CYP2D1 Gene Knockout Reduces the Metabolism and …dmd.aspetjournals.org/content/dmd/early/2019/10/28/dmd.119.088526.full-text.pdfvenlafaxine (ODV) by CYP2D6 (~89%), CYP2C19 (~10%),

DMD # 88526

1

CYP2D1 Gene Knockout Reduces the Metabolism and Efficacy of Venlafaxine in

Rats

Hongqiu Zhoua , Li Yang

a , Changsuo Wang

a , Zhiqiang Li

a , Zhen Ouyang

a , Mangting

Shanb , Jun Gu

c,*, Yuan Wei

a ,*

aSchool of Pharmacy, Jiangsu University, Zhenjiang, Jiangsu 212013, China

bMtC BioPharma Co. Ltd, Nanjing, Jiangsu 210042, China

cWadsworth Center, New York State Department of Health, and School of Public

Health, State University of New York at Albany, Albany, NY 12201, USA

This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 28, 2019 as DOI: 10.1124/dmd.119.088526

at ASPE

T Journals on M

arch 1, 2020dm

d.aspetjournals.orgD

ownloaded from

http://dmd.aspetjournals.org/

DMD # 88526

2

Running Title: CYP2D1-knockout rat model

*Corresponding Author: Yuan Wei*

Mailing address: School of Pharmacy, Jiangsu University, 301 Xuefu Road, Jingkou

Zone, Zhenjiang 212013, Jiangsu, China

Tel/Fax.: +86-511-85038750

Email: [email protected]

*Corresponding Author: Jun Gu*

Mailing address: Wadsworth Center, New York State Department of Health, Empire

State Plaza, Albany, NY 12201-0509, USA

Email: [email protected]

Number of Text pages: 31

Number of Tables: 5

Number of Figures: 4

Number of References: 58

Number of Words:

Abstract: 249

Introduction: 642

Discussion: 1499


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from

mailto:[email protected]

mailto:[email protected]


DMD # 88526

3

Abbreviations: ANOVA, analysis of variance; AUC, area under the curve of the drug;

AUC0-t, AUC from the time of administration to the last point; AUC0-∞, time from the

start of administration to the theoretical extrapolation AUC; AhR, aryl hydrocarbon

receptor; CYPOR, NADPH-cytochrome P450 oxidoreductase; CRISPR, clustered

regularly interspaced short palindromic repeat; CMS, chronic mild stimulations; Ctrl,

control groups; CLint, intrinsic clearance; CL/F, apparent total clearance; Cmax, peak

concentration; CAR, constitutive androgen receptor; EM, extensive metabolizers;

H&E, Hematoxylin and Eosin; 5-HT, 5-hydroxytryptamine; HPLC, high-performance

liquid chromatography; Km, Michaelis constant; NE, norepinephrine; ODV,

O-desmethyl venlafaxine; PM, poor metabolizer; PXR, Pregnane X receptor; UCSC,

University of California Santa Cruz; VLF, venlafaxine; Vd/F, apparent volume of

distribution; WT, wild-type.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

4

Abstract

Rat CYP2D1 has been considered as an ortholog of human CYP2D6. To

assess the role of CYP2D1 in physiological processes and drug metabolism, a

CYP2D1-null rat model was generated with a clustered regularly interspaced

short palindromic repeat (CRISPR)/Cas9 method. Seven base-pairs were deleted

from the exon 4 of CYP2D1 of Sprague-Dawley wild-type (WT) rats. The

CYP2D1-null rats were viable and showed no abnormalities in general

appearance and behaviors. Metabolism of venlafaxine (VLF) was further studied

in CYP2D1-null rats. Vmax and CLint of the liver microsomes in vitro from

CYP2D1-null rats were decreased (decreased by ~46% and ~57% in males,

~47% and ~58% in females), while Km was increased (increased by ~24% in

males, ~25% in females) compared to those of WTs. In the pharmacokinetic

studies, compared to the WTs, VLF in the CYP2D1-null rats had significantly

lower Cl/F and Vd/F (decreased by ~36% and ~48% in males, ~23% and ~25%

in females), significantly increased AUC0-t, AUC0-∞, and Cmax (increased by ~64%,

~59% and ~26% in males, ~43%, ~35% and ~15% in females). In addition,

O-desmethyl venlafaxine formation was reduced as well in the CYP2D1-null rats

compared to that in WTs. Rat depression models were developed by feeding

separately and chronic mild stimulations with CYP2D1-null and WT rats. VLF

showed a better efficacy in the WT depression rats compared to that in the

CYP2D1-null ones. In conclusion, a CYP2D1-null rat model was successfully

generated, and CYP2D1 was found to play a certain role in the metabolism and

efficacy of venlafaxine.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

5

Significance Statement

A novel CYP2D1-null rat model was generated using CRISPR/Cas9 technology,

and it was a valuable tool to study the in vivo function of human CYP2D6. Moreover,

our data suggested that the reduced ODV formation was associated with a lower VLF

efficacy in rats.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

6

Introduction

Cytochrome P450 enzymes are part of an extended family of hemoproteins and

are an important family of oxidases in the microsomal mixed-function oxidase system

(Yamazaki, 2014). To date, a total of 57 cytochrome P450 isoforms have been

identified in humans, which are grouped into 18 families and 44 subfamilies by their

sequence similarity (Zanger et al., 2008). Among them, CYP1, CYP2, and CYP3

subfamilies are responsible for the biotransformation of most of the foreign

substances including 70−80% of the clinically used drugs (Zhou et al., 2012;

Guengerich, 2008).

Although being only 4% of the total cytochrome P450 enzyme in the human liver,

CYP2D6 is associated with biotransformation of approximately 30% of the

commonly used drugs (Teh and Bertilsson, 2012). Substrates of CYP2D6 include a

variety of antiarrhythmics, antipsychotics, and second-generation and tricyclic

antidepressants (Zanger and Schwab, 2013). It has been reported that the frequency of

CYP2D6 allele varies by racial/ethnic groups, about 6−10% of the Caucasians and

only 2% of the Asians are CYP2D6 poor metabolizers (PMs) (Meyer et al., 1990;

Bradford, 2002). If the amount of a drug administered to the CYP2D6 PMs is the

same as that administered to normal individuals, serious adverse reactions are more

likely to occur in the PMs because the metabolism of the drug is often unpredictable

in the PMs (De Leon et al., 2005; Hertz et al., 2015). Further research is needed in

order to improve the efficacy of the drugs, reduce the incidence of adverse reactions,

and achieve an individualized drug therapy.

Venlafaxine (VLF) is an antidepressant of selective serotonin and norepinephrine

reuptake inhibito (Bymaster, 2001). In humans, VLF was metabolized to O-desmethyl

venlafaxine (ODV) by CYP2D6 (~89%), CYP2C19 (~10%), and CYP2C9 (~1%),

venlafaxine is also metabolized by CYP3A4 to N-desmethyl venlafaxine (Magalhães

et al., 2014). ODV is the main metabolite of VLF to exert pharmacological activity

(Wellington and Perry, 2001). For rat CYP2D subfamily, it was reported that 6

members (CYP2D1, -2D2, -2D3, -2D4, -2D5, and -2D18) have been identified by


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

7

genomic analysis and CYP2D1 was considered as an ortholog of human CYP2D6

(~83% homology) (Nelson et al., 1996; Martignoni et al., 2006).

A variety of cytochrome P450 gene knockout mouse models and CYP-humanized

mouse models have been reported to illustrate the function of cytochrome P450

isoforms on drug metabolism, toxicity and carcinogenicity (Scheer et al., 2012, 2014;

Bissig et al., 2018). However, mouse model may have some limitations. For example,

the small volume of blood samples collected from mice increases the difficulty of

pharmacokinetic studies. Moreover, the mouse model is poorly tolerated in some

experiments, such as bacterial infections experiment, chronic heart failure experiment

(Robinson et al., 1968; Li et al., 2004; Handa et al., 2009). Compared to the mouse

model, the rat model could be more suitable for certain experiments.

In 2013, a knockout rat model was generated with clustered regularly interspaced

short palindromic repeat (CRISPR)/Cas9 method (Li et al., 2013), and since then

knockout rats have become an accessible tool for studying human cytochrome P450

functions. It has been reported that the metabolism of chlorzoxazone is significantly

reduced in CYP2E1 knockout rats (Wang et al., 2016), while the metabolism of

nifedipine and midazolam were reduced as well in CYP3A1/2 double knockout rats

(Lu et al., 2017). A CYP2C11 knockout rat model was successfully generated by our

group and was used to study the metabolism of tolbutamide and warfarin (Wei et al.,

2018; Ye et al., 2019).

For a better understanding the role of human CYP2D6 in drug metabolism, in this

study, a unique CYP2D1-null rat model was generated using the CRISPR/Cas9

technology. The general phenotypes were characterized and the hepatic expression of

major P450s was determined in the knockout rat model. Venlafaxine, an inhibitor of

serotonin-norepinephrine reuptake and a substrate of human CYP2D6, was used as a

probe drug to study the metabolism and efficacy function of CYP2D1 in rats.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

8

Materials and methods

Chemicals and reagents. NADPH (> 98% purity) was purchased from Aladdin

Industrial Co. Ltd. (Shanghai, China). Carvedilol (> 99% purity) was purchased from

Aladdin Bio-Chem Technology Co. Ltd. (Shanghai, China). Venlafaxine

hydrochloride and O-desmethyl venlafaxine (> 98% purity) were purchased from Sam

Chemical Technology Co., Ltd. (Shanghai, China). Acetonitrile and methanol, as well

as all other reagents, were purchased from Sinopharm Chemical Reagent Co. Ltd.

(Shanghai, China).

Generation of the CYP2D1-null rats by CRISPR/Cas9. Three specific sgRNA

target sequences were selected from the target site in exon 4 of the rat CYP2D1 gene

(ID: 266684) using Gene Knock-Out with Cas9 software from Xunqi Biotechnology

Co. Ltd. (Nanjing, China). Three pairs of guiding primers were designed: sgRNA1

(forward primer: 5′–GCAGCATGGCCTTGGGATTGA–3′, reverse primer:

5′–TCAATCCCAAGGCCATGCTG–3′)，sgRNA2 (forward primer:

5′–AGACCCTTACCTCATCAGGA–3′, reverse primer:

5′–TCCTGATGAGGTAAGGGTCT–3′), and sgRNA3 (forward primer:

5′–CTAGTTTCACCATCCTGATG–3′, reverse primer:

5′–CATCAGGATGGTGAAACTAG–3′). The sgRNAs were transcribed in vitro using

the T7 Quick High Yield RNA Synthesis Kit, recovered by phenol-chloroform

extraction and alcohol precipitation, and finally dissolved in nuclease-free water. The

pST1374-cas9 vector was linearized by Agel (New England Bioscience, Ipswich, MA,

USA), transcribed into Cas9 mRNA, and purified with RNeasy Mini Kit (Qiagen,

Valencia, CA). The constructed Cas9 mRNA was co-injected with sgRNA1, sgRNA2,

and sgRNA3 (Cas9 mRNA: 50 ng/μL, sgRNA1: 100 ng/μL, sgRNA2: 100 ng/μL, and

sgRNA3: 100 ng/μL) into zebrafish zygotes to determine their activities, respectively.

The sgRNA3 set primer (30 ng/μL) was injected into the wild-type (WT)

Sprague-Dawley rat monocytic embryos with Cas9 mRNA (50 ng/μL) as sgRNA3

showed the highest activity in zebrafish (Supplementary Table 1). The obtained

CYP2D1+/-

rat (F0, 1♀) was hybridized with WT rat (1♂) and the pups were subjected

to PCR amplification and genomic DNA sequencing to select the heterozygous


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

9

CYP2D1+/-

rats (F1). The F1 generation rats were inbred (1♂: 2♀) to produce F2

generation rats, and then the homozygous CYP2D-/-

rats were screened out from the F2

generation rats by the same method. The homozygous CYP2D-/-

rats were transferred

from the Model Animal Research Center of Nanjing University to the Laboratory

Animal Center of Jiangsu University for further breeding and animal experiments.

The animal facilities of Nanjing University and Jiangsu University have passed the

certification of the Association for Assessment and Accreditation of Laboratory

Animal Care. All animal breeding and experimental procedures were performed in

accordance with the Guide for the Care and Use of Laboratory Animals and were

approved by the Institutional Animal Care and Use Committees of Nanjing University

and Jiangsu University.

Off-target analysis. The sgRNA3 sequence (CTAGTTTCACCATCCTGATG)

was submitted to TagScan (http://ccg.vital-it.ch/tagger) to predict the possible

off-target sites. The detailed sequences around the potential off-target sites were

obtained from the University of California, Santa Cruz (UCSC) database

(http://genome.ucsc.edu/). The corresponding primers were designed for the potential

off-target sites and PCR was performed. The PCR products were then sequenced by

Sangon Biotech Co. Ltd. (Shanghai, China) and compared to those from UCSC

database.

General characterization of the CYP2D1-null rats. The appearance, fertility, and

general behaviors of CYP2D1-null rats were observed. CYP2D1-null rats at

12-week-old (6 rats per group, male and female) were sacrificed by exposure to an

ascending concentration of CO2 and dissected for further study. The viscera indices

(defined as the ratio of tissue weight to body weight) were calculated and compared to

those of WT rats.

Analysis of the expression levels of major P450s. The rat liver microsomes were

prepared by differential centrifugation using a previously described method (Egorin et

al., 1997). The concentration of liver microsomes was determined using the Enhanced

Bicinchoninic Acid Protein Assay Kit (Beyotime, Nantong, China) and the expression

of major subtypes of cytochrome P450 in the CYP2D1-null and WT rats were


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

10

determined by western blotting. The common loading controls such as GAPDH or

β-actin could not be used in the experiment since most of them had been removed

during microsomal preparation. Therefore, we used Ponceau S stain on the duplicate

gel to guarantee the loading amount of protein per lane (5 µg/lane) was consistent (Gu

et al., 2003). The blots were incubated with CYP1A2 (sc-53241, mouse monoclonal

IgG1, Santa Cruz Biotechnology, CA, USA), CYP2A (PAB19502, rabbit polyclonal,

Abnova, Taipei, Taiwan, China), CYP3A (sc-25845, rabbit polyclonal, Santa Cruz

Biotechnology, CA, USA), CYP2B (sc-73546, mouse monoclonal IgG1, Santa Cruz

Biotechnology, CA, USA), CYP2C11 (PA3-034, rabbit polyclonal, Thermo Fisher

Scientific, Waltham, MA, USA), CYP2D1 (AB1271, rabbit polyclonal, EMD

Millipore Corporation, Single Oak Drive, Temecula, CA 92590, USA), CYP2E1

(BML-CR3271-0100, rabbit polyclonal, Enzo, NY, USA) and CYPOR (sc-55477,

mouse monoclonal, Santa Cruz Biotechnology, CA, USA) antibodies, respectively, at

room temperature for 2 h, followed by incubation with the corresponding secondary

antibodies for 1 h. Chemiluminescence solution was added to the blot and the

ChemiDoc XRS imaging system (BioRdad, Hercules, CA, USA) was used to

visualize the images.

mRNA analysis of CYP2D genes. Total RNA was isolated from livers of WT and

CYP2D1-null rats using Trizol reagent (CW0580S, CWBIO, Beijing, China)

according to the instruction of the manufacturer. To detect selected CYP expression in

mRNA level, cDNA was prepared from total RNAs using the RevertAid First Strand

cDNA Synthesis kit (K1622, Thermo Fisher Scientific, MA, USA). β-actin was set as

the internal reference. Selected genes for quantification in livers of WT and

CYP2D1-null rats were CYP2D1, -2D2, -2D3, -2D4/18,-2D5 and primers designed for

quantification were listed in Supplementary Table 2.

VLF metabolism in the CYP2D1-null rats. Liver microsomes (1 mg/mL) and

various concentrations of VLF (7.5 μM, 10 μM, 15 μM, 20 μM, or 25 μM) were

mixed and pre-incubated at 37 °C water bath for 5 min, followed by adding

β-NADPH (1 mM) and MgCl2 (5 mM) to initiate the reaction in a total volume of 200

μL and incubated at 37 °C water bath for 50 min. The reaction was then stopped with


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

11

800 μL of ice-cold ethyl acetate containing 50 μg/mL carvedilol, which was used as

internal standard solution. The upper organic phase was collected by vigorous

vortexing for 3 min and centrifugation at 9, 600 g for 10 min at 4 °C. Then 400 μL of

ethyl acetate was used to extract the precipitate for the second time. The combined

organic phase was dried with nitrogen and reconstituted with 100 μL acetonitrile for

high-performance liquid chromatography (HPLC) analysis.

For determination of the pharmacokinetic parameters, CYP2D1-null and WT rats

were divided into 4 groups (6 rats per group, 12-week-old, male and female). The rats

were fasted for 12 h before the experiment but were provided with water. After

administration of a single dose of VLF (20 mg/kg, intragastric administration),

approximately 0.3 mL blood was collected from the orbital vein at different time

points (0.25, 0.5, 1, 2, 4, 8, 12, 24, and 36 h) in both CYP2D1-null and WT rats. The

blood samples were centrifuged at 1,500 g for 10 min to obtain plasma. 50 μL of 1.0

M hydrochloric acid solution and 10 μL of 50 μg/mL carvedilol (internal standard)

were added into 100 μL plasma and thoroughly mixed. Then 200 μL of ethyl acetate

was added and vortexed for 3 min. The supernatant was collected by centrifugation at

9, 600 g for 10 min. The precipitate was re-extracted with 200 μL ethyl acetate. The

combined supernatant was dried with nitrogen, and re-dissolved in 100 μL acetonitrile

for HPLC analysis.

Agilent Eclipse plus C18 (5 μm, 4.6 250 mm, Agilent Technologies, Santa Clara,

CA, USA) column was used at room temperature. The flow rate was 0.8 mL/min and

the wavelength for detection was set at 228 nm. The mobile phase consisted of 60%

acetonitrile and 40% 0.01 mol/L ammonium acetate buffer (pH 4.8), and the injection

volume was 20 μL.

Development of rat model of depression. The development of the depression

model was based on previous literatures and in accordance with our laboratory

conditions (Pucilowski et al., 1993; Zhao et al., 2008). Briefly, the depression models

in WT rats and CYP2D1-null rats were developed by feeding separately and chronic

mild stimulations (CMS). In the first and second week, the CMS groups were given 8

kinds of stimulations, including tail suspension for 5 min, rat cage tilting at 45°,


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

12

humid padding, overcrowding, electric shock (36 V, 2 times/min), forced swimming,

alternated light and dark, and fasting and water deprivation for 24 h. From day 15 to

day 20, ice water (4 °C, 5 min) was added in the bath coupled with heat stress (45 °C,

5 min). The same kind of stimulation was intermittently used to prevent the rats from

anticipating the upcoming stimulation (Supplementary Table 3). During the

development of rat model of depression, all CMS rats were kept feeding with 1 rat per

cage except in the overcrowding stimulation experiment. The control groups were

bred normally with 5 rats per cage.

Body weight test. The effects of depression on body weight in rats were

investigated with reference to a previous literature (Liu et al., 2011). Rats in each

group were weighed at 9:00 am on day 21 of depression modeling.

Locomotor activity test. The experiment was performed according to the method

from a previous report (Zhao et al., 2008). On day 21 of depression modeling, rats

were individually placed in an open box of 80 cm 80 cm 50 cm. A TSE

multi-function conditioning system (TSE Systems, Thuringia, Germany) was used to

automatically record the trajectory of the movement within 8 min and calculate the

total distance of locomotor activity.

1% sucrose water consumption test. The experiment was performed according to

a previous literature (Kim et al., 2003). After 4 h of locomotor activity test, the rats

were fasted with no food or water for 24h, and then 1% sucrose water was provided to

rats for another 24 hours. The 1% sucrose water consumption for 24 h was determined

with the ratio of intake volume (mL) to rat body weight (100 g).

Efficacy of venlafaxine hydrochloride in the rat model of depression. After CMS

modeling, the rats (5 rats per group, 12-week-old, male and female) were

administered with venlafaxine hydrochloride (CMS VLF groups, 20 mg/kg,

intragastrical administration) or 2 mL 0.9% saline (CMS Saline groups) every day

for 14 days. Then body weight, locomotor activity and 1% sucrose water consumption

were also evaluated. After those analyses, approximately 1.0 mL of blood was taken

from the orbital vein of each rat, and plasma was prepared by 1,500 g centrifugation

for 20 min. The levels of norepinephrine (NE) and 5-hydroxytryptamine (5-HT) in


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

13

plasma were determined by an ELISA kit (SenBeiJia, Nanjing, China). The rats were

sacrificed by CO2 after blood sampling.

Statistical analyses. The experimental data were analyzed using Prism 5.0

statistical software (GraphPad, La Jolla, CA, USA). The experimental data were

presented as the mean ± standard deviation (SD). One-way analysis of variance

(ANOVA) was performed and a P value of < 0.05 was considered statistically

significant.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

14

Results

Generation of CYP2D1-null rats. Two rat founders with different genotypes, 7-base

pairs (ACCTCAT) deletion or 1-base pair (A) insertion in exon 4, were generated.

Due to the infertility of the other one (with 1-bp insertion), only the founder with 7-bp

deletion was used for further studies. The generation scheme of CYP2D1-null rat

model was shown in Fig. 1A. The PCR amplification results of the CYP2D1-null and

WT rats are shown in Fig. 1B. The DNA fragments showed bright bands around 586

bp. The homozygous CYP2D1-null rats lacked the 7 bp (ACCTCAT) at 270 ~ 280 bp

as compared to the WT rats, and the heterozygous CYP2D1-null rats presented mixed

peaks in corresponding area (Fig. 1C). Based on the genotyping results, CYP2D1-null

rats were successfully generated and the genotype-stable offspring were obtained.

Off-target analysis. Nine potential off-target sites of sgRNA3 (Supplementary

Table 4) were predicted using the off-target detection software and the corresponding

primers (Supplementary Table 5). The sequencing results showed that those potential

off-target sites were not mutated in the CYP2D1-null rats.

General characterization of the CYP2D1-null rats. There were no significant

differences in the appearance, fertility, and general behaviors between the

CYP2D1-null and WT rats, in either males or females (Supplementary Table 6-7). The

data of viscera indices were shown in Table 1. The viscera indices of CYP2D1-null

rats also showed no significant difference compared to those of WTs.

Hepatic expression levels of major P450s. Hepatic expression levels of major

P450s in CYP2D1-null and WT rats were shown as Fig. 2. CYP2D1 protein was only

detected in the WTs, but not in the CYP2D1-null rats. The expression levels of the

other P450s showed no significant differences, except for the expression of CYP2A,

which was significantly higher in the CYP2D1-null rats compared with that in the WT

rats, for both males and females. Notably, CYP2C11 was detected neither in the WT

females nor in CYP2D1-null females.

mRNA expression levels of CYP2D genes. Greatly reduced mRNA level of

targeted CYP2D1 gene was detected in the livers of the CYP2D1-null model

(Supplementary Fig. 1). Among the mRNA expression of other CYP2D genes,


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

15

CYP2D2 and CYP2D3 were up-regulated, CYP2D4/18 and CYP2D5 were

down-regulated (Supplementary Fig. 2).

Venlafaxine hydrochloride metabolism in the CYP2D1-null rats. The VLF in vitro

activities were determined with liver microsomes from both WTs and the

CYP2D1-null rats. The kinetic parameters of Michaelis constant (Km), maximum

velocity (Vmax), and intrinsic clearance (CLint) were calculated and shown in Table 2.

There is no sex difference in the model, the Vmax and the CLint of CYP2D1-null males

decreased by 46% (P < 0.05) and 57% (P < 0.05), respectively, while the Km increased

by 24% (P < 0.05), compared to those in WT males. The Vmax and the CLint of the

CYP2D1-null females decreased by 47% (P < 0.05) and 58% (P < 0.05), respectively,

while Km increased by 25%, compared to those in WT females.

In the pharmacokinetic study, the plasma levels of VLF in the CYP2D1-null rats

were significantly higher than those in the WT rats (at the marked time points, Fig. 3A,

B), while the levels of O-desmethyl venlafaxine (ODV) were significantly lower than

those in the WT rats (at the marked time points, Fig. 3C, D). Compared to the WT

males, VLF in the CYP2D1-null males had significantly lower Cl/F (decreased by

~36%, P < 0.05) and Vd/F (decreased by ~48%, P < 0.05), significantly increased

AUC0-t (increased by ~64%, P < 0.05) and AUC0-∞ (increased by ~59%, P < 0.05),

Cmax (increased by ~26%, P < 0.05). VLF in the CYP2D1-null females also had

significantly lower Cl/F (decreased by ~23%, P < 0.05) and Vd/F (decreased by ~25%,

P < 0.05), and had a significantly higher AUC0-t (increased by ~43%, P < 0.05),

AUC0-∞ (increased by ~35%, P < 0.05), and Cmax (increased by ~15%, P < 0.05), as

compared to those of the WTs (Table 3).

Body weight, 1% sucrose water consumption, and locomotor activity after

depression modeling. There were significant differences (P < 0.05) in body weight,

1% sucrose water consumption, and locomotor activity in CMS groups as compared

to those in control groups (Table 4). This result suggested that the depression

modeling in both strains was successful.

Efficacy of venlafaxine hydrochloride in the rat depression model. After 14 days

of administration of VLF, three depression indicators (e.g. body weight, 1% sucrose


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

16

water consumption, and locomotor activity) were recorded and shown in Table 5. All

the three indicators in VLF-treated groups (CMS + VLF groups) were significantly

increased than those saline-treated ones (CMS + Saline groups) for WT rats (P <

0.05). Those indicators were slightly improved (P > 0.05) in VLF-treated

CYP2D1-null rats compared with those of saline-treated groups, except for the 1%

sucrose water consumption in CYP2D1-null females. With VLF treatments, those

indicators in WTs were significantly higher (P > 0.05) than those in the CYP2D1-null

rats. Furthermore, with VLF treatments, plasma NE and 5-HT levels in WTs were

significantly higher than those in the CYP2D1-null rats, in either males or females

(Fig.4).


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

17

Discussion

Rat and human CYP2D isoforms share a good homology (> 70%), and rat CYP2D1

(~83% homology) is known as an ortholog of human CYP2D6 (Venhorst et al., 2003;

Martignoni et al., 2006). Rat CYP2D1 shares high homology with other CYP2D genes

(e.g. CYP2D2, ~82%; -2D3, ~85%; -2D4, ~80%; -2D5, ~98% and -2D18, ~80%),

which makes it difficult to develop a CYP2D1 knockout model in rats. In this study,

the exon 4 was found to be a suitable target for the CRISPR/Cas9 technology. We

analyzed the coding sequence of CYP2D1 gene and found that the deletion of

ACCTCAT would lead to truncated protein with only 213 amino acids, while the WT

CYP2D1 had 511 amino acids.

Previous studies using CRISPR/Cas9 have reported that off-target effects may

occur in the sgRNAs of mice and rats, which could also be inherited by the offspring

(Tan et al., 2015; Anderson et al., 2018). We used TagScan to predict the potential

off-target sites of sgRNA3 sequences in the CYP2D1-null rats and confirmed there

were no mutations in those potential off-target sites. Whether the mutation of

CRISPR/Cas9 occurred in non-predicted sites was necessary for further study due to

various factors.

In this study, the expression of CYP2C11 protein was detected only in male

CYP2D1-null rats (same as WT), so the knockout of CYP2D1 had little effects on the

male-specifically expression of CYP2C11. There was no significant difference in the

expression levels of other P450s, except the expression levels of CYP2As were higher

in the CYP2D1-null rats as compared to those in the WT rats. The rat CYP2A family

consisted of CYP2A1, -2A2 and -2A3 (Su and Ding, 2004). In the liver of rats,

CYP2A1 and CYP2A2 were dominantly expressed in females and males, respectively

(Haduch et al., 2005). CYP2A1 is responsible for the 7α-hydroxylation of

testosterone, while CYP2A2 catalyzes the 15α- and 7α-hydroxylation of testosterone

(Martignoni et al., 2006). The induction mechanism of CYP2A genes is still not very

clear. To the best of our knowledge, very few endogenous substances were identified

to regulate the expression of CYP2A genes in rats, except sexually dimorphic growth

hormone had been reported to up-regulate the expression of CYP2A1 and CYP2A2


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

18

(Waxman et al., 1995; Thangavel et al., 2004). Since the expression pattern of

CYP2C11 was not changed in the CYP2D1-null rat model, it was unlikely that the

induction of CYP2A was caused by growth hormone. Foreign compounds, including

phenobarbital, dexamethasone, and 3-methylcholanthrene, were found to up-regulate

CYP2A1 (Ryan and Levin, 1990), and pregnane X receptor (PXR), constitutive

androstane receptor (CAR), and aryl hydrocarbon receptor (AhR) could also be

involved in the regulation of CYP2As (Wallace and Redinbo, 2013). The specific

roles of those nuclear receptors in CYP2D1-null rats need to be further studied.

In human beings, it was reported that after administration of 150 mg VLF to 141

healthy subjects, the Cmax, AUC0-t, and AUC0-∞ of VLF in PMs were increased by 83%,

189%, and 212%, respectively as compared to those of extensive metabolizers (EMs).

The t1/2 was prolonged by 71%, and Cl/F was decreased by 68% (Kandasamy et al.,

2010). In another study, 14 healthy volunteers received 75 mg VLF extended release

formulations, the mean Cmax and AUC of VLF were increased by 149% and 331% in

the PMs compared those in the EMs, while Cl/F was decreased by 83% (Preskorn et

al., 2009). However, in our VLF metabolism study with rat models, the Cmax, AUC0-t,

and AUC0-∞ of VLF in the CYP2D1-null males were only increased by 24%, 64%, and

59%, respectively, as compared with those of the WT males; while Cl/F and Vd/F

were decreased by 36%, 48%, respectively. The difference of VLF metabolism

between CYP2D1-null and WT rats seemed much smaller than that between human

PMs and EMs. This fact suggested that other 2D isozymes might also contribute to

VLF metabolism, and the broad use of the current knockout model was limited.

Therefore, a rat model with multiple knockouts of CYP2D genes would be a better

approach to understand the VLF metabolism in humans.

The CRISPR/Cas9 system could be used to knockout multiple genes

simultaneously by co-expressing multiple sgRNAs targeting different sites (Cong et

al., 2013; Cao et al., 2016; Hashimoto et al., 2016). However, those approaches

achieved complete bi-allelic knockout animals with low efficiencies (Zuo et al., 2017).

Since there were six members in CYP2D subfamily, the deletion of those genes

simultaneously in rat genome would require an approach having very high gene


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

19

targeting efficiency. In 2017, Zuo et al. demonstrated a new “C-CRISPR” approach,

with which three genes (Tet1, Tet2, and Tet3) were completely knocked out in mouse

embryos after an one-step injection of sgRNAs in zygotes (Zuo et al., 2017). Most

recently, Campa et al. demonstrated a multiplexed genome targeting method using

Cas12a and CRISPR arrays delivered on a single plasmid (Campa et al., 2019). Those

high efficiency methods would greatly facilitate our future generation of a

CYP2D-null rat model with deletion of all the six CYP2D genes.

Depression is a serious mental disorder characterized by anhedonia, weight loss,

sleeping disturbances, a sense of worthlessness, cognitive decline, or repeated

thoughts of death (Xu et al., 2002). In the CMS rat model, 1% sucrose water

consumption reflected the euphoria of the rats, and the locomotor activity in open-box

was used to detect the state of nervousness in the new environment (Matthews et al.,

1995; Willner, 1997). Thus, body weight test, 1% sucrose water consumption test and

locomotor activity test were commonly used behavioral indicators for depression

research (Bortolato et al., 2007; Dai et al., 2010). After 20 days of depression

modeling, the body weight, 1% sucrose water consumption, and locomotor activity of

the CMS groups were changed similar to the previous reports (Pucilowski et al., 1993;

Orsetti et al., 2008; Zhao et al., 2008; Dai et al., 2010). Those results demonstrated

the reproducibility in our depression modeling. Notably, sporadic death occurred in

both of WT female and CYP2D1-null female rats during the CMS modeling (data not

shown). Whereas, the rat mortality rate our experiment was less than that of mice

under the same challenge (Goshen et al., 2008; Sun et al., 2011), indicating that the

rats are more tolerant than mice in the depression modeling.

For the depressed WT rats, after VLF-treatment for 14 days, all the three

depression indicators were significantly improved than those in saline-treated ones.

This result suggested that VLF was effective in our depression model. Based on the

plasma levels of NE and 5-TH, it was clear that VLF treatment was more effective in

WT depression rats than that in the CYP2D1-null ones, possibly because of the

reduced formation of ODV in CYP2D1-null rats. We also tried to determine ODV


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

20

concentrations in the brain, but was unable obtain convincing results due to the

limitation of the analytical instruments.

In conclusion, we have successfully developed a novel and valuable CYP2D1-null

rat model in studying human drug metabolism by CYP2D6 using the CRISPR/Cas9

technology and demonstrated that the antidepressant effects of VLF were decreased in

the depressed CYP2D1-null rats. Moreover, our data demonstrated that the reduced

ODV formation was associated with a lower VLF efficacy in rats, suggesting a

potential application of monitoring plasma ODV level in the clinical optimization of

VLF for the treatment of depression.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

21

Authorship contributions

Participated in research design: Yuan Wei, Jun Gu, Hongqiu Zhou

Conducted experiments: Hongqiu Zhou, Yang Li, Changsuo Wang, Zhiqiang Li

Performed data analysis: Hongqiu Zhou, Mangting Shan

Wrote or contributed to the writing of the manuscript: Hongqiu Zhou, Yuan Wei, Jun

Gu, Zhen Ouyang


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

22

References

Anderson KR, Haeussler M, Watanabe C, Janakiraman V, Lund J, Modrusan Z,

Stinson J, Bei Q, Buechler A, Yu C, Thamminana SR, Tam L, Sowick M-A,

Alcantar T, O’Neil N, Li J, Ta L, Lima L, Roose-Girma M, Rairdan X,

Durinck S, and Warming S (2018) CRISPR off-target analysis in genetically

engineered rats and mice. Nat Methods 15:512–514.

Bissig K-D, Han W, Barzi M, Kovalchuk N, Ding L, Fan X, Pankowicz FP, Zhang

Q-Y, and Ding X (2018) P450-Humanized and Human Liver Chimeric Mouse

Models for Studying Xenobiotic Metabolism and Toxicity. Drug Metab Dispos

46:1734–1744.

Bortolato M, Mangieri RA, Fu J, Kim JH, Arguello O, Duranti A, Tontini A, Mor M,

Tarzia G, and Piomelli D (2007) Antidepressant-like Activity of the Fatty Acid

Amide Hydrolase Inhibitor URB597 in a Rat Model of Chronic Mild Stress.

Biol Psychiatry 62:1103–1110.

Bradford LD (2002) CYP2D6 allele frequency in European Caucasians, Asians,

Africans and their descendants. Pharmacogenomics 3:229–243.

Bymaster F (2001) Comparative Affinity of Duloxetine and Venlafaxine for Serotonin

and Norepinephrine Transporters in vitro and in vivo, Human Serotonin

Receptor Subtypes, and Other Neuronal Receptors.

Neuropsychopharmacology 25:871–880.

Campa CC, Weisbach NR, Santinha AJ, Incarnato D, and Platt RJ (2019) Multiplexed

genome engineering by Cas12a and CRISPR arrays encoded on single

transcripts. Nat Methods, doi: 10.1038/s41592-019-0508-6.

Cao J, Wu L, Zhang S-M, Lu M, Cheung WKC, Cai W, Gale M, Xu Q, and Yan Q

(2016) An easy and efficient inducible CRISPR/Cas9 platform with improved

specificity for multiple gene targeting. Nucleic Acids Res gkw660.

Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W,

Marraffini LA, and Zhang F (2013) Multiplex Genome Engineering Using

CRISPR/Cas Systems. Science 339:819–823.

Dai Y, Li Z, Xue L, Dou C, Zhou Y, Zhang L, and Qin X (2010) Metabolomics study

on the anti-depression effect of xiaoyaosan on rat model of chronic

unpredictable mild stress. J Ethnopharmacol 128:482–489.

De Leon J, Susce MT, Pan R-M, Fairchild M, Koch WH, and Wedlund PJ (2005) The

CYP2D6 Poor Metabolizer Phenotype May Be Associated With Risperidone

Adverse Drug Reactions and Discontinuation. J Clin Psychiatry 66:15–27.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

23

Egorin MJ, Rosen DM, Benjamin SE, Callery PS, Sentz DL, and Eiseman JL (1997)

In vitro metabolism by mouse and human liver preparations of halomon, an

antitumor halogenated monoterpene. Cancer Chemother Pharmacol 41:9–14.

Gonzalez FJ (2003) Role of Gene Knockout and Transgenic Mice in the Study of

Xenobiotic Metabolism. Drug Metab Rev 35:319–335.

Goshen I, Kreisel T, Ben-Menachem-Zidon O, Licht T, Weidenfeld J, Ben-Hur T, and

Yirmiya R (2008) Brain interleukin-1 mediates chronic stress-induced

depression in mice via adrenocortical activation and hippocampal

neurogenesis suppression. Mol Psychiatry 13:717–728.

Gu J, Weng Y, Zhang Q-Y, Cui H, Behr M, Wu L, Yang W, Zhang L, and Ding X

(2003) Liver-specific deletion of the NADPH-cytochrome P450 reductase

gene: impact on plasma cholesterol homeostasis and the function and

regulation of microsomal cytochrome P450 and heme oxygenase. J Biol Chem

278:25895–25901.

Guengerich FP (2008) Cytochrome P450 and Chemical Toxicology. Chem Res Toxicol

21:70–83.

Haduch A, Wójcikowski J, and Daniel WA (2005) Effect of short- and long-term

treatment with antidepressant drugs on the activity of rat CYP2A in the liver.

Pharmacol Rep Pr 57:774.

Handa T, Katare RG, Kakinuma Y, Arikawa M, Ando M, Sasaguri S, Yamasaki F, and

Sato T (2009) Anti-Alzheimer’s Drug, Donepezil, Markedly Improves

Long-Term Survival After Chronic Heart Failure in Mice. J Card Fail

15:805–811.

Hashimoto M, Yamashita Y, and Takemoto T (2016) Electroporation of Cas9

protein/sgRNA into early pronuclear zygotes generates non-mosaic mutants in

the mouse. Dev Biol 418:1–9.

Hertz DL, Snavely AC, McLeod HL, Walko CM, Ibrahim JG, Anderson S, Weck KE,

Rubin P, Olajide O, Moore S, Raab R, Carrizosa DR, Corso S, Schwartz G,

Peppercorn JM, Evans JP, Desta Z, Flockhart DA, Carey LA, and Irvin WJ

(2015) CYP2D6 intermediate metabolizers includes patient groups with

distinct metabolic activity. Cancer Res 75:P1-03–02.

Kandasamy M, Srinivas P, Subramaniam K, Ravi S, John J, Shekar R, Srinivas N, and

Thangam S (2010) Differential outcomes from metabolic ratios in the

identification of CYP2D6 phenotypes–focus on venlafaxine and

O-desmethylvenlafaxine. Eur J Clin Pharmacol 66:879–887.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

24

Kim H, Whang W-W, Kim H-T, Pyun K-H, Cho S-Y, Hahm D-H, Lee H-J, and Shim I

(2003) Expression of neuropeptide Y and cholecystokinin in the rat brain by

chronic mild stress. Brain Res 983:201–208.

Li D, Qiu Z, Shao Y, Chen Y, Guan Y, Liu Meizhen, Li Y, Gao N, Wang L, Lu X,

Zhao Y, and Liu Mingyao (2013) Heritable gene targeting in the mouse and rat

using a CRISPR-Cas system. Nat Biotechnol 31:681–683.

Li M, Zheng C, Sato T, Kawada T, Sugimachi M, and Sunagawa K (2004) Vagal

Nerve Stimulation Markedly Improves Long-Term Survival After Chronic

Heart Failure in Rats. Circulation 109:120–124.

Liu J, Li Y, Bai G, Wang J, and Xue C (2011) The change of behavior and the

consumption of food and syrup of depression rats model under space

circumstances. Chin J Vet Med 47:12–14.

Lu J, Shao Y, Qin X, Liu D, Chen A, Li D, Liu M, and Wang X (2017) CRISPR

knockout rat cytochrome P450 3A1/2 model for advancing drug metabolism

and pharmacokinetics research. Sci Rep 7:42922.

Magalhães P, Alves G, Llerena A, and Falcão A (2014) Venlafaxine pharmacokinetics

focused on drug metabolism and potential biomarkers. Drug Metabol Drug

Interact 29:129–141.

Martignoni M, Groothuis GMM, and De Kanter R (2006) Species differences

between mouse, rat, dog, monkey and human CYP-mediated drug metabolism,

inhibition and induction. Expert Opin Drug Metab Toxicol 2:875–894.

Matthews K, Forbes N, and Reid IC (1995) Sucrose consumption as an hedonic

measure following chronic unpredictable mild stress. Physiol Behav

57:241–248.

Meyer UA, Skoda RC, and Zanger UM (1990) The genetic polymorphism of

debrisoquine/sparteine metabolism—molecular mechanisms. Pharmacol Ther

46:297–308.

Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ,

Waterman MR, Gotoh O, Coon MJ, Estabrook RW, Gunsalus IC, and Nebert

DW (1996) P450 superfamily: update on new sequences, gene mapping,

accession numbers and nomenclature. Pharmacogenetics 6:1–42.

Orsetti M, Di Brisco F, Canonico PL, Genazzani AA, and Ghi P (2008) Gene

regulation in the frontal cortex of rats exposed to the chronic mild stress

paradigm, an animal model of human depression. Eur J Neurosci

27:2156–2164.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

25

Preskorn S, Patroneva A, Silman H, Jiang Q, Isler JA, Burczynski ME, Ahmed S, Paul

J, and Nichols AI (2009) Comparison of the Pharmacokinetics of Venlafaxine

Extended Release and Desvenlafaxine in Extensive and Poor Cytochrome

P450 2D6 Metabolizers. J Clin Psychopharmacol 29:39–43.

Pucilowski O, Overstreet DH, Rezvani AH, and Janowsky DS (1993) Chronic mild

stress-induced anhedonia: Greater effect in a genetic rat model of depression.

Physiol Behav 54:1215–1220.

Robinson HJ, Phares HF, and Graessle OE (1968) Effects of indomethacin on acute,

subacute, and latent infections in mice and rats. J Bacteriol 96:6–13.

Ryan DE, and Levin W (1990) Purification and characterization of hepatic

microsomal cytochrome P-450. Pharmacol Ther 45:153–239.

Scheer N, Kapelyukh Y, McEwan J, Beuger V, Stanley LA, Rode A, and Wolf CR

(2012) Modeling Human Cytochrome P450 2D6 Metabolism and Drug-Drug

Interaction by a Novel Panel of Knockout and Humanized Mouse Lines. Mol

Pharmacol 81:63–72.

Scheer N, McLaughlin LA, Rode A, MacLeod AK, Henderson CJ, and Wolf CR

(2014) Deletion of 30 Murine Cytochrome P450 Genes Results In Viable Mice

With Compromised Drug Metabolism. Drug Metab Dispos 42:1022–1030.

Su T, and Ding X (2004) Regulation of the cytochrome P450 2A genes. Toxicol Appl

Pharmacol 199:285–294.

Sun X-L, Liu Y, Dai T, Ding J-H, and Hu G (2011) Uncoupling protein 2 knockout

exacerbates depression-like behaviors in mice via enhancing inflammatory

response. Neuroscience 192:507–514.

Tan EP, Li Y, Del Castillo Velasco-Herrera M, Yusa K, and Bradley A (2015)

Off-target assessment of CRISPR-Cas9 guiding RNAs in human iPS and

mouse ES cells: Off-Target Assessment of CRISPR-Cas9. genesis

53:225–236.

Teh LK, and Bertilsson L (2012) Pharmacogenomics of CYP2D6: Molecular Genetics,

Interethnic Differences and Clinical Importance. Drug Metab Pharmacokinet

27:55–67.

Thangavel C, Garcia MC, and Shapiro BH (2004) Intrinsic sex differences determine

expression of growth hormone-regulated female cytochrome P450s. Mol Cell

Endocrinol 220:31–39.

Venhorst J, ter Laak AM, Commandeur JNM, Funae Y, Hiroi T, and Vermeulen NPE

(2003) Homology Modeling of Rat and Human Cytochrome P450 2D


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

26

(CYP2D) Isoforms and Computational Rationalization of Experimental

Ligand-Binding Specificities. J Med Chem 46:74–86.

Wallace BD, and Redinbo MR (2013) Xenobiotic-sensing nuclear receptors involved

in drug metabolism: a structural perspective. Drug Metab Rev 45:79–100.

Wang X, Tang Y, Lu J, Shao Y, Qin X, Li Y, Wang L, Li D, and Liu M (2016)

Characterization of novel cytochrome P450 2E1 knockout rat model generated

by CRISPR/Cas9. Biochem Pharmacol 105:80–90.

Waxman D, Ram P, Pampori N, and Shapiro B (1995) Growth hormone regulation of

male-specific rat liver P450s 2A2 and 3A2: induction by intermittent growth

hormone pulses in male but not female rats rendered growth hormone

deficient by neonatal monosodium glutamate. Mol Pharmacol 48:790.

Wei Y, Yang L, Zhang X, Sui D, Wang C, Wang K, Shan M, Guo D, and Wang H

(2018) Generation and Characterization of a CYP2C11-Null Rat Model by

Using the CRISPR/Cas9 Method. Drug Metab Dispos 46:525–531.

Wellington K, and Perry CM (2001) Venlafaxine Extended-Release: A Review of its

Use in the Management of Major Depression. CNS Drugs 15:643–669.

Willner P (1997) Validity, reliability and utility of the chronic mild stress model of

depression: a 10-year review and evaluation. Psychopharmacology (Berl)

134:319–329.

Wuttke H, Rau T, Heide R, Bergmann K, Bohm M, Weil J, Werner D, and

Eschenhagen T (2002) Increased frequency of cytochrome P450 2D6 poor

metabolizers among patients with metoprolol-associated adverse effects. Clin

Pharmacol Ther 72:429–437.

Xu S, Lu X, Ying Y, He X, Zhang J, and Ye C (2002) An controlled analysis of

clinical characters of 43 cases with chronic depression. Sichuan Ment Health

15:24–26.

Yamazaki H (ed) (2014) Fifty Years of Cytochrome P450 Research, Springer Japan,

Tokyo.

Ye H, Sui D, Liu W, Yuan Y, Ouyang Z, and Wei Y (2019) Effects of CYP2C11 gene

knockout on the pharmacokinetics and pharmacodynamics of warfarin in rats.

Xenobiotica, doi: 10.1080/00498254.2019.1579006.

Zanger UM, and Schwab M (2013) Cytochrome P450 enzymes in drug metabolism:

Regulation of gene expression, enzyme activities, and impact of genetic

variation. Pharmacol Ther 138:103–141.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

27

Zanger UM, Turpeinen M, Klein K, and Schwab M (2008) Functional

pharmacogenetics/genomics of human cytochromes P450 involved in drug

biotransformation. Anal Bioanal Chem 392:1093–1108.

Zhao Z, Wang W, Guo H, and Zhou D (2008) Antidepressant-like effect of liquiritin

from Glycyrrhiza uralensis in chronic variable stress induced depression

model rats. Behav Brain Res 194:108–113.

Zhou X, Chan K, and Yeung JHK (2012) Herb-drug interactions with Danshen (Salvia

miltiorrhiza): a review on the role of cytochrome P450 enzymes. Drug

Metabol Drug Interact 27:9–18.

Zuo E, Cai Y-J, Li K, Wei Y, Wang B-A, Sun Y, Liu Z, Liu J, Hu X, Wei W, Huo X,

Shi L, Tang C, Liang D, Wang Y, Nie Y-H, Zhang C-C, Yao X, Wang X, Zhou

C, Ying W, Wang Q, Chen R-C, Shen Q, Xu G-L, Li J, Sun Q, Xiong Z-Q, and

Yang H (2017) One-step generation of complete gene knockout mice and

monkeys by CRISPR/Cas9-mediated gene editing with multiple sgRNAs. Cell

Res 27:933–945.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

28

Footnotes

This study was supported by the National Natural Science Foundation of China [Grant

Nos. 81102522, 81373480, and 81573529], and the Natural Science Foundation of

Jiangsu Province [Grant No. BK2011473].


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

29

FIGURE LEGENDS

Figure 1 Confirmation of gene targeting in CYP2D1-null rats. (A) Schematic of the

exon structure of the CYP2D1 gene in rats. Exons are shown as black boxes. The 7 bp

(ACCTCAT) was deleted in exon 4. (B) Fragments of approximately 586 bp were

amplified from ten F2 pups. (n = 10) (C) Genotyping results for CYP2D1–/–

,

CYP2D1+/–

and wild-type (WT) rats; seven base pairs were deleted in exon 4 of

CYP2D1 in the knockout alleles.

Figure 2 Western blotting analyses of several cytochrome P450 isoforms (CYP2D1,

CYP1A2, CYP2B, CYP2A, CYP2C11, and CYP2E1) in the livers of CYP2D1-null

and WT rats. Each lane represents the pooled microsomes of the livers of WT or

CYP2D1-null rats. CYP2D1 was not detected in the liver microsomes of

CYP2D1-null rats. The expression of CYP1A2, CYP2B, CYP2C11, and CYP2E1 in

CYP2D1-null rats showed no marked difference, while the expression of CYP2A

showed higher levels, compared to that of WT rats. CYP2C11 protein was not

expressed in female rats. WT (M), wild-type male rats; WT (F), wild-type female rats;

Null (M), CYP2D1-null male rats; Null (F), CYP2D1-null female rats.

Figure 3 Mean plasma concentration-time curves of venlafaxine hydrochloride and

O-desmethyl venlafaxine after intragastrical administration at a dose of 20 mg/kg in

wild-type (WT) Sprague-Dawley and CYP2D1-null rats. (A) Mean plasma

concentration-time curves of venlafaxine hydrochloride (VLF) in male rats; (B) Mean

plasma concentration-time curves of venlafaxine hydrochloride (VLF) in female rats;

(C) Mean plasma concentration-time curves of O-desmethyl venlafaxine (ODV) in

male rats; (D) Mean plasma concentration-time curves of O-desmethyl venlafaxine

(ODV) in female rats. WT-M, wild-type male rats; WT-F, wild-type female rats;

Null-M, CYP2D1-null male rats; Null-F, CYP2D1-null female rats. All values are

shown as the mean ± SD, n = 6. *P < 0.05, compared to that of WTs with same sex.

Figure 4 The levels of NE (A) and 5-HT (B) in CYP2D1-null and WT rats after

administration of venlafaxine hydrochloride. WT-M, wild-type male rats; WT-F,


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

30

wild-type female rats; Null-M, CYP2D1-null male rats; Null-F, CYP2D1-null female

rats. Ctrl, control group; CMS Saline, chronic mild stimulations saline-treated group;

CMS VLF, the group of chronic mild stimulations treated-rats administered with

venlafaxine. All values are shown as the mean ± SD, n = 6. *P < 0.05, compared to

that of Ctrl group; #P < 0.05, compared to that of CMS Saline group.

$P < 0.05,

compared to that of WT group.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

31

Table 1. Viscera indices in CYP2D1-null and wild-type rats.

All values are shown as the mean ± SD, n = 6. WT-M, wild-type male rats; WT-F,


rats.

Viscera indices Null-M WT-M Null-F WT-F

Kidney (%) 0.9321 ± 0.0838 0.8779 ± 0.0121 0.7357 ± 0.0203 0.9419 ± 0.0550

Liver (%) 4.537 ± 0.3352 4.700 ± 0.4461 3.915 ± 0.3302 4.108 ± 0.0110

Heart (%) 0.3659 ± 0.0255 0.3646 ± 0.0271 0.4032 ± 0.0041 0.4140 ± 0.0113

Testis (%) 0.9323 ± 0.0840 0.9521 ± 0.0372 N/A N/A

Spleen (%) 0.2208 ± 0.0290 0.2518 ± 0.0091 0.1880 ± 0.0061 0.2446 ± 0.0324

Brain (%) 0.6345 ± 0.0202 0.5511 ± 0.0460 0.7624 ± 0.0650 0.8546 ± 0.0452

Lungs (%) 0.6309 ± 0.0588 0.5602 ± 0.0711 0.6343 ± 0.0649 0.7862 ± 0.0951


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

32

Table 2. Kinetics of venlafaxine hydrochloride metabolism in liver microsomes

from CYP2D1-null and wild-type rats.

All values are shown as the mean ± SD, n = 3. Km, substrate concentration at half of

the maximum reaction rate; Vmax, maximum reaction rate; CLint, intrinsic clearance;

WT-M, wild-type male rats; WT-F, wild-type female rats; Null-M, CYP2D1-null

male rats; Null-F, CYP2D1-null female rats. *P < 0.05, compared to that of WTs with

same sex.

Vmax (nmol-1

·min-1

·mg potein-1

) Km (µmol·L-1

) CLint (L·mg-1

·min-1

)

WT-M 156.7 ± 14.7 94.7 ± 8.9 1655 ± 165

Null-M 84.6 ± 5.5* 117.9 ± 16.6

* 717 ± 33

*

WT-F 125.1 ± 18.8 144.4 ± 8.7 866 ± 216

Null-F 66.2 ± 9.1* 181.1 ± 15.9

* 365 ± 57

*


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

33

Table 3. Plasma pharmacokinetic parameters in CYP2D1-null rats and wild-type

rats after treatment with venlafaxine hydrochloride at 20 mg/kg.

Parameter WT-M Null-M WT-F Null-F

AUC0-t

(μg·mL-1

·h-1

)

12.4 ± 3.3 20.3 ± 2.5* 13.6 ± 1.7 19.4 ± 1.3*

AUC0-∞

(μg·mL-1

·h-1

)

15.0 ± 2.6 23.8 ± 4.2* 15.3 ± 2.1 20.7 ± 1.5*

Cmax

(μg·mL-1

)

1.9 ± 0.1 2.4 ± 0.1* 2.6 ± 0.1 3.0 ± 0.1*

Vd/F

(103

mL·kg-1

)

25.2 ± 7.2 13.1 ± 3.4* 15.4 ± 1.4 11.5 ± 2.5*

Cl/F

(103

mL·h-1

·kg-1

)

1.4 ± 0.3 0.9 ± 0.2* 1.3 ± 0.2 1.0 ± 0.1*

All values are shown as the mean ± SD, n = 6. Cmax, peak concentration; AUC, area

under the curve of the drug; AUC0-t, AUC from the time of administration to the last

point; AUC0-∞, time from the start of administration to the theoretical extrapolation

AUC; CL/F, apparent total clearance; Vd/F, apparent volume of distribution. WT-M,

wild-type male rats; WT-F, wild-type female rats; Null-M, CYP2D1-null male rats;

Null-F, CYP2D1-null female rats. *P < 0.05, compared to that of WTs.


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

34

Table 4. The body weight, 1% sucrose water consumption, and locomotor

activity of CYP2D1-null and wild-type rats after depression modeling.

All values are shown as the mean ± SD, n = 5. Ctrl, control group without depression

modeling; CMS, chronic mild stimulations-treated group. WT-M, wild-type male rats;

WT-F, wild-type female rats; Null-M, CYP2D1-null male rats; Null-F, CYP2D1-null

female rats. *P < 0.01, compared to that of control groups.

WT-M Null-M WT-F Null-F

Body Weight (g)

Ctrl 217.9 ± 17.2 214.3 ± 12.0 210.5 ± 9.4 203.9 ± 12.4

CMS 178.5 ± 11.1* 198.2 ± 11.9

* 165.1 ± 8.5

* 158.5 ± 15.8

*

1% Sucrose water consumption (mL/100 g)

Ctrl 20.5 ± 1.0 22.2 ± 1.4 21.7 ± 2.1 19.3 ± 1.1

CMS 18.1 ± 0.8* 16.6 ± 2.4

* 12.3 ± 1.3

* 13.3 ± 1.1

*

Total distance (m)

Ctrl 22.1 ± 0.5 24.4 ± 1.1 21.2 ± 1.2 20.0 ± 1.2

CMS 18.4 ± 1.7*

21.5 ± 1.1* 17.4 ± 1.6

* 17.5 ± 1.5

*


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

35

Table 5. The body weight, 1% sucrose water consumption, and locomotor

activity of CYP2D1-null and wild-type rats after administration.

All values are shown as the mean ± SD, n = 5. WT-M, wild-type male rats; WT-F,


rats. Ctrl, control group without depression modeling; CMS Saline, chronic mild

stimulations-treated group administered with saline; CMS VLF, chronic mild

stimulations-treated group administered with venlafaxine. *P < 0.05, compared to that

of Ctrl group; #P < 0.05, compared to that of CMS Saline group.

$P < 0.05,

compared to that of WT group.

WT-M Null-M WT-F Null-F

Body Weight (g)

Ctrl 255.8 ± 9.0 240.1 ± 15.5 228.7 ± 14.6 220.7 ± 7.3

CMS Saline 207.6 ± 24.9* 185.6 ± 14.0

* 174.0 ± 8.1

* 134.3 ± 14.5

*

CMS VLF 237.0 ± 14.4*,#

197.6 ± 15.1*,$

194.5 ± 9.7*,#

152.5 ± 11.5*,$

1% Sucrose water consumption (mL/100 g)

Ctrl 22.2 ± 1.5 20.5 ± 0.9 19.2 ± 0.9 20.3 ± 1.5

CMS Saline 17.8 ± 1.7* 15.0 ± 1.2

* 13.0 ± 1.6

* 14.6 ± 1.7

*

CMS VLF 21.2 ± 1.6# 16.2 ± 1.3

*,$ 17.1 ± 1.0

*,# 13.5 ± 1.1

*,$

Total distance (m)

Ctrl 23.8 ± 1.2 21.5 ± 0.7 19.5 ± 1.2 20.7 ± 1.3

CMS Saline 20.4 ± 0.9* 18.0 ± 1.9

* 17.4 ± 0.7

* 15.6 ± 1.5

*

CMS VLF 24.6 ± 1.6#

20.2 ± 1.5$ 21.4 ± 1.5

# 16.5 ± 1.5

*,$


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

36

Figure 1


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

37

Figure 2


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

38

Figure 3


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


DMD # 88526

39

Figure 4


at ASPE

T Journals on M

arch 1, 2020dm


ownloaded from


Documents

CYP2D1 Gene Knockout Reduces the Metabolism and …dmd.aspetjournals.org/content/dmd/early/2019/10/28/dmd.119.088526.full-text.pdfvenlafaxine (ODV) by CYP2D6 (~89%), CYP2C19 (~10%),