once the trial started. For each trial, latency to

cross over was recorded by floor sensors and the rat’s response was classified as

avoidance (latency < 5 sec), escape (latency >5 sec) or failure to move between

compartments for the 10 sec duration of the trial.

2.4 Elevated plus maze

In a separate cohort of rats, elevated plus maze testing occurred immediately

following stimulation on the twentieth day of DBS (N=10 sham controls, 11 STN-

DBS, 9 EPN-DBS). The apparatus consisted of two open arms and two enclosed

arms at right angles (arms: 10cm wide, 15cm high, 50cm long), raised 1 meter

above the ground. Rats were placed in the center of the maze, facing an open arm

an allowed to explore for 5 minutes, during which time behaviour was recorded. The

number of entries as well as total time spent in open vs. closed arms was quantified

by a trained observer blind to treatment group.

169

2.5 Open field assessments

As a control for the possibility that chronic DBS might induce motor effects

that could affect learned helplessness and/or plus maze results, rats were tested on

an open field arena. On the twentieth day of DBS, locomotor activity was assessed

in an open field (N=8 sham controls, 10 STN-DBS, 10 EPN-DBS). Immediately

following DBS rats were placed in automated activity chambers (Med Associates, St.

Albans, VT) and locomotor activity was recorded for 20 min by photobeam breaks.

Animals without electrodes were also monitored in the activity chamber for 20 min,

to coincide with the timing of behavioural testing relative to DBS.

2.6 BDNF protein measurements

Quantification of hippocampal BDNF levels was done using an ELISA kit

(Promega, Madison WI), according to manufacturer’s instructions with modified lysis

buffer. Briefly, dorsal hippocampus was dissected from frozen tissue and lysed in

1:100 volumes of modified lysis buffer (100mM PIPES, pH 7, 500mM NaCl, 0.2%

Triton X-100, 0.1% NaN3, 2% BSA, 2mMEDTA·Na2·2H2O, 200M PMSF frozen in

isopropanol, 10M leupeptin frozen separately in deionized water, 0.3 maprotinin

frozen separately in 0.01MHEPES pH 8 and 1 M pepstatin frozen separately in

DMSO) (Szapacs, Mathews et al. 2004). Samples were centrifuged for 30 min at

16,000 × g at 4◦C. Supernatants were then removed and frozen at −70 ◦C until

analysis according to kit instructions. Plates were read with an automated plate

reader using SPF software.

170

2.7 TrkB and BDNF In situ hybridization

In situ hybridization was used to quantify trkB and BDNF gene expression in

the hippocampus. At the conclusion of twenty-one days of DBS and learned

helplessness testing, rats were sacrificed (N=8 per group), brains were removed and

flash frozen, and then sliced in a cryostat at 20µm thickness. Hybridization was

performed using 35S-UTP labelled riboprobes complementary to trkB (according to

Genbank # # NM_012731, (bases 2213-2232) 5’- ggtatcaccaacagccagct – 3’ and

(bases 2600-2583) 5’- ggcggtgggcgggttaccct -3’ and BDNF according to Genbank #

NM_012513.2 (bases 240-259, 5’- gcccaacgaagaaaaccata-3’ and (bases 594-575,

5’- gcagccttccttcgtgtaac-3’). Full methods for in situ hybridization can be found in

section 7 of the general methods.

2.8 zif268 mapping

To obtain comparative information on anatomical targets affected by STN- vs.

EPN-DBS, a separate group of stimulation-naive rats underwent one hour of

continuous DBS (N=6 shams, 6 STN-DBS, 6 EPN-DBS), after which they were

sacrificed. Brains were removed, flash frozen and sliced into 20µm sections for

further processing. Hybridization was performed as described above, using 35S-UTP

labeled riboprobes complementary to zif268 (according to Genbank # NM_012551,

(bases 660-679), 5’- tcacctatactggccgcttc-3’ and (bases 1062-1043) 5’-

aggtctccctgttgttgtgg-3’). Full in situ hybridization methods are described in section 7

of the general methods.

171


All statistics were performed using SPSS version 19. Data for the elevated

plus maze and BDNF protein levels were analyzed using one-way ANOVAs with

stimulation target as the independent variable. Data for BDNF and trkB mRNA were

analyzed using two-way ANOVA with stimulation target and stress as independent

variables. Learned helplessness data were also analyzed with two-way repeated

measures ANOVA using stimulation target and stress as independent variables and

test day as the within-subjects variable. Tukey’s post-hoc tests were performed to

determine between-group differences where appropriate.

172

3. Results

3.1 Learned helplessness

As expected, animals that were previously exposed to inescapable footshock

showed impaired performance in the avoidance task relative to non-stressed

controls (Fig 54, 55). A two-way, repeated-measures ANOVA indicated significant

main effects of stress (F=15.36, p<0.001) and target (F=4.78, p=0.014). On the third

day of testing, stressed animals exhibited greater rates of failure (p<0.001) than non-

stressed rats (Fig. 54, 55). They also had longer escape latencies (p<0.001)) and

lower rates of avoidance (p=0.006).

There was a significant effect of stimulation target on failure rates in the LH

task (p=0.014). As shown in Fig. 54, STN-DBS groups performed worse than non-

stimulated control animals, exhibiting higher rates of failure (p=0.01). This difference

was apparent in both stressed and non-stressed animals (Fig. 55). In contrast, the

performance of animals that underwent chronic EPN-DBS did not differ from that of

un-stimulated rats (Fig. 55).

173

*

*

*

Num

ber o

f fai

lure

s ( /

30)

No Stress + No DBSNo Stress + DBS

Stress + No DBSStress + DBS

*

*

*

Num

ber o

f fai

lure

s ( /

30)





Figure 54. Effect of chronic DBS of the subthalamic nucleus on learned

helplessness performance. Stressed animals exhibited higher rates of failure than

non-stressed controls. Both stressed and non-stressed animals who underwent

chronic STN-DBS (solid lines) exhibited higher failure rates than their respective

controls. N= 7-8 per group. *p<0.05

174

Num

ber o

f fai

lure

s ( /

30)



Num

ber o

f fai

lure

s ( /

30)



Figure 55. Effect of chronic DBS of the entopeduncular nucleus on learned

helplessness performance. Stressed animals exhibited higher rates of failure than

non-stressed controls. Chronic EPN-DBS had no effect in non-stressed rats and

while a higher rate of failure was observed in stressed as compared to non-stressed

animals, this effect was not statistically significant. N= 7-8 per group. *p<0.05

175

3.2 Elevated plus maze

Chronic DBS had no effect on elevated plus maze performance. The total

number of entries, proportion of time spent in open arms (Fig 56, F=1.03, p=0.370)

or proportion of entries into open arms (Fig 57, F=1.13, p=0.338) were not different

between treatment groups. Similarly, total number of entries made into arms was

not affected by treatment group (Fig 58, F=2.05, p=0.148).

176

Figure 56. Effect of chronic DBS on time spent in open arms of elevated plus

maze. DBS of either the STN or the EPN did not affect percentage of time spent in

open arms. N=7-8/group.

177

Figure 57. Effect of chronic DBS on entries into open arms made in elevated

plus maze performance. DBS of either the STN or the EPN did not affect

percentage of entries made into open arms. N=7-8/group.

178

Figure 58. Effect of chronic DBS on exploratory activity in elevated plus maze.

DBS of either the STN or the EPN did not affect total entries made in the elevated

plus maze, an index of exploratory activity N=7-8/group.

179

3.3 Open field behaviour

As shown in figure 59, DBS had no effect on locomotor activity. Total activity,

as measured by ambulatory counts were not different between stimulated and un-

stimulated groups, as revealed by one-way ANOVA (F=1.85, p=0.177).

180

Figure 59. Effect of chronic DBS on ambulatory activity. DBS of either the STN

or the EPN did not affect ambulatory counts made in the open field arena. N=7-

8/group.

181

3.4 trkB and BDNF expression

trkB and BDNF gene expression were measured in hippocampal subdivisions

(CA1, CA3, dentate gyrus and subiculum) (Fig 60, 61). Amygdala (combined

basolateral and basomedial subdivisions) and motor cortex were measured as

control areas. Two-way ANOVA indicated no significant main effect of stress on

either trkB (Amygdala: F=1.01, p=0.323, MC F=.070, p=0.793) or BDNF (Amygdala:

F=0.00, p=0.998, MC F=.84, p=0.366) expression. Two-way ANOVA also indicated

there was an overall significant effect of stimulation target on hippocampal trkB

expression (F=2.00, p=0.04), which was likely driven by effects in the medial blade

of the dentate gyrus (DGm) and subiculum (Fig 60). Post-hoc tests revealed that

STN-DBS groups exhibited significantly lower trkB expression than sham operated

animals in the DGm (p=0.019) and subiculum (p=0.04).

Similarly, there was a significant main effect of DBS target on hippocampal

BDNF expression (F=4.34, p<0.001), which was likely driven by group differences in

the DGm (Fig 62, 63). In the DGm, levels of BDNF expression were significantly

lower in STN-DBS treated animals relative to EPN-DBS animals (p=0.002) and

sham-operated controls (p=0.034).

182

Figure 60. Effect of chronic STN-DBS on trkB gene expression. There was no

significant effect of inescapable footshock stress on trkB expression in any

hippocampal subdivision. Stressed and non-stressed animals that underwent

chronic STN-DBS had reduced levels of trkB expression in the DGm and SUB.

Abbreviations: DGl – dentate gyrus, lateral blade; DGm – dentate gyrus, medial

blade; SUB – subiculum. N=7-8/group *p<0.05

183

Figure 61. Effect of chronic EPN-DBS on trkB gene expression. There was no

significant effect of inescapable footshock stress on trkB expression in any

hippocampal subdivision. EPN-DBS also did not affect trkB expression in any

hippocampal subdivision. Abbreviations: DGl – dentate gyrus, lateral blade; DGm

– dentate gyrus, medial blade; SUB – subiculum. N=7-8/group *p<0.05

184

Figure 62. Effect of chronic STN-DBS on BDNF gene expression. There was no

significant effect of inescapable foot-shock stress on BDNF expression in any

hippocampal subdivision. Stressed and non-stressed animals that underwent

chronic STN-DBS had reduced levels of BDNF expression in the DGm relative to

control animals and animals that had undergone EPN-DBS. For abbreviations see

caption for Figure 58; N=7-8/group, *p<0.05.

185

Figure 63. Effect of chronic EPN-DBS on BDNF gene expression. There was

no significant effect of inescapable foot-shock stress on BDNF expression in any

hippocampal subdivision. EPN-DBS also did not affect BDNF expression in any

hippocampal subdivision. For abbreviations see caption for Figure 58; N=7-8/group,

*p<0.05.

186

3.5 Hippocampal BDNF levels

There was no main effect of stress (F=0.004, p=0.98) or target (F=0.97,

p=0.387) on BDNF protein levels in the dorsal hippocampus, as revealed by two-way

ANOVA. While BDNF levels in STN-DBS groups (Stressed: 5259 ± 146 pg/g w/w;

Non-Stressed: 5202 ± 107 pg/g w/w) were slightly lower than those in EPN-DBS

(Stressed: 5422 ± 74 pg/g w/w; Non-Stressed: 5443 ± 102 pg/g w/w) or non-

stimulated groups (Stressed: 5348 ± 106 pg/g w/w; Non-Stressed: 5412 ± 108 pg/g

w/w), this difference did not approach statistical significance. Mean BDNF levels for

all treatment groups ranged from 4136 to 6234 pg/g w/w hippocampal tissue.

3.6 zif268 mRNA expression

Overall, there was a significant effect of treatment group (df=2, F=12.96,

p=0.001), of brain region (df=17, F=203.21, p<0.001) and their interaction (df=34,

F=6.821, p<0.001) on zif268 expression in examined brain regions. DBS of either

the STN or the EPN increased zif268 expression in the piriform cortex (EPN= 61%

STN=51% p<0.001); claustrum (EPN=66% STN=56%, p=0.001); n. accumbens shell

(EPN=68% STN=73%, p=0.016), CA1 (EPN=59% STN=66%, p=0.001) and

perientorhinal cortex (EPN=97% STN=96%, p=0.001) (Fig 64). In addition, STN-

DBS, but not EPN-DBS, decreased zif268 expression in the dentate gyrus DGm (-

17%, p=0.039) (Fig, 65), median raphe (-35%, p=0.035) and dorsal raphe (-78%,

p<0.001). The only significant difference in zif268 expression between STN- and

EPN-DBS treated animals was observed in the dorsal raphe nucleus (p<0.001) (Fig

66).

187

Figure 64. zif268 expression following acute DBS in the hippocampus and

associated areas. Immediate early gene mapping was performed using zif268

expression as an index of neuronal activation in brain areas implicated in emotional

reactivity including hippocampus. Abbreviations: DG – dentate gyrus; EntC –

entorhinal cortex; PRh – perientorhinal cortex. N=6/group *p<0.05, *** p<0.001

188

Figure 65. zif268 expression following acute DBS in limbic areas. zif268

expression as an index of neuronal activation in brain areas implicated in emotional

reactivity including hippocampus-related areas (top) and brain stem regions

(bottom). Abbreviations: MRN - median raphe nucleus; Pir – piriform cortex;

Clstrm – claustrum; NAc – nucleus accumbens; LS – lateral septum; VP – ventral

pallidum; BLA – basolateral. N=6/group *p<0.05, *** p<0.001

189

Figure 66. zif268 expression following acute DBS in brain stem nuclei. zif268

expression as an index of neuronal activation in brain stem nuclei. VTA – ventral

tegmental area. MRN - median raphe nuclei, DRN - dorsal raphe nuclei. N=6/group

*p<0.05, *** p<0.001

190

4. Discussion

The main finding of this study was that DBS applied chronically to the STN,

but not to the EPN, impaired performance in the learned helplessness model of

depression, and was associated with lower levels of gene expression of the

neurotrophin BDNF and its receptor trkB. DBS applied to either target had no effect

on performance in the elevated plus maze and did not affect general locomotor

activity.

This pattern of results is consistent with clinical reports suggesting that STN-

DBS is more strongly associated with affective symptoms than GPi-DBS (Albanese,

Piacentini et al. 2005; Temel, Kessels et al. 2006; Voon, Kubu et al. 2006; Castelli,

Zibetti et al. 2008; Heo, Lee et al. 2008; Soulas, Gurruchaga et al. 2008; Tommasi,

Lanotte et al. 2008; Witt, Daniels et al. 2008; Le Jeune, Drapier et al. 2009; Okun,

Fernandez et al. 2009; Temel, Tan et al. 2009; Temel, Tan et al. 2009; Wang,

Chang et al. 2009; Schneider, Reske et al. 2010; Altug, Acar et al. 2011; Kirsch-

Darrow, Marsiske et al. 2011; Kirsch-Darrow, Zahodne et al. 2011; Strutt, Simpson

et al. 2011). However, as these studies have been carried out in patients with

Parkinson's disease the contribution of underlying neuropathology could not be

completely ruled out. A further potential difficulty in interpreting clinical studies is the

possibility of psychiatric effects associated with dopamine agonists or dopamine

replacement therapy in PD patients (Fenu, Wardas et al. 2009; Ceravolo, Frosini et

al. 2010). STN- but not GPi- DBS is often associated with reductions in

dopaminergic medication (Evidente, et al., 2011), which may have implications for

psychiatric side effect profile (Funkiewiez 2003; Witt, Daniels et al. 2006). As DBS

becomes increasingly used in other movement disorders, such as TD and dystonia,

191

which are not necessarily associated with dopaminergic neuron degeneration, it

becomes important to disentangle the contribution of DBS itself from the effects of

the underlying neuropathology. The current findings confirm that STN stimulation in

the absence of other neuropathology is able to induce or accentuate depressive-type

behaviour in rodents.

One leading hypothesis for the increased incidence of psychiatric effects with

STN as compared to the GPi refers to the activation of limbic subregions and limbic

projections of the target nuclei (Butson, Cooper et al. 2007; Le Jeune, Drapier et al.

2009). Both the STN and EPN are connected to several limbic areas, and are

subdivided into associative, limbic, and motor regions (Pralong, Pollo et al. 2005;

Mallet, Schupbach et al. 2007; Hong and Hikosaka 2008). In humans, the GPi

(average size 478mm3) is approximately three times larger than the STN (average

size 158mm3), and it has been suggested that the increased size of the GPi may

make it an architecturally safer environment for DBS (Okun, et al., 2003). Due to the

compact size of the STN, stimulation delivered at parameters optimized for reduction

of motor symptoms may result in current spread to both limbic sub-regions of the

STN when electrodes are positioned too medially (Hamani et al., 2004). In contrast,

in the case of the GPi the risk of current spread to non-motor sub areas would be

less, given the larger total size. In rats, although the EPN and STN are closer in

size, and although the differences in current spread are less pronounced than in

human patients, STN-DBS was still associated with greater psychiatric-type adverse

effects than EPN-DBS. This suggests that proximity of anatomical subdivisions in

the target nuclei may not explain the higher incidence of psychiatric effects of STN-

DBS relative to EPN-DBS.

192

The results from immediate early gene mapping also suggest that differences

in side effects of STN vs. GPi are probably not accounted for by differential effects

on limbic projection areas. If DBS applied to the STN were having a greater effect

on activity of limbic areas connected to the target structure, we would expect

pronounced differences in limbic zif268 expression in DBS applied to the two

targets. While zif268 expression was generally altered in the same direction and to

the same extent by DBS of the STN and EPN, there were no significant differences

in zif268 expression in any region of the limbic system between the two DBS targets.

We do, however, report a difference between the STN and EPN in the raphe

nucleus; zif268 expression here was significantly decreased by STN- but not EPN-

DBS. It has previously been shown that STN decreases firing of raphe neurons

(Temel, Boothman et al. 2007; Hartung, Tan et al. 2011). The raphe provide

serotonergic innervation to the forebrain (Parent 1981; Parent, Wallman et al. 2011),

and these discrepant effects of STN- and EPN-DBS on raphe neurons may have

implications for the different depressive-like effects in the rodent. In support of this

idea, acute high-frequency stimulation of the STN has been shown to impair

performance in the forced swim test, a task used to model depressive-like behaviour

(Temel, Boothman et al. 2007). This deficit was prevented by pretreatment with the

SSRI fluoxetine.

Another possible mechanism would involve changes in BDNF regulation. The

neurotrophic theory of stress-related mood disorders posits that stress negatively

regulates BDNF in distinct brain regions including the hippocampus (Schmidt and

Duman 2007; Sen, Duman et al. 2008; Schmidt and Duman 2010; Taliaz, Stall et al.

2010; Hamani, Machado et al. 2011). Decreased BDNF levels have been reported

193

in depressed individuals (Chen, Dowlatshahi et al. 2001; Karege, Vaudan et al.

2005; Duman and Monteggia 2006) and chronically-stressed animals (Roceri,

Hendriks et al. 2002; Koo, Park et al. 2003; Fumagalli, Bedogni et al. 2004; Roceri,

Cirulli et al. 2004). This decrease in BDNF is responsive to antidepressant

treatment, and is thought to contribute to antidepressant response (Saarelainen,

Hendolin et al. 2003; Monteggia, Barrot et al. 2004). Here, we examined the trkB-

BDNF system in three ways: gene expression of trkB and BDNF as well has

hippocampal BDNF levels. Consistent with behavioral results from the LH task,

there were no differences in trkB or BDNF expression in EPN-DBS treated groups

relative to controls. However, rats that underwent STN-DBS exhibited reduced trkB

and BDNF expression in the medial blade of the dentate gyrus. These changes in

hippocampal gene expression were region specific, being most apparent in the

medial blade of the dentate gyrus. This region-specific pattern is consistent with

previous studies reporting that decreased neurotrophin expression in response to

stress is most pronounced in the dentate gyrus (Duman and Monteggia, 2006), and

that knock-down of BDNF in the dentate gyrus, but not other hippocampal regions,

induces depressive-like behaviour in rats (Taliaz et al., 2010).

The regulation of BDNF and trkB can be activity-dependent (Lu 2003;

Nagappan and Lu 2005). STN- but not EPN-DBS reduced zif268 expression in the

DGm, suggesting that STN-DBS-induced decreases in trkB and BNDF expression

may be activity-dependent. Moreover, STN-DBS reduces 5-HT release in the

hippocampus (Navailles, Benazzouz et al. 2010). Consistent with this finding, our

zif268 results suggest that STN- but not EPN-DBS is associated with decreased

activity of the median raphe nucleus (MRN), which provides serotonergic innervation

194

to the hippocampus. Although the interaction between serotonin and BDNF is not

fully understood, it has been reported that serotonin enhances BDNF gene

expression (Martinowich and Lu, 2008). Future studies may determine if decreased

5-HT release in the hippocampus induced by STN-DBS may contributes to lower

BDNF expression in this brain region.

Our results could have significant implications for the choice of DBS target in

patients with movement disorders. To our knowledge, this study is the first to

systematically compare the induction of depressive-like symptoms after chronic DBS

in an animal model. We conclude that in the absence of specific motor pathology,

DBS of the STN is more likely to induce depressive-like effects than is EPN-DBS.

DBS applied to either target does not appear to affect anxiety behavior. While this

study does not define a mechanism by which DBS induces psychiatric effects, we

report that depressive-like symptoms were also correlated with hippocampal BDNF

expression. Finally, our results also suggest it is unlikely that STN-DBS is having

more pronounced effects on neuronal activity in limbic areas, or that decreased in

trkB and BDNF expression in the DG after STN-DBS are strictly activity dependent.

More studies are needed to further elucidate a mechanism for DBS-induced

psychiatric effects.

195

5. Statement of Significance. A primary objective of this overall project was to

compare the STN and EPN as DBS targets, and it has emerged that in the clinic,

DBS may be associated with adverse psychiatric effects. In this section we

established that in intact rats, DBS applied to the STN-, but not EPN impairs

performance in a learned helplessness model of depression. DBS has no effect on

anxiety, as measured by performance in an elevated plus maze. Neuroanatomically,

STN- but not EPN-DBS decreased expression of BDNF and its receptor, TrkB in the

DGm, a brain area in which BDNF signalling has been linked to depression. While

DBS effected zif268 expression in several regions of the basal ganglia, there were

no differences between STN and EPN DBS, except in the raphe nucleus and DGm.

These findings suggest that the EPN exhibits a favourable side effect profile, in

terms of the ability of DBS to induce adverse depressive-like behaviour. Moreover,

like the anti-dyskinetic effects of DBS explored in previous chapters, the psychiatric

effects of EPN- and STN-DBS may act through different neuro-anatomical

substrates.

196

General Discussion

Tardive dyskinesia (TD) is a persistent and debilitating hyperkinetic

movement disorder associated with long-term treatment with classical antipsychotic

drugs. Risk of developing TD increases by approximately 5% per year of treatment

and constitutes a major limitation of antipsychotic therapy (Glazer, Morgenstern et

al. 1990; Glazer, Morgenstern et al. 1993). To date, there are no pharmacotherapies

approved for the treatment of TD (Feltner and Hertzman 1993; Soares and McGrath

1999; Schrader, Peschel et al. 2004). While the incidence of TD is much lower with

newer atypical antipsychotics (Correll et al., 2004), they carry risks of their own,

including agranulocytosis, excessive weight gain, diabetes and potentially fatal

metabolic complications (Haddad and Sharma, 2007). Thus classical antipsychotic

medications are still used, and TD remains a significant clinical problem (Remington,

2007).

Because of its dramatic clinical efficacy, the application of DBS has

progressed quickly, and has been used to treat severe movement and psychiatric

disorders, including PD, dystonia, tremor, dyskinesias, depression, OCD, addiction,

dementia and compulsive behaviour (Lozano, Dostrovsky et al. 2002; Collins,

Lehmann et al. 2010; Krack, Hariz et al. 2010; Holtzheimer and Mayberg 2011;

Tierney, Sankar et al. 2011). Despite this widespread application for movement and

psychiatric disorders, the mechanisms underlying the efficacy of DBS remain poorly

understood. In recent years, these mechanisms have been an area of active

research. However, the majority of preclinical studies have been conducted in

animal models of PD, and as DBS becomes more widely applied, it becomes

increasingly important to disentangle the mechanisms of DBS form underlying basal

197

ganglia pathology associated with dopamine depletion. Moreover, it is emerging that

DBS may be associated with adverse psychiatric effects, such as depression,

anxiety and impulsivity (Krack, Batir et al. 2003; Meissner, Frasier et al. 2011).

In this project, we established that DBS of the STN and EPN effectively

suppresses HAL-induced oral dyskinesias in an animal model of TD, and

investigated mechanisms that might contribute to anti-dyskinetic DBS effects,

including inactivation of the target nucleus, and effects on serotonergic and

dopaminergic transmission in the basal ganglia. Finally, we compared the STN and

EPN in terms of their ability to induce depressive- and anxiety-like behaviour.

Summary of experimental work

In chapter 1, we confirmed our hypothesis that DBS applied to the STN or

EPN effectively suppressed HAL-induced VCMs in an animal model of TD. Despite

promising case reports, no consensus exists as yet regarding optimal stimulation

parameters or neuroanatomical target for DBS in TD. Stimulation of the STN or

EPN resulted in significant reductions in VCM counts at frequencies of 30, 60 or 130

Hz. In the STN DBS groups, effects were significantly more pronounced at 130 Hz

than at lower frequencies, whereas at the EPN the three frequencies were

equipotent. DBS did not affect locomotor activity, and VCMs were not reduced by

inert electrodes, linking these effects to DBS. These results suggest that stimulation

of either the EPN or STN significantly alleviates oral dyskinesias induced by chronic

HAL treatment. We determined that the chronic HAL VCM model preparation can

be used to explore mechanisms underlying the anti-dyskinetic effects of DBS, and

198

determined that 130Hz bilateral DBS are the optimal stimulation parameters to

compare the STN and EPN in subsequent investigations.

A leading hypothesis of the efficacy of DBS is equivalent to functional

inactivation. In chapter 2, we determined that local tissue inactivation using

muscimol injections into the STN or EPN also reduced VCMs, but to a lesser degree

than DBS applied to the same targets. Using zif268 as a neural activity marker, we

found that in HAL-treated animals EPN stimulation increased zif268 mRNA levels in

the globus pallidus (+65%) and substantia nigra compacta (+62%) and reticulata

(+76%), while decreasing levels in the motor cortex and throughout the thalamus. In

contrast, after STN DBS zif268 levels in HAL-treated animals decreased in all basal

ganglia structures, thalamus and motor cortex (range: 29% in the ventrolateral

caudate-putamen to 100% in the EPN). When applied to the EPN muscimol

decreased zif268 levels in substantia nigra (-29%), whereas STN infusions did not

result in significant zif268 changes in any brain area. These results confirm the

effectiveness of DBS in reducing VCMs and suggest that tissue inactivation does not

fully account for DBS effects in this preparation. The divergent effects of STN vs.

EPN manipulations on HAL-induced zif268 changes suggest that similar behavioral

outcomes of DBS in these two areas may involve different neuroanatomical

mechanisms.

In chapter 3, we conducted a series of experiments to determine the

contribution of serotonergic mechanisms to the anti-dyskinetic effects of DBS. We

found that lesions of the dorsal (DRN) raphe nuclei with the serotonergic neurotoxin

5,7-DHT significantly decreased HAL-induced VCMs. Acute administration of the

inhibitory 5HT1A autoreceptor agonist, 8-OH-DPAT, under conditions known to

199

suppress raphe neuronal firing, also reduced VCMs. We also determined that

antagonism of 5HT2C receptors, but not 5-HT2A receptors suppressed VCMs.

Immediate early gene mapping using zif268 in situ hybridization revealed that STN-

DBS inhibited activity of DRN and MRN neurons. Microdialysis experiments

indicated that STN-DBS decreased 5-HT release in the dorsolateral caudate-

putamen, an area implicated in the aetiology of HAL-induced VCMs. DBS applied to

the EPN also suppressed VCMs but did not alter 5-HT release or raphe neuron

activation. While these findings suggested a role for decreased 5-HT release in the

mechanisms of STN-DBS, further experiments showed that when the 5-HT lowering

effects of STN-DBS were prevented by pre-treatment with fluoxetine or fenfluramine,

the ability of DBS to suppress VCMs remained unaltered. These results suggest

that EPN- and STN-DBS have different effects on the 5-HT system. While

decreasing 5-HT function is sufficient to suppress HAL-induced VCMs, 5-HT

decrease is not necessary for the beneficial motor effects of DBS in this model.

In chapter 4, we examined the contribution of dopamine to the anti-dyskinetic

effects of DBS. While STN-DBS produced a transient increase in striatal DA release

in VEH-treated rats, this was not observed in HAL-treated rats. EPN-DBS had no

effect on striatal DA release. STN-DBS altered zif268 expression in the SNc, which

provides dopaminergic innervation to the striatum, whereas EPN-DBS had no effect.

We found that when we elevated DA by systemic treatment of L-DOPA

independently of DBS, VCMs were not suppressed. We concluded that increased

DA does not contribute to the anti-dyskinetic effects of STN- or EPN-DBS.

In the clinic, it is emerging that DBS applied to the STN or EPN for the

treatment of movement disorders is associated with adverse psychiatric effects. In a

200

final series of experiments, in chapter 5 we compared the STN and EPN in terms of

their ability to induce depressive- and anxiety-like behaviours in rats. Rats

underwent chronic DBS (4 hours per day for 21 consecutive days) before being

tested in a learned helplessness or elevated plus maze task, to assess depressive-

and anxiety-like behaviours, respectively. We found that chronic DBS of the STN,

but not of the EPN, led to impaired performance in the learned helplessness

protocol, suggesting that STN-DBS induces or potentiates depressive-like

behaviour. There was no effect of DBS on elevated plus maze or on open field

behaviour. Chronic STN-DBS, but not EPN-DBS, led to decreased levels of BDNF

and trkB mRNA in hippocampus. Acute stimulation of the STN or EPN resulted in

similar decreases in levels of the early gene marker zif268 in several brain areas.

Together these results suggestion that the EPN may be a preferable target for DBS

insofar as it may be associated with a lower incidence of depressive-like behaviour

of STN-DBS. Furthermore, results indicate that the effects of STN- and EPN-DBS

differ in behavioural and neurochemical respects.

Synthesis and significance

Cumulatively, this project has provided the first evidence that DBS can

alleviate orofacial dyskinesias induced by haloperidol in rats. This model system

can thus be used to investigate the mechanisms underlying the efficacy of DBS in

TD, and this project also constitutes the first mechanistic investigations of the anti-

dyskinetic effects of DBS in a pre-clinical model of TD. TD is a debilitating motor

disorder for which there is no reliable pharmacotherapy, and it is therefore urgent

that novel therapies such as DBS are optimized for clinical application. Although

201

DBS is a mainstay treatment for PD, few clinical studies have studied DBS in the

context of TD, although these preliminary results are favourable. In order to

optimize the application for TD, improve patient selection and predict patient

response, the mechanisms underlying its anti-dyskinetic and potential adverse

psychiatric effects must be understood and disentangled.

A consistent result from this series of investigations is that despite their

similar motor effects, EPN- and STN-DBS exert different neurochemical and

neuroanatomical effects. The effects of EPN-DBS on neuronal activity were

restricted to projection areas, and did not affect release of DA or 5-HT in the basal

ganglia. By contrast, STN-DBS induced widespread decreases in neuronal activity

throughout the basal ganglia, while inducing pronounced decreases 5-HT release

and a transient increase in DA release (in intact animals) in the basal ganglia. Based

on our results, there is no evidence to suggest that changes in dopaminergic or

serotonergic transmission contribute to the anti-dyskinetic effects of DBS. Moreover,

while we conclude that DBS induces changes in neuronal activity throughout the

basal ganglia that are not recapitulated by chemical inactivation, we cannot

determine the contribution of these distal changes in neuronal activity to DBS-

induced dyskinetic effects. For this reason, our results are most in agreement with a

leading theory of DBS efficacy, which posits that DBS exerts its effects through

inactivation or interfering with pathological overactivity of the target structure. We

would expect that decreasing activity of the STN or EPN would normalize

pathological overactivity of the indirect basal ganglia output pathway induced by

chronic HAL treatment (Fig 64). The fact that serotonergic and dopaminergic

systems do not significantly contribute to the anti-dyskinetic effects of DBS is also

202

significant, since it suggests that administration of pharmacotherapies that affect

these neurotransmitter systems, such as antipsychotics, L-Dopa or antidepressants

will not interfere with the therapeutic efficacy of DBS.

Our comparison of depressive-like behaviours induced by chronic DBS in

intact rats is consistent with the theme that STN- and EPN-DBS induce different

neurochemical effects. STN-DBS only was associated with induction of depressive-

like behaviours and decreases activity-dependent decreases in BDNF and TrkB

expression in the DGm. This suggests that EPN-DBS may have a superior side

effect profile in terms of liability for adverse psychiatric effects. This finding is

significant as it may be generalizable to DBS applied clinically for other movement

disorders, including PD.

203

Figure 64. Basal ganglia circuitry in TD with DBS. This hypothetical wiring

diagram shows the normal state of the basal ganglia under the conditions of TD, with

DBS applied to the EPN (left) or STN (right). These diagrams demonstrate how

pathological output of the affected nucleus with DBS would correct over-activity of

the indirect basal ganglia output pathway in TD.

204

Conclusions and future directions

In order to optimize the clinical application of DBS for TD, it is necessary to

understand the mechanisms underlying its anti-dyskinetic and adverse psychiatric

effects. This study is the first to establish that DBS attenuates HAL-induced VCMs

in an animal model of TD, and provides the first series of investigations into the

mechanisms underlying these observed anti-dyskinetic effects. We concluded that

EPN- and STN-DBS exert different effects on neuronal activity throughout the basal

ganglia and limbic system, and differentially affected serotonin and dopamine

release in the CPu. We determined that chemical inactivation mimics the

behavioural, but not neurochemical effects of DBS, and that changes in 5-HT and

DA transmission likely do not contribute to the anti-dyskinetic effects of DBS. While

these findings have implications for the optimization of DBS for TD, several

questions remain.

Future studies should address whether treatment with antidepressants can

improve the psychiatric effects associated with STN-DBS, and how underlying

pathology associated with TD or other movement disorders may modulate these

psychiatric effects. While we determined that 5-HT and DA do not account for the

VCM-suppressing effects of DBS, the role of 5-HT and DA changes to the motor

effects of DBS in other movement disorders remains to be investigated. And

certainly it would be important to ascertain whether other neurochemical systems

(GABA, glutamate) may play a role in these effects. A clear association of a

particular neurochemical system with DBS effects would be invaluable to the clinical

improvement of the technique.

205

We also established that DBS, particularly STN-DBS has widespread effects

on activity of the basal-ganglia circuitry. However, we did not determine the

significance of these changes in terms of the anti-dyskinetic effects of DBS. Future

studies should determine if these widespread changes are related to alterations in

neurotransmission, or if they are necessary for the anti-dyskinetic effects of DBS.

Network analyses currently in progress could identify key candidate nodes not only

for the effects of chronic haloperidol but also for the modulation of these effects by

STN- and EPN- DBS. Our studies also did not directly measure neuronal firing rates

in HAL-treated animals, and weather DBS corrects pathological activity induced by

chronic HAL treatment.

This project represents the first pre-clinical experiments aimed at elucidating

the anti-dyskinetic effects of DBS in HAL-treated rats, although further studies will be

required to fully elucidate these mechanisms.

206

References Abilio VC, Silva RH, Carvalho RC, Grassl C, Calzavara MB, Registro S, D'Almeida V,

Ribeiro Rde A and Frussa-Filho R (2004) Important role of striatal catalase in aging- and reserpine-induced oral dyskinesia. Neuropharmacology 47:263-72

Abosch A, Kapur S, Lang AE, Hussey D, Sime E, Miyasaki J, Houle S and Lozano AM (2003) Stimulation of the subthalamic nucleus in Parkinson's disease does not produce striatal dopamine release. Neurosurgery 53:1095-102; discussion 1102-5

Adachi K, Hasegawa M, Fujita S, Sato M, Miwa Y, Ikeda H, Koshikawa N and Cools AR (2002) Dopaminergic and cholinergic stimulation of the ventrolateral striatum elicit rat jaw movements that are funnelled via distinct efferents. Eur J Pharmacol 442:81-92

Adler CM, Malhotra AK, Elman I, Pickar D and Breier A (2002) Amphetamine-induced dopamine release and post-synaptic specific binding in patients with mild tardive dyskinesia. Neuropsychopharmacology 26:295-300

Al-Janabi I, Arranz MJ, Blakemore AI, Saiz PA, Susce MT, Glaser PE, Clark D and de Leon J (2009) Association study of serotonergic gene variants with antipsychotic-induced adverse reactions. Psychiatr Genet 19:305-11

Al Hadithy AF, Ivanova SA, Pechlivanoglou P, Semke A, Fedorenko O, Kornetova E, Ryadovaya L, Brouwers JR, Wilffert B, Bruggeman R and Loonen AJ (2009) Tardive dyskinesia and DRD3, HTR2A and HTR2C gene polymorphisms in Russian psychiatric inpatients from Siberia. Prog Neuropsychopharmacol Biol Psychiatry 33:475-81

Albanese A, Piacentini S, Romito LM, Leone M, Franzini A, Broggi G and Bussone G (2005) Suicide after successful deep brain stimulation for movement disorders. Neurology 65:499-500; author reply 499-500

Albin RL, Young AB and Penney JB (1989) The functional anatomy of basal ganglia disorders. Trends Neurosci 12:366-75

Alex KD and Pehek EA (2007) Pharmacologic mechanisms of serotonergic regulation of dopamine neurotransmission. Pharmacol Ther 113:296-320

Algeri S, Achilli G, Cimino M, Perego C, Ponzio F and Vantini G (1982) Study on some compensatory responses of dopaminergic system in aging rats. Exp Brain Res Suppl 5:146-52

Alterman RL, Miravite J, Weisz D, Shils JL, Bressman SB and Tagliati M (2007) Sixty hertz pallidal deep brain stimulation for primary torsion dystonia. Neurology 69:681-8

Altug F, Acar F, Acar G and Cavlak U (2011) The influence of subthalamic nucleus deep brain stimulation on physical, emotional, cognitive functions and daily living activities in patients with Parkinson's disease. Turk Neurosurg 21:140-6

Anderson ME, Postupna N and Ruffo M (2003) Effects of high-frequency stimulation in the internal globus pallidus on the activity of thalamic neurons in the awake monkey. J Neurophysiol 89:1150-60

Andersson U, Eckernas SA, Hartvig P, Ulin J, Langstrom B and Haggstrom JE (1990) Striatal binding of 11C-NMSP studied with positron emission tomography in patients with persistent tardive dyskinesia: no evidence for altered dopamine D2 receptor binding. J Neural Transm Gen Sect 79:215-26

207

Andreassen O, Ferrante R, Aamo T, Beal M and Jorgensen H (2003a) Oral dyskinesias and histopathological alterations in substantia nigra after long-term haloperidol treatment of old rats. Neuroscience 122:717-25

Andreassen O, Waage J, Finsen B and Jorgensen H (2003b) Memantine attenuates the increase in striatal preproenkephalin mRNA expression and development of haloperidol-induced persistent oral dyskinesias in rats. Brain Res 994:188-92

Andreassen OA, Aamo TO and Joorgensen HA (1996) Inhibition by memantine of the development of persistent oral dyskinesias induced by long-term haloperidol treatment of rats. Br J Pharmacol 119:751-7

Andreassen OA, Ferrante RJ, Beal MF and Jorgensen HA (1998) Oral Dyskinesias and striatal lesions in rats after long-term co-treatment with haloperidol and 3-nitropropionic acid. Neuroscience 87:639-48

Andreassen OA, Finsen B, Ostergaard K, Sorensen JC, West MJ and Jorgensen HA (1999) The relationship between oral dyskinesias produced by long-term haloperidol treatment, the density of striatal preproenkephalin messenger RNA and enkephalin peptide, and the number of striatal neurons expressing preproenkephalin messenger RNA in rats. Neuroscience 88:27-35

Andreassen OA, Finsen B, Ostergaard K, West MJ and Jorgensen HA (2000) Reduced number of striatal neurons expressing preprosomatostatin mRNA in rats with oral dyskinesias after long-term haloperidol administration. Neurosci Lett 279:21-4

Andreassen OA and Jorgensen HA (2000) Neurotoxicity associated with neuroleptic-induced oral dyskinesias in rats. Implications for tardive dyskinesia? Prog Neurobiol 61:525-41

Andreassen OA, Meshul CK, Moore C and Jorgensen HA (2001) Oral dyskinesias and morphological changes in rat striatum during long-term haloperidol administration. Psychopharmacology (Berl) 157:11-9

Antonini A, Landi A, Benti R, Mariani C, De Notaris R, Marotta G, Pezzoli G, Gaini SM and Gerundini P (2003) Functional neuroimaging (PET and SPECT) in the selection and assessment of patients with Parkinson's disease undergoing deep brain stimulation. J Neurosurg Sci 47:40-6

Appleby BS, Duggan PS, Regenberg A and Rabins PV (2007) Psychiatric and neuropsychiatric adverse events associated with deep brain stimulation: A meta-analysis of ten years' experience. Mov Disord 22:1722-8

Archibald NK, Clarke MP, Mosimann UP and Burn DJ (2011) Visual symptoms in Parkinson's disease and Parkinson's disease dementia. Mov Disord 26:2387-95

Ardouin C, Pillon B, Peiffer E, Bejjani P, Limousin P, Damier P, Arnulf I, Benabid AL, Agid Y and Pollak P (1999) Bilateral subthalamic or pallidal stimulation for Parkinson's disease affects neither memory nor executive functions: a consecutive series of 62 patients. Ann Neurol 46:217-23

Auker CR, Meszler RM and Carpenter DO (1983) Apparent discrepancy between single-unit activity and [14C]deoxyglucose labeling in optic tectum of the rattlesnake. J Neurophysiol 49:1504-16

Aziz TZ, Peggs D, Sambrook MA and Crossman AR (1991) Lesion of the subthalamic nucleus for the alleviation of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced parkinsonism in the primate. Mov Disord 6:288-92

208

Bakker PR, van Harten PN and van Os J (2008) Antipsychotic-induced tardive dyskinesia and polymorphic variations in COMT, DRD2, CYP1A2 and MnSOD genes: a meta-analysis of pharmacogenetic interactions. Mol Psychiatry 13:544-56

Baldissera F, Lundberg A and Udo M (1972a) Activity evoked from the mesencephalic tegmentum in descending pathways other than the rubrospinal tract. Exp Brain Res 15:133-50

Baldissera F, Lundberg A and Udo M (1972b) Stimulation of pre- and postsynaptic elements in the red nucleus. Exp Brain Res 15:151-67

Basile VS, Masellis M, Badri F, Paterson AD, Meltzer HY, Lieberman JA, Potkin SG, Macciardi F and Kennedy JL (1999) Association of the MscI polymorphism of the dopamine D3 receptor gene with tardive dyskinesia in schizophrenia. Neuropsychopharmacology 21:17-27

Basile VS, Ozdemir V, Masellis M, Meltzer HY, Lieberman JA, Potkin SG, Macciardi FM, Petronis A and Kennedy JL (2001) Lack of association between serotonin-2A receptor gene (HTR2A) polymorphisms and tardive dyskinesia in schizophrenia. Mol Psychiatry 6:230-4

Bates GD and Khin-Maung-Zaw F (1998) Movement disorder with fluoxetine. J Am Acad Child Adolesc Psychiatry 37:14-5

Baud J and Fagg GE (1986) Glutamate-containing dipeptides do not modulate ligand binding at excitatory amino acid receptors. Neurosci Lett 70:228-33

Beal MF (1992) Mechanisms of excitotoxicity in neurologic diseases. FASEB J 6:3338-44

Bejjani BP, Damier P, Arnulf I, Thivard L, Bonnet AM, Dormont D, Cornu P, Pidoux B, Samson Y and Agid Y (1999) Transient acute depression induced by high-frequency deep-brain stimulation. N Engl J Med 340:1476-80

Benabid AL, Pollak P, Louveau A, Henry S and de Rougemont J (1987) Combined (thalamotomy and stimulation) stereotactic surgery of the VIM thalamic nucleus for bilateral Parkinson disease. Appl Neurophysiol 50:344-6

Benabid AL, Chabardes S, Torres N, Piallat B, Krack P, Fraix V and Pollak P (2009) Functional neurosurgery for movement disorders: a historical perspective. Prog Brain Res 175:379-91

Benazzouz A, Piallat B, Pollak P and Benabid AL (1995) Responses of substantia nigra pars reticulata and globus pallidus complex to high frequency stimulation of the subthalamic nucleus in rats: electrophysiological data. Neurosci Lett 189:77-80

Benazzouz A, Gao D, Ni Z and Benabid AL (2000a) High frequency stimulation of the STN influences the activity of dopamine neurons in the rat. Neuroreport 11:1593-6

Benazzouz A, Gao DM, Ni ZG, Piallat B, Bouali-Benazzouz R and Benabid AL (2000b) Effect of high-frequency stimulation of the subthalamic nucleus on the neuronal activities of the substantia nigra pars reticulata and ventrolateral nucleus of the thalamus in the rat. Neuroscience 99:289-95

Benazzouz A and Hallett M (2000) Mechanism of action of deep brain stimulation. Neurology 55:S13-6

Benes FM, Paskevich PA and Domesick VB (1983) Haloperidol-induced plasticity of axon terminals in rat substantia nigra. Science 221:969-71

209

Benes FM, Paskevich PA, Davidson J and Domesick VB (1985) Synaptic rearrangements in medial prefrontal cortex of haloperidol-treated rats. Brain Res 348:15-20

Benoit-Marand M, Borrelli E and Gonon F (2001) Inhibition of dopamine release via presynaptic D2 receptors: time course and functional characteristics in vivo. J Neurosci 21:9134-41

Bergamo M, Abilio VC, Queiroz CM, Barbosa-Junior HN, Abdanur LR and Frussa-Filho R (1997) Effects of age on a new animal model of tardive dyskinesia. Neurobiol Aging 18:623-9

Bergmann O, Winter C, Meissner W, Harnack D, Kupsch A, Morgenstern R and Reum T (2004) Subthalamic high frequency stimulation induced rotations are differentially mediated by D1 and D2 receptors. Neuropharmacology 46:974-83

Berney A, Vingerhoets F, Perrin A, Guex P, Villemure JG, Burkhard PR, Benkelfat C and Ghika J (2002) Effect on mood of subthalamic DBS for Parkinson's disease: a consecutive series of 24 patients. Neurology 59:1427-9

Berney A, Panisset M, Sadikot AF, Ptito A, Dagher A, Fraraccio M, Savard G, Pell M and Benkelfat C (2007) Mood stability during acute stimulator challenge in Parkinson's disease patients under long-term treatment with subthalamic deep brain stimulation. Mov Disord 22:1093-6

Bertran-Gonzalez J, Bosch C, Maroteaux M, Matamales M, Herve D, Valjent E and Girault JA (2008) Opposing patterns of signaling activation in dopamine D1 and D2 receptor-expressing striatal neurons in response to cocaine and haloperidol. J Neurosci 28:5671-85

Beurrier C, Bioulac B, Audin J and Hammond C (2001) High-frequency stimulation produces a transient blockade of voltage-gated currents in subthalamic neurons. J Neurophysiol 85:1351-6

Bevan MD and Wilson CJ (1999) Mechanisms underlying spontaneous oscillation and rhythmic firing in rat subthalamic neurons. J Neurosci 19:7617-28

Birdno MJ and Grill WM (2008) Mechanisms of deep brain stimulation in movement disorders as revealed by changes in stimulus frequency. Neurotherapeutics 5:14-25

Birthi P, Walters C and Karandikar N (2010) A rare case of tardive dyskinesia and akathisia induced by citalopram. PM R 2:973-5

Bishnoi M, Chopra K and Kulkarni SK (2008) Protective effect of L-type calcium channel blockers against haloperidol-induced orofacial dyskinesia: a behavioural, biochemical and neurochemical study. Neurochem Res 33:1869-80

Blahak C, Wohrle JC, Capelle HH, Bazner H, Grips E, Weigel R, Hennerici MG and Krauss JK (2007) Tremor reduction by subthalamic nucleus stimulation and medication in advanced Parkinson's disease. J Neurol 254:169-78

Blahak C, Bazner H, Capelle HH, Wohrle JC, Weigel R, Hennerici MG and Krauss JK (2009) Rapid response of parkinsonian tremor to STN-DBS changes: direct modulation of oscillatory basal ganglia activity? Mov Disord 24:1221-5

Blanchet PJ, Parent MT, Rompre PH and Levesque D (2012) Relevance of animal models to human tardive dyskinesia. Behav Brain Funct 8:12

Blier P, Steinberg S, Chaput Y and de Montigny C (1989) Electrophysiological assessment of putative antagonists of 5-hydroxytryptamine receptors: a single-cell study in the rat dorsal raphe nucleus. Can J Physiol Pharmacol 67:98-105

210

Blin J, Baron JC, Cambon H, Bonnet AM, Dubois B, Loc'h C, Maziere B and Agid Y (1989) Striatal dopamine D2 receptors in tardive dyskinesia: PET study. J Neurol Neurosurg Psychiatry 52:1248-52

Blomstedt P, Fytagoridis A and Tisch S (2009) Deep brain stimulation of the posterior subthalamic area in the treatment of tremor. Acta Neurochir (Wien) 151:31-6

Boke O, Gunes S, Kara N, Aker S, Sahin AR, Basar Y and Bagci H (2007) Association of serotonin 2A receptor and lack of association of CYP1A2 gene polymorphism with tardive dyskinesia in a Turkish population. DNA Cell Biol 26:527-31

Bolam JP, Wainer BH and Smith AD (1984) Characterization of cholinergic neurons in the rat neostriatum. A combination of choline acetyltransferase immunocytochemistry, Golgi-impregnation and electron microscopy. Neuroscience 12:711-8

Boraud T, Bezard E, Bioulac B and Gross C (1996) High frequency stimulation of the internal Globus Pallidus (GPi) simultaneously improves parkinsonian symptoms and reduces the firing frequency of GPi neurons in the MPTP-treated monkey. Neurosci Lett 215:17-20

Boraud T, Bezard E, Stutzmann JM, Bioulac B and Gross CE (2000) Effects of riluzole on the electrophysiological activity of pallidal neurons in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine-treated monkey. Neurosci Lett 281:75-8

Boulet S. LE, Carcenac C., Feuerstein C., Sgambato-Faure V., Poupard A., Savasta M. (2006) Subthalamic stimulation-induced forelimb dyskinesias are linked to an increase in glutamate levels in the stubstantia nigra pars reticulata. Journal of Neuroscience 26:10768-10776

Bozon B, Davis S and Laroche S (2002) Regulated transcription of the immediate-early gene Zif268: mechanisms and gene dosage-dependent function in synaptic plasticity and memory formation. Hippocampus 12:570-7

Breit S, Schulz JB and Benabid AL (2004) Deep brain stimulation. Cell Tissue Res 318:275-88

Broen M, Duits A, Visser-Vandewalle V, Temel Y and Winogrodzka A (2011) Impulse control and related disorders in Parkinson's disease patients treated with bilateral subthalamic nucleus stimulation: a review. Parkinsonism Relat Disord 17:413-7

Bronstein JM, Tagliati M, Alterman RL, Lozano AM, Volkmann J, Stefani A, Horak FB, Okun MS, Foote KD, Krack P, Pahwa R, Henderson JM, Hariz MI, Bakay RA, Rezai A, Marks WJ, Jr., Moro E, Vitek JL, Weaver FM, Gross RE and DeLong MR (2011) Deep brain stimulation for Parkinson disease: an expert consensus and review of key issues. Arch Neurol 68:165

Bronte-Stewart H, Louie S, Batya S and Henderson JM (2010) Clinical motor outcome of bilateral subthalamic nucleus deep-brain stimulation for Parkinson's disease using image-guided frameless stereotaxy. Neurosurgery 67:1088-93; discussion 1093

Bruet N, Windels F, Bertrand A, Feuerstein C, Poupard A and Savasta M (2001) High frequency stimulation of the subthalamic nucleus increases the extracellular contents of striatal dopamine in normal and partially dopaminergic denervated rats. J Neuropathol Exp Neurol 60:15-24

Bruet N, Windels F, Carcenac C, Feuerstein C, Bertrand A, Poupard A and Savasta M (2003) Neurochemical mechanisms induced by high frequency stimulation of the

211

subthalamic nucleus: increase of extracellular striatal glutamate and GABA in normal and hemiparkinsonian rats. J Neuropathol Exp Neurol 62:1228-40

Bubser M and Deutch AY (2002) Differential effects of typical and atypical antipsychotic drugs on striosome and matrix compartments of the striatum. Eur J Neurosci 15:713-20

Burdick AP, Foote KD, Wu S, Bowers D, Zeilman P, Jacobson CE, Ward HE and Okun MS (2011) Do patient's get angrier following STN, GPi, and thalamic deep brain stimulation. Neuroimage 54 Suppl 1:S227-32

Burkhardt JM, Constantinidis C, Anstrom KK, Roberts DC and Woodward DJ (2007) Synchronous oscillations and phase reorganization in the basal ganglia during akinesia induced by high-dose haloperidol. Eur J Neurosci 26:1912-24

Burt DR, Creese I and Snyder SH (1977) Antischizophrenic drugs: chronic treatment elevates dopamine receptor binding in brain. Science 196:326-8

Butson CR, Cooper SE, Henderson JM and McIntyre CC (2007) Patient-specific analysis of the volume of tissue activated during deep brain stimulation. Neuroimage 34:661-70

Cacciola F, Farah JO, Eldridge PR, Byrne P and Varma TK (2011) Bilateral deep brain stimulation for cervical dystonia: long-term outcome in a series of 10 patients. Neurosurgery 67:957-63

Cadet JL and Kahler LA (1994) Free radical mechanisms in schizophrenia and tardive dyskinesia. Neurosci Biobehav Rev 18:457-67

Caley CF (1998) Extrapyramidal reactions from concurrent SSRI and atypical antipsychotic use. Can J Psychiatry 43:307-8

Capelle HH, Blahak C, Schrader C, Baezner H, Kinfe TM, Herzog J, Dengler R and Krauss JK (2010) Chronic deep brain stimulation in patients with tardive dystonia without a history of major psychosis. Mov Disord 25:1477-81

Caroff SN, Campbell EC, Havey J, Sullivan KA, Mann SC and Gallop R (2001) Treatment of tardive dyskinesia with donepezil: a pilot study. J Clin Psychiatry 62:772-5

Carvalho GA and Nikkhah G (2001) Subthalamic nucleus lesions are neuroprotective against terminal 6-OHDA-induced striatal lesions and restore postural balancing reactions. Exp Neurol 171:405-17

Casey DE (1984) Tardive dyskinesia--animal models. Psychopharmacol Bull 20:376-9 Casey DE (1985) Spontaneous and tardive dyskinesias: clinical and laboratory studies. J

Clin Psychiatry 46:42-7 Casey DE and Keepers GA (1988) Neuroleptic side effects: acute extrapyramidal

syndromes and tardive dyskinesia. Psychopharmacol Ser 5:74-93 Casey DE (1996) Behavioral effects of sertindole, risperidone, clozapine and haloperidol

in Cebus monkeys. Psychopharmacology (Berl) 124:134-40 Casey DE (1997) The relationship of pharmacology to side effects. J Clin Psychiatry 58

Suppl 10:55-62 Casey DE (2000) Tardive dyskinesia: pathophysiology and animal models. J Clin

Psychiatry 61 Suppl 4:5-9 Casey DE (2004) Pathophysiology of antipsychotic drug-induced movement disorders. J

Clin Psychiatry 65 Suppl 9:25-8

212

Castelli L, Zibetti M, Rizzi L, Caglio M, Lanotte M and Lopiano L (2008) Neuropsychiatric symptoms three years after subthalamic DBS in PD patients: a case-control study. J Neurol 255:1515-20

Cates M, Lusk K and Wells BG (1993) Are calcium-channel blockers effective in the treatment of tardive dyskinesia? Ann Pharmacother 27:191-6

Ceballos-Baumann AO, Boecker H, Bartenstein P, von Falkenhayn I, Riescher H, Conrad B, Moringlane JR and Alesch F (1999) A positron emission tomographic study of subthalamic nucleus stimulation in Parkinson disease: enhanced movement-related activity of motor-association cortex and decreased motor cortex resting activity. Arch Neurol 56:997-1003

Ceravolo R, Frosini D, Rossi C and Bonuccelli U (2010) Spectrum of addictions in Parkinson's disease: from dopamine dysregulation syndrome to impulse control disorders. J Neurol 257:S276-83

Cersosimo MG, Raina GB, Benarroch EE, Piedimonte F, Aleman GG and Micheli FE (2009) Micro lesion effect of the globus pallidus internus and outcome with deep brain stimulation in patients with Parkinson disease and dystonia. Mov Disord 24:1488-93

Chakos MH, Shirakawa O, Lieberman J, Lee H, Bilder R and Tamminga CA (1998) Striatal enlargement in rats chronically treated with neuroleptic. Biol Psychiatry 44:675-84

Chan V, Starr PA and Turner RS (2011) Bursts and oscillations as independent properties of neural activity in the parkinsonian globus pallidus internus. Neurobiol Dis 41:2-10

Chang J, Shi L, Luo F and Woodward D (2003) High frequency stimulation of the subthalamic nucleus improves treadmill locomotion in unilateral 6-hydroxydopamine lesioned rats. . Brain Res. 983:174-84

Chang JY, Shi LH, Luo F, Zhang WM and Woodward DJ (2007) Studies of the neural mechanisms of deep brain stimulation in rodent models of Parkinson's disease. Neurosci Biobehav Rev 31:643-57

Chang VC and Chou KL (2006) Deep brain stimulation for Parkinson's disease: patient selection and motor outcomes. Med Health R I 89:142-4

Charles PD, Dolhun RM, Gill CE, Davis TL, Bliton MJ, Tramontana MG, Salomon RM, Wang L, Hedera P, Phibbs FT, Neimat JS and Konrad PE (2012) Deep brain stimulation in early Parkinson's disease: enrollment experience from a pilot trial. Parkinsonism Relat Disord 18:268-73

Chartoff EH, Ward RP and Dorsa DM (1999) Role of adenosine and N-methyl-D-aspartate receptors in mediating haloperidol-induced gene expression and catalepsy. J Pharmacol Exp Ther 291:531-7

Chaudhuri A (1997) Neural activity mapping with inducible transcription factors. Neuroreport 8:v-ix

Chaudhuri A, Zangenehpour S, Rahbar-Dehgan F and Ye F (2000) Molecular maps of neural activity and quiescence. Acta Neurobiol Exp (Wars) 60:403-10

Chen B, Dowlatshahi D, MacQueen GM, Wang JF and Young LT (2001) Increased hippocampal BDNF immunoreactivity in subjects treated with antidepressant medication. Biol Psychiatry 50:260-5

213

Chen CH, Wei FC, Koong FJ and Hsiao KJ (1997) Association of TaqI A polymorphism of dopamine D2 receptor gene and tardive dyskinesia in schizophrenia. Biol Psychiatry 41:827-9

Chen JJ and Swope DM (2005) A case of complex movement disorder induced by fluoxetine with management of dystonia by botulinum toxin type A. J Clin Psychiatry 66:267-8

Chen S, Seeman P and Liu F (2010) Antipsychotic drug binding in the substantia nigra: an examination of high metoclopramide binding in the brains of normal, Alzheimer's disease, Huntington's disease, and Multiple Sclerosis patients, and its relation to tardive dyskinesia. Synapse 65:119-24

Cheramy A, Barbeito L, Godeheu G, Desce JM, Pittaluga A, Galli T, Artaud F and Glowinski J (1990) Respective contributions of neuronal activity and presynaptic mechanisms in the control of the in vivo release of dopamine. J Neural Transm Suppl 29:183-93

Chin GD and Hutchison WD (2008) Effects of cobalt and bicuculline on focal microstimulation of rat pallidal neurons in vivo. Brain Stimul 1:134-50

Chiodo LA and Bunney BS (1983) Typical and atypical neuroleptics: differential effects of chronic administration on the activity of A9 and A10 midbrain dopaminergic neurons. J Neurosci 3:1607-19

Choi DW, Maulucci-Gedde M and Kriegstein AR (1987) Glutamate neurotoxicity in cortical cell culture. J Neurosci 7:357-68

Chong SA, Tan EC, Tan CH, Mahendren R, Tay AH and Chua HC (2000) Tardive dyskinesia is not associated with the serotonin gene polymorphism (5-HTTLPR) in Chinese. Am J Med Genet 96:712-5

Chouinard G and Steinberg S (1982) Type I tardive dyskinesia induced by anticholinergic drugs, dopamine agonists and neuroleptics. Prog Neuropsychopharmacol Biol Psychiatry 6:571-8

Cilia R, Marotta G, Landi A, Isaias IU, Mariani CB, Vergani F, Benti R, Sganzerla E, Pezzoli G and Antonini A (2009) Clinical and cerebral activity changes induced by subthalamic nucleus stimulation in advanced Parkinson's disease: a prospective case-control study. Clin Neurol Neurosurg 111:140-6

Clow A, Jenner P and Marsden CD (1979a) Changes in dopamine-mediated behaviour during one year's neuroleptic administration. Eur J Pharmacol 57:365-75

Clow A, Jenner P, Theodorou A and Marsden CD (1979b) Neuroleptic drugs and the dopamine hypothesis. Lancet 1:934

Cobb WS and Abercrombie ED (2003) Relative involvement of globus pallidus and subthalamic nucleus in the regulation of somatodendritic dopamine release in substantia nigra is dopamine-dependent. Neuroscience 119:777-86

Cochran SM, McKerchar CE, Morris BJ and Pratt JA (2002) Induction of differential patterns of local cerebral glucose metabolism and immediate-early genes by acute clozapine and haloperidol. Neuropharmacology 43:394-407

Colangelo V, Di Grezia R, Passarelli F, Musicco M, Pontieri FE and Orzi F (1997) Differential effects of acute administration of clozapine or haloperidol on local cerebral glucose utilization in the rat. Brain Res 768:273-8

214

Cole AJ, Saffen DW, Baraban JM and Worley PF (1989) Rapid increase of an immediate early gene messenger RNA in hippocampal neurons by synaptic NMDA receptor activation. Nature 340:474-6

Collins KL, Lehmann EM and Patil PG (2010) Deep brain stimulation for movement disorders. Neurobiol Dis 38:338-45

Correll C, Leucht S and Kane J (2004) Lower risk for tardive dyskinesia associated with second-generation antipscyhotics: a systematic review of 1-year studies. . Am J Psychiatry 161:414-425

Correll CU and Schenk EM (2008) Tardive dyskinesia and new antipsychotics. Curr Opin Psychiatry 21:151-6

Covey DP and Garris PA (2009) Using fast-scan cyclic voltammetry to evaluate striatal dopamine release elicited by subthalamic nucleus stimulation. Conf Proc IEEE Eng Med Biol Soc 2009:3306-9

Cowen PJ (2008) Serotonin and depression: pathophysiological mechanism or marketing myth? Trends Pharmacol Sci 29:433-6

Creed-Carson M, Oraha A and Nobrega JN (2011) Effects of 5-HT(2A) and 5-HT(2C) receptor antagonists on acute and chronic dyskinetic effects induced by haloperidol in rats. Behav Brain Res 219:273-9

Creed M, Hamani C and Nobrega JN (2010) Deep brain stimulation of the subthalamic or entopeduncular nucleus attenuates vacuous chewing movements in a rodent model of tardive dyskinesia. Eur Neuropsychopharmacol

Creed M, Hamani C and Nobrega JN (2011a) Deep brain stimulation of the subthalamic or entopeduncular nucleus attenuates vacuous chewing movements in a rodent model of tardive dyskinesia. Eur Neuropsychopharmacol 21:393-400

Creed MC, Hamani C and Nobrega JN (2011b) Early gene mapping after deep brain stimulation in a rat model of tardive dyskinesia: Comparison with transient local inactivation. Eur Neuropsychopharmacol

Crocker AD and Hemsley KM (2001) An animal model of extrapyramidal side effects induced by antipsychotic drugs: relationship with D2 dopamine receptor occupancy. Prog Neuropsychopharmacol Biol Psychiatry 25:573-90

Cummings JL (1992) Depression and Parkinson's disease: a review. Am J Psychiatry 149:443-54

D'Souza DC, Bennett A, Abi-Dargham A and Krystal JH (1994) Precipitation of a psychoneuromotor syndrome by fluoxetine in a haloperidol-treated schizophrenic patient. J Clin Psychopharmacol 14:361-3

Da Cunhaa C, Wietzikoskia, EC., Ferrob, MM., Martinezb, GR., Barbato Frazão Vitala, M.A., Hipólidec, D., Tufikc, S., and Canterasd, N.S. (2008) Hemiparkinsonian rats rotate toward the side with the weaker dopaminergic neurotransmission. . Behavioural Brain Research. 189:364-372

Damier P, Thobois S, Witjas T, Cuny E, Derost P, Raoul S, Mertens P, Peragut JC, Lemaire JJ, Burbaud P, Nguyen JM, Llorca PM and Rascol O (2007) Bilateral deep brain stimulation of the globus pallidus to treat tardive dyskinesia. Arch Gen Psychiatry 64:170-6

Damier P (2009) Drug-induced dyskinesias. Curr Opin Neurol 22:394-9 Daniel DG, Smith K, Hyde T and Egan M (1996) Neuroleptic-induced tardive

dyskinesia. Am J Psychiatry 153:734

215

Davis KD, Taub E, Houle S, Lang AE, Dostrovsky JO, Tasker RR and Lozano AM (1997) Globus pallidus stimulation activates the cortical motor system during alleviation of parkinsonian symptoms. Nat Med 3:671-4

de Boer C and Gaete HP (1992) Neuroleptic malignant syndrome and diabetic keto-acidosis. Br J Psychiatry 161:856-8

de Leon J (2007) The effect of atypical versus typical antipsychotics on tardive dyskinesia: a naturalistic study. Eur Arch Psychiatry Clin Neurosci 257:169-72

Degos B, Deniau JM, Thierry AM, Glowinski J, Pezard L and Maurice N (2005) Neuroleptic-induced catalepsy: electrophysiological mechanisms of functional recovery induced by high-frequency stimulation of the subthalamic nucleus. J Neurosci 25:7687-96

Del Sorbo F and Albanese A (2008) Levodopa-induced dyskinesias and their management. J Neurol 255 Suppl 4:32-41

DeLong M and Wichmann T (2009) Update on models of basal ganglia function and dysfunction. Parkinsonism Relat Disord 15 Suppl 3:S237-40

Deshpande SN, Varma PG, Semwal P, Rao AR, Bhatia T, Nimgaonkar VL, Lerer B and Thelma BK (2005) II. Serotonin receptor gene polymorphisms and their association with tardive dyskinesia among schizophrenia patients from North India. Psychiatr Genet 15:157-8

Di Giovanni G, Di Matteo V, Pierucci M, Benigno A and Esposito E (2006) Serotonin involvement in the basal ganglia pathophysiology: could the 5-HT2C receptor be a new target for therapeutic strategies? Curr Med Chem 13:3069-81

Di Giovanni G, Esposito E and Di Matteo V (2010) Role of serotonin in central dopamine dysfunction. CNS Neurosci Ther 16:179-94

Di Matteo V, Pierucci M, Esposito E, Crescimanno G, Benigno A and Di Giovanni G (2008) Serotonin modulation of the basal ganglia circuitry: therapeutic implication for Parkinson's disease and other motor disorders. Prog Brain Res 172:423-63

Dolder CR, Lacro JP, Dunn LB and Jeste DV (2002) Antipsychotic medication adherence: is there a difference between typical and atypical agents? Am J Psychiatry 159:103-8

Dolzan V, Plesnicar BK, Serretti A, Mandelli L, Zalar B, Koprivsek J and Breskvar K (2007) Polymorphisms in dopamine receptor DRD1 and DRD2 genes and psychopathological and extrapyramidal symptoms in patients on long-term antipsychotic treatment. Am J Med Genet B Neuropsychiatr Genet 144B:809-15

Dostrovsky JO, Levy R, Wu JP, Hutchison WD, Tasker RR and Lozano AM (2000) Microstimulation-induced inhibition of neuronal firing in human globus pallidus. J Neurophysiol 84:570-4

Dostrovsky JO and Lozano AM (2002) Mechanisms of deep brain stimulation. Mov Disord 17 Suppl 3:S63-8

Doucet JP, Nakabeppu Y, Bedard PJ, Hope BT, Nestler EJ, Jasmin BJ, Chen JS, Iadarola MJ, St-Jean M, Wigle N, Blanchet P, Grondin R and Robertson GS (1996) Chronic alterations in dopaminergic neurotransmission produce a persistent elevation of deltaFosB-like protein(s) in both the rodent and primate striatum. Eur J Neurosci 8:365-81

216

Dubovsky SL and Thomas M (1996) Tardive dyskinesia associated with fluoxetine. Psychiatr Serv 47:991-3

Duman CH and Duman RS (2005) Neurobiology and treatment of anxiety: signal transduction and neural plasticity. Handb Exp Pharmacol:305-34

Duman RS (2004) Role of neurotrophic factors in the etiology and treatment of mood disorders. Neuromolecular Med 5:11-25

Duman RS (2005) Neurotrophic factors and regulation of mood: role of exercise, diet and metabolism. Neurobiol Aging 26 Suppl 1:88-93

Duman RS and Monteggia LM (2006) A neurotrophic model for stress-related mood disorders. Biol Psychiatry 59:1116-27

Eastwood SL, Burnet PW and Harrison PJ (1994) Striatal synaptophysin expression and haloperidol-induced synaptic plasticity. Neuroreport 5:677-80

Eastwood SL, Heffernan J and Harrison PJ (1997) Chronic haloperidol treatment differentially affects the expression of synaptic and neuronal plasticity-associated genes. Mol Psychiatry 2:322-9

Eberle-Wang K, Lucki I and Chesselet MF (1996) A role for the subthalamic nucleus in 5-HT2C-induced oral dyskinesia. Neuroscience 72:117-28

Egan MF, Ferguson J and Hyde TM (1996a) Effects of rating parameters on assessment of neuroleptic-induced vacuous chewing movements. Pharmacol Biochem Behav 53:401-10

Egan MF, Hurd Y, Ferguson J, Bachus SE, Hamid EH and Hyde TM (1996b) Pharmacological and neurochemical differences between acute and tardive vacuous chewing movements induced by haloperidol. Psychopharmacology (Berl) 127:337-45

El-Sayeh HG, Lyra da Silva JP, Rathbone J and Soares-Weiser K (2006) Non-neuroleptic catecholaminergic drugs for neuroleptic-induced tardive dyskinesia. Cochrane Database Syst Rev:CD000458

Elble RJ (2009) Tremor: clinical features, pathophysiology, and treatment. Neurol Clin 27:679-95, v-vi

Elkashef AM and Wyatt RJ (1999) Tardive dyskinesia: possible involvement of free radicals and treatment with vitamin E. Schizophr Bull 25:731-40

Eltahawy HA, Feinstein A, Khan F, Saint-Cyr J, Lang AE and Lozano AM (2004) Bilateral globus pallidus internus deep brain stimulation in tardive dyskinesia: a case report. Mov Disord 19:969-72

Evidente VG, Premkumar AP, Adler CH, Caviness JN, Driver-Dunckley E and Lyons MK (2011) Medication dose reductions after pallidal versus subthalamic stimulation in patients with Parkinson's disease. Acta Neurol Scand 124:211-4

Farivar R, Zangenehpour S and Chaudhuri A (2004) Cellular-resolution activity mapping of the brain using immediate-early gene expression. Front Biosci 9:104-9

Fass D, Takimoto K, Mains R and Levitan E (1999) Tonic dopamine inhibition of L-type Ca2+ channel activity reduces alpha1D Ca2+ channel gene expression. J Neurosci 19:3345-52

Faurbye A, Rasch PJ, Petersen PB, Brandborg G and Pakkenberg H (1964) Neurological Symptoms in Pharmacotherapy of Psychoses. Acta Psychiatr Scand 40:10-27

Feltner DE and Hertzman M (1993) Progress in the treatment of tardive dyskinesia: theory and practice. Hosp Community Psychiatry 44:25-34

217

Fenton WS, Blyler CR and Heinssen RK (1997) Determinants of medication compliance in schizophrenia: empirical and clinical findings. Schizophr Bull 23:637-51

Fenton WS and Kane JM (1997) Clinical challenges in the psychopharmacology of schizophrenia. Schizophr Bull 23:563-5

Fenu S, Wardas J and Morelli M (2009) Impulse control disorders and dopamine dysregulation syndrome associated with dopamine agonist therapy in Parkinson's disease. Behav Pharmacol 20:363-79

Fernandez HH and Friedman JH (2003) Classification and treatment of tardive syndromes. Neurologist 9:16-27

Ferre S, O'Connor WT, Fuxe K and Ungerstedt U (1993) The striopallidal neuron: a main locus for adenosine-dopamine interactions in the brain. J Neurosci 13:5402-6

Feuerstein TJ, Kammerer M, Lucking CH and Moser A (2011) Selective GABA release as a mechanistic basis of high-frequency stimulation used for the treatment of neuropsychiatric diseases. Naunyn Schmiedebergs Arch Pharmacol 384:1-20

Fibiger H and Lloyd K (1984) Neurobiological substrates of tardive dyskinesia: The GABA hypothesis. Trends in Neuroscience 7:462-464

Fields JA, Troster AI, Wilkinson SB, Pahwa R and Koller WC (1999) Cognitive outcome following staged bilateral pallidal stimulation for the treatment of Parkinson's disease. Clin Neurol Neurosurg 101:182-8

Fletcher PJ (1995) Effects of combined or separate 5,7-dihydroxytryptamine lesions of the dorsal and median raphe nuclei on responding maintained by a DRL 20s schedule of food reinforcement. Brain Res 675:45-54

Follet K (2004) Comparison of pallidal and subthalamic deep brain stimulation for the treatment of levodopa-induced dyskinesias. . Neurosurg Focus. 17:E3

Follett KA, Weaver FM, Stern M, Hur K, Harris CL, Luo P, Marks WJ, Jr., Rothlind J, Sagher O, Moy C, Pahwa R, Burchiel K, Hogarth P, Lai EC, Duda JE, Holloway K, Samii A, Horn S, Bronstein JM, Stoner G, Starr PA, Simpson R, Baltuch G, De Salles A, Huang GD and Reda DJ (2010) Pallidal versus subthalamic deep-brain stimulation for Parkinson's disease. N Engl J Med 362:2077-91

Frank MJ, Samanta J, Moustafa AA and Sherman SJ (2007) Hold your horses: impulsivity, deep brain stimulation, and medication in parkinsonism. Science 318:1309-12

Fukuda M, Mentis M, Ghilardi MF, Dhawan V, Antonini A, Hammerstad J, Lozano AM, Lang A, Lyons K, Koller W, Ghez C and Eidelberg D (2001a) Functional correlates of pallidal stimulation for Parkinson's disease. Ann Neurol 49:155-64

Fukuda M, Mentis MJ, Ma Y, Dhawan V, Antonini A, Lang AE, Lozano AM, Hammerstad J, Lyons K, Koller WC, Moeller JR and Eidelberg D (2001b) Networks mediating the clinical effects of pallidal brain stimulation for Parkinson's disease: a PET study of resting-state glucose metabolism. Brain 124:1601-9

Fumagalli F, Bedogni F, Perez J, Racagni G and Riva MA (2004) Corticostriatal brain-derived neurotrophic factor dysregulation in adult rats following prenatal stress. Eur J Neurosci 20:1348-54

Funkiewiez A, Ardouin C, Krack P, Fraix V, Van Blercom N, Xie J, Moro E, Benabid AL and Pollak P (2003) Acute psychotropic effects of bilateral subthalamic nucleus stimulation and levodopa in Parkinson's disease. Mov Disord 18:524-30

218

Funkiewiez A, Ardouin C, Caputo E, Krack P, Fraix V, Klinger H, Chabardes S, Foote K, Benabid AL and Pollak P (2004) Long term effects of bilateral subthalamic nucleus stimulation on cognitive function, mood, and behaviour in Parkinson's disease. J Neurol Neurosurg Psychiatry 75:834-9

Funkiewiez A, Ardouin C, Cools R, Krack P, Fraix V, Batir A, Chabardes S, Benabid AL, Robbins TW and Pollak P (2006) Effects of levodopa and subthalamic nucleus stimulation on cognitive and affective functioning in Parkinson's disease. Mov Disord 21:1656-62

Funkiewiez A, Ardouin, C and Krack, P. (2003) Acute psychotropic effects of bilateral subthalamic nucleus stimulation and levodopa in Parkinson’s disease. Mov Disord 18:524-530

Gao XM, Kakigi T, Friedman MB and Tamminga CA (1994) Tiagabine inhibits haloperidol-induced oral dyskinesias in rats. J Neural Transm Gen Sect 95:63-9

Garcia-Barcelo MM, Lam LC, Ungvari GS, Lam VK and Tang WK (2001) Dopamine D3 receptor gene and tardive dyskinesia in Chinese schizophrenic patients. J Neural Transm 108:671-7

Garcia L, Audin J, D'Alessandro G, Bioulac B and Hammond C (2003) Dual effect of high-frequency stimulation on subthalamic neuron activity. J Neurosci 23:8743-51

Gerber PE and Lynd LD (1998) Selective serotonin-reuptake inhibitor-induced movement disorders. Ann Pharmacother 32:692-8

Gerlach J, Lublin H and Peacock L (1996) Extrapyramidal symptoms during long-term treatment with antipsychotics: special focus on clozapine and D1 and D2 dopamine antagonists. Neuropsychopharmacology 14:35S-39S

Gernert M, Hamann M, Bennay M, Loscher W and Richter A (2000) Deficit of striatal parvalbumin-reactive GABAergic interneurons and decreased basal ganglia output in a genetic rodent model of idiopathic paroxysmal dystonia. J Neurosci 20:7052-8

Ghika J VJ, Fankhauser H, Favre J, Assal G, Ghika-Scmid F (1998) Efficiency and safety of bilateral contemporaneous pallidal stimulation

(deep brain stimulation) in levodopa-responsive patients with Parkinson’s disease with severe motor fluctuations: a two-year follow-up review. J Neurosurg 89:713-718

Glazer WM, Morgenstern H, Schooler N, Berkman CS and Moore DC (1990) Predictors of improvement in tardive dyskinesia following discontinuation of neuroleptic medication. Br J Psychiatry 157:585-92

Glazer WM, Morgenstern H and Doucette JT (1993) Predicting the long-term risk of tardive dyskinesia in outpatients maintained on neuroleptic medications. J Clin Psychiatry 54:133-9

Glick S, Ross DA., Hough, LB. (1982) Lateral asymmetry of neurotransmitters in the human brain. Brain Res. 234:53-63

Goetz CG, Klawans HL and Carvey P (1983) Animal models of tardive dyskinesia: their use in the search for new treatment methods. Mod Probl Pharmacopsychiatry 21:5-20

Gradinaru V, Mogri M, Thompson KR, Henderson JM and Deisseroth K (2009) Optical deconstruction of parkinsonian neural circuitry. Science 324:354-9

219

Greenamyre JT (1986) The role of glutamate in neurotransmission and in neurologic disease. Arch Neurol 43:1058-63

Grimm JW, Chapman MA, Zahm DS and See RE (2001) Decreased choline acetyltransferase immunoreactivity in discrete striatal subregions following chronic haloperidol in rats. Synapse 39:51-7

Gross RE and Lozano AM (2000) Advances in neurostimulation for movement disorders. Neurol Res 22:247-58

Gruber D, Trottenberg T, Kivi A, Schoenecker T, Kopp UA, Hoffmann KT, Schneider GH, Kuhn AA and Kupsch A (2009) Long-term effects of pallidal deep brain stimulation in tardive dystonia. Neurology 73:53-8

Gubellini P, Eusebio A, Oueslati A, Melon C, Kerkerian-Le Goff L and Salin P (2006) Chronic high-frequency stimulation of the subthalamic nucleus and L-DOPA treatment in experimental parkinsonism: effects on motor behaviour and striatal glutamate transmission. Eur J Neurosci 24:1802-14

Gunes A, Dahl ML, Spina E and Scordo MG (2008) Further evidence for the association between 5-HT2C receptor gene polymorphisms and extrapyramidal side effects in male schizophrenic patients. Eur J Clin Pharmacol 64:477-82

Gunne LM and Barany S (1976) Haloperidol-induced tardive dyskinesia in monkeys. Psychopharmacology (Berl) 50:237-40

Gunne LM and Haggstrom JE (1983) Reduction of nigral glutamic acid decarboxylase in rats with neuroleptic-induced oral dyskinesia. Psychopharmacology (Berl) 81:191-4

Gunne LM, Haggstrom JE and Sjoquist B (1984) Association with persistent neuroleptic-induced dyskinesia of regional changes in brain GABA synthesis. Nature 309:347-9

Gunne LM, Andersson U, Bondesson U and Johansson P (1986) Spontaneous chewing movements in rats during acute and chronic antipsychotic drug administration. Pharmacol Biochem Behav 25:897-901

Gunne LM and Andren PE (1993) An animal model for coexisting tardive dyskinesia and tardive parkinsonism: a glutamate hypothesis for tardive dyskinesia. Clin Neuropharmacol 16:90-5

Gustafsson B and Jankowska E (1976) Direct and indirect activation of nerve cells by electrical pulses applied extracellularly. J Physiol 258:33-61

Guzey C, Scordo MG, Spina E, Landsem VM and Spigset O (2007) Antipsychotic-induced extrapyramidal symptoms in patients with schizophrenia: associations with dopamine and serotonin receptor and transporter polymorphisms. Eur J Clin Pharmacol 63:233-41

Haberfellner EM (2000) Remission of tardive dyskinesia after changing from flupenthixol to olanzapine. Eur Psychiatry 15:338-9

Haddad P and Sharma S (2007) Adverse effects of atypical antipsychotics : differential risk and clinical implications. . CNS Drugs. 21:911-936

Haffenden A, Khan U, Kiss ZH and Suchowersky O (2007) Surgery for Parkinson's disease improves disability but not impairment components of the UPDRS-II. Parkinsonism Relat Disord 13:399-405

220

Hajos M, Gartside SE, Varga V and Sharp T (2003) In vivo inhibition of neuronal activity in the rat ventromedial prefrontal cortex by midbrain-raphe nuclei: role of 5-HT1A receptors. Neuropharmacology 45:72-81

Halbig TD, Gruber D, Kopp UA, Schneider GH, Trottenberg T and Kupsch A (2005) Pallidal stimulation in dystonia: effects on cognition, mood, and quality of life. J Neurol Neurosurg Psychiatry 76:1713-6

Haleem DJ, Samad N and Haleem MA (2007) Reversal of haloperidol-induced tardive vacuous chewing movements and supersensitive somatodendritic serotonergic response by buspirone in rats. Pharmacol Biochem Behav 87:115-21

Hamani C, Saint-Cyr JA, Fraser J, Kaplitt M and Lozano AM (2004) The subthalamic nucleus in the context of movement disorders. Brain 127:4-20

Hamani C, Diwan M, Macedo CE, Brandao ML, Shumake J, Gonzalez-Lima F, Raymond R, Lozano AM, Fletcher PJ and Nobrega JN (2009) Antidepressant-like effects of medial prefrontal cortex deep brain stimulation in rats. Biol Psychiatry 67:117-24

Hamani C, Diwan M, Macedo CE, Brandao ML, Shumake J, Gonzalez-Lima F, Raymond R, Lozano AM, Fletcher PJ and Nobrega JN (2010) Antidepressant-like effects of medial prefrontal cortex deep brain stimulation in rats. Biol Psychiatry 67:117-24

Hamani C, Machado DC, Hipolide DC, Dubiela FP, Suchecki D, Macedo CE, Tescarollo F, Martins U, Covolan L and Nobrega JN (2011) Deep brain stimulation reverses anhedonic-like behavior in a chronic model of depression: role of serotonin and brain derived neurotrophic factor. Biol Psychiatry 71:30-5

Hamani C, Machado DC, Hipolide DC, Dubiela FP, Suchecki D, Macedo CE, Tescarollo F, Martins U, Covolan L and Nobrega JN (2012) Deep brain stimulation reverses anhedonic-like behavior in a chronic model of depression: role of serotonin and brain derived neurotrophic factor. Biol Psychiatry 71:30-5

Hamann M, Sander SE, Kreil A and Richter A (2010) Effects of pharmacological entopeduncular manipulations on idiopathic dystonia in the dt(sz) mutant hamster. J Neural Transm 117:747-57

Hameleers R, Blokland A, Steinbusch HW, Visser-Vandewalle V and Temel Y (2007) Hypomobility after DOI administration can be reversed by subthalamic nucleus deep brain stimulation. Behav Brain Res 185:65-7

Hamid EH, Hyde TM, Baca SM and Egan MF (1998) Failure to down regulate NMDA receptors in the striatum and nucleus accumbens associated with neuroleptic-induced dyskinesia. Brain Res 796:291-5

Hansen TE, Brown WL, Weigel RM and Casey DE (1988) Risk factors for drug-induced parkinsonism in tardive dyskinesia patients. J Clin Psychiatry 49:139-41

Harnack D, Hamann M, Meissner W, Morgenstern R, Kupsch A and Richter A (2004) High-frequency stimulation of the entopeduncular nucleus improves dystonia in dtsz hamsters. Neuroreport 15:1391-3

Harnack D, Meissner W, Jira JA, Winter C, Morgenstern R and Kupsch A (2008) Placebo-controlled chronic high-frequency stimulation of the subthalamic nucleus preserves dopaminergic nigral neurons in a rat model of progressive Parkinsonism. Exp Neurol 210:257-60

221

Harrison PJ (1999) The neuropathological effects of antipsychotic drugs. Schizophr Res 40:87-99

Hartung H, Tan SK, Steinbusch HM, Temel Y and Sharp T (2011) High-frequency stimulation of the subthalamic nucleus inhibits the firing of juxtacellular labelled 5-HT-containing neurones. Neuroscience 186:135-45

Haslinger B KK, Boecker H, Alesch F, Ceballos-Baumann AO. (2005) Frequency-correlated decreases of motor cortex activity associated with subthalamic nucleus stimulation in Parkinson's disease. Neuroimage. 28:598-606

Heo JH, Lee KM, Paek SH, Kim MJ, Lee JY, Kim JY, Cho SY, Lim YH, Kim MR, Jeong SY and Jeon BS (2008) The effects of bilateral subthalamic nucleus deep brain stimulation (STN DBS) on cognition in Parkinson disease. J Neurol Sci 273:19-24

Herken H, Erdal ME, Boke O and Savas HA (2003) Tardive dyskinesia is not associated with the polymorphisms of 5-HT2A receptor gene, serotonin transporter gene and catechol-o-methyltransferase gene. Eur Psychiatry 18:77-81

Hilker R, Voges J, Ghaemi M, Lehrke R, Rudolf J, Koulousakis A, Herholz K, Wienhard K, Sturm V and Heiss WD (2003) Deep brain stimulation of the subthalamic nucleus does not increase the striatal dopamine concentration in parkinsonian humans. Mov Disord 18:41-8

Hilker R, Portman AT, Voges J, Staal MJ, Burghaus L, van Laar T, Koulousakis A, Maguire RP, Pruim J, de Jong BM, Herholz K, Sturm V, Heiss WD and Leenders KL (2005) Disease progression continues in patients with advanced Parkinson's disease and effective subthalamic nucleus stimulation. J Neurol Neurosurg Psychiatry 76:1217-21

Hilker R, Benecke R, Deuschl G, Fogel W, Kupsch A, Schrader C, Sixel-Doring F, Timmermann L, Volkmann J and Lange M (2009) [Deep brain stimulation for Parkinson's disease. Consensus recommendations of the German Deep Brain Stimulation Association]. Nervenarzt 80:646-55

Hillier CE, Wiles CM and Simpson BA (1999) Thalamotomy for severe antipsychotic induced tardive dyskinesia and dystonia. J Neurol Neurosurg Psychiatry 66:250-1

Holtzheimer PE and Mayberg HS (2011) Deep brain stimulation for psychiatric disorders. Annu Rev Neurosci 34:289-307

Hong S and Hikosaka O (2008) The globus pallidus sends reward-related signals to the lateral habenula. Neuron 60:720-9

Hori H, Ohmori O, Shinkai T, Kojima H and Nakamura J (2001) Association between three functional polymorphisms of dopamine D2 receptor gene and tardive dyskinesia in schizophrenia. Am J Med Genet 105:774-8

Houeto JL, Mallet L, Mesnage V, Tezenas du Montcel S, Behar C, Gargiulo M, Torny F, Pelissolo A, Welter ML and Agid Y (2006) Subthalamic stimulation in Parkinson disease: behavior and social adaptation. Arch Neurol 63:1090-5

Howland RH (2011) Drug therapies for tardive dyskinesia: Part 1. J Psychosoc Nurs Ment Health Serv 49:13-6

Hsieh CJ, Chen YC, Lai MS, Hong CJ and Chien KL (2010) Genetic variability in serotonin receptor and transporter genes may influence risk for tardive dyskinesia in chronic schizophrenia. Psychiatry Res 188:175-6

222

Huot P, Fox SH and Brotchie JM (2011) The serotonergic system in Parkinson's disease. Prog Neurobiol 95:163-212

Hussain N, Flumerfelt BA and Rajakumar N (2001) Glutamatergic regulation of haloperidol-induced c-fos expression in the rat striatum and nucleus accumbens. Neuroscience 102:391-9

Hutchison WD, Lang AE, Dostrovsky JO and Lozano AM (2003) Pallidal neuronal activity: implications for models of dystonia. Ann Neurol 53:480-8

Ikram H, Samad N and Haleem DJ (2007) Neurochemical and behavioral effects of m-CPP in a rat model of tardive dyskinesia. Pak J Pharm Sci 20:188-95

Jabre M, Nohra G, Damier P and Bejjani BP (2008) Does dopamine still have a leading role in advanced Parkinson's disease after subthalamic stimulation? Stereotact Funct Neurosurg 86:184-6

Jackson MJ, Al-Barghouthy G, Pearce RK, Smith L, Hagan JJ and Jenner P (2004) Effect of 5-HT1B/D receptor agonist and antagonist administration on motor function in haloperidol and MPTP-treated common marmosets. Pharmacol Biochem Behav 79:391-400

Jaffer A, van der Spuy GD, Russell VA, Mintz M and Taljaard JJ (1995) Activation of the subthalamic nucleus and pedunculopontine tegmentum: does it affect dopamine levels in the substantia nigra, nucleus accumbens and striatum? Neurodegeneration 4:139-45

Jankowska E, Fu TC and Lundberg A (1975) Reciprocal La inhibition during the late reflexes evoked from the flexor reflex afferents after DOPA. Brain Res 85:99-102

Jech R, Urgosik D, Tintera J, Nebuzelsky A, Krasensky J, Liscak R, Roth J and Ruzicka E (2001) Functional magnetic resonance imaging during deep brain stimulation: a pilot study in four patients with Parkinson's disease. Mov Disord 16:1126-32

Jerussi T, Glick, SD. (1976) Drug-induced rotation in rats without lesions: Behavioral and neurochemical indices of a normal asymmetry in nigro-striatal function. Psychopharmacology 47:249-260

Jeste DV, Lohr JB and Manley M (1992) Study of neuropathologic changes in the striatum following 4, 8 and 12 months of treatment with fluphenazine in rats. Psychopharmacology (Berl) 106:154-60

Jeste DV and Caligiuri MP (1993) Tardive dyskinesia. Schizophr Bull 19:303-15 Jeste DV and Glick ID (2000) Intervention research in psychosis: past, present, and

future. Schizophr Bull 26:527-31 Jeste DV, Okamoto A, Napolitano J, Kane JM and Martinez RA (2000) Low incidence of

persistent tardive dyskinesia in elderly patients with dementia treated with risperidone. Am J Psychiatry 157:1150-5

Johnson MD, Miocinovic S, McIntyre CC and Vitek JL (2008) Mechanisms and targets of deep brain stimulation in movement disorders. Neurotherapeutics 5:294-308

Joseph JA, Filburn CR and Roth GS (1981) Development of dopamine receptor denervation supersensitivity in the neostriatum of the senescent rat. Life Sci 29:575-84

Kaiser R, Tremblay PB, Klufmoller F, Roots I and Brockmoller J (2002) Relationship between adverse effects of antipsychotic treatment and dopamine D(2) receptor polymorphisms in patients with schizophrenia. Mol Psychiatry 7:695-705

223

Kalen P, Karlson M and Wiklund L (1985) Possible excitatory amino acid afferents to nucleus raphe dorsalis of the rat investigated with retrograde wheat germ agglutinin and D-[3H]aspartate tracing. Brain Res 360:285-97

Kalen P, Strecker RE, Rosengren E and Bjorklund A (1988) Endogenous release of neuronal serotonin and 5-hydroxyindoleacetic acid in the caudate-putamen of the rat as revealed by intracerebral dialysis coupled to high-performance liquid chromatography with fluorimetric detection. J Neurochem 51:1422-35

Kane JM, Woerner M and Lieberman J (1988) Tardive dyskinesia: prevalence, incidence, and risk factors. J Clin Psychopharmacol 8:52S-56S

Kapur S, Zipursky RB and Remington G (1999) Clinical and theoretical implications of 5-HT2 and D2 receptor occupancy of clozapine, risperidone, and olanzapine in schizophrenia. Am J Psychiatry 156:286-93

Kapur S, Barsoum SC and Seeman P (2000a) Dopamine D(2) receptor blockade by haloperidol. (3)H-raclopride reveals much higher occupancy than EEDQ. Neuropsychopharmacology 23:595-8

Kapur S, Zipursky R, Jones C, Remington G and Houle S (2000b) Relationship between dopamine D(2) occupancy, clinical response, and side effects: a double-blind PET study of first-episode schizophrenia. Am J Psychiatry 157:514-20

Kapur S and Remington G (2001) Atypical antipsychotics: new directions and new challenges in the treatment of schizophrenia. Annu Rev Med 52:503-17

Karege F, Vaudan G, Schwald M, Perroud N and La Harpe R (2005) Neurotrophin levels in postmortem brains of suicide victims and the effects of antemortem diagnosis and psychotropic drugs. Brain Res Mol Brain Res 136:29-37

Karimi M, Golchin N, Tabbal SD, Hershey T, Videen TO, Wu J, Usche JW, Revilla FJ, Hartlein JM, Wernle AR, Mink JW and Perlmutter JS (2008) Subthalamic nucleus stimulation-induced regional blood flow responses correlate with improvement of motor signs in Parkinson disease. Brain 131:2710-9

Kefalopoulou Z, Paschali A, Markaki E, Vassilakos P, Ellul J and Constantoyannis C (2009) A double-blind study on a patient with tardive dyskinesia treated with pallidal deep brain stimulation. Acta Neurol Scand 119:269-73

Kelley JJ, Gao XM, Tamminga CA and Roberts RC (1997) The effect of chronic haloperidol treatment on dendritic spines in the rat striatum. Exp Neurol 146:471-8

Kelley JJ and Roberts RC (2004) Effects of haloperidol on cholinergic striatal interneurons: relationship to oral dyskinesias. J Neural Transm 111:1075-91

Kerns JM, Sierens DK, Kao LC, Klawans HL and Carvey PM (1992) Synaptic plasticity in the rat striatum following chronic haloperidol treatment. Clin Neuropharmacol 15:488-500

Kessas M, Creed M and Nobrega J (2010) An examination of synaptic proteins following chronic haloperidol in a rat model of tardive dyskinesia

Psychology & Neuroscience 3 Ketai R (1993) Interaction between fluoxetine and neuroleptics. Am J Psychiatry

150:836-7 Khaindrava V, Salin P, Melon C, Ugrumov M, Kerkerian-Le-Goff L and Daszuta A

(2011) High frequency stimulation of the subthalamic nucleus impacts adult neurogenesis in a rat model of Parkinson's disease. Neurobiol Dis 42:284-91

224

Khan M and Farver D (2000) Rapid resolution of antipsychotic-induced tardive dyskinesia with olanzapine. S D J Med 53:65-7

Khiat A, Kuznetsov Y, Blanchet PJ and Boulanger Y (2008) Diffusion-weighted imaging and magnetization transfer imaging of tardive and edentulous orodyskinesia. Mov Disord 23:1281-5

Kirouac GJ, Li S and Mabrouk G (2004) GABAergic projection from the ventral tegmental area and substantia nigra to the periaqueductal gray region and the dorsal raphe nucleus. J Comp Neurol 469:170-84

Kirsch-Darrow L, Marsiske M, Okun MS, Bauer R and Bowers D (2011a) Apathy and depression: separate factors in Parkinson's disease. J Int Neuropsychol Soc 17:1058-66

Kirsch-Darrow L, Zahodne LB, Marsiske M, Okun MS, Foote KD and Bowers D (2011b) The trajectory of apathy after deep brain stimulation: from pre-surgery to 6 months post-surgery in Parkinson's disease. Parkinsonism Relat Disord 17:182-8

Kiss ZH, Mooney DM, Renaud L and Hu B (2002) Neuronal response to local electrical stimulation in rat thalamus: physiological implications for mechanisms of deep brain stimulation. Neuroscience 113:137-43

Kita H and Kitai ST (1994) The morphology of globus pallidus projection neurons in the rat: an intracellular staining study. Brain Res 636:308-19

Kitagawa M, Murata J, Kikuchi S, Sawamura Y, Saito H, Sasaki H and Tashiro K (2000) Deep brain stimulation of subthalamic area for severe proximal tremor. Neurology 55:114-6

Klawans HL, Goetz CG and Carvey P (1983) Animal models of tardive dyskinesias. Clin Neuropharmacol 6:129-35

Klawans HL, Jr. and Rubovits R (1972) An experimental model of tardive dyskinesia. J Neural Transm 33:235-46

Kleiner-Fisman G, Herzog J, Fisman D, Tamma F, Lyons K, Pahwa R, Lang A and Deuschl G (2006) Subthalamic nucleus deep brain stimulation: summary and meta-analysis of outcomes. Mov Disord. 21:S290-304

Klemm WR (1985) Evidence for a cholinergic role in haloperidol-induced catalepsy. Psychopharmacology (Berl) 85:139-42

Klintsova A, Uranova NA, Bruk VP, Khase'lkhorst U and Shenk K (1989) [Effect of long-term administration of haloperidol: ultrastructural changes in the prefrontal cortex]. Zh Nevropatol Psikhiatr Im S S Korsakova 89:110-4

Klintzova AJ, Haselhorst U, Uranova NA, Schenk H and Istomin VV (1989) The effects of haloperidol on synaptic plasticity in rat's medial prefrontal cortex. J Hirnforsch 30:51-7

Klintzova AJ, Uranova NA, Haselhorst U and Schenk H (1990) Synaptic plasticity in rat medial prefrontal cortex under chronic haloperidol treatment produced behavioral sensitization. J Hirnforsch 31:175-9

Koning JP, Vehof J, Burger H, Wilffert B, Al Hadithy A, Alizadeh B, van Harten PN and Snieder H (2012) Association of two DRD2 gene polymorphisms with acute and tardive antipsychotic-induced movement disorders in young Caucasian patients. Psychopharmacology (Berl) 219:727-36

225

Konitsiotis S, Tsironis C, Kiortsis DN and Evangelou A (2006) Effects of N-methyl-D-aspartate receptor antagonism on neuroleptic-induced orofacial dyskinesias. Psychopharmacology (Berl) 185:369-77

Konradi C, Kobierski LA, Nguyen TV, Heckers S and Hyman SE (1993) The cAMP-response-element-binding protein interacts, but Fos protein does not interact, with the proenkephalin enhancer in rat striatum. Proc Natl Acad Sci U S A 90:7005-9

Konradi C and Heckers S (2001) Antipsychotic drugs and neuroplasticity: insights into the treatment and neurobiology of schizophrenia. Biol Psychiatry 50:729-42

Koo JW, Park CH, Choi SH, Kim NJ, Kim HS, Choe JC and Suh YH (2003) The postnatal environment can counteract prenatal effects on cognitive ability, cell proliferation, and synaptic protein expression. FASEB J 17:1556-8

Kosel M, Sturm V, Frick C, Lenartz D, Zeidler G, Brodesser D and Schlaepfer TE (2007) Mood improvement after deep brain stimulation of the internal globus pallidus for tardive dyskinesia in a patient suffering from major depression. J Psychiatr Res 41:801-3

Kostrzewa RM, Huang NY, Kostrzewa JP, Nowak P and Brus R (2007) Modeling tardive dyskinesia: predictive 5-HT2C receptor antagonist treatment. Neurotox Res 11:41-50

Krack P, Batir A, Van Blercom N, Chabardes S, Fraix V, Ardouin C, Koudsie A, Limousin PD, Benazzouz A, LeBas JF, Benabid AL and Pollak P (2003) Five-year follow-up of bilateral stimulation of the subthalamic nucleus in advanced Parkinson's disease. N Engl J Med 349:1925-34

Krack P, Hariz MI, Baunez C, Guridi J and Obeso JA (2010) Deep brain stimulation: from neurology to psychiatry? Trends Neurosci 33:474-84

Kulkarni SK and Naidu PS (2001) Animal models of tardive dyskinesia--a review. Indian J Physiol Pharmacol 45:148-60

Kulkarni SK, Bishnoi M and Chopra K (2009) In vivo microdialysis studies of striatal level of neurotransmitters after haloperidol and chlorpromazine administration. Indian J Exp Biol 47:91-7

L'Hirondel M, Cheramy A, Godeheu G, Artaud F, Saiardi A, Borrelli E and Glowinski J (1998) Lack of autoreceptor-mediated inhibitory control of dopamine release in striatal synaptosomes of D2 receptor-deficient mice. Brain Res 792:253-62

Lacombe E, Carcenac C, Boulet S, Feuerstein C, Bertrand A, Poupard A and Savasta M (2007) High-frequency stimulation of the subthalamic nucleus prolongs the increase in striatal dopamine induced by acute l-3,4-dihydroxyphenylalanine in dopaminergic denervated rats. Eur J Neurosci 26:1670-80

Lacro JP, Dunn LB, Dolder CR, Leckband SG and Jeste DV (2002) Prevalence of and risk factors for medication nonadherence in patients with schizophrenia: a comprehensive review of recent literature. J Clin Psychiatry 63:892-909

Lafreniere-Roula M, Kim E, Hutchison WD, Lozano AM, Hodaie M and Dostrovsky JO (2010) High-frequency microstimulation in human globus pallidus and substantia nigra. Exp Brain Res 205:251-61

Lattuada E, Cavallaro R, Serretti A, Lorenzi C and Smeraldi E (2004) Tardive dyskinesia and DRD2, DRD3, DRD4, 5-HT2A variants in schizophrenia: an association study with repeated assessment. Int J Neuropsychopharmacol 7:489-93

226

Lauterbach EC and Shillcutt SD (1997) Dyskinesia with fluoxetine: tardive or late-onset persistent, acute norfluoxetine dyskinesia? J Clin Psychiatry 58:85-6

Lavoie B and Parent A (1990) Immunohistochemical study of the serotoninergic innervation of the basal ganglia in the squirrel monkey. J Comp Neurol 299:1-16

Le Jeune F, Drapier D, Bourguignon A, Peron J, Mesbah H, Drapier S, Sauleau P, Haegelen C, Travers D, Garin E, Malbert CH, Millet B and Verin M (2009) Subthalamic nucleus stimulation in Parkinson disease induces apathy: a PET study. Neurology 73:1746-51

Lee J and Rajakumar N (2003) Role of NR2B-containing N-methyl-D-aspartate receptors in haloperidol-induced c-Fos expression in the striatum and nucleus accumbens. Neuroscience 122:739-45

Lee JI, Verhagen Metman L, Ohara S, Dougherty PM, Kim JH and Lenz FA (2007) Internal pallidal neuronal activity during mild drug-related dyskinesias in Parkinson's disease: decreased firing rates and altered firing patterns. J Neurophysiol 97:2627-41

Lee KH, Blaha CD, Harris BT, Cooper S, Hitti FL, Leiter JC, Roberts DW and Kim U (2006) Dopamine efflux in the rat striatum evoked by electrical stimulation of the subthalamic nucleus: potential mechanism of action in Parkinson's disease. Eur J Neurosci 23:1005-14

Leelavathi DE, Misra CH, Shelat H and Smith RC (1980) Effects of acute and chronic administration of phencyclidine on dopaminergic receptors in rat striatum. Commun Psychopharmacol 4:417-24

Leentjens AF (2011) The role of dopamine agonists in the treatment of depression in patients with Parkinson's disease: a systematic review. Drugs 71:273-86

Lenders MW, Buschman HP, Vergouwen MD, Steur EN, Kolling P and Hariz M (2005) Long term results of unilateral posteroventral pallidotomy for antipsychotic drug induced tardive dyskinesia. J Neurol Neurosurg Psychiatry 76:1039

Leo RJ (1996) Movement disorders associated with the serotonin selective reuptake inhibitors. J Clin Psychiatry 57:449-54

Levy R, Hutchison WD, Lozano AM and Dostrovsky JO (2000) High-frequency synchronization of neuronal activity in the subthalamic nucleus of parkinsonian patients with limb tremor. J Neurosci 20:7766-75

Levy R, Lang AE, Dostrovsky JO, Pahapill P, Romas J, Saint-Cyr J, Hutchison WD and Lozano AM (2001) Lidocaine and muscimol microinjections in subthalamic nucleus reverse Parkinsonian symptoms. Brain 124:2105-18

Li T, Qadri F and Moser A (2004) Neuronal electrical high frequency stimulation modulates presynaptic GABAergic physiology. Neurosci Lett 371:117-21

Liao DL, Yeh YC, Chen HM, Chen H, Hong CJ and Tsai SJ (2001) Association between the Ser9Gly polymorphism of the dopamine D3 receptor gene and tardive dyskinesia in Chinese schizophrenic patients. Neuropsychobiology 44:95-8

Lidow MS, Song ZM, Castner SA, Allen PB, Greengard P and Goldman-Rakic PS (2001) Antipsychotic treatment induces alterations in dendrite- and spine-associated proteins in dopamine-rich areas of the primate cerebral cortex. Biol Psychiatry 49:1-12

Lim SY, O'Sullivan SS, Kotschet K, Gallagher DA, Lacey C, Lawrence AD, Lees AJ, O'Sullivan DJ, Peppard RF, Rodrigues JP, Schrag A, Silberstein P, Tisch S and

227

Evans AH (2009) Dopamine dysregulation syndrome, impulse control disorders and punding after deep brain stimulation surgery for Parkinson's disease. J Clin Neurosci 16:1148-52

Limousin P, Pollak P, Benazzouz A, Hoffmann D, Le Bas JF, Broussolle E, Perret JE and Benabid AL (1995) Effect of parkinsonian signs and symptoms of bilateral subthalamic nucleus stimulation. Lancet 345:91-5

Limousin P, Greene J, Pollak P, Rothwell J, Benabid A and Frackowiak R (1997) Changes in cerebral activity pattern due to subthalamic nucleus or internal pallidum stimulation in Parkinson’s disease. Ann Neurol 42:283-291

Limousin P, Krack P, Pollak P, Benazzouz A, Ardouin C, Hoffmann D and Benabid AL (1998) Electrical stimulation of the subthalamic nucleus in advanced Parkinson's disease. N Engl J Med 339:1105-11

Lindgren HS, Andersson DR, Lagerkvist S, Nissbrandt H and Cenci MA (2010) L-DOPA-induced dopamine efflux in the striatum and the substantia nigra in a rat model of Parkinson's disease: temporal and quantitative relationship to the expression of dyskinesia. J Neurochem 112:1465-76

Liou YJ, Liao DL, Chen JY, Wang YC, Lin CC, Bai YM, Yu SC, Lin MW and Lai IC (2004) Association analysis of the dopamine D3 receptor gene ser9gly and brain-derived neurotrophic factor gene val66met polymorphisms with antipsychotic-induced persistent tardive dyskinesia and clinical expression in Chinese schizophrenic patients. Neuromolecular Med 5:243-51

Liou YJ, Lai IC, Liao DL, Chen JY, Lin CC, Lin CY, Chen CM, Bai YM, Chen TT and Wang YC (2006) The human dopamine receptor D2 (DRD2) gene is associated with tardive dyskinesia in patients with schizophrenia. Schizophr Res 86:323-5

Liou YJ, Wang YC, Chen JY, Bai YM, Lin CC, Liao DL, Chen TT, Chen ML, Mo GH and Lai IC (2007) Association analysis of polymorphisms in the N-methyl-D-aspartate (NMDA) receptor subunit 2B (GRIN2B) gene and tardive dyskinesia in schizophrenia. Psychiatry Res 153:271-5

Liu HL, Chen HM, Wu YC, Lim SN, Huang CM, Hsu YY, Wai YY and Wu T (2008) False-positive analysis of functional MRI during simulated deep brain stimulation: a phantom study. J Magn Reson Imaging 27:1439-42

Lovlie R, Daly AK, Blennerhassett R, Ferrier N and Steen VM (2000) Homozygosity for the Gly-9 variant of the dopamine D3 receptor and risk for tardive dyskinesia in schizophrenic patients. Int J Neuropsychopharmacol 3:61-65

Lozano A (2001) Deep brain stimulation: challenges to integrating stimulation technology with human neurobiology, neuroplasticity, and neural repair. J Rehabil Res Dev 38:x-xix

Lozano AM, Dostrovsky J, Chen R and Ashby P (2002) Deep brain stimulation for Parkinson's disease: disrupting the disruption. Lancet Neurol 1:225-31

Lozano AM, Snyder BJ, Hamani C, Hutchison WD and Dostrovsky JO (2010) Basal ganglia physiology and deep brain stimulation. Mov Disord 25 Suppl 1:S71-5

Lu B (2003) BDNF and activity-dependent synaptic modulation. Learn Mem 10:86-98 Lubarr N and Bressman S (2011) Treatment of generalized dystonia. Curr Treat Options

Neurol 13:274-89 Lyons MK (2011) Deep brain stimulation: current and future clinical applications. Mayo

Clin Proc 86:662-72

228

MacGibbon GA, Lawlor PA, Bravo R and Dragunow M (1994) Clozapine and haloperidol produce a differential pattern of immediate early gene expression in rat caudate-putamen, nucleus accumbens, lateral septum and islands of Calleja. Brain Res Mol Brain Res 23:21-32

Maesawa S, Kaneoke Y, Kajita Y, Usui N, Misawa N, Nakayama A and Yoshida J (2004) Long-term stimulation of the subthalamic nucleus in hemiparkinsonian rats: neuroprotection of dopaminergic neurons. J Neurosurg 100:679-87

Magarinos-Ascone C, Pazo JH, Macadar O and Buno W (2002) High-frequency stimulation of the subthalamic nucleus silences subthalamic neurons: a possible cellular mechanism in Parkinson's disease. Neuroscience 115:1109-17

Malhotra AK, Murphy GM, Jr. and Kennedy JL (2004) Pharmacogenetics of psychotropic drug response. Am J Psychiatry 161:780-96

Mallet L, Schupbach M, N'Diaye K, Remy P, Bardinet E, Czernecki V, Welter ML, Pelissolo A, Ruberg M, Agid Y and Yelnik J (2007) Stimulation of subterritories of the subthalamic nucleus reveals its role in the integration of the emotional and motor aspects of behavior. Proc Natl Acad Sci U S A 104:10661-6

Manley LD, Kuczenski R, Segal DS, Young SJ and Groves PM (1992) Effects of frequency and pattern of medial forebrain bundle stimulation on caudate dialysate dopamine and serotonin. J Neurochem 58:1491-8

Mann JJ (2003) Neurobiology of suicidal behaviour. Nat Rev Neurosci 4:819-28 Marchese G, Casu MA, Bartholini F, Ruiu S, Saba P, Gessa GL and Pani L (2002) Sub-

chronic treatment with classical but not atypical antipsychotics produces morphological changes in rat nigro-striatal dopaminergic neurons directly related to "early onset" vacuous chewing. Eur J Neurosci 15:1187-96

Marchese G, Bartholini F, Casu MA, Ruiu S, Casti P, Congeddu E, Tambaro S and Pani L (2004) Haloperidol versus risperidone on rat "early onset" vacuous chewing. Behav Brain Res 149:9-16

Margolese HC, Chouinard G, Kolivakis TT, Beauclair L, Miller R and Annable L (2005) Tardive dyskinesia in the era of typical and atypical antipsychotics. Part 2: Incidence and management strategies in patients with schizophrenia. Can J Psychiatry 50:703-14

Margolese HC and Ferreri F (2007) Management of conventional antipsychotic-induced tardive dyskinesia. J Psychiatry Neurosci 32:72

Marin C and Tolosa E (1997) Striatal synaptophysin levels are not indicative of dopaminergic supersensitivity. Neuropharmacology 36:1115-7

Marsalek M (2000) Tardive drug-induced extrapyramidal syndromes. Pharmacopsychiatry 33 Suppl 1:14-33

Martinowich K and Lu B (2008) Interaction between BDNF and serotonin: role in mood disorders. Neuropsychopharmacology 33:73-83

Mata M, Fink DJ, Gainer H, Smith CB, Davidsen L, Savaki H, Schwartz WJ and Sokoloff L (1980) Activity-dependent energy metabolism in rat posterior pituitary primarily reflects sodium pump activity. J Neurochem 34:213-5

Maurice N, Thierry AM, Glowinski J and Deniau JM (2003) Spontaneous and evoked activity of substantia nigra pars reticulata neurons during high-frequency stimulation of the subthalamic nucleus. J Neurosci 23:9929-36

229

McCulloch J, Savaki HE and Sokoloff L (1982) Distribution of effects of haloperidol on energy metabolism in the rat brain. Brain Res 243:81-90

McIntyre CC and Grill WM (1999) Excitation of central nervous system neurons by nonuniform electric fields. Biophys J 76:878-88

McIntyre CC and Grill WM (2002) Extracellular stimulation of central neurons: influence of stimulus waveform and frequency on neuronal output. J Neurophysiol 88:1592-604

McIntyre CC, Savasta M, Kerkerian-Le Goff L and Vitek JL (2004a) Uncovering the mechanism(s) of action of deep brain stimulation: activation, inhibition, or both. Clin Neurophysiol 115:1239-48

McIntyre CC, Savasta M, Walter BL and Vitek JL (2004b) How does deep brain stimulation work? Present understanding and future questions. J Clin Neurophysiol 21:40-50

Mehta A and Chesselet MF (2005) Effect of GABA(A) receptor stimulation in the subthalamic nucleus on motor deficits induced by nigrostriatal lesions in the rat. Exp Neurol 193:110-7

Mehta A, Menalled L and Chesselet MF (2005) Behavioral responses to injections of muscimol into the subthalamic nucleus: temporal changes after nigrostriatal lesions. Neuroscience 131:769-78

Meissner W, Paul G, Reum T, Reese R, Sohr R, Morgenstern R and Kupsch A (2000) The influence of pallidal deep brain stimulation on striatal dopaminergic metabolism in the rat. Neurosci Lett 296:149-52

Meissner W, Reum T, Paul G, Harnack D, Sohr R, Morgenstern R and Kupsch A (2001) Striatal dopaminergic metabolism is increased by deep brain stimulation of the subthalamic nucleus in 6-hydroxydopamine lesioned rats. Neurosci Lett 303:165-8

Meissner W, Harnack D, Paul G, Reum T, Sohr R, Morgenstern R and Kupsch A (2002) Deep brain stimulation of subthalamic neurons increases striatal dopamine metabolism and induces contralateral circling in freely moving 6-hydroxydopamine-lesioned rats. Neurosci Lett 328:105-8

Meissner W, Harnack D, Reese R, Paul G, Reum T, Ansorge M, Kusserow H, Winter C, Morgenstern R and Kupsch A (2003) High-frequency stimulation of the subthalamic nucleus enhances striatal dopamine release and metabolism in rats. J Neurochem 85:601-9

Meissner W, Harnack D, Hoessle N, Bezard E, Winter C, Morgenstern R and Kupsch A (2004) High frequency stimulation of the entopeduncular nucleus has no effect on striatal dopaminergic transmission. Neurochem Int 44:281-6

Meissner WG, Frasier M, Gasser T, Goetz CG, Lozano A, Piccini P, Obeso JA, Rascol O, Schapira A, Voon V, Weiner DM, Tison F and Bezard E (2011) Priorities in Parkinson's disease research. Nat Rev Drug Discov 10:377-93

Meltzer HY, Bastani B, Ramirez L and Matsubara S (1989a) Clozapine: new research on efficacy and mechanism of action. Eur Arch Psychiatry Neurol Sci 238:332-9

Meltzer HY, Matsubara S and Lee JC (1989b) Classification of typical and atypical antipsychotic drugs on the basis of dopamine D-1, D-2 and serotonin2 pKi values. J Pharmacol Exp Ther 251:238-46

230

Meltzer HY and Nash JF (1991) Effects of antipsychotic drugs on serotonin receptors. Pharmacol Rev 43:587-604

Meltzer HY and Gudelsky GA (1992) Dopaminergic and serotonergic effects of clozapine. Implications for a unique clinical profile. Arzneimittelforschung 42:268-72

Meltzer HY (2004) What's atypical about atypical antipsychotic drugs? Curr Opin Pharmacol 4:53-7

Merchant KM, Dobner PR and Dorsa DM (1992) Differential effects of haloperidol and clozapine on neurotensin gene transcription in rat neostriatum. J Neurosci 12:652-63

Merchant KM and Dorsa DM (1993) Differential induction of neurotensin and c-fos gene expression by typical versus atypical antipsychotics. Proc Natl Acad Sci U S A 90:3447-51

Merello M, Cerquetti D, Cammarota A, Tenca E, Artes C, Antico J and Leiguarda R (2004) Neuronal globus pallidus activity in patients with generalised dystonia. Mov Disord 19:548-54

Meshul CK and Casey DE (1989) Regional, reversible ultrastructural changes in rat brain with chronic neuroleptic treatment. Brain Res 489:338-46

Meshul CK, Janowsky A, Casey DE, Stallbaumer RK and Taylor B (1992) Coadministration of haloperidol and SCH-23390 prevents the increase in "perforated" synapses due to either drug alone. Neuropsychopharmacology 7:285-93

Meshul CK, Stallbaumer RK and Allen C (1995) GM1 ganglioside administration partially counteracts the morphological changes associated with haloperidol treatment within the dorsal striatum of the rat. Psychopharmacology (Berl) 121:461-9

Meshul CK, Andreassen OA, Allen C and Jorgensen HA (1996a) Correlation of vacuous chewing movements with morphological changes in rats following 1-year treatment with haloperidol. Psychopharmacology (Berl) 125:238-47

Meshul CK, Bunker GL, Mason JN, Allen C and Janowsky A (1996b) Effects of subchronic clozapine and haloperidol on striatal glutamatergic synapses. J Neurochem 67:1965-73

Miller CH, Mohr F, Umbricht D, Woerner M, Fleischhacker WW and Lieberman JA (1998) The prevalence of acute extrapyramidal signs and symptoms in patients treated with clozapine, risperidone, and conventional antipsychotics. J Clin Psychiatry 59:69-75

Miller R and Chouinard G (1993) Loss of striatal cholinergic neurons as a basis for tardive and L-dopa-induced dyskinesias, neuroleptic-induced supersensitivity psychosis and refractory schizophrenia. Biol Psychiatry 34:713-38

Mintz I, Hammond C, Guibert B and Leviel V (1986) Stimulation of the subthalamic nucleus enhances the release of dopamine in the rat substantia nigra. Brain Res 376:406-8

Misra CH, Shelat HS and Smith RC (1980) Effect of age on adrenergic and dopaminergic receptor binding in rat brain. Life Sci 27:521-6

231

Mitchell IJ, Crossman AR, Liminga U, Andren P and Gunne LM (1992) Regional changes in 2-deoxyglucose uptake associated with neuroleptic-induced tardive dyskinesia in the Cebus monkey. Mov Disord 7:32-7

Mitchell IJ, Cooper AC, Griffiths MR and Cooper AJ (2002) Acute administration of haloperidol induces apoptosis of neurones in the striatum and substantia nigra in the rat. Neuroscience 109:89-99

Miwa H, Fuwa T, Nishi K and Mizuno Y (1998) Effects of the globus pallidus lesion on the induction of c-Fos by dopaminergic drugs in the striatum possibly via pallidostriatal feedback loops. Neurosci Lett 240:167-70

Moghaddam B and Bunney BS (1993) Depolarization inactivation of dopamine neurons: terminal release characteristics. Synapse 14:195-200

Monteggia LM, Barrot M, Powell CM, Berton O, Galanis V, Gemelli T, Meuth S, Nagy A, Greene RW and Nestler EJ (2004) Essential role of brain-derived neurotrophic factor in adult hippocampal function. Proc Natl Acad Sci U S A 101:10827-32

Montgomery EB, Jr. and Baker KB (2000) Mechanisms of deep brain stimulation and future technical developments. Neurol Res 22:259-66

Morelli E, Moore H, Rebello TJ, Gray N, Steele K, Esposito E, Gingrich JA and Ansorge MS (2011) Chronic 5-HT transporter blockade reduces DA signaling to elicit basal ganglia dysfunction. J Neurosci 31:15742-50

Morelli M, Pontieri FE, Linfante I, Orzi F and Di Chiara G (1993) Local cerebral glucose utilization after D1 receptor stimulation in 6-OHDA lesioned rats: effect of sensitization (priming) with a dopaminergic agonist. Synapse 13:264-9

Morgenstern H and Glazer WM (1993) Identifying risk factors for tardive dyskinesia among long-term outpatients maintained with neuroleptic medications. Results of the Yale Tardive Dyskinesia Study. Arch Gen Psychiatry 50:723-33

Moro E, Scerrati M, Romito LM, Roselli R, Tonali P and Albanese A (1999) Chronic subthalamic nucleus stimulation reduces medication requirements in Parkinson's disease. Neurology 53:85-90

Moro E, Esselink RJ, Xie J, Hommel M, Benabid AL and Pollak P (2002) The impact on Parkinson's disease of electrical parameter settings in STN stimulation. Neurology 59:706-13

Moro E, Lozano AM, Pollak P, Agid Y, Rehncrona S, Volkmann J, Kulisevsky J, Obeso JA, Albanese A, Hariz MI, Quinn NP, Speelman JD, Benabid AL, Fraix V, Mendes A, Welter ML, Houeto JL, Cornu P, Dormont D, Tornqvist AL, Ekberg R, Schnitzler A, Timmermann L, Wojtecki L, Gironell A, Rodriguez-Oroz MC, Guridi J, Bentivoglio AR, Contarino MF, Romito L, Scerrati M, Janssens M and Lang AE (2010) Long-term results of a multicenter study on subthalamic and pallidal stimulation in Parkinson's disease. Mov Disord 25:578-86

Moser A, Gieselberg A, Ro B, Keller C and Qadri F (2003) Deep brain stimulation: response to neuronal high frequency stimulation is mediated through GABA(A) receptor activation in rats. Neurosci Lett 341:57-60

Moum SJ, Price CC, Limotai N, Oyama G, Ward H, Jacobson C, Foote KD and Okun MS (2012) Effects of STN and GPi Deep Brain Stimulation on Impulse Control Disorders and Dopamine Dysregulation Syndrome. PLoS One 7:e29768

232

Muller P and Seeman P (1977) Brain neurotransmitter receptors after long-term haloperidol: dopamine, acetylcholine, serotonin, alpha-noradrenergic and naloxone receptors. Life Sci 21:1751-8

Murata J, Kitagawa M, Uesugi H, Saito H, Iwasaki Y, Kikuchi S, Tashiro K and Sawamura Y (2003) Electrical stimulation of the posterior subthalamic area for the treatment of intractable proximal tremor. J Neurosurg 99:708-15

Murata T, Maruoka N, Omata N, Takashima Y, Igarashi K, Kasuya F, Fujibayashi Y and Wada Y (2007) Effects of haloperidol and its pyridinium metabolite on plasma membrane permeability and fluidity in the rat brain. Prog Neuropsychopharmacol Biol Psychiatry 31:848-57

Nagappan G and Lu B (2005) Activity-dependent modulation of the BDNF receptor TrkB: mechanisms and implications. Trends Neurosci 28:464-71

Naidu PS and Kulkarni SK (2001a) Reversal of neuroleptic-induced orofacial dyskinesia by 5-HT3 receptor antagonists. Eur J Pharmacol 420:113-7

Naidu PS and Kulkarni SK (2001b) Effect of 5-HT1A and 5-HT2A/2C receptor modulation on neuroleptic-induced vacuous chewing movements. Eur J Pharmacol 428:81-6

Naidu PS and Kulkarni SK (2001c) Excitatory mechanisms in neuroleptic-induced vacuous chewing movements (VCMs): possible involvement of calcium and nitric oxide. Behav Pharmacol 12:209-16

Nakahara T, Nakamura K, Tsutsumi T, Hashimoto K, Hondo H, Hisatomi S, Motomura K and Uchimura H (1998) Effect of chronic haloperidol treatment on synaptic protein mRNAs in the rat brain. Brain Res Mol Brain Res 61:238-42

Nakanishi H, Kita H and Kitai ST (1987) Electrical membrane properties of rat subthalamic neurons in an in vitro slice preparation. Brain Res 437:35-44

Nambu A, Tokuno H and Takada M (2002) Functional significance of the cortico-subthalamo-pallidal 'hyperdirect' pathway. Neurosci Res 43:111-7

Navailles S, Benazzouz A, Bioulac B, Gross C and De Deurwaerdere P (2010) High-frequency stimulation of the subthalamic nucleus and L-3,4-dihydroxyphenylalanine inhibit in vivo serotonin release in the prefrontal cortex and hippocampus in a rat model of Parkinson's disease. J Neurosci 30:2356-64

Navailles S and De Deurwaerdere P (2011) Presynaptic control of serotonin on striatal dopamine function. Psychopharmacology (Berl) 213:213-42

Navailles S and De Deurwaerdere P (2012) Contribution of serotonergic transmission to the motor and cognitive effects of high-frequency stimulation of the subthalamic nucleus or levodopa in Parkinson's disease. Mol Neurobiol 45:173-85

Neusch C, Böhme V, Riesland N, Althaus M and Moser A (2000) The dopamine D2 receptor agonist alpha-dihydroergocryptine modulates voltage-gated sodium channels in the rat caudate-putamen. Journal of Neural Transmission 107:531-541

Nielsen EB and Lyon M (1978) Evidence for cell loss in corpus striatum after long-term treatment with a neuroleptic drug (flupenithixol) in rats. Psychopharmacology (Berl) 59:85-9

Nowak LG and Bullier J (1998) Axons, but not cell bodies, are activated by electrical stimulation in cortical gray matter. II. Evidence from selective inactivation of cell bodies and axon initial segments. Exp Brain Res 118:489-500

233

Numan S, Lundgren KH, Write DE, Herman JP and Seroogy KB (1995) Increased expression of 5HT2 receptor mRNA in rat striatum following 6-OHDA lesions of the adult nigrostriatal pathway. Molecular Brain Research 29:391-396

Okai D, Samuel M, Askey-Jones S, David AS and Brown RG (2011) Impulse control disorders and dopamine dysregulation in Parkinson's disease: a broader conceptual framework. Eur J Neurol 18:1379-83

Okun MS, Green J, Saben R, Gross R, Foote KD and Vitek JL (2003) Mood changes with deep brain stimulation of STN and GPi: results of a pilot study. J Neurol Neurosurg Psychiatry 74:1584-6

Okun MS and Foote KD (2005) Subthalamic nucleus vs globus pallidus interna deep brain stimulation, the rematch: will pallidal deep brain stimulation make a triumphant return? Arch Neurol 62:533-6

Okun MS, Fernandez HH, Wu SS, Kirsch-Darrow L, Bowers D, Bova F, Suelter M, Jacobson CEt, Wang X, Gordon CW, Jr., Zeilman P, Romrell J, Martin P, Ward H, Rodriguez RL and Foote KD (2009) Cognition and mood in Parkinson's disease in subthalamic nucleus versus globus pallidus interna deep brain stimulation: the COMPARE trial. Ann Neurol 65:586-95

Okun MS, Wu SS, Foote KD, Bowers D, Gogna S, Price C, Malaty I, Rodriguez RL, Jacobson CE and Ward H (2011) Do Stable Patients with a Pre-Morbid Depression History Have a Worse Outcome Following DBS for Parkinson's Disease. Neurosurgery

Osborne PG, O'Connor WT, Beck O and Ungerstedt U (1994) Acute versus chronic haloperidol: relationship between tolerance to catalepsy and striatal and accumbens dopamine, GABA and acetylcholine release. Brain Res 634:20-30

Ostrem JL, Racine CA, Glass GA, Grace JK, Volz MM, Heath SL and Starr PA (2011) Subthalamic nucleus deep brain stimulation in primary cervical dystonia. Neurology 76:870-8

Oueslati A, Sgambato-Faure V, Melon C, Kachidian P, Gubellini P, Amri M, Kerkerian-Le Goff L and Salin P (2007) High-frequency stimulation of the subthalamic nucleus potentiates L-DOPA-induced neurochemical changes in the striatum in a rat model of Parkinson's disease. J Neurosci 27:2377-86

Owen F, Cross AJ, Waddington JL, Poulter M, Gamble SJ and Crow TJ (1980) Dopamine-mediated behaviour and 3H-spiperone binding to striatal membranes in rats after nine months haloperidol administration. Life Sci 26:55-9

Padberg J, Recanzone G, Engle J, Cooke D, Goldring A and Krubitzer L (2010) Lesions in posterior parietal area 5 in monkeys result in rapid behavioral and cortical plasticity. J Neurosci 30:12918-35

Pakkenberg H, Fog R and Nilakantan B (1973) The long-term effect of perphenazine enanthate on the rat brain. Some metabolic and anatomical observations. Psychopharmacologia 29:329-36

Palacios JM and Wiederhold KH (1985) Dopamine D2 receptor agents, but not dopamine D1, modify brain glucose metabolism. Brain Res 327:390-4

Palombo E, Porrino LJ, Bankiewicz KS, Crane AM, Sokoloff L and Kopin IJ (1990) Local cerebral glucose utilization in monkeys with hemiparkinsonism induced by intracarotid infusion of the neurotoxin MPTP. J Neurosci 10:860-9

234

Parent A (1981) Comparative anatomy of the serotoninergic systems. J Physiol (Paris) 77:147-56

Parent M, Wallman MJ, Gagnon D and Parent A (2011) Serotonin innervation of basal ganglia in monkeys and humans. J Chem Neuroanat 41:256-65

Paul G, Reum T, Meissner W, Marburger A, Sohr R, Morgenstern R and Kupsch A (2000) High frequency stimulation of the subthalamic nucleus influences striatal dopaminergic metabolism in the naive rat. Neuroreport 11:441-4

Paxinos G and Watson C (1982a) The Rat Brain in Stereotaxic Coordinates. Paxinos G and Watson C (1982b) The Rat Brain in Stereotaxic Coordinates Paxinos G and Watson C (1998) The rat brain in stereotaxic coordinates. Academic Press Pazo JH, Hocht C, Barcelo AC, Fillipini B and Lomastro MJ (2011) Effect of electrical

and chemical stimulation of the subthalamic nucleus on the release of striatal dopamine. Synapse 64:905-15

Pazos A, Probst A and Palacios JM (1987) Serotonin receptors in the human brain--IV. Autoradiographic mapping of serotonin-2 receptors. Neuroscience 21:123-39

Peixoto MF, Abilio VC, Silva RH and Frussa-Filho R (2003) Effects of valproic acid on an animal model of tardive dyskinesia. Behav Brain Res 142:229-33

Peritogiannis V and Tsouli S (2011) The emerging role of atypical antipsychotics in the treatment of tardive dyskinesia induced by other atypical antipsychotics. J Clin Psychiatry 72:1016; author reply 1016-7

Perlmutter JS, Mink JW, Bastian AJ, Zackowski K, Hershey T, Miyawaki E, Koller W and Videen TO (2002) Blood flow responses to deep brain stimulation of thalamus. Neurology 58:1388-94

Petersen R, Finsen B, Andreassen OA, Zimmer J and Jorgensen HA (2000) No changes in dopamine D(1) receptor mRNA expressing neurons in the dorsal striatum of rats with oral movements induced by long-term haloperidol administration. Brain Res 859:394-7

Peyron C, Petit JM, Rampon C, Jouvet M and Luppi PH (1998) Forebrain afferents to the rat dorsal raphe nucleus demonstrated by retrograde and anterograde tracing methods. Neuroscience 82:443-68

Pillon B, Ardouin C, Damier P, Krack P, Houeto JL, Klinger H, Bonnet AM, Pollak P, Benabid AL and Agid Y (2000) Neuropsychological changes between "off" and "on" STN or GPi stimulation in Parkinson's disease. Neurology 55:411-8

Pillon B, Ardouin C, Dujardin K, Vittini P, Pelissolo A, Cottencin O, Vercueil L, Houeto JL, Krystkowiak P, Agid Y, Destee A, Pollak P and Vidailhet M (2006) Preservation of cognitive function in dystonia treated by pallidal stimulation. Neurology 66:1556-8

Piper M, Abrams GM and Marks WJ, Jr. (2005) Deep brain stimulation for the treatment of Parkinson's disease: overview and impact on gait and mobility. NeuroRehabilitation 20:223-32

Pizzolato G, Soncrant TT and Rapoport SI (1984) Haloperidol and cerebral metabolism in the conscious rat: relation to pharmacokinetics. J Neurochem 43:724-32

Pizzolato G, Soncrant TT, Holloway HW and Rapoport SI (1985a) Reduced metabolic response of the aged rat brain to haloperidol. J Neurosci 5:2831-8

Pizzolato G, Soncrant TT, Larson DM and Rapoport SI (1985b) Reduced metabolic response of the rat brain to haloperidol after chronic treatment. Brain Res 337:1-9

235

Plenz D and Kital ST (1999) A basal ganglia pacemaker formed by the subthalamic nucleus and external globus pallidus. Nature 400:677-82

Ponzio F, Calderini G, Lomuscio G, Vantini G, Toffano G and Algeri S (1982) Changes in monoamines and their metabolite levels in some brain regions of aged rats. Neurobiol Aging 3:23-9

Pralong E, Pollo C, Coubes P, Bloch J, Roulet E, Tetreault MH, Debatisse D and Villemure JG (2005) Electrophysiological characteristics of limbic and motor globus pallidus internus (GPI) neurons in two cases of Lesch-Nyhan syndrome. Neurophysiol Clin 35:168-73

Raja M, Azzoni A and Maisto G (1999) Three cases of improvement of tardive dyskinesia following olanzapine treatment. Int J Neuropsychopharmacol 2:333-334

Rattay F (1986) High frequency electrostimulation of excitable cells. J Theor Biol 123:45-54

Reavill C, Taylor SG, Wood MD, Ashmeade T, Austin NE, Avenell KY, Boyfield I, Branch CL, Cilia J, Coldwell MC, Hadley MS, Hunter AJ, Jeffrey P, Jewitt F, Johnson CN, Jones DN, Medhurst AD, Middlemiss DN, Nash DJ, Riley GJ, Routledge C, Stemp G, Thewlis KM, Trail B, Vong AK and Hagan JJ (2000) Pharmacological actions of a novel, high-affinity, and selective human dopamine D(3) receptor antagonist, SB-277011-A. J Pharmacol Exp Ther 294:1154-65

Redgrave P, Rodriguez M, Smith Y, Rodriguez-Oroz MC, Lehericy S, Bergman H, Agid Y, DeLong MR and Obeso JA (2011) Goal-directed and habitual control in the basal ganglia: implications for Parkinson's disease. Nat Rev Neurosci 11:760-72

Reese R. CG, Nadjar A., Aubert I., Thiolat M., Hamann M., Richter A., Bezard E., Meissner W. (2009) High frequency stimulatio nof the entopeduncular nucleus sets the cortico-basal ganglia network to a new functional state in the dystonic hamster. Neurobiology of disease

Reid MS, O'Connor WT, Herrera-Marschitz M and Ungerstedt U (1990) The effects of intranigral GABA and dynorphin A injections on striatal dopamine and GABA release: evidence that dopamine provides inhibitory regulation of striatal GABA neurons via D2 receptors. Brain Res 519:255-60

Reijnders JS, Ehrt U, Weber WE, Aarsland D and Leentjens AF (2008) A systematic review of prevalence studies of depression in Parkinson's disease. Mov Disord 23:183-9; quiz 313

Remington G (2007) Tardive dyskinesia: eliminated, forgotten, or overshadowed? Curr Opin Psychiatry 20:131-7

Remple MS, Bradenham CH, Kao CC, Charles PD, Neimat JS and Konrad PE (2011) Subthalamic nucleus neuronal firing rate increases with Parkinson's disease progression. Mov Disord 26:1657-62

Reynolds GP, Templeman LA and Zhang ZJ (2005) The role of 5-HT2C receptor polymorphisms in the pharmacogenetics of antipsychotic drug treatment. Prog Neuropsychopharmacol Biol Psychiatry 29:1021-8

Rizos EN, Siafakas N, Katsantoni E, Lazou V, Sakellaropoulos K, Kastania A, Kossida S, Chatzigeorgiou KS, Arsenis G, Zerva L, Katsafouros K and Lykouras L (2009) Association of the dopamine D3 receptor Ser9Gly and of the serotonin 2C

236

receptor gene polymorphisms with tardive dyskinesia in Greeks with chronic schizophrenic disorder. Psychiatr Genet 19:106-7

Rizzone M LM, Bergamasco B, Tavella A, Torre E, Faccani G, Melcarne A, Lopiano L (2001) Deep brain stimulation of the subthalamic nucleus in Parkinson’s disease: effects of variation in stimulation parameters. J Neurol Neurosurg Psychiatry 71:215-219

Robbins MJ, Critchlow HM, Lloyd A, Cilia J, Clarke JD, Bond B, Jones DN and Maycox PR (2008) Differential expression of IEG mRNA in rat brain following acute treatment with clozapine or haloperidol: a semi-quantitative RT-PCR study. J Psychopharmacol 22:536-42

Roberts RC, Gaither LA, Gao XM, Kashyap SM and Tamminga CA (1995) Ultrastructural correlates of haloperidol-induced oral dyskinesias in rat striatum. Synapse 20:234-43

Roberts RC (2001) Effect of chronic olanzapine treatment on striatal synaptic organization. Synapse 39:8-15

Roberts RC, Force M and Kung L (2002) Dopaminergic synapses in the matrix of the ventrolateral striatum after chronic haloperidol treatment. Synapse 45:78-85

Roberts RC and Lapidus B (2003) Ultrastructural correlates of haloperidol-induced oral dyskinesias in rats: a study of unlabeled and enkephalin-labeled striatal terminals. J Neural Transm 110:961-75

Robertson GS and Fibiger HC (1992) Neuroleptics increase c-fos expression in the forebrain: contrasting effects of haloperidol and clozapine. Neuroscience 46:315-28

Robertson GS, Matsumura H and Fibiger HC (1994) Induction patterns of Fos-like immunoreactivity in the forebrain as predictors of atypical antipsychotic activity. J Pharmacol Exp Ther 271:1058-66

Robertson GS and Fibiger HC (1996) Effects of olanzapine on regional C-Fos expression in rat forebrain. Neuropsychopharmacology 14:105-110

Robertson GS, Lee CJ, Sridhar K, Nakabeppu Y, Cheng M, Wang YM and Caron MG (2004) Clozapine-, but not haloperidol-, induced increases in deltaFosB-like immunoreactivity are completely blocked in the striatum of mice lacking D3 dopamine receptors. Eur J Neurosci 20:3189-94

Robinet EA, Geurts M, Maloteaux JM and Pauwels PJ (2001) Chronic treatment with certain antipsychotic drugs preserves upregulation of regulator of G-protein signalling 2 mRNA in rat striatum as opposed to c-fos mRNA. Neurosci Lett 307:45-8

Roceri M, Hendriks W, Racagni G, Ellenbroek BA and Riva MA (2002) Early maternal deprivation reduces the expression of BDNF and NMDA receptor subunits in rat hippocampus. Mol Psychiatry 7:609-16

Roceri M, Cirulli F, Pessina C, Peretto P, Racagni G and Riva MA (2004) Postnatal repeated maternal deprivation produces age-dependent changes of brain-derived neurotrophic factor expression in selected rat brain regions. Biol Psychiatry 55:708-14

Rodriguez JJ, Garcia DR, Nakabeppu Y and Pickel VM (2001) FosB in rat striatum: normal regional distribution and enhanced expression after 6-month haloperidol administration. Synapse 39:122-32

237

Rodriguez RL, Miller K, Bowers D, Crucian G, Wint D, Fernandez H, Foote KD and Okun MS (2005) Mood and cognitive changes with deep brain stimulation. What we know and where we should go. Minerva Med 96:125-44

Rogue P and Vincendon G (1992) Dopamine D2 receptor antagonists induce immediate early genes in the rat striatum. Brain Res Bull 29:469-72

Rosales MG, Flores G, Hernandez S, Martinez-Fong D and Aceves J (1994) Activation of subthalamic neurons produces NMDA receptor-mediated dendritic dopamine release in substantia nigra pars reticulata: a microdialysis study in the rat. Brain Res 645:335-7

Rosengarten H, Bartoszyk GD, Quartermain D and Lin Y (2006) The effect of chronic administration of sarizotan, 5-HT1A agonist/D3/D4 ligand, on haloperidol-induced repetitive jaw movements in rat model of tardive dyskinesia. Prog Neuropsychopharmacol Biol Psychiatry 30:273-9

Rupniak NM, Jenner P and Marsden CD (1985) Pharmacological characterisation of spontaneous or drug-associated purposeless chewing movements in rats. Psychopharmacology (Berl) 85:71-9

Saarelainen T, Hendolin P, Lucas G, Koponen E, Sairanen M, MacDonald E, Agerman K, Haapasalo A, Nawa H, Aloyz R, Ernfors P and Castren E (2003) Activation of the TrkB neurotrophin receptor is induced by antidepressant drugs and is required for antidepressant-induced behavioral effects. J Neurosci 23:349-57

Sagar SM, Sharp FR and Curran T (1988) Expression of c-fos protein in brain: metabolic mapping at the cellular level. Science 240:1328-31

Saint-Cyr JA, Trepanier LL, Kumar R, Lozano AM and Lang AE (2000) Neuropsychological consequences of chronic bilateral stimulation of the subthalamic nucleus in Parkinson's disease. Brain 123 ( Pt 10):2091-108

Salin P, Manrique C, Forni C and Kerkerian-Le Goff L (2002) High-frequency stimulation of the subthalamic nucleus selectively reverses dopamine denervation-induced cellular defects in the output structures of the basal ganglia in the rat. J Neurosci 22:5137-48

Sanci V, Houle S and DaSilva JN (2002) No change in dopamine D1 receptor in vivo binding in rats after sub-chronic haloperidol treatment. Can J Physiol Pharmacol 80:36-41

Sander SE and Richter A (2007) Effects of intrastriatal injections of glutamate receptor antagonists on the severity of paroxysmal dystonia in the dtsz mutant. Eur J Pharmacol 563:102-8

Sandler NH (1996) Tardive dyskinesia associated with fluoxetine. J Clin Psychiatry 57:91

Sasaki T, Kennedy JL and Nobrega JN (1996) Localized changes in GABA receptor-gated chloride channel in rat brain after long-term haloperidol: relation to vacuous chewing movements. Synapse 25:73-79

Sasaki T, Kennedy JL and Nobrega JN (1998) Regional brain changes in [3H]SCH 23390 binding to dopamine D1, receptors after long-term haloperidol treatment: lack of correspondence with the development of vacuous chewing movements. Behav Brain Res 90:125-32

238

Schmidt HD and Duman RS (2007) The role of neurotrophic factors in adult hippocampal neurogenesis, antidepressant treatments and animal models of depressive-like behavior. Behav Pharmacol 18:391-418

Schmidt HD and Duman RS (2010) Peripheral BDNF produces antidepressant-like effects in cellular and behavioral models. Neuropsychopharmacology 35:2378-91

Schneider F, Reske M, Finkelmeyer A, Wojtecki L, Timmermann L, Brosig T, Backes V, Amir-Manavi A, Sturm V, Habel U and Schnitzler A (2010) Predicting acute affective symptoms after deep brain stimulation surgery in Parkinson's disease. Stereotact Funct Neurosurg 88:367-73

Schneider L, Murphy R and Coons E (1982) Lateralization of striatal dopamine (D2) receptors in normal rats. Neurosci Lett. 33:281-4

Schrader C, Peschel T, Petermeyer M, Dengler R and Hellwig D (2004) Unilateral deep brain stimulation of the internal globus pallidus alleviates tardive dyskinesia. Mov Disord 19:583-5

Schrag A, Jahanshahi M and Quinn N (2000) What contributes to quality of life in patients with Parkinson's disease? J Neurol Neurosurg Psychiatry 69:308-12

Schrag A (2004) Psychiatric aspects of Parkinson's disease--an update. J Neurol 251:795-804

Schrock LE, Ostrem JL, Turner RS, Shimamoto SA and Starr PA (2009) The subthalamic nucleus in primary dystonia: single-unit discharge characteristics. J Neurophysiol 102:3740-52

Schulte T, Brecht S, Herdegen T, Illert M, Mehdorn HM and Hamel W (2006) Induction of immediate early gene expression by high-frequency stimulation of the subthalamic nucleus in rats. Neuroscience 138:1377-85

Schwartz WJ, Smith CB, Davidsen L, Savaki H, Sokoloff L, Mata M, Fink DJ and Gainer H (1979) Metabolic mapping of functional activity in the hypothalamo-neurohypophysial system of the rat. Science 205:723-5

See RE, Chapman MA and Meshul CK (1992) Comparison of chronic intermittent haloperidol and raclopride effects on striatal dopamine release and synaptic ultrastructure in rats. Synapse 12:147-54

See RE and Chapman MA (1994) Chronic haloperidol, but not clozapine, produces altered oral movements and increased extracellular glutamate in rats. Eur J Pharmacol 263:269-76

Seeman P (2002) Atypical antipsychotics: mechanism of action. Can J Psychiatry 47:27-38

Seeman P (2010) All roads to schizophrenia lead to dopamine supersensitivity and elevated dopamine D2(high) receptors. CNS Neurosci Ther 17:118-32

Segman RH, Heresco-Levy U, Finkel B, Inbar R, Neeman T, Schlafman M, Dorevitch A, Yakir A, Lerner A, Goltser T, Shelevoy A and Lerer B (2000) Association between the serotonin 2C receptor gene and tardive dyskinesia in chronic schizophrenia: additive contribution of 5-HT2Cser and DRD3gly alleles to susceptibility. Psychopharmacology (Berl) 152:408-13

Segman RH, Heresco-Levy U, Finkel B, Goltser T, Shalem R, Schlafman M, Dorevitch A, Yakir A, Greenberg D, Lerner A and Lerer B (2001) Association between the serotonin 2A receptor gene and tardive dyskinesia in chronic schizophrenia. Mol Psychiatry 6:225-9

239

Segman RH, Goltser T, Heresco-Levy U, Finkel B, Shalem R, Schlafman M, Yakir A, Greenberg D, Strous R, Lerner A, Shelevoy A and Lerer B (2003) Association of dopaminergic and serotonergic genes with tardive dyskinesia in patients with chronic schizophrenia. Pharmacogenomics J 3:277-83

Sen S, Duman R and Sanacora G (2008) Serum brain-derived neurotrophic factor, depression, and antidepressant medications: meta-analyses and implications. Biol Psychiatry 64:527-32

Sgambato-Faure V and Cenci MA (2012) Glutamatergic mechanisms in the dyskinesias induced by pharmacological dopamine replacement and deep brain stimulation for the treatment of Parkinson's disease. Prog Neurobiol 96:69-86

Sharp FR, Sagar SM and Swanson RA (1993) Metabolic mapping with cellular resolution: c-fos vs. 2-deoxyglucose. Crit Rev Neurobiol 7:205-28

Sharp T, Bramwell SR, Clark D and Grahame-Smith DG (1989) In vivo measurement of extracellular 5-hydroxytryptamine in hippocampus of the anaesthetized rat using microdialysis: changes in relation to 5-hydroxytryptaminergic neuronal activity. J Neurochem 53:234-40

Shin DS, Samoilova M, Cotic M, Zhang L, Brotchie JM and Carlen PL (2007) High frequency stimulation or elevated K+ depresses neuronal activity in the rat entopeduncular nucleus. Neuroscience 149:68-86

Shin DS and Carlen PL (2008) Enhanced Ih depresses rat entopeduncular nucleus neuronal activity from high-frequency stimulation or raised Ke+. J Neurophysiol 99:2203-19

Shirayama Y, Chen AC, Nakagawa S, Russell DS and Duman RS (2002) Brain-derived neurotrophic factor produces antidepressant effects in behavioral models of depression. J Neurosci 22:3251-61

Silvestri S, Seeman MV, Negrete JC, Houle S, Shammi CM, Remington GJ, Kapur S, Zipursky RB, Wilson AA, Christensen BK and Seeman P (2000) Increased dopamine D2 receptor binding after long-term treatment with antipsychotics in humans: a clinical PET study. Psychopharmacology (Berl) 152:174-80

Simpson GM (2000) The treatment of tardive dyskinesia and tardive dystonia. J Clin Psychiatry 61 Suppl 4:39-44

Smeding HM, Speelman JD, Koning-Haanstra M, Schuurman PR, Nijssen P, van Laar T and Schmand B (2006) Neuropsychological effects of bilateral STN stimulation in Parkinson disease: a controlled study. Neurology 66:1830-6

Smith Y, Bevan MD, Shink E and Bolam JP (1998) Microcircuitry of the direct and indirect pathways of the basal ganglia. Neuroscience 86:353-87

Soares-Weiser KV and Joy C (2003) Miscellaneous treatments for neuroleptic-induced tardive dyskinesia. Cochrane Database Syst Rev:CD000208

Soares K, Rathbone J and Deeks J (2004) Gamma-aminobutyric acid agonists for neuroleptic-induced tardive dyskinesia. Cochrane Database Syst Rev:CD000203

Soares KV and McGrath JJ (1999) The treatment of tardive dyskinesia--a systematic review and meta-analysis. Schizophr Res 39:1-16; discussion 17-8

Soares KV and McGrath JJ (2001a) Calcium channel blockers for neuroleptic-induced tardive dyskinesia. Cochrane Database Syst Rev:CD000206

Soares KV and McGrath JJ (2001b) Vitamin E for neuroleptic-induced tardive dyskinesia. Cochrane Database Syst Rev:CD000209

240

Soulas T, Gurruchaga JM, Palfi S, Cesaro P, Nguyen JP and Fenelon G (2008) Attempted and completed suicides after subthalamic nucleus stimulation for Parkinson's disease. J Neurol Neurosurg Psychiatry 79:952-4

Spieles-Engemann AL, Behbehani MM, Collier TJ, Wohlgenant SL, Steece-Collier K, Paumier K, Daley BF, Gombash S, Madhavan L, Mandybur GT, Lipton JW, Terpstra BT and Sortwell CE (2010) Stimulation of the rat subthalamic nucleus is neuroprotective following significant nigral dopamine neuron loss. Neurobiol Dis 39:105-15

Srivastava V, Varma PG, Prasad S, Semwal P, Nimgaonkar VL, Lerer B, Deshpande SN and Bk T (2006) Genetic susceptibility to tardive dyskinesia among schizophrenia subjects: IV. Role of dopaminergic pathway gene polymorphisms. Pharmacogenet Genomics 16:111-7

Stahl SM (1999) Introduction: What makes an antipsychotic atypical? J Clin Psychiatry 60 Suppl 10:3-4

Starr PA, Rau GM, Davis V, Marks WJ, Jr., Ostrem JL, Simmons D, Lindsey N and Turner RS (2005) Spontaneous pallidal neuronal activity in human dystonia: comparison with Parkinson's disease and normal macaque. J Neurophysiol 93:3165-76

Starr PA (2008) DBS and dopamine. Comment on "Does dopamine still have a leading role in advanced Parkinson's disease after subthalamic stimulation?" (Stereotact Funct Neurosurg 2008;86: 184-186). Stereotact Funct Neurosurg 86:188

Stavrinou LC, Boviatsis EJ, Leonardos A, Panourias IG and Sakas DE (2011) Current concepts on the mechanisms of dystonia and the beneficial effects of deep brain stimulation. Cent Eur Neurosurg 72:144-8

Steen VM, Lovlie R, MacEwan T and McCreadie RG (1997) Dopamine D3-receptor gene variant and susceptibility to tardive dyskinesia in schizophrenic patients. Mol Psychiatry 2:139-45

Stock G and Kummer P (1981) Long-term application of haloperidol: effects on dopamine and acetylcholine receptors. Int Pharmacopsychiatry 16:144-53

Stoklosa J and Ongur D (2011) Rational antipsychotic choice: weighing the risk of tardive dyskinesia and metabolic syndrome. Harv Rev Psychiatry 19:271-6

Straits-Troster K, Fields JA, Wilkinson SB, Pahwa R, Lyons KE, Koller WC and Troster AI (2000) Health-related quality of life in Parkinson's disease after pallidotomy and deep brain stimulation. Brain Cogn 42:399-416

Strutt AM, Simpson R, Jankovic J and York MK (2011) Changes in cognitive-emotional and physiological symptoms of depression following STN-DBS for the treatment of Parkinson's disease. Eur J Neurol

Su PC, Ma Y, Fukuda M, Mentis MJ, Tseng HM, Yen RF, Liu HM, Moeller JR and Eidelberg D (2001) Metabolic changes following subthalamotomy for advanced Parkinson's disease. Ann Neurol 50:514-20

Sun B, Chen S, Zhan S, Le W and Krahl SE (2007) Subthalamic nucleus stimulation for primary dystonia and tardive dystonia. Acta Neurochir Suppl 97:207-14

Szapacs ME, Mathews TA, Tessarollo L, Ernest Lyons W, Mamounas LA and Andrews AM (2004) Exploring the relationship between serotonin and brain-derived neurotrophic factor: analysis of BDNF protein and extraneuronal 5-HT in mice

241

with reduced serotonin transporter or BDNF expression. J Neurosci Methods 140:81-92

Szczepanik AM and Wilmot CA (1997) Effects of ritanserin on haloperidol-induced dopamine (D2) receptor up-regulation in the rat. Neurosci Lett 231:91-4

Szymanski S, Gur RC, Gallacher F, Mozley LH and Gur RE (1996) Vulnerability to tardive dyskinesia development in schizophrenia: an FDG-PET study of cerebral metabolism. Neuropsychopharmacology 15:567-75

Tai C, Boraud T, Bezard E, Bioulac B, Gross C and Benazzouz A (2003) Electrophysiological and metabolic evidence that high-frequency stimulation of the subthalamic nucleus bridles neuronal activity in the subthalamic nucleus and the substantia nigra reticulata. FASEB J 17:1820-1830

Takeshita S, Kurisu K, Trop L, Arita K, Akimitsu T and Verhoeff NP (2005) Effect of subthalamic stimulation on mood state in Parkinson's disease: evaluation of previous facts and problems. Neurosurg Rev 28:179-86; discussion 187

Taliaz D, Stall N, Dar D and Zangen A (2010) Knockdown of brain-derived neurotrophic factor in specific brain sites precipitates behaviors associated with depression and reduces neurogenesis. Mol Psychiatry 15:80-92

Tammenmaa IA, Sailas E, McGrath JJ, Soares-Weiser K and Wahlbeck K (2004) Systematic review of cholinergic drugs for neuroleptic-induced tardive dyskinesia: a meta-analysis of randomized controlled trials. Prog Neuropsychopharmacol Biol Psychiatry 28:1099-107

Tamminga CA, Thaker GK and Nguyen JA (1989) GABAmimetic treatments for tardive dyskinesia: efficacy and mechanism. Psychopharmacol Bull 25:43-6

Tan SK, Hartung H, Sharp T and Temel Y (2011a) Serotonin-dependent depression in Parkinson's disease: a role for the subthalamic nucleus? Neuropharmacology 61:387-99

Tan SK, Janssen ML, Jahanshahi A, Chouliaras L, Visser-Vandewalle V, Lim LW, Steinbusch HW, Sharp T and Temel Y (2011b) High frequency stimulation of the subthalamic nucleus increases c-fos immunoreactivity in the dorsal raphe nucleus and afferent brain regions. J Psychiatr Res 45:1307-15

Tang F, Costa E and Schwartz JP (1983) Increase of proenkephalin mRNA and enkephalin content of rat striatum after daily injection of haloperidol for 2 to 3 weeks. Proc Natl Acad Sci U S A 80:3841-4

Tang JK, Moro E, Mahant N, Hutchison WD, Lang AE, Lozano AM and Dostrovsky JO (2007) Neuronal firing rates and patterns in the globus pallidus internus of patients with cervical dystonia differ from those with Parkinson's disease. J Neurophysiol 98:720-9

Tanner CM and Klawans HL (1986) Tardive dyskinesia: prevention and treatment. Clin Neuropharmacol 9 Suppl 2:S76-84

Tarsy D and Baldessarini RJ (1973) Pharmacologically induced behavioural supersensitivity to apomorphine. Nat New Biol 245:262-3

Tauscher J, Kufferle B, Asenbaum S, Tauscher-Wisniewski S and Kasper S (2002) Striatal dopamine-2 receptor occupancy as measured with [123I]iodobenzamide and SPECT predicted the occurrence of EPS in patients treated with atypical antipsychotics and haloperidol. Psychopharmacology (Berl) 162:42-9

242

Temel Y, Blokland A, Steinbusch HW and Visser-Vandewalle V (2005) The functional role of the subthalamic nucleus in cognitive and limbic circuits. Prog Neurobiol 76:393-413

Temel Y, Kessels A, Tan S, Topdag A, Boon P and Visser-Vandewalle V (2006a) Behavioural changes after bilateral subthalamic stimulation in advanced Parkinson disease: a systematic review. Parkinsonism Relat Disord 12:265-72

Temel Y, Visser-Vandewalle V, Kaplan S, Kozan R, Daemen MA, Blokland A, Schmitz C and Steinbusch HW (2006b) Protection of nigral cell death by bilateral subthalamic nucleus stimulation. Brain Res 1120:100-5

Temel Y, Boothman LJ, Blokland A, Magill PJ, Steinbusch HW, Visser-Vandewalle V and Sharp T (2007) Inhibition of 5-HT neuron activity and induction of depressive-like behavior by high-frequency stimulation of the subthalamic nucleus. Proc Natl Acad Sci U S A 104:17087-92

Temel Y, Tan S, Visser-Vandewalle V and Sharp T (2009a) Parkinson's disease, DBS and suicide: a role for serotonin? Brain 132:e126; author reply e127

Temel Y, Tan S, Vlamings R, Sesia T, Lim LW, Lardeux S, Visser-Vandewalle V and Baunez C (2009b) Cognitive and limbic effects of deep brain stimulation in preclinical studies. Front Biosci 14:1891-901

Tenback DE and van Harten PN (2011) Epidemiology and risk factors for (tardive) dyskinesia. Int Rev Neurobiol 98:211-30

Terry AV, Jr. and Gearhart DA (2007) Time dependent decreases in central alpha7 nicotinic acetylcholine receptors associated with haloperidol and risperidone treatment in rats. Eur J Pharmacol 571:29-32

Tierney TS, Sankar T and Lozano AM (2011) Deep brain stimulation emerging indications. Prog Brain Res 194:83-95

Timmermann L, Braun M, Groiss S, Wojtecki L, Ostrowski S, Krause H, Pollok B, Sudmeyer M, Ploner M, Gross J, Maarouf M, Voges J, Sturm V and Schnitzler A (2008) Differential effects of levodopa and subthalamic nucleus deep brain stimulation on bradykinesia in Parkinson's disease. Mov Disord 23:218-27

Tommasi G, Lanotte M, Albert U, Zibetti M, Castelli L, Maina G and Lopiano L (2008) Transient acute depressive state induced by subthalamic region stimulation. J Neurol Sci 273:135-8

Troster AI, Fields JA, Wilkinson S, Pahwa R, Koller WC and Lyons KE (2003) Effect of motor improvement on quality of life following subthalamic stimulation is mediated by changes in depressive symptomatology. Stereotact Funct Neurosurg 80:43-7

Troster AI (2009) Neuropsychology of deep brain stimulation in neurology and psychiatry. Front Biosci 14:1857-79

Trottenberg T, Paul G, Meissner W, Maier-Hauff K, Taschner C and Kupsch A (2001) Pallidal and thalamic neurostimulation in severe tardive dystonia. J Neurol Neurosurg Psychiatry 70:557-9

Tsai HT, North KE, West SL and Poole C (2009) The DRD3 rs6280 polymorphism and prevalence of tardive dyskinesia: a meta-analysis. Am J Med Genet B Neuropsychiatr Genet 153B:57-66

243

Turrone P, Remington G and Nobrega JN (2002) The vacuous chewing movement (VCM) model of tardive dyskinesia revisited: is there a relationship to dopamine D(2) receptor occupancy? Neurosci Biobehav Rev 26:361-80

Turrone P, Remington G, Kapur S and Nobrega JN (2003a) Differential effects of within-day continuous vs. transient dopamine D2 receptor occupancy in the development of vacuous chewing movements (VCMs) in rats. Neuropsychopharmacology 28:1433-9

Turrone P, Remington G, Kapur S and Nobrega JN (2003b) The relationship between dopamine D2 receptor occupancy and the vacuous chewing movement syndrome in rats. Psychopharmacology (Berl) 165:166-71

Turrone P, Remington G, Kapur S and Nobrega JN (2005) Continuous but not intermittent olanzapine infusion induces vacuous chewing movements in rats. Biol Psychiatry 57:406-11

Uranova NA, Orlovskaya DD, Apel K, Klintsova AJ, Haselhorst U and Schenk H (1991) Morphometric study of synaptic patterns in the rat caudate nucleus and hippocampus under haloperidol treatment. Synapse 7:253-9

Utsunomiya K, Shinkai T, Sakata S, Yamada K, Chen HI, De Luca V, Hwang R, Ohmori O and Nakamura J (2011) Genetic association between the dopamine D3 receptor gene polymorphism (Ser9Gly) and tardive dyskinesia in patients with schizophrenia: a reevaluation in East Asian populations. Neurosci Lett 507:52-6

Valldeoriola F, Regidor I, Minguez-Castellanos A, Lezcano E, Garcia-Ruiz P, Rojo A, Salvador A, Castro A, Grandas F, Kulisevsky J, Marti MJ, Martinez-Martin P, Relova L, Rumia J, Camara A, Burguera JA, Linazasoro G, de Val JL, Obeso J, Rodriguez-Oroz MC and Tolosa E (2010) Efficacy and safety of pallidal stimulation in primary dystonia: results of the Spanish multicentric study. J Neurol Neurosurg Psychiatry 81:65-9

Van Blercom N CD, Limousin P, Krack P, Benazzouz A, Ardouin C, Koudsie A, Xie J, Benabid AL (1999) Long-term bilateral subthalamic nucleus stimulation for the treatment of Parkinson’s disease. Neurology 52:A271

Varga V, Szekely AD, Csillag A, Sharp T and Hajos M (2001) Evidence for a role of GABA interneurones in the cortical modulation of midbrain 5-hydroxytryptamine neurones. Neuroscience 106:783-92

Varga V, Kocsis B and Sharp T (2003) Electrophysiological evidence for convergence of inputs from the medial prefrontal cortex and lateral habenula on single neurons in the dorsal raphe nucleus. Eur J Neurosci 17:280-6

Vernon AC, Natesan S, Modo M and Kapur S (2011) Effect of chronic antipsychotic treatment on brain structure: a serial magnetic resonance imaging study with ex vivo and postmortem confirmation. Biol Psychiatry 69:936-44

Vernon AC, Natesan S, Crum WR, Cooper JD, Modo M, Williams SC and Kapur S (2012) Contrasting Effects of Haloperidol and Lithium on Rodent Brain Structure: A Magnetic Resonance Imaging Study with Postmortem Confirmation. Biol Psychiatry

Vidailhet M, Vercueil L, Houeto JL, Krystkowiak P, Benabid AL, Cornu P, Lagrange C, Tezenas du Montcel S, Dormont D, Grand S, Blond S, Detante O, Pillon B, Ardouin C, Agid Y, Destee A and Pollak P (2005) Bilateral deep-brain

244

stimulation of the globus pallidus in primary generalized dystonia. N Engl J Med 352:459-67

Vidailhet M, Yelnik J, Lagrange C, Fraix V, Grabli D, Thobois S, Burbaud P, Welter ML, Xie-Brustolin J, Braga MC, Ardouin C, Czernecki V, Klinger H, Chabardes S, Seigneuret E, Mertens P, Cuny E, Navarro S, Cornu P, Benabid AL, Le Bas JF, Dormont D, Hermier M, Dujardin K, Blond S, Krystkowiak P, Destee A, Bardinet E, Agid Y, Krack P, Broussolle E and Pollak P (2009) Bilateral pallidal deep brain stimulation for the treatment of patients with dystonia-choreoathetosis cerebral palsy: a prospective pilot study. Lancet Neurol 8:709-17

Vita A and De Peri L (2007) The effects of antipsychotic treatment on cerebral structure and function in schizophrenia. Int Rev Psychiatry 19:429-36

Vitek JL, Zhang J, Evatt M, Mewes K, DeLong MR, Hashimoto T, Triche S and Bakay RA (1998) GPi pallidotomy for dystonia: clinical outcome and neuronal activity. Adv Neurol 78:211-9

Vitek JL, Chockkan V, Zhang JY, Kaneoke Y, Evatt M, DeLong MR, Triche S, Mewes K, Hashimoto T and Bakay RA (1999) Neuronal activity in the basal ganglia in patients with generalized dystonia and hemiballismus. Ann Neurol 46:22-35

Vitek JL (2002a) Deep brain stimulation for Parkinson's disease. A critical re-evaluation of STN versus GPi DBS. Stereotact Funct Neurosurg 78:119-31

Vitek JL (2002b) Mechanisms of deep brain stimulation: excitation or inhibition. Mov Disord 17 Suppl 3:S69-72

Vitek JL (2008) Deep brain stimulation: how does it work? Cleve Clin J Med 75 Suppl 2:S59-65

Volkmann J (2004) Deep brain stimulation for the treatment of Parkinson's disease. . J Clin Neurophysiol. 21:6-17

Volkmann J, Albanese A, Kulisevsky J, Tornqvist AL, Houeto JL, Pidoux B, Bonnet AM, Mendes A, Benabid AL, Fraix V, Van Blercom N, Xie J, Obeso J, Rodriguez-Oroz MC, Guridi J, Schnitzler A, Timmermann L, Gironell AA, Molet J, Pascual-Sedano B, Rehncrona S, Moro E, Lang AC, Lozano AM, Bentivoglio AR, Scerrati M, Contarino MF, Romito L, Janssens M and Agid Y (2009) Long-term effects of pallidal or subthalamic deep brain stimulation on quality of life in Parkinson's disease. Mov Disord 24:1154-61

Voon V, Kubu C, Krack P, Houeto JL and Troster AI (2006) Deep brain stimulation: neuropsychological and neuropsychiatric issues. Mov Disord 21 Suppl 14:S305-27

Voon V, Krack P, Lang AE, Lozano AM, Dujardin K, Schupbach M, D'Ambrosia J, Thobois S, Tamma F, Herzog J, Speelman JD, Samanta J, Kubu C, Rossignol H, Poon YY, Saint-Cyr JA, Ardouin C and Moro E (2008) A multicentre study on suicide outcomes following subthalamic stimulation for Parkinson's disease. Brain 131:2720-8

Waddington JL, O'Callaghan E, Buckley P, Madigan C, Redmond O, Stack JP, Kinsella A, Larkin C and Ennis JT (1995) Tardive dyskinesia in schizophrenia. Relationship to minor physical anomalies, frontal lobe dysfunction and cerebral structure on magnetic resonance imaging. Br J Psychiatry 167:41-4

245

Wadenberg ML, Kapur S, Soliman A, Jones C and Vaccarino F (2000) Dopamine D2 receptor occupancy predicts catalepsy and the suppression of conditioned avoidance response behavior in rats. Psychopharmacology (Berl) 150:422-9

Walker RH, Koch RJ, Moore C and Meshul CK (2009) Subthalamic nucleus stimulation and lesioning have distinct state-dependent effects upon striatal dopamine metabolism. Synapse 63:136-46

Wallace BA, Ashkan K, Heise CE, Foote KD, Torres N, Mitrofanis J and Benabid AL (2007) Survival of midbrain dopaminergic cells after lesion or deep brain stimulation of the subthalamic nucleus in MPTP-treated monkeys. Brain 130:2129-45

Wang X, Chang C, Geng N, Li N, Wang J, Ma J, Xue W, Zhao W, Wu H, Wang P and Gao G (2009) Long-term effects of bilateral deep brain stimulation of the subthalamic nucleus on depression in patients with Parkinson's disease. Parkinsonism Relat Disord 15:587-91

Wang Y, Turnbull I, Calne S, Stoessl AJ and Calne DB (1997) Pallidotomy for tardive dyskinesia. Lancet 349:777-8

Ward RP and Dorsa DM (1996) Colocalization of serotonin receptor subtypes 5-HT2A, 5-HT2C, and 5-HT6 with neuropeptides in rat striatum. J Comp Neurol 370:405-14

Waziri R (1980) Lateralization of neuroleptic-induced dyskinesia indicates pharmacologic asymmetry in the brain. Psychopharmacology 68:51-53

Weetman J, Anderson IM, Gregory RP and Gill SS (1997) Bilateral posteroventral pallidotomy for severe antipsychotic induced tardive dyskinesia and dystonia. J Neurol Neurosurg Psychiatry 63:554-6

Welter ML, Grabli D and Vidailhet M (2010) Deep brain stimulation for hyperkinetics disorders: dystonia, tardive dyskinesia, and tics. Curr Opin Neurol 23:420-5

Wichmann T and DeLong MR (2003) Functional neuroanatomy of the basal ganglia in Parkinson's disease. Adv Neurol 91:9-18

Wilson JM, Nobrega JN, Carroll ME, Niznik HB, Shannak K, Lac ST, Pristupa ZB, Dixon LM and Kish SJ (1994) Heterogeneous subregional binding patterns of 3H-WIN 35,428 and 3H-GBR 12,935 are differentially regulated by chronic cocaine self-administration. J Neurosci 14:2966-79

Windels F, Bruet N, Poupard A, Urbain N, Chouvet G, Feuerstein C and Savasta M (2000) Effects of high frequency stimulation of subthalamic nucleus on extracellular glutamate and GABA in substantia nigra and globus pallidus in the normal rat. Eur J Neurosci 12:4141-6

Windels F, Bruet N, Poupard A, Feuerstein C, Bertrand A and Savasta M (2003) Influence of the frequency parameter on extracellular glutamate and gamma-aminobutyric acid in substantia nigra and globus pallidus during electrical stimulation of subthalamic nucleus in rats. J Neurosci Res 72:259-67

Windels F, Carcenac C, Poupard A and Savasta M (2005) Pallidal origin of GABA release within the substantia nigra pars reticulata during high-frequency stimulation of the subthalamic nucleus. J Neurosci 25:5079-86

Winter C, Lemke C, Sohr R, Meissner W, Harnack D, Juckel G, Morgenstern R and Kupsch A (2008) High frequency stimulation of the subthalamic nucleus

246

modulates neurotransmission in limbic brain regions of the rat. Exp Brain Res 185:497-507

Wirtshafter D (1998) Clozapine antagonizes the induction of striatal Fos expression by typical neuroleptics. Eur J Pharmacol 358:R1-3

Witt K, Daniels C, Herzog J, Lorenz D, Volkmann J, Reiff J, Mehdorn M, Deuschl G and Krack P (2006) Differential effects of L-dopa and subthalamic stimulation on depressive symptoms and hedonic tone in Parkinson's disease. J Neuropsychiatry Clin Neurosci 18:397-401

Witt K, Daniels C, Reiff J, Krack P, Volkmann J, Pinsker MO, Krause M, Tronnier V, Kloss M, Schnitzler A, Wojtecki L, Botzel K, Danek A, Hilker R, Sturm V, Kupsch A, Karner E and Deuschl G (2008) Neuropsychological and psychiatric changes after deep brain stimulation for Parkinson's disease: a randomised, multicentre study. Lancet Neurol 7:605-14

Wolf WA, Bieganski GJ, Guillen V and Mignon L (2005) Enhanced 5-HT2C receptor signaling is associated with haloperidol-induced "early onset" vacuous chewing in rats: implications for antipsychotic drug therapy. Psychopharmacology (Berl) 182:84-94

Wooten GF and Collins RC (1981) Metabolic effects of unilateral lesion of the substantia nigra. J Neurosci 1:285-91

Wotanis J, Hanak SE, Wettstein JG and Black MD (2003) Comparative analysis of acute and chronic administration of haloperidol and clozapine using [3H] 2-deoxyglucose metabolic mapping. Schizophr Res 61:195-205

Wu YR, Levy R, Ashby P, Tasker RR and Dostrovsky JO (2001) Does stimulation of the GPi control dyskinesia by activating inhibitory axons? Mov Disord 16:208-16

Xie J, Krack P, Benabid AL and Pollak P (2001) Effect of bilateral subthalamic nucleus stimulation on parkinsonian gait. J Neurol 248:1068-72

Yassa R and Jeste DV (1992) Gender differences in tardive dyskinesia: a critical review of the literature. Schizophr Bull 18:701-15

Young CD, Bubser M, Meltzer HY and Deutch AY (1999) Clozapine pretreatment modifies haloperidol-elicited forebrain Fos induction: a regionally-specific double dissociation. Psychopharmacology (Berl) 144:255-63

Zahodne LB, Okun MS, Foote KD, Fernandez HH, Rodriguez RL, Wu SS, Kirsch-Darrow L, Jacobson CEt, Rosado C and Bowers D (2009) Greater improvement in quality of life following unilateral deep brain stimulation surgery in the globus pallidus as compared to the subthalamic nucleus. J Neurol 256:1321-9

Zai CC, De Luca V, Hwang RW, Voineskos A, Muller DJ, Remington G and Kennedy JL (2007a) Meta-analysis of two dopamine D2 receptor gene polymorphisms with tardive dyskinesia in schizophrenia patients. Mol Psychiatry 12:794-5

Zai CC, Hwang RW, De Luca V, Muller DJ, King N, Zai GC, Remington G, Meltzer HY, Lieberman JA, Potkin SG and Kennedy JL (2007b) Association study of tardive dyskinesia and twelve DRD2 polymorphisms in schizophrenia patients. Int J Neuropsychopharmacol 10:639-51

Zhang JG, Zhang K, Wang ZC, Ge M and Ma Y (2006) Deep brain stimulation in the treatment of secondary dystonia. Chin Med J (Engl) 119:2069-74

247

Zhang ZJ, Zhang XB, Sha WW and Reynolds GP (2002) Association of a polymorphism in the promoter region of the serotonin 5-HT2C receptor gene with tardive dyskinesia in patients with schizophrenia. Mol Psychiatry 7:670-1

Zhao XD, Zhou XP, Liu HH, Li BM, Hu XW, Li FQ and You BM (2007) [Changes of amino acids neurotransmitters in striatum of hemi-parkinsonian rhesus monkey after high frequency stimulation of subthalamic nucleus]. Zhonghua Wai Ke Za Zhi 45:1682-4

Zibetti M, Torre E, Cinquepalmi A, Rosso M, Ducati A, Bergamasco B, Lanotte M and Lopiano L (2007) Motor and nonmotor symptom follow-up in parkinsonian patients after deep brain stimulation of the subthalamic nucleus. Eur Neurol 58:218-23

Behavioural Brain Research 219 (2011) 273–279

Contents lists available at ScienceDirect

Behavioural Brain Research

journa l homepage: www.e lsev ier .com/ locate /bbr

Research report

Effects of 5-HT2A and 5-HT2C receptor antagonists on acute and chronicdyskinetic effects induced by haloperidol in rats

Meaghan Creed-Carsona,b, Alhan Orahaa,b, José N. Nobregaa,b,c,d,∗

a Neuroimaging Research Section, Centre for Addiction and Mental Health, Toronto, Ontario, Canadab Department of Pharmacology, University of Toronto, Ontario, Canadac Department of Psychiatry, University of Toronto, Ontario, Canadad Department of Psychology, University of Toronto, Ontario, Canada

a r t i c l e i n f o

Article history:Received 16 November 2010Received in revised form 6 January 2011Accepted 16 January 2011Available online 22 January 2011

Keywords:HaloperidolTardive dyskinesiaCatalepsyVacuous chewing movements5-HT2 receptorsKetanserinSB242,084M100,907

a b s t r a c t

An important limitation of classical antipsychotic drugs such as haloperidol (HAL) is their liability toinduce extrapyramidal motor symptoms acutely and tardive dyskinetic syndromes when given chron-ically. These effects are less likely to occur with newer antipsychotic drugs, an attribute that is oftenthought to result from their serotonin-2 (5-HT2) receptor antagonistic properties. In the present study,we used selected doses of the 5-HT2A antagonist M100,907, the 5-HT2C antagonist SB242,084 and themixed 5-HT2A/C antagonist ketanserin to re-examine the respective roles of 2A vs. 2C 5-HT2 receptor sub-types in both acute and chronic motor effects induced by HAL. Acutely, SB242,084 (0.5 mg/kg) reducedHAL-induced catalepsy, while M100,907 (0.5 mg/kg) and ketanserin (1 mg/kg) were without effect. Noneof the drugs reduced HAL-induced Fos expression in the striatum or frontal cortex, and M100,907 actu-ally potentiated HAL-induced Fos expression in the n. accumbens. In rats chronically treated with HAL,both ketanserin and SB242,084 attenuated vacuous chewing movements, while M100,907 had no effect.In addition, 5-HT2C but not 5-HT2A mRNA levels were altered in several brain regions after chronic HAL.These results highlight the importance of 5-HT22C receptors in both acute and chronic motoric side effectsof HAL, and suggest that 5-HT2C antagonism could be targeted as a key property in the development ofnew antipsychotic medications.

© 2011 Elsevier B.V. All rights reserved.

1. Introduction

Treatment with classical antipsychotic drugs (APDs) such ashaloperidol (HAL) is associated with both acute and chronic motorside effects. Acutely, these drugs may induce extrapyramidal symp-toms (EPS), including akathisia, rigidity, tremor and bradykinesia,while prolonged treatment may result in tardive dyskinesia (TD) ortardive dystonia. Acute EPS and tardive syndromes differ in time ofonset, clinical manifestation, persistence, and response to pharma-cological agents [14,16]. While both acute and chronic motor sideeffects are less likely to occur with so called atypical APDs, the latterare not completely devoid of acute EPS effects [8] and, more impor-tantly, are associated with other health-threatening side effectssuch as excessive weight gain and potentially fatal metabolic com-plications [35]. Renewed interest in mechanisms involved in motorside effects of classical APDs is also due in part to the need to

∗ Corresponding author at: Neuroimaging Research Section, Centre for Addictionand Mental Health, 250 College St, Toronto, Ontario M5T1 R8, Canada.Tel.: +1 416 979 6917; fax: +1 416 979 4739.

E-mail address: jose [email protected] (J.N. Nobrega).

develop effective treatments for patients that have developed per-sistent TD before the advent of atypical APDs [40] and to inform thedevelopment of new medications devoid of such effects.

A prevailing hypothesis for the decreased incidence of EPS asso-ciated with atypical antipsychotics centers on serotonin-2 (5-HT2)receptor antagonism [18,19,24–26,41]. In vivo brain imaging hasrevealed low occupancy of 5-HT2 receptors by HAL at therapeuticdoses, while the atypical APDs, olanzapine, sertindole, risperidoneand clozapine occupy 80–100% of these receptors at therapeuticdoses [44]. Given the inhibitory role of 5-HT on dopamine (DA)release from axon terminals, it has been suggested that antago-nism of 5-HT2 receptors would increase DA release and this mightpotentially reverse the effects of D2 receptor blockade selectivelyin the nigrostriatal pathway [6].

5-HT2A agonists positively modulate DA release under basalconditions, and 5-HT2A antagonism decreases evoked DA release[1]. Conversely, 5-HT2C receptors phasically and tonically inhibitDA release in the nucleus accumbens and caudate-putamen, while5-HT2C antagonism disinhibits DA release throughout the mesos-triatal system [9,10]. There is evidence to suggest a differentialinvolvement of 2A vs. 2C subtypes in the development of EPS[12,24,25,33]. A particularly relevant possibility relates to evidence

0166-4328/$ – see front matter © 2011 Elsevier B.V. All rights reserved.doi:10.1016/j.bbr.2011.01.025

dx.doi.org/10.1016/j.bbr.2011.01.025

http://www.sciencedirect.com/science/journal/01664328

http://www.elsevier.com/locate/bbr

mailto:[email protected]

dx.doi.org/10.1016/j.bbr.2011.01.025

meaghan_creed

Typewritten Text

248

274 M. Creed-Carson et al. / Behavioural Brain Research 219 (2011) 273–279

that 2A and 2C antagonism may in several cases lead to oppositefunctional effects [15].

Previous work addressing the role of 5-HT receptors in HALmotoric side effects often failed to distinguish acute from long-termeffects and used test compounds with limited specificity. In thepresent study, we re-examined the respective contributions of 5-HT2A and 5-HT2C receptor subtypes in both acute and chronic motoreffects induced by HAL by using potent and selective 5-HT2A and 5-HT2C antagonists, namely M100,907 (previously MDL-100,907) andSB242,084, respectively. For comparative purposes we also testedthe effects of the mixed 5-HT2A/2C antagonist ketanserin. In acutestudies catalepsy was used as a prototypical behavioural index ofHAL-induced EPS, and patterns of brain Fos expression were cho-sen as a typical brain response. We were particularly interestedin the possibility that addition of 5-HT2 antagonists could convertthe characteristic Fos pattern induced by HAL into a pattern similarto the one obtained with atypical APDs such as clozapine [36,37].In chronic HAL studies we tested the effects of 5-HT2 antago-nists on vacuous chewing movements (VCMs), a well-documentedbehavioural effect of prolonged classical APD use [14,43,47]. Wealso examined chronic HAL effects on 5-HT2A and 5-HT2C geneexpression in brain, in an effort to further ascertain the contribu-tion of each of these receptor subtypes to the pathophysiology ofchronic HAL-induced motor side effects.

2. Materials and methods

2.1. Subjects

Adult male Sprague-Dawley rats (Charles River, Quebec) were pair-housed andmaintained on a 12-h light/dark cycle (lights on at 8:00 AM), with ad libitum accessto food and water. All tests and treatments were conducted according to the guide-lines of the Canadian Council on Animal Care and were approved by the Centre forAddiction and Mental Health Animal Care Committee. All behavioural tests wereperformed by a trained observer blind to treatment conditions.

2.2. Test drugs

Haloperidol and haloperidol decanoate were obtained from Sabex (Quebec,Canada). Ketanserin was purchased from Tocris (Burlington, Canada) and M100,907((R)-(2,3-dimethoxyphenyl)-[1-[2-(4-fluorophenyl)ethyl]-4-piperidyl]methanol)and SB242,084 (6-chloro-5-methyl-1-[2-(2-methylpyid-5-yl carbonyl] indoline)from Sigma–Aldrich (Oakville, Canada). Since the study involved several drugs inboth acute and chronic regimens, a decision was made to carefully select a singleappropriate dose for each test compound. Thus acute HAL effects were inducedby 0.5 mg/kg given s.c. as in previous work [29,30] and HAL chronic effects wereevaluated after 12 weeks of treatment with HAL decanoate (21 mg/kg given i.m.once every three weeks), as in previous work [45–47]. Likewise, doses for M100,907(0.5 mg/kg) and SB242,084 (0.5 mg/kg) were carefully chosen on the basis ofprevious work demonstrating their respective ability to effectively block 5-HT 2A-or 2C-dependent behaviour [15,34] while minimizing effects at non-target 5-HT2subtype in each case.

2.3. Acute drug administration and catalepsy

Rats weighing 214–275 g on the day of the experiment were used. Fifty-four ani-mals were administered HAL (0.5 mg/kg s.c.) and 22 received saline vehicle. This wasimmediately followed by administration of M100,907 (0.5 mg/kg dissolved in 0.9%saline containing 0.3% Tween), ketanserin (1.0 mg/kg, i.p. in 0.9% saline), SB242,084(0.5 mg/kg i.p. in 8% cyclodextrin and 0.52% citric acid) or their respective vehicles.In all experiments drug doses were calculated as the base. Catalepsy was assessed110 min after the drug injections in a quiet room. The rat’s forepaws were gen-tly placed over the edge of a platform raised 7 cm above the working surface andthe animal was slowly released. Catalepsy was scored as the latency to remove bothforepaws from this position or to climb onto the platform. If this did not occur within3 min, the test was terminated and a latency of 180 s was recorded.

2.4. Fos immunocytochemistry

Animals were injected subcutaneously with HAL (0.5 mg/kg; n = 33) or vehi-cle and then immediately received an i.p. injection of either M100,907 (0.5 mg/kg),ketanserin (1 mg/kg), SB242,084 (0.5 mg/kg), or vehicle. Two hours after the injec-tions, rats were sacrificed with an overdose of sodium pentobarbital and perfusedwith saline and 10% formaldehyde. The brains were post-fixed in 4% paraformalde-hyde, transferred to sucrose solutions (10% for 2 h, 20% for 12 h, and 30% for 24 h),

and then dried and stored at −80 ◦C until processing. Fos immunoreactive nuclei,labeled with antiserum raised in rabbits against the Fos peptide 4–17 amino acids ofhuman Fos (Oncogene Research Products, Cambridge, MA), were counted within a400 �m × 400 �m grid at a magnification of ×100 using an MCID Elite system (Inter-Focus Imaging, Linton, UK). Cell counts were obtained from the shell and core of thenucleus accumbens, dorsolateral caudate-putamen, and prefrontal cortex [32,37]from at least three separate brain sections for each brain in at least 5 subjects pergroup.

2.5. Vacuous chewing movements (VCMs) induced by chronic haloperidol

Twenty-four rats were treated with HAL decanoate (21 mg/kg, i.m.) once everythree weeks, the equivalent of approximately 1 mg/kg/day. Another sixteen ratsreceived i.m. injections of the sesame oil vehicle. This regimen was maintained for17 weeks, with VCM assessments occurring once a week. For VCM assessments, ratswere placed on a cylindrical platform (height: 50 cm; diameter: 26 cm) and allowed2 min to acclimate. Over the subsequent 2 min, VCMs were quantified by a trainedobserver blind to treatment condition. VCMs were defined as jaw movements in thevertical plane not directed at any object. Starting on week 13 HAL-treated rats werechallenged with each of the 3 test drugs before the weekly VCM observations in acounterbalanced within-subject design.

2.6. In situ hybridization (ISH)

Hybridization was performed using 35S-UTP labeled riboprobes complementaryto regions of 5-HT2A or 5-HT2C receptor mRNA [5-HT2C (GenBank Accession #NM 012765) (ACGT Corp) left primer: 5’-atttaggtgacactatagaagacaaaaagcctcctgttc-3’, and 5-HT2C right primer: 5’-taatacgactcactatagggatcctctcgctgaccacat-3’;5-HT2A (GenBank Accession # NM 017254) (ACGT Corp) left primer: 5’-atttaggtgacactatagaaccaggtgggacagaaaaaga-3’, and 5-HT2A right primer:5’-taatacgactcactatagggttgttgcagcctccttatcc-3’. Using the NCBI BLAST Tool,the sequences were checked for homology with the rat genome and found to bespecific for their respective transcripts. Probes were diluted to a concentrationof 200,000 cpm/�l in hybridization solution containing: 50% formamide, 35%Denhardt’s solution, 10% dextran sulfate, 0.1× SSC, salmon sperm DNA (300 �g/ml),yeast tRNA (100 �g/ml), and DTT (40 �M). Slides were incubated in plastic mailersovernight at 60 ◦C. After hybridization, sections were rinsed in 4× SSC at 60 ◦C,treated in RNase A (20 �g/ml) solution at 45 ◦C for 40 min, washed with agitationin decreasing concentrations of SSC containing 25 g/ml sodium thiosulfate, dippedin water, dehydrated in 70% ethanol, and air-dried. The slides were exposedto Hyperfilm �–Max film (Amersham, Quebec) for 4 weeks at 4 ◦C along withcalibrated radioactivity standards. Probe specificity was confirmed by testinglabeled sense and scrambled probes, both of which produced no measurable signalon film.

2.7. Statistical analyses

Analyses were done with SPSS version 12.0 (Chicago, IL). The statistical sig-nificance of differences among treatment groups was first determined by analysesof variance followed by Bonferroni-adjusted tests. p ≤ 0.05 was considered to bestatistically significant.

3. Results

3.1. Catalepsy induced by acute haloperidol

A two-way ANOVA indicated significant main effects of HAL(F1,63 = 139.2, p < 0.001), 5-HT2 antagonist (F3,63 = 4.97, p < 0.004)and their interaction (F3,63 = 4.65, p < 0.005). As expected, ratsreceiving a single injection of haloperidol (0.5 mg/kg s.c.) showedsignificantly higher catalepsy scores than their vehicle-treatedcounterparts (p < 0.001). As shown in Fig. 1, co-administration ofM100,907 or ketanserin had no affect on HAL-induced catalepsy,while SB242,084 reduced the HAL effect by more than 50%(p < 0.02). A lower dose of SB242,084 (0.25 mg/kg) and a higher doseof ketanserin (1.5 mg/kg) did not affect catalepsy (data not shown).Vehicle-treated rats did not display catalepsy scores significantlydifferent from zero and these scores were not affected by any ofthe test compounds (Fig. 1).

3.2. Fos expression induced by acute haloperidol

Separate ANOVAs for each brain region revealed signifi-cant HAL main effects in the dorsolateral caudate-putamen(CPu) (F1.52 = 140.97, p < 0.001), medial prefrontal cortex (PFC)

meaghan_creed

Typewritten Text

249

M. Creed-Carson et al. / Behavioural Brain Research 219 (2011) 273–279 275

200

160

180HAL

VEH

******

***

120

140

60

80

100

Cat

alep

sy (

sec)

**# #

20

40

0VEH SB242,084 Ketanserin M100,907

Fig. 1. Effect of 5-HT2A or 5-HT2C blockade on HAL-induced catalepsy. Each bar rep-resents mean catalepsy score (±SEM) of 6–12 rats per group. Separate groups weregiven vehicle or HAL (0.5 mg/kg s.c.) followed by i.p. injections of the appropriatetest compound or vehicle. Ketanserin (1.0 mg/kg) and M100,907 (0.5 mg/kg) hadno effect on HAL-induced catalepsy (p > 0.05). SB242,084 (0.5 mg/kg) significantlyattenuated HAL-induced catalepsy. **p < 0.02, ***p < 0.001 in comparison to the VEHgroup receiving the same 5-HT2 blocker. p < 0.02 in comparison to the HAL-VEHgroup (Bonferroni comparisons).

(F1.52 = 4.78, p < 0.03), nucleus accumbens (NAc) shell (F1.52 = 39.79,p < 0.001) and core (F1.52 = 18.99, p < 0.001). The main effect of 5-HT2 blockers was significant only in the nucleus accumbens core(F3.52 = 6.53, p < 0.001) and the HAL x 5-HT2 blocker interaction wasnot significant in any of the four regions examined.

Bonferroni-adjusted comparisons confirmed that acute HALadministration increased Fos expression in the dorsolateral CPu(p < 0.0001), NAc core (p = 0.004) and shell (p = 0.001) but not in thePFC (p > 0.05) (Fig. 2). Fig. 3 illustrates the typical effect of acute HALon Fos levels in the dorsolateral CPu. As illustrated in Fig. 2, thisbasic HAL effect was not modified by ketanserin or SB242,084 inany of the four brain regions studied. In contrast, M100,907 signifi-cantly potentiated HAL-induced Fos expression in the NAc core andshell (p < 0.05). In vehicle-treated rats ketanserin tended to reduceFos levels as compared to the vehicle–vehicle group in the NAc andin the PFC but these effects did not reach statistical significance(p > 0.05, Fig. 2).

For comparison purposes, a separate group of animals receivedacute clozapine, the prototype atypical antipsychotic drug. Asexpected, Fos levels were significantly increased by clozapine inthe NAc shell and core and PFC (p < 0.05), but not in the dorsolat-eral CPu (Fig. 2). None of the test compounds, when administeredconcurrently with HAL, were able to transform the pattern ofFos induction into a pattern similar to that induced by clozapine(Fig. 2).

3.3. Vacuous chewing movements induced by chronic haloperidol

As expected, HAL-treated animals exhibited significantly moreVCMs than vehicle-treated animals at all time points after the onsetof HAL treatment (Fig. 4). After 12 weeks of HAL treatment, theeffects of acute administration of the three 5-HT2 blockers wereassessed by a repeated measures ANOVA (F4,80 = 6.54, p < 0.001) fol-lowed by Bonferroni-adjusted paired t tests. As illustrated in Fig. 5,SB242,084 (p < 0.006) and ketanserin (p < 0.02) but not M100,907significantly reduced VCMs in HAL-treated rats in comparison toacute vehicle.

Fig. 2. Effect of 5-HT2A or 5-HT2C blockade on HAL-induced Fos expression. Each bar represents mean Fos counts ±SEM of 3–6 rats per group. Abbreviations: CPu, caudateputamen, Acb, accumbens; SB, SB242,804; KET, ketanserin; M100, M100,907. Compared to vehicle (open bars), HAL (filled bars) induced significant increases in Fos levels inall regions, except for the prefrontal cortex. None of the 5-HT2 antagonists attenuated this basic HAL effect. M100,907 significantly potentiated HAL effects in the n. accumbens(#p < 0.05 compared to the HAL-VEH group).

meaghan_creed

Typewritten Text

250


Fig. 3. Representative photomicrograph illustrating pattern of Fos induction by HAL in dorsolateral caudate putamen. Rats were sacrificed 2 h after vehicle or HAL (0.5 mg/kg).The asterisk indicates the location of the corpus callosum on both panels.

HAL (N=20)

16

18

10

12

14

VEH (N=20)4

6

8

VC

M c

ount

s

0

2

0 1 2 3 4 5 6 7 8 9 10 11 12

Weeks of treatment

Fig. 4. Development of VCMs during chronic HAL treatment. Rats received 21 mg/kghaloperidol decanoate once every 3 weeks and were assessed once a week. Exceptfor baseline (week 0) all points are statistically different between HAL and VEHgroups (p < 0.01).

3.4. Changes in 5-HT2 receptor mRNA expression after chronichaloperidol

Several brain regions known to express 5-HT2 receptors wereexamined for mRNA levels (Fig. 6). Eighteen weeks of HAL treat-

16

12

14

*

8

10**

4

6

VC

M c

ount

s

2

0Baseline VEH SB242,084 Ketanserin M100,907

Fig. 5. Effects of 5-HT2A or 5-HT2C blockade on HAL-induced VCMs. Each bar repre-sents mean VCM counts ±SEM in 3 separate determinations. Compared to vehicle,SB242,084 (SB, 0.5 mg/kg) and ketanserin (1 mg/kg, i.p.) significantly reduced VCMs,while M100,907 (0.5 mg/kg) had no effect. *p < 0.02; **p < 0.006 compared to vehicle(Bonferroni-adjusted paired t tests).

ment had no effect on levels of 5-HT2A receptor mRNA in anybrain region examined (Table 1). In contrast, chronic HAL treatmentcaused significant decreases in 5-HT2C mRNA levels in the dorsal(p = 0.02) and ventral (p = 0.03) CPu, and a significant increase inthe ventral (p = 0.046) and dorsal aspects of the and dorsomedialthalamus (p = 0.006) (independent t tests, Table 2).

4. Discussion

The aim of the present study was to assess the role of 5-HT2Aand 5-HT2C receptors in both acute and chronic motoric effectsinduced by haloperidol. It was found that 5-HT2C, but not 5-HT2Aantagonism decreased catalepsy induced by acute HAL. However,none of the 5-HT2 antagonists significantly modified the typicalpattern of brain Fos expression induced by HAL, thus suggestinga dissociation between Fos induction and acute catalepsy inducedby haloperidol. After chronic HAL, both the mixed 5-HT2A/2C antag-onist ketanserin and the 5-HT2C antagonist SB242,084, but notthe 5-HT2A antagonist M100,907, significantly attenuated VCMs.Chronic HAL treatment did not appreciably affect 5-HT2A mRNAlevels, but did alter 5-HT2C mRNA levels in dorsal striatum andthalamic nuclei.

4.1. Effects of acute haloperidol

We found that SB242,084, but not ketanserin or MDL-100,907,attenuated HAL-induced catalepsy. Catalepsy is thought to result

Table 15-HT2A mRNA levels after chronic HAL.a

VEH (N = 7) HAL (N = 5)

CortexPrefrontal 26.27 ± 1.14 25.88 ± 0.47Prefrontal, layer 2 17.89 ± 1.50 16.87 ± 1.15Cingulate 29.12 ± 0.99 28.74 ± 1.19Cingulate, layer 2 18.23 ± 1.59 17.74 ± 1.07Piriform 33.44 ± 1.78 32.53 ± 1.81

n. Accumbens—shell 14.04 ± 1.62 11.99 ± 1.53n. Accumbens—core 11.63 ± 1.35 10.89 ± 1.29

Caudate-putamenAnterior 9.20 ± 1.06 9.50 ± 1.55Dorsomedial 8.49 ± 0.98 8.67 ± 0.80Dorsolateral 8.83 ± 1.07 9.11 ± 0.81Ventrolateral 8.95 ± 1.04 9.17 ± 0.81Ventromedial 8.62 ± 1.04 8.28 ± 0.74Posterior, dorsal 9.00 ± 0.82 11.02 ± 1.09Posterior, ventral 9.46 ± 0.95 12.08 ± 1.12

a Values are means ± SEM in �ci/gT. No significant differences were found.

meaghan_creed

Typewritten Text

251


Fig. 6. Representative photomicrograph illustrating 5-HT2A and 5-HT2C gene expression. Abbreviations: Prf, piriform cortex; Cng, anterior cingulate cortex; PFC, prefrontalcortex; NAc, nucleus accumbens; CPu, caudate-putamen.

from blocked signaling through post-synaptic D2 receptors [52], aneffect that may be modulated by 5-HT activity. SB242,084 has beenshown to increase midbrain dopaminergic transmission [11] andthis may account in part for its beneficial effects on HAL-inducedcatalepsy.

4.1.1. Fos effectsIt is well established that HAL, but not atypical APDs such as

clozapine, increase Fos expression in the dorsolateral CPu, whichagrees with our present observations [36,37]. Further, the favor-able profile of motor side effects exhibited by clozapine has beenattributed to its antagonism of 5-HT2A receptors. In the presentstudy, however, either 5-HT2A or 5-HT2C antagonism modified theHAL-induced Fos expression pattern. In fact the 5-HT2A antagonist

Table 25-HT2C mRNA levels after chronic HAL.a

VEH (N = 7) HAL (N = 5)

CortexPrefrontal 24.97 + 1.86 21.41 + 1.74Cingulate 16.73 + 1.30 17.96 + 0.78Piriform 63.34 + 3.89 54.08 + 2.87

n. Accumbens shell 32.6 + 0.79 32.18 + 2.39n. Accumbens core 36.80 + 1.42 36.63 + 1.00

Caudate-putamenAnterior 19.71 + 0.80 17.47 + 0.94Dorsomedial 14.65 + 0.16 13.09 + 0.67*

Dorsolateral 8.16 + 0.29 8.08 + 0.52Ventrolateral 11.36 + 0.31 11.14 + 0.39Ventromedial 19.03 + 0.45 17.13 + 0.58*

Posterior, dorsal 9.27 + 0.35 8.42 + 0.37Posterior, ventral 7.91 + 0.26 7.87 + 0.32

Choroid plexus 198.59 + 8.55 192.33 + 6.31

ThalamusLaterodorsal, lateroventral 15.04 + 0.91 19.09 + 1.74*

Laterodorsal, ventromedial 10.41 + 1.14 15.48 + 1.70*

Central n, ventral 27.26 + 1.18 30.51 + 2.37Central, n., medial 30.85 + 2.04 32.30 + 3.90Lateroposterior n. 20.06 + 2.48 25.84 + 3.14Posterior n. 6.24 + 1.46 9.73 + 1.71Parafascicular n. 25.80 + 0.80 28.61 + 3.78

Subthalamic nucleus 113.61 + 3.26 125.69 + 7.11Subst. nigra pars compacta 44.56 + 5.23 48.94 + 3.47Subst. nigra pars reticulata 19.24 + 3.71 19.22 + 1.45

a Values are means ± SEM in �ci/gT.* p < 0.05.

M100,907 enhanced HAL-induced Fos expression in the NAc coreand shell. Since NAc neurons activated by HAL have been shownto express 5-HT2A receptors [21], it is conceivable that concurrentadministration of HAL and M100,907 could produce a synergisticactivation effect in these cells.

Irrespective of exact mechanisms involved, Fos induction in thedorsolateral CPu has been shown to correlate well with sever-ity of cataleptic symptoms [7,27,37–39]. We found however thatthe attenuation of HAL-induced catalepsy by SB242,084 was notaccompanied by changes in HAL-induced Fos levels in the dorsolat-eral CPu. Our findings therefore suggest an interesting dissociationbetween Fos induction and acute cataleptic behaviour induced byhaloperidol.

4.2. Effects of chronic haloperidol

4.2.1. Oral dyskinesiasPrevious studies examining the role of 5-HT2 receptors in vac-

uous chewing movements (VCMs) have produced inconsistentresults. Takeuchi et al. [42] reported that acute doses of the 5-HT2A/2C antagonist ritanserin did not attenuate VCMs, but didprevent the development of VCMs when administered concurrentlywith HAL over 4 weeks; paradoxically however VCMs did emergedespite co-treatment with ritanserin by 6 weeks [42]. Other studieshave reported that acute and chronic administration of the 5-HT2A/2C receptor antagonists, seganserin, ketanserin and ritanserin,over 3 weeks reduced HAL-induced VCMs in a dose-dependentmanner [28]. However, when administered acutely at very highdoses (1.0 mg/kg), ritanserin increased VCMs, ketanserin decreasedVCMs, while seganserin had no effect on VCM levels [28].

Two factors that may explain these inconsistencies are failure todistinguish “early” from “late” VCMs and poor specificity of 5-HT2antagonists. It has known that VCMs emerging in the first 3 weeksof HAL treatment (so called “early VCMs”) are pharmacologicallydistinct from late VCMs, which may reflect morphological and func-tional changes associated with prolonged treatment [13,22,23].Moreover, the use of poorly selective 5-HT2 antagonists in previ-ous studies failed to distinguish between the effects of 2A and 2Csubtypes, while evidence suggests differential involvement of 2Aand 2C subtypes in the development of EPS [12,24,25].

In the present study, both the mixed 5-HT2A/C antagonistketanserin and the 5-HT2C antagonist SB242,084 significantlyattenuated VCMs after chronic HAL treatment, although the effectswas more pronounced with 5-HT2C antagonist treatment. This is

meaghan_creed

Typewritten Text

252


in good agreement with previous findings in HAL-treated rats thathad undergone neonatal 6-OHDA lesions [20]. In addition to beingexpressed in the striatum, 5-HT2C receptors are located in the sub-thalamic nucleus (STN) on glutamatergic projection neurons to theglobus pallidus internus (GPi) and substantia nigra pars reticulata(SNr) [9,12]. Intra-subthalamic infusion of the 5-HT2C agonist mCPPis sufficient to elicit VCMs, implicating these receptors in orofa-cial dyskinesias [12]. 5-HT2C receptors are also located on GABAinterneurons in the SNr which project to the pars compacta (SNc)[12]. This provides a potential mechanism whereby 5-HT2C couldmediate inhibition of DA cellular activity in the SNc, which is themain source of DA projections to the striatum [50]. Antagonism ofthese 5-HT2C receptors would be expected to increase DA releaseto the striatum, where HAL exerts its motor effects.

The mixed 5-HT2A/2C antagonist ketanserin but not the highlyselective 5-HT2A antagonist M100,907 also reduced VCMs. It isconceivable that the ketanserin effects reflected activity at 5-HT2Creceptors. While ketanserin exhibits a three-fold higher affinity forthe 5-HT2A receptor subtype over the 5-HT2C subtype, it may havestill affected 5-HT2C receptors

4.2.2. Effects on 5-HT2A and 5-HT2C mRNAResults from previous studies examining the effects of HAL on

5-HT receptor mRNA have been inconsistent. In agreement withprevious studies in normal drug-naïve rats, we report 5-HT2A in theprefrontal, piriform and cingulated cortices, with lower expressionin the NAc core and shell and even lower expression throughout theCPu. 5-HT2C mRNA was detected in the same regions, in additionto the choroid plexus, thalamus, SNc, SNr and STN.

Consistent with most previous studies [2,4,5,17,51], we reportthat HAL had minimal effects on levels of 5-HT2A mRNA in allregions tested. Previously, a decrease in 5-HT2A mRNA in thehippocampus and midbrain after 32 days of HAL treatment wasreported [3]. In all previous studies, however, the duration of HALtreatment ranged between 14 and 36 days, whereas here we exam-ined effects of HAL administered for 18 weeks. While 5-HT2A isa unique GPCR in that chronic antagonism paradoxically leads topronounced down-regulation rather than up-regulation [48], thefailure of HAL to alter levels of 5-HT2A mRNA is not unexpectedgiven the weak affinity of HAL for the 5-HT2A receptor [24]. How-ever, it must be noted that 5-HT2A binding and activity do notnecessarily change in parallel with mRNA levels [3,5].

In contrast, we found significant decreases in 5-HT2C mRNA lev-els in the ventromedial and dorsomedial CPu after chronic HAL.Consistent with this, Burnet et al. [5] reported a small, albeit non-significant decrease in 5-HT2C mRNA in the striatum after 14 daysof HAL treatment, and a concomitant decrease in 5-HT and 5-HIAAlevels in the striatum only. Other groups have reported 32–41%decreases in 5-HT2C mRNA levels in the cerebellum after 32 daysHAL and a 42% decrease in the SNc after 36 days of HAL [3,17]. Dis-crepancies between studies could again be due to shorter durationsof HAL administration in previous studies.

Dopaminergic inputs to the striatum regulate 5-HT receptorgene expression. D2 receptor signaling inhibits the expression of5-HT2 mRNA in the striatum, although the differential regulationof 2A vs. 2C subtypes is not clear [31]. Furthermore, as in thecase of 5-HT2A, 5-HT2C antagonism causes a paradoxical down-regulation that could also contribute to the observed decrease in5-HT2C mRNA. However, increases in 5-HT2C signaling after chronicHAL administration have been reported. Wolf et al. [51] showedan adaptive increase in 5-HT2C coupling to G-proteins as a resultof repeated HAL administration, which was limited to the stria-tum. It is not clear how this increase in coupling is mediated, butit is thought to involve post-translational modifications of the 5-HT2C receptor [51]. In the striatum, 5-HT2C receptors are located onmedium spiny interneurons, which regulate information outflow to

the STN and GPe [49]. Intrastriatal infusion of the 5-HT2A/2C agonistmCPP induces orofacial dyskinetic movements [12]. In agreementwith these previous observations, our present results implicateenhanced 5-HT2C signaling in both acute and chronic HAL-inducedmotoric effects.

5. Conclusion

This may be the first examination of effects of 5-HT 2A vs. 2Cantagonism on both acute and chronic brain and behavioural effectsof HAL under the same laboratory conditions. We found that 5-HT2C antagonism reduced motor effects induced by both acuteand chronic HAL administration. 5-HT2A antagonism did not affecteither class of motor symptoms, whereas at the doses used, themixed antagonist ketanserin attenuated HAL-induced VCMs buthad no effect on catalepsy. None of the antagonists reduced HAL-induced Fos expression in the dorsolateral CPu, the area implicatedin the cataleptic affects of HAL. Our results implicate 5-HT2C recep-tors in the development of both acute and chronic motor effectsinduced by HAL, and suggest that 5-HT2C antagonism could be tar-geted as a key property of new antipsychotic medications.

Acknowledgements

Supported in part by funds from the Ontario Mental HealthFoundation and the Canadian Institutes of Health Research. M.C.-C.was the recipient of an NSERC Graduate Fellowship. The authorsthank Dr. P.J. Fletcher for making M100,907 available and RogerRaymond and Mustansir Diwan for excellent technical help.

References

[1] Alex KD, Pehek EA. Pharmacologic mechanisms of serotonergic regulation ofdopamine neurotransmission. Pharmacol Ther 2007;113:296–320.

[2] Badiani A, Oates MM, Fraioli S, Browman KE, Ostrander MM, Xue CJ, et al. Envi-ronmental modulation of the response to amphetamine: dissociation betweenchanges in behavior and changes in dopamine and glutamate overflow in therat striatal complex. Psychopharmacology (Berl) 2000;151:166–74.

[3] Buckland PR, D’Souza U, Maher NA, McGuffin P. The effects of antipsychoticdrugs on the mRNA levels of serotonin 5HT2A and 5HT2C receptors. Brain ResMol Brain Res 1997;48:45–52.

[4] Burnet PW, Chen CP, McGowan S, Franklin M, Harrison PJ. The effects of clozap-ine and haloperidol on serotonin-1A-2A and -2C receptor gene expression andserotonin metabolism in the rat forebrain. Neuroscience 1996;73:531–40.

[5] Burnet PW, Eastwood SL. Harrison PJ 5-HT1A and 5-HT2A receptor mRNAsand binding site densities are differentially altered in schizophrenia. Neuropsy-chopharmacology 1996;15:442–55.

[6] Casey DE. Pathophysiology of antipsychotic drug-induced movement disor-ders. J Clin Psychiatry 2004;65Suppl9:25–8.

[7] Chartoff EH, Ward RP, Dorsa DM. Role of adenosine and N-methyl-d-aspartatereceptors in mediating haloperidol-induced gene expression and catalepsy. JPharmacol Exp Ther 1999;291:531–7.

[8] Correll CU, Schenk EM. Tardive dyskinesia and new antipsychotics. Curr OpinPsychiatry 2008;21:151–6.

[9] De Deurwaerdere P, Navailles S, Berg KA, Clarke WP, Spampinato U. Constitu-tive activity of the serotonin2C receptor inhibits in vivo dopamine release inthe rat striatum and nucleus accumbens. J Neurosci 2004;24:3235–41.

[10] Di Giovanni G, De Deurwaerdere P, Di Mascio M, Di Matteo V, Esposito E, Spamp-inato U. Selective blockade of serotonin-2C/2B receptors enhances mesolimbicand mesostriatal dopaminergic function: a combined in vivo electrophysiolog-ical and microdialysis study. Neuroscience 1999;91:587–97.

[11] Di Matteo V, Di Giovanni G, Di Mascio M, Esposito E. SB 242084, a selectiveserotonin2C receptor antagonist, increases dopaminergic transmission in themesolimbic system. Neuropharmacology 1999;38:1195–205.

[12] Eberle-Wang K, Lucki I, Chesselet MF. A role for the subthalamic nucleus in5-HT2C-induced oral dyskinesia. Neuroscience 1996;72:117–28.

[13] Egan MF, Ferguson J, Hyde TM. Effects of rating parameters on assessment ofneuroleptic-induced vacuous chewing movements. Pharmacol Biochem Behav1996;53:401–10.

[14] Egan MF, Hurd Y, Ferguson J, Bachus SE, Hamid EH, Hyde TM. Pharmaco-logical and neurochemical differences between acute and tardive vacuouschewing movements induced by haloperidol. Psychopharmacology (Berl)1996;127:337–45.

[15] Fletcher PJ, Grottick AJ, Higgins GA. Differential effects of the 5-HT(2A) recep-tor antagonist M100907 and the 5-HT(2C) receptor antagonist SB242084on cocaine-induced locomotor activity, cocaine self-administration and

meaghan_creed

Typewritten Text

253


cocaine-induced reinstatement of responding. Neuropsychopharmacology2002;27:576–86.

[16] Glazer WM. Extrapyramidal side effects tardive dyskinesia, and the concept ofatypicality. J Clin Psychiatry 2000;61(Suppl. 3):16–21.

[17] Huang XF, Tan YY, Huang X, Wang Q. Effect of chronic treatment with clozapineand haloperidol on 5-HT(2A and 2C) receptor mRNA expression in the rat brain.Neurosci Res 2007;59:314–21.

[18] Kapur S, Remington G. Serotonin–dopamine interaction and its relevance toschizophrenia. Am J Psychiatry 1996;153:466–76.

[19] Kapur S, Zipursky RB, Remington G. Clinical and theoretical implications of 5-HT2 and D2 receptor occupancy of clozapine, risperidone, and olanzapine inschizophrenia. Am J Psychiatry 1999;156:286–93.

[20] Kostrzewa RM, Huang NY, Kostrzewa JP, Nowak P, Brus R. Modeling tardivedyskinesia: predictive 5-HT2C receptor antagonist treatment. Neurotox Res2007;11:41–50.

[21] Ma J, Ye N, Cohen BM. Expression of noradrenergic alpha1, serotoniner-gic 5HT2a and dopaminergic D2 receptors on neurons activated by typicaland atypical antipsychotic drugs. Prog Neuropsychopharmacol Biol Psychiatry2006;30:647–57.

[22] Marchese G, Bartholini F, Ruiu S, Casti P, Casu GL, Pani L. Ritanserin coun-teracts both rat vacuous chewing movements and nigro-striatal tyrosinehydroxylase-immunostaining alterations induced by haloperidol. Eur J Phar-macol 2004;483:65–9.

[23] Marchese G, Casu MA, Bartholini F, Ruiu S, Saba P, Gessa GL, et al. Sub-chronictreatment with classical but not atypical antipsychotics produces morphologi-cal changes in rat nigro-striatal dopaminergic neurons directly related to “earlyonset” vacuous chewing. Eur J Neurosci 2002;15:1187–96.

[24] Meltzer HY, Matsubara S, Lee JC. Classification of typical and atypical antipsy-chotic drugs on the basis of dopamine D-1 D-2 and serotonin2 pKi values. JPharmacol Exp Ther 1989;251:238–46.

[25] Meltzer HY, Matsubara S, Lee JC. The ratios of serotonin2 and dopamine2 affini-ties differentiate atypical and typical antipsychotic drugs. PsychopharmacolBull 1989;25:390–2.

[26] Meltzer HY, Nash JF. Effects of antipsychotic drugs on serotonin receptors.Pharmacol Rev 1991;43:587–604.

[27] Merchant KM, Dorsa DM. Differential induction of neurotensin and c-fos geneexpression by typical versus atypical antipsychotics. Proc Natl Acad Sci U S A1993;90:3447–51.

[28] Naidu PS, Kulkarni SK. Effect of 5-HT1A and 5-HT2A/2C receptor modula-tion on neuroleptic-induced vacuous chewing movements. Eur J Pharmacol2001;428:81–6.

[29] Natesan S, Reckless GE, Barlow KB, Nobrega JN, Kapur S. Evaluation ofN-desmethylclozapine as a potential antipsychotic—preclinical studies. Neu-ropsychopharmacology 2007;32:1540–9.

[30] Natesan S, Reckless GE, Barlow KB, Odontiadis J, Nobrega JN, Baker GB,et al. The antipsychotic potential of l-stepholidine—a naturally occurringdopamine receptor D1 agonist and D2 antagonist. Psychopharmacology (Berl)2008;199:275–89.

[31] Numan S, Lundgren KH, Wright DE, Herman JP, Seroogy KB. Increased expres-sion of 5HT2 receptor mRNA in rat striatum following 6-OHDA lesions of theadult nigrostriatal pathway. Brain Res Mol Brain Res 1995;29:391–6.

[32] Paxinos G, Watson C. The rat brain in stereotaxic coordinates. New York: Aca-demic Press; 1998.

[33] Reavill C, Kettle A, Holland V, Riley G, Blackburn TP. Attenuation ofhaloperidol-induced catalepsy by a 5-HT2C receptor antagonist. Br J Pharmacol1999;126:572–4.

[34] Reavill C, Taylor SG, Wood MD, Ashmeade T, Austin NE, Avenell KY,et al. Pharmacological actions of a novel, high-affinity, and selective humandopamine D(3) receptor antagonist, SB-277011-A. J Pharmacol Exp Ther2000;294:1154–65.

[35] Remington G. Tardive dyskinesia: eliminated, forgotten, or overshadowed. CurrOpin Psychiatry 2007;20:131–7.

[36] Robertson GS, Fibiger HC. Neuroleptics increase c-fos expression in theforebrain: contrasting effects of haloperidol and clozapine. Neuroscience1992;46:315–28.

[37] Robertson GS, Matsumura H, Fibiger HC. Induction patterns of Fos-likeimmunoreactivity in the forebrain as predictors of atypical antipsychotic activ-ity. J Pharmacol Exp Ther 1994;271:1058–66.

[38] Sakharov DA, Voronezhskaya EE, Nezlin L, Baker MW, Elekes K, CrollRP. Tyrosine hydroxylase-negative, dopaminergic neurons are targets fortransmitter-depleting action of haloperidol in the snail brain. Cell Mol Neu-robiol 1996;16:451–61.

[39] Snijders R, Kramarcy NR, Hurd RW, Nemeroff CB, Dunn AJ. Neurotensin inducescatalepsy in mice. Neuropharmacology 1982;21:465–8.

[40] Soares KV, McGrath JJ. The treatment of tardive dyskinesia—a systematic reviewand meta-analysis. Schizophr Res 1999;39:1–16, discussion 17–8.

[41] Stahl SM. Introduction: What makes an antipsychotic atypical. J Clin Psychiatry1999;60(Suppl. 10):3–4.

[42] Takeuchi H, Ishigooka J, Kobayashi K, Watanabe S, Miura S. Study on the suit-ability of a rat model for tardive dyskinesia and the preventive effects of variousdrugs. Prog Neuropsychopharmacol Biol Psychiatry 1998;22:679–91.

[43] Tamminga CA, Dale JM, Goodman L, Kaneda H, Kaneda N. Neuroleptic-inducedvacuous chewing movements as an animal model of tardive dyskinesia: a studyin three rat strains. Psychopharmacology (Berl) 1990;102:474–8.

[44] Travis MJ, Busatto GF, Pilowsky LS, Kerwin RW, Mulligan R, Gacinovic S, et al.5-HT2A receptor occupancy in vivo and response to the new antipsychoticsolanzapine and sertindole. Br J Psychiatry 1997;171:290–1.

[45] Turrone P, Remington G, Kapur S, Nobrega JN. Differential effects of within-daycontinuous vs. transient dopamine D2 receptor occupancy in the developmentof vacuous chewing movements (VCMs) in rats. Neuropsychopharmacology2003;28:1433–9.

[46] Turrone P, Remington G, Kapur S, Nobrega JN. The relationship betweendopamine D2 receptor occupancy and the vacuous chewing movement syn-drome in rats. Psychopharmacology (Berl) 2003;165:166–71.

[47] Turrone P, Remington G, Nobrega JN. The vacuous chewing movement (VCM)model of tardive dyskinesia revisited: is there a relationship to dopamine D(2)receptor occupancy. Neurosci Biobehav Rev 2002;26:361–80.

[48] Van Oekelen D, Luyten WH, Leysen JE. 5-HT2A and 5-HT2C receptors and theiratypical regulation properties. Life Sci 2003;72:2429–49.

[49] Ward RP, Dorsa DM. Colocalization of serotonin receptor subtypes 5-HT2A,5-HT2C, and 5-HT6 with neuropeptides in rat striatum. J Comp Neurol1996;370:405–14.

[50] Wichmann T, DeLong MR. Functional neuroanatomy of the basal ganglia inParkinson’s disease. Adv Neurol 2003;91:9–18.

[51] Wolf WA, Bieganski GJ, Guillen V, Mignon L. Enhanced 5-HT2C receptor signal-ing is associated with haloperidol-induced “early onset” vacuous chewing inrats: implications for antipsychotic drug therapy. Psychopharmacology (Berl)2005;182:84–94.

[52] Wu Q, Reith ME, Walker QD, Kuhn CM, Carroll FI, Garris PA. Concur-rent autoreceptor-mediated control of dopamine release and uptake duringneurotransmission: an in vivo voltammetric study. J Neurosci 2002;22:6272–81.

meaghan_creed

Typewritten Text

254

Documents

Deep Brain Stimulation of the Subthalamic and Entopeduncular … · 2013-12-13 · 25. Effects of STN-DBS on zif268 expression in the basal ganglia of VEH-treated rats 91 26. Effects