CRISPR-Cas9 strategy for activation of silent Streptomyces ... · CRISPR-Cas9 strategy for activation of silent Streptomyces biosynthetic gene ... doi:10.1038 /nchembio.2341 ... subjected

Supplementary Information

1

CRISPR-Cas9 strategy for activation of silent Streptomyces biosynthetic gene clusters

Mingzi M Zhang1,5

, Fong Tian Wong2,5

, Yajie Wang3, Shangwen Luo

3, Yee Hwee Lim

4, Elena Heng

2,

Wan Lin Yeo1, Ryan E Cobb

3, Behnam Enghiad

3, Ee Lui Ang

1 and Huimin Zhao

1,3,*

1Metabolic Engineering Research Laboratory, Science and Engineering Institutes, Agency for Science,

Technology, and Research (A*STAR), Singapore

2Molecular Engineering Lab, Biomedical Science Institutes, A*STAR, Singapore

3Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana-Champaign,

Urbana, IL 61801

4Organic Chemistry, Institute of Chemical and Engineering Sciences, A*STAR, Singapore

5Authors contributed equally

*To whom correspondence should be addressed. Phone: (217) 333-2631. Fax: (217) 333-5052. E-mail:

[email protected]

Nature Chemical Biology: doi:10.1038/nchembio.2341


2

SUPPLEMENTARY RESULTS

Supplementary Figure 1. CRISPR-Cas9 mediated promoter knock-in for activation of pigment BGCs.

Supplementary Figure 2. LCMS analysis of S. albus strain with activated indigoidine BGC.

Supplementary Figure 3. LCMS analysis of S. lividans strain with activated RED cluster.

Supplementary Figure 4. Production of pH-sensitive pigments by engineered S. lividans strain.

Supplementary Figure 5. LCMS analysis of S. lividans strain with activated ACT cluster.

Supplementary Figure 6. RT-qPCR analysis of S. roseosporus PTM cluster 24.

Supplementary Figure 7. LCMS analyses of PTM compounds produced by S. roseosporus.

Supplementary Figure 8. RT-qPCR analysis of S. roseosporus phosphonate cluster 10.

Supplementary Figure 9. Introduction of kasO*p-P8 promoter cassette for activation of the

phosphonate BGC in S. roseosporus.

Supplementary Figure 10. Locations of promoter knock-in for S. roseosporus clusters.

Supplementary Figure 11. Location of promoter knock-in for S. venezuelae cluster 16.

Supplementary Figure 12. LCMS analysis of S. roseosporus strain with an engineered cluster 3.


Supplementary Figure 14. LCMS analysis S. venezuelae strain with an engineered cluster 16.

Supplementary Figure 15. A distinct type II polyketide is produced by S. viridochromogenes with

promoter knock-in.

Supplementary Figure 16. Constitutive promoters used for cluster activation.

Supplementary Figure 17. Workflow for constructing genome editing plasmid for promoter knock-in.

Supplementary Table 1. Efficiencies of CRISPR-Cas9 mediated knock-in for streptomycetes.

Supplementary Table 2. AntiSMASH analyses of S. roseosporus NRRL15998.

Supplementary Table 3. Sequence homology of S. roseosporous cluster 24 to reported PTM clusters.

Supplementary Table 4. Sequence homology of S. roseosporous cluster 10 to FR-900098 BGC from

S. rubellomurinus.

Supplementary Table 5. AntiSMASH analyses of S. venezuelae ATCC10712.

Supplementary Table 6. AntiSMASH analyses of S. viridochromogenes DSM 40736.

Supplementary Table 7. Bacterial strains and plasmids used in this study.

Supplementary Table 8. Oligonucleotides used in this study.

Supplementary Note. Chemical characterization data for 1-4.

Supplementary References



3

SUPPLEMENTARY FIGURES

Supplementary Figure 1. CRISPR-Cas9 mediated promoter knock-in for activation of pigment

BGCs. (a) PCR product from genomic DNA isolated from wild type (wt) and exconjugants were

subjected to BstBI-digestion to determine tsr-kasO*p knock-in at the designated genomic locus within

the indigoidine cluster in S. albus. (b) Diagnostic PCR from genomic DNA isolated from wild type

(wt) and exconjugants using the indicated primers to determine kasO*p knock-in at the designated

genomic locus within the RED cluster in S. lividans. For control PCR of the left and right flanks,

primer pairs 1+2 and 3+4 were used respectively. For detection of kasO*p knock-in, primer pairs 1+5

and 3+6 were used. (c) PCR product from genomic DNA isolated from wild type (wt) and

exconjugants were subjected to BstBI-digestion to determine kasO*p knock-in at the designated

genomic locus within the ACT cluster in S. lividans. M refers to molecular weight ladder. Arrow heads

refer to location of primers used for PCR.



4

Supplementary Figure 2. LCMS analysis of S. albus strain with activated indigoidine BGC. (a)

HPLC analysis (UV detection at 600 nm) of acidic methanol from wild type (WT) S. albus and the

indicated engineered strain (Indigoidine) in which kasO*p was introduced into indigoidine cluster in

front of the indC-like ORF.1 (b) The masses of the two new major metabolites at 5 min and 5.3 min,

indicated by (*), are consistent with indigoidine-related metabolites (m/z 249, 250) and their adducts

(m/z 308, 292).2



5

Supplementary Figure 3. LCMS analysis of S. lividans strain with activated RED cluster. (a)

HPLC analysis (UV detection at 500 nm) of methanol extracts from wild type (WT) S. lividans and the

indicated engineered strain (RED) in which kasO*p was introduced into RED cluster. The masses of

the two new major metabolites at 15.3 min and 15.8 min, indicated by (*), are consistent with that of

undecylprodigiosin (m/z 394).3 (b) MS/MS analysis of the major metabolites at 15.3 min and 15.8 min

with m/z 394 yielded fragmentation patterns that are consistent with undecylprodigiosin.3,4



6

Supplementary Figure 4. Production of pH-sensitive pigments by engineered S. lividans strain.

Wild type (wt) and engineered S. lividans strains with activated ACT cluster were streaked onto MGY

medium. The plate (left panel) was exposed to ammonia fumes (right panel) to confirm the production

of pH-sensitive pigments.



7

Supplementary Figure 5. LCMS analysis of S. lividans strain with activated ACT cluster. (a)

HPLC analysis (UV detection at 500 nm) of acidic methanol extracts from wild type (WT) S. lividans

and the indicated engineered strain (ACT) in which kasO*p was introduced into ACT cluster. (b) The

masses of the two new major metabolites at 12.1 min and 12.5 min, indicated by (*), are consistent

with an actinorhodin-related metabolite (m/z 645) and gamma-actinorhodin (m/z 631) respectively.

The ACT cluster in S. coelicolor is known to produce different actinorhodin-related metabolites,

including gamma-actinorhodin.5,6

(c) MS/MS analysis of the major metabolites at 12.1 min and 12.5

min with m/z 645 and m/z 631 respectively yielded fragmentation patterns that are similar to that of

actinorhodin.4



8

Supplementary Figure 6. RT-qPCR analysis of S. roseosporus PTM cluster 24. (a) Relative gene

expression of each indicated gene after normalization to the housekeeping rpsL gene for both wild type

(red) and engineered (blue) strains. Error bars represent the standard deviation of biological triplicates.

n.d. indicates undetectable transcript levels. (b) Part of the PTM BGC (cluster 24) in S. roseosporus.

Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_ RS02310 is located within

the gene cluster and was used as a negative control (NC) for our RT-qPCR assay as an example of a

gene whose expression is unaffected by knock-in of the kasO*p promoter cassette. Site of kasO*p

knock-in is indicated by the blue arrowhead.



9

Supplementary Figure 7. LCMS analyses of PTM compounds produced by S. roseosporus. (a)

HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type S. roseosporus and

the indicated engineered strain in which kasO*p is introduced into cluster 24. (b) Mass spectra of 1 and

2 at the indicated retention times.



10

Supplementary Figure 8. RT-qPCR analysis of S. roseosporus phosphonate cluster 10. (a,

b) Relative gene expression of each indicated gene after normalization to the housekeeping rpsL gene

for both wild type (red) and engineered (blue) strains. SSGG_RS16990 and SSGG_RS16985 are

plotted separately due to differences in scale. Error bars represent the standard deviation of biological

triplicates. n.d. indicates undetectable transcript levels. (c) Phosphonate BGC (cluster 10) in S.

roseosporus. Genes that were examined by RT-qPCR are highlighted in yellow. SSGG_RS16955 is

located near the FR-900098 cluster and was used as a negative control (NC) for our RT-qPCR assay as

an example of a gene whose expression is unaffected by knock-in of the kasO*p-P8 promoter cassette.

Site of kasO*p-P8 promoter cassette knock-in is indicated by the blue arrowhead.



11

Supplementary Figure 9. Introduction of kasO*p-P8 promoter cassette for activation of the

phosphonate BGC in S. roseosporus. Shown from bottom to top are 1) the native genomic locus with

the location of chosen PAM and protospacer sequences indicated in blue, 2) the edited genome locus

with the inserted kasO*p-P8 promoter cassette indicated in green, and 3) the sequence traces of the two

junctions flanking the promoter cassette. Biosynthetic genes needed for FR-900009 are highlighted in

red and yellow.



12

Supplementary Figure 10. Locations of promoter knock-in for S. roseosporus clusters. Red genes

are putative biosynthetic genes while blue and green genes are transport-related and regulation-related

genes, respectively. Sites of single or bidirectional promoter cassette knock-in are indicated by the blue

arrowheads.

Supplementary Figure 11. Location of promoter knock-in for S. venezuelae cluster 16. Indicated

in red are putative biosynthetic genes while blue and green genes are transport-related and regulation-

related genes, respectively. Site of bidirectional kasO*p-P8 cassette knock-in is indicated by the blue

arrowhead.



13


(a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type S. roseosporus

and the indicated engineered strain in which kasO*p is introduced into cluster 3. The major unique

product produced by the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and

wild type (bottom) strains at retention time 20 min. (c) Extraction ion chromatogram (m/z 405) of

engineered (top) and wild type (bottom) strains. It is common to observe multiple changes in metabolic

profiles with cluster activation. Regulatory crosstalk between clusters and competition for common

precursors can result in increased and decreased production of metabolites that are not products of the

target cluster. Until the compounds are isolated, identified, and their biosynthesis accounted for by

genes encoded by the respective clusters, we cannot rule out that additional peaks observed for the

engineered strains are related products, shunt intermediates or simply a result of pleiotropic changes in

the host’s secondary metabolism as a result of activating the target cluster.



14


(a) HPLC analysis (UV detection at 254 nm) of ethyl acetate extracts from wild type S. roseosporus

and the indicated engineered strain in which kasO*p is introduced into cluster 18. The major unique

ion detected for the engineered strain is indicated by (*). (b) Mass spectra of engineered (top) and wild

type (bottom) strains at retention time 30.3 min. m/z 380 is the doubly charged species of m/z 780. (c)

Extracted ion chromatograms (m/z 780) of engineered (top) and wild type (bottom) strains. It is

common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk

between clusters and competition for common precursors can result in increased and decreased

production of metabolites that are not products of the target cluster. Until the compounds are isolated,

identified, and their biosynthesis accounted for by genes encoded by the respective clusters, we cannot

rule out that additional peaks observed for the engineered strains are related products, shunt

intermediates or simply a result of pleiotropic changes in the host’s secondary metabolism as a result of

activating the target cluster.



15

Supplementary Figure 14. LCMS analysis of S. venezuelae strain with an engineered cluster 16.

(a) Wild type (WT) and engineered strain in which kasO*p is introduced into cluster 16 on MGY

plates. (b) HPLC analysis (UV detection at 320 nm) of ethyl acetate extracts from wild type S.

venezuelae and the indicated engineered strain. The major unique ion detected for the engineered strain

is indicated by (*). (c) Mass spectra of engineered (red) and wild type (black) strains at retention times

31.2 min. (d) Extracted ion chromatograms (m/z 425) of engineered (top) and wild type (bottom)

strains. It is common to observe multiple changes in metabolic profiles with cluster activation.

Regulatory crosstalk between clusters and competition for common precursors can result in increased

and decreased production of metabolites that are not products of the target cluster. Until the compounds

are isolated, identified, and their biosynthesis accounted for by genes encoded by the respective

clusters, we cannot rule out that additional peaks observed for the engineered strains are related

products, shunt intermediates or simply a result of pleiotropic changes in the host’s secondary

metabolism as a result of activating the target cluster.



16

Supplementary Figure 15. A distinct type II polyketide is produced by S. viridochromogenes with

promoter knock-in. (a) Partial schematic of NZ_GG657757 containing majority of biosynthetic genes

(orange) and the position of kasO*p knock-in. This operon contains contained the minimal set of type

II PKS enzymes, including a ketosynthase (SSQG_RS26900), chain-length factor (SSQG_RS26905)

and an acyl carrier protein (SSQG_RS26910), together with a polyketide cyclase (SSQG_RS26915),

monooxygenase (SSQG_RS26930) and cytochrome P450 (SSQG_RS26935). Except for an additional

cytochrome P450, NZ_GG657757 has high homology and similar gene arrangement as a spore

pigment BGC in S. avermitilis (Accession number: AB070937.1). (b) HPLC analysis of extracts from

the engineered S. viridochromogenes strain harbouring a kasO*p in front of SSQG_RS26895 (bottom)

compared to that from the parent wild type strain (top). The major unique metabolite 4 is indicated. It is

common to observe multiple changes in metabolic profiles with cluster activation. Regulatory crosstalk

between clusters and competition for common precursors can result in increased and decreased

production of metabolites that are not products of the target cluster. Until the compounds are isolated,

identified, and their biosynthesis accounted for by genes encoded by the respective clusters, we cannot

rule out that additional peaks observed for the engineered strains are related products, shunt

intermediates or simply a result of pleiotropic changes in the host’s secondary metabolism as a result of

activating the target cluster.



17

Promoter Sequence

kasO*p tgttcacattcgaacggtctctgctttgacaacatgctgtgcggtgttgtaaagtcgtggccaggagaatacgacagcgtgcaggactgggggagttATG

P8

ggcgccgaccgcaccacactcacgagggcccgccccaccaacagggggcgggccctctgtgctggcctcaggcgccgaccgggctcggtgccctcaagcgccggccg

ggctccaagggtggcctcaagcgccggccgggctgagttgggccggtctgggcccgcacgcgcgcctcactgacggcctcaagcgccggccgggctatctatagcccgg

ccggcgcttgaggccgtctttggcgcgcgcctgtgagcggacggcccgtcaaagatcagcccggccggcgcttgaggccatctttcgagcccggccggcgtttgaggccac

cccacccccgccccggcaggggcggcctgacctccgcatccgccggcgcggacagggcacccccagtagacgggcgcggggccggaggcccctagcgccttgcactc

tcctaccccgagtgctaattattggcgttagcactctccgagtgagagtgacagaaggaccgggtcggtgaggcccgctggccacgcggggcaaggaaccgcgaggcagg

caggccgtccgtcgcgggcgccagcacggtccggagtatccaccctcccccagacagagtccggggggacccccagtcctgggaggaccacttcacaATG

b

c

Supplementary Figure 16. Constitutive promoters used for cluster activation. (a) Sequences of

constitutive promoters used in this study. ATG start codons of genes to be activated are underlined.

(b, c) Scheme and sequences of adapters introduced into pCRISPomyces at the XbaI site for making (b)

monodirectional and (c) bidirectional promoter knock-in constructs. Restriction sites of selected

enzymes are indicated in the sequence maps.



18

Supplementary Figure 17. Workflow for constructing genome editing plasmid for promoter

knock-in. Helper pCRISPomyces-2 plasmids (e.g. pCRISPomyces-2-kasO*p) for making promoter

knock-in constructs were made by ligating adapter sequences, containing restriction sites flanking the

promoter of choice to facilitate insertion of homology arms into pCRISPomyces-2.7 The protospacer of

a target cluster was first inserted via BbsI-mediated Golden Gate Assembly. The final editing plasmid

was achieved by sequential insertion of the first and second homology arms by Gibson assembly. Refer

to Online Methods section for more information.



19

Supplementary Table 1. Efficiencies of CRISPR-Cas9 mediated knock-in for streptomycetes.

Organism Clustera

Promoter insertedb Editing efficiency

edited/total screened

S. albus

Indigoidine – 1kb

Indigoidine

No protospacer – 1kb

No protospacer

kasO*p

3/5 (60%)

7/7 (100%)

0/8 (0%)

4/9 (44%)

S. albus Indigoidine – 1kb

Indigoidine tsr-kasO*p

1/5 (20%)

7/9 (78%)

S. lividans RED

No protospacer kasO*p

8/8 (100%)

4/6 (66%)

S. lividans ACT kasO*p 3/3 (100%)

S. roseosporus Cluster 3 kasO*p 3/3 (100%)

S. roseosporus Cluster 10 P8-kasO*p 2/4 (50%)

S. roseosporus Cluster 18 kasO*p 2/3 (66%)

S. roseosporus Cluster 24

No protospacer kasO*p

3/6 (50%)

0/8 (0%)

S. venezuelae Cluster 16

No protospacer P8-kasO*p

9/14 (64%)

3/8 (38%)

S. viridochromogenes Cluster 22 kasO*p 6/6 (100%)

aUnless otherwise indicated, knock-ins were performed with editing templates containing the indicated

insert with 2 kb homology flanks. No protospacer refers to the same knock-in constructs for the

indicated cluster without a protospacer. bkasO*p and P8-kasO*p cassettes are 97 and 774 bp respectively. tsr refers to a ~1 kb thiostrepton-

resistance cassette.



20

Supplementary Table 2. AntiSMASH analyses of S. roseosporus NRRL15998 (NCBI Reference

Sequence: NZ_DS999644.1).8 Previously observed compounds include daptomycin (clusters 1,2),

napsamycin (cluster 9), stenothricin (cluster 5) and arylomycin (cluster 20).9

Cluster Type From To Compound Study

Cluster 1 Nrps 294555 342186

Cluster 2 Nrps 327150 404865 Daptomycin Liu et al,

20149

Cluster 3 Nucleoside-t1pks 542942 610237 m/z 405 This study

Cluster 4 Terpene 749569 770645

Cluster 5 Nrps 867981 941249 Stenothricin Liu et al,

20149

Cluster 6 Ectoine 1254796 1265194

Cluster 7 Lantipeptide 2310568 2333055

Cluster 8 Siderophore 2417885 2429663

Cluster 9 Nrps 3338145 3408899 Napsamycin Liu et al,

20149

Cluster 10 Phosphonate 3538559 3564634 3 This study

Cluster 11 T2pks 4069279 4111773

Cluster 12 Siderophore-nrps 4243258 4290705


Cluster 14 Nrps 5067958 5119039


Cluster 16 Nrps 5627322 5683180


Cluster 18 T1pks 6088404 6152437 m/z 780 This study

Cluster 19 T1pks-

oligosaccharide 6137252 6204339

Cluster 20 Nrps 6206554 6271974 Arylomycin Liu et al,

20149

Cluster 21 Nrps-t1pks 6373968 6429540

Cluster 22 Bacteriocin 6529256 6540056


Cluster 24 Nrps-t1pks 7222916 7272356 1, 2 This study


Cluster 26 T1pks-nrps 7435742 7486384

Cluster 27 Melanin 7520011 7530493

Cluster 28 T3pks 7565600 7606652




21

Supplementary Table 3. Sequence homology of S. roseosporous cluster 24 to reported PTM

clusters.10,11

Frontalamide

biosynthetic (ftd)

S. griseus.

PTM

cluster11

Cluster 24

equivalent

Predicted

Function

Sequence

identity of

cluster 24 to

S. griseus

equivalent

FtdA SGR 815 SSGG_RS0133915 Sterol desaturase 95%

FtdB SGR 814 SSGG_RS02305 polyketide

synthase 95%

FtdC SGR 813 SSGG_RS02300 FAD-dependent

oxidoreductase 98%

FtdD SGR 812 SSGG_RS02295 phytoene

dehydrogenase 96%

FtdE SGR 811 SSGG_RS02290 alcohol

dehydrogenase 97%

FtdF SGR 810 SSGG_RS02285

putative

cytochrome P450

hydroxylase

91%

Supplementary Table 4. Sequence homology of S. roseosporous cluster 10 to FR-900098 BGC from

S. rubellomurinus.12

FR-900098

cluster12

Cluster 10

equivalent Predicted Function

Sequence

Identity

FrbI SSGG_RS17015 NUDIX hydrolase 60%

FrbH SSGG_RS17010 L-threonine-O-3-phosphate decarboxylase

[Streptomyces] 74%

FrbG SSGG_RS17005 Hypothetical protein 60%

FrbF SSGG_RS17000 AAC(3) family N-acetyltransferase 73%

FrbE SSGG_RS16995 Isocitrate dehydrogenase 63%

FrbD SSGG_RS16990 Phosphoenolpyruvate synthase 76%

FrbC SSGG_RS16985 Hypothetical protein 87%



22

Supplementary Table 5. AntiSMASH analyses of S. venezuelae ATCC10712 (NCBI Reference

Sequence: NC_018750.1).8 Previously observed compounds from S. venezuelae include

chloramphenicol (cluster 7) and jadomycin (cluster 20).13,14




Cluster 3 T1pks-T3pks-Nrps 504136 604067

Cluster 4 Lantipeptide-Terpene 614220 645285


Cluster 6 Indole 867489 890695

Cluster 7 Other 1031023 1073914 Chloramphenicol He et al,

200114

Cluster 8 Other 2055965 2096690


Cluster 10 Lassopeptide 3408328 3430687

Cluster 11 Other 4408196 4451900

Cluster 12 Butyrolactone 4522206 4533171



Cluster 15 Thiopeptide 5531076 5557501

Cluster 16 T3pks 5785193 5826323 m/z 425 This study




Cluster 20 Butyrolactone-T2pks 6494470 6531416 Jadomycin Doull et al,

199315

Cluster 21 Other 6672467 6716369

Cluster 22 Nrps-Ladderane 6720590 6814598

Cluster 23 Nrps 6800195 6855167



Cluster 26 T2pks 7421589 7464101


Cluster 28 Nrps 7706602 7760938


Cluster 30 T3pks 7946146 7987237

Cluster 31 Terpene-Nrps 8189935 8226158



23

Supplementary Table 6. AntiSMASH analyses of S. viridochromogenes DSM 40736 (NCBI

Reference Sequence: NZ_ACEZ00000000.1)8 Previously observed product from S. viridochromogenes

include phosphinothricin.


Cluster 1 Terpene-nrps-t1pks 147228 209213

Cluster 2 Melanin-terpene 350984 374124

Cluster 3 Nrps 614938 667909 Coelichelina

Cluster 4 T1pks-butyrolactone 925309 1004775


Cluster 6 T1pks 1023099 1074657

Cluster 7 T1pks 1068135 1123254


Cluster 9 Nrps-phosphonate 1172570 1240729 Phosphonothricin Metcalf et al,

200516

Cluster 10 Ectoine 1986466 1997781 Ectoineb

Cluster 11 NRPS-t1PKS 2482772 2542826







Cluster 18 T1pks 4852429 4915920

Cluster 19 Linaridin 4917000 4938204

Cluster 20 Lantipeptide-nrps 5099822 5150004


Cluster 22 T2pks 6046899 6089394 4 This study


Cluster 24 T1pks 6568627 6618163







Cluster 31 Bacteriocin-

lantipeptide 8164951 8193467

Cluster 32 T1pks 8282728 8326427

Cluster 33 Other 8476453 8521258 a 100% of genes show similarity with coelichelin BGC of S. coelicolor A3(2).

17,18

b 100% of genes show similarity with ectoine BGCs of S. chrysomallus.

19



24

Supplementary Table 7. Bacterial strains and plasmids used in this study.

Strains and plasmids Description Source

pCRISPomyces-2 (pCm2) AprR, oriT, reppSG5(ts), oriColE1, sSpcas9, sgRNA

cassette Cobb et al.7

pCm2-adapter1-kasO*p-

adapter2

pCM2 with adapters to facilitate assembly of

editing flanks upstream and downstream of

kasO*p

This work

pCm2-adapter1-P8-kasO*p-

adapter2

pCM2 with adapters to facilitate assembly of

editing flanks upstream and downstream of

bidirectional P8-kasO*p

This work

pUC19-tsr-kasO*p

Thiostrepton-resistance cassette (tsr)-kasO*p

cloned into EcoRI/HindIII site of pUC19,

preserving the restriction sites

This work

Escherichia coli DH5α

F– Φ80lacZΔM15 Δ(lacZYA-argF) U169

recA1 endA1 hsdR17 (rK–, mK+) phoA supE44

λ– thi-1 gyrA96 relA1

Zhao laboratory stock

Escherichia coli OmniMAX™

F– proAB+ lacIq lacZΔM15 Tn10(TetR)

Δ(ccdAB) mcrA Δ(mrr-hsdRMS-mcrBC)

Φ80lacZΔM15 Δ(lacZYA-argF)

U169 endA1 recA1 supE44 thi-

1 gyrA96 relA1 tonA panD

Thermo Fisher

Escherichia coli WM6026 diaminopimelic acid auxotroph William Metcalf

laboratory

Escherichia coli WM3780 dam-dcm- William Metcalf

laboratory

Streptomyces albus J1074 wild type

Prof. Wenjun Zhang,

University of California,

Berkeley

Streptomyces lividans 66 wild type Zhao laboratory stock

Streptomyces roseosporus

NRRL15998 wild type Zhao laboratory stock

Streptomyces venezualae

ATCC10712 wild type NRRL

Streptomyces

viridochromogenes DSM 40736 wild type Zhao laboratory stock



25

Supplementary Table 8. Oligonucleotides used in this study.

Primers Sequence Comments

Complementary oligonucleotides for BsaI Golden Gate assembly of protospacers.

20 bp protospacer sequences are represented in lowercase letters.

npPP6 ACGCcccgagtgtgtgatctgcga Indigoidine protospacer, S. albus

npPP7 AAACtcgcagatcacacactcggg

npPP288 ACGCgcccgaatccgatcgttcgg RED protospacer, S. lividans

npPP289 AAACccgaacgatcggattcgggc

npPP20 ACGCatcccgcatcggtgattaca ACT protospacer, S. lividans

npPP21 AAACtgtaatcaccgatgcgggat

npPP207 ACGCaagcgttccacgaaaacagg Cluster 10 protospacer in S. roseosporus

npPP208 AAACcctgttttcgtggaacgctt

npPP255 ACGCaatgaatttcgccat Cluster 24 protospacer in S. roseosporus

npPP256 AAACatggcgaaattcatt

npPP261 ACGCggcctggtcaaggcatgtac Cluster 3 protospacer in S. roseosporus

npPP262 AAACgtacatgccttgaccaggcc

npPP786 ACGCcccgtacatgcattgaacga Cluster 18 protospacer in S. roseosporus

npPP787 AAACtcgttcaatgcatgtacggg

npPP624 ACGCgcgcgcccggacgcttacgc Cluster 16 protospacer in S. venezuelae

npPP625 AAACgcgtaagcgtccgggcgcgc

pCm2-

C22-for ACGCccatggtccgtctccaaggt

Cluster 22 protospacer in S. viridochromogenes pCm2-

C22-rev AAACaccttggagacggaccatgg



26

Diagnostic PCR and sequencing

npPP356 cccggcgagacccatacgctcgc PCR of target genomic locus for S. roseosporus cluster 24

npPP357 ggtgctcgatgctcagcacggtcttg

npPP300 ttccgtaaggcttccccggataaaagcgc Sequencing primers for edited genomic region (S. roseosporus

cluster 24) npPP301 cgatcaggaaaagcggactgacccacg

npPP283 ggacctgtccttgttccacgccga PCR of target genomic locus for S. roseosporus cluster 10

npPP284 gacgacacgcaccatcaggaacgcc

npPP246 cagtcagcgagcaccggcag Sequencing primers for edited genomic region (S. roseosporus

cluster 10) npPP247 cccatggcggggatgccgat

npPP802 agagcggtttcgagctcacgaccgatgtcg PCR of target genomic locus for S. roseosporus cluster 18

npPP803 tcgagctgctgtctcgccagatcacggg

npPP804 caccacagtgccagtaggtctggtacggta Sequencing primers for edited genomic region (S. roseosporus

cluster 18)

npPP674 ggacgggaagatcacaccggtctccgtgg PCR of target genomic locus for S. roseosporus cluster 3

npPP675 ctgcgaccgcttcgtcaggtcgcattcg

npPP676 gacagcggacttgagggagcgtcataggtc Sequencing primer for edited genomic region (S. roseosporus cluster

3)

npPP689 gtcaccatcggctcctacgacggggtgcac PCR of target genomic locus for S. venezuelae cluster 16

npPP699 ccttcggcatgatctcgcaggcgctgatgg

npPP700 ccggtcatcttggtgacctgctggtcgagc Sequencing primers for edited genomic region (S. venezuelae cluster

16) npPP701 gcttcagggtctcctcgatgggctgcacg

npPP200 gcctccgccgcgacctgtgaacggta PCR of target genomic locus for S. lividans ACT cluster

npPP201 cggcgagtcagcaggactccgaacggac

npPP164 cgtgatcgacgacgaaccgcaga PCR of target genomic locus for S. lividans RED cluster – control

primer pair for left flank npPP178 gcgcctggagggcgttgaggacg

npPP355 cataactcccccagtcctgcacg PCR of target genomic locus for S. lividans RED cluster – kasO*p-

specific primer for left flank, used with npPP164

npPP176 cggcaccccatccgctcatgggag PCR of target genomic locus for S. lividans RED cluster – control

primer pair for right flank npPP227 tggtagaggtcccggtcgaacaactcggccgg

npPP196 agtcgtggccaggagaatacgacagcgtgc PCR of target genomic locus for S. lividans RED cluster – kasO*p-

specific primer for right flank, used with npPP227

npPP183 ggcctcgaactccagcacctcgacg PCR of target genomic locus for S. albus indigoidine cluster

npPP186 cacgcgttcatggtgcccggcatc

C22_Up-

2kbL-for cggtttgtcacaatgggcgg

PCR of target genomic locus for S. viridochromogenes cluster 22

C22-Seq-rev tggacgacgaacacgaact

C22-Seq-for agcaccgtcttccaccggg Sequencing primers for edited genomic region (S. viridochromogenes

cluster 22) C22-Seq-rev tggacgacgaacacgaact



27

Gene-specific primers for RT-qPCR

atcgaggtcacggcctacatc rpsL

cgcggatgatcttgtaacgaac

ttggaggcactggaagagag SSGG_RS107025

atcctggccaacaaggaatcc

aactggtcgacgacaacatc SSGG_RS107020

cgttctcgacattgatccacag

gctcgacaaagacgaaattcgc SSGG_RS107010

atttgcggagagttgtgtgc

cgaatgagttctgcggatgc SSGG_RS107000

tattcgacccagcgctgac

agttggaaaacgtcgctcac SSGG_RS106990

atcaccgccatgcagaaaag

tgggattcaaggccgtacac SSGG_RS106985

tccttggccatcttgatcagc

tgtggtcgatgatcagactctc SSGG_RS0132525

caaatacaccgatgggctgttc

tcgaggacaagtgtcagcatc SSGG_RS16955

gcaatcgccggtctatttgc

aagaacttgtacggggagcag SSGG_RS02310

gcgttgctgtacgtggac

tcggagtgatcgcctatttgg SSGG_RS0133915

agcaggaagtagatgccgtac

aacgcatcaaggacgaactg SSGG_RS02305

tccttcgacacctgtgagatac

actgcacctacttcagcgac SSGG_RS02300

gaagtcccggacgaaatcgg

actcgatcatggaggtggtg SSGG_RS02290

tcgagatcacatgcgtacgc



28

SUPPLEMENTARY NOTE

Chemical characterization data for compounds 1–4.



29

NMR analyses of 1. (a) 1H NMR (CD3OD). (b) COSY (CD3OD) (c) HSQC (CD3OD). (d) HMBC

(CD3OD).



30

NMR analyses of 2 (a) 1H NMR of 2 (CD3OD). (b) COSY of 2 (CD3OD).



31

31

P HMBC for FR-900098

31

P HMBC for methanol extract from engineered S. roseosporus strain (cluster 10)

31

P HMBC of authentic FR-900098 sample and 3 produced by the engineered S. roseosporus strain

upon activation of phosphonate BGC (cluster 10).



32

1H NMR of 4 (DMSO-d6)



33

13C NMR of 4 (DMSO-d6)



34

COSY of 4 (DMSO-d6)



35

TOCSY of 4 (DMSO-d6)



36

HSQC of 4 (DMSO-d6)



37

HMBC of 4 (DMSO-d6)



38

NMR peak assignment for 4.

No.

Compound 4

δC δH (J in Hz)

COSY/

TOCSY HMBC

1 54.2 2.73, d (15.3) 2, 21, 22, 23

2.61, d (15.3)

2 196.8

3 150.7

4 137.0

5 115.2 9.30, s 7, 15, 17

6 135.5

7 183.5

8 133.0

9 105.8 7.07, s 11 7, 11, 13

10 162.8

11 108.1 6.52, s 9 9, 10, 12, 13

12 164.4

13 111.4

14 184.1

15 108.7

16 169.2

17 119.0

18 175.2

19 113.2 6.43, s 21 17, 20, 21

20 117.1

21 44.9 3.07, d (15.6) 19 1, 3, 19, 20, 22, 23

2.95, d (15.6)

22 69.6

23 28.9 1.26, s 1, 21, 22

10-OH 10.70, s 9, 10, 11

12-OH nd

16-OH nd

18-OH nd

22-OH 4.77, s 1, 21, 22, 23

.



39

SUPPLEMENTARY REFERENCES

1. Olano, C. et al. Activation and identification of five clusters for secondary metabolites in

Streptomyces albus J1074. Microbial biotechnology 7, 242-256 (2014).

2. Kuhn, R., Starr, M.P., Kuhn, D.A., Bauer, H. & Knackmuss, H.J. Indigoidine and other

bacterial pigments related to 3,3'-bipyridyl. Arch Mikrobiol 51, 71-84 (1965).

3. Meschke, H., Walter, S. & Schrempf, H. Characterization and localization of prodiginines

from Streptomyces lividans suppressing Verticillium dahliae in the absence or presence of

Arabidopsis thaliana. Environ Microbiol 14, 940-52 (2012).

4. Watrous, J. et al. Mass spectral molecular networking of living microbial colonies. Proc Natl

Acad Sci U S A 109, E1743-52 (2012).

5. Bystrykh, L.V. et al. Production of actinorhodin-related "blue pigments" by Streptomyces

coelicolor A3(2). J Bacteriol 178, 2238-44 (1996).

6. Tanaka, Y. et al. Activation and products of the cryptic secondary metabolite biosynthetic

gene clusters by rifampin resistance (rpoB) mutations in actinomycetes. J Bacteriol 195,

2959-70 (2013).

7. Cobb, R.E., Wang, Y. & Zhao, H. High-efficiency multiplex genome editing of Streptomyces

species using an engineered CRISPR/Cas system. ACS Synth Biol 4, 723-8 (2015).

8. Weber, T. et al. antiSMASH 3.0-a comprehensive resource for the genome mining of

biosynthetic gene clusters. Nucleic Acids Res 43, 237-43 (2015).

9. Moree, W.J. et al. Microbiota of healthy corals are active against fungi in a light-dependent

manner. ACS Chem Biol 9, 2300-8 (2014).

10. Blodgett, J.A. et al. Common biosynthetic origins for polycyclic tetramate macrolactams from

phylogenetically diverse bacteria. Proc Natl Acad Sci U S A 107, 11692-7 (2010).

11. Luo, Y. et al. Activation and characterization of a cryptic polycyclic tetramate macrolactam

biosynthetic gene cluster. Nat Commun 4, 2894 (2013).

12. Johannes, T.W. et al. Deciphering the late biosynthetic steps of antimalarial compound FR-

900098. Chem Biol 17, 57-64 (2010).

13. Doull, J.L., Ayer, S.W., Singh, A.K. & Thibault, P. Production of a novel polyketide

antibiotic, jadomycin B, by Streptomyces venezuelae following heat shock. J Antibiot (Tokyo)

46, 869-71 (1993).

14. He, J., Magarvey, N., Piraee, M. & Vining, L.C. The gene cluster for chloramphenicol

biosynthesis in Streptomyces venezuelae ISP5230 includes novel shikimate pathway

homologues and a monomodular non-ribosomal peptide synthetase gene. Microbiology 147,

2817-29 (2001).

15. Bruheim, P., Sletta, H., Bibb, M.J., White, J. & Levine, D.W. High-yield actinorhodin

production in fed-batch culture by a Streptomyces lividans strain overexpressing the pathway-

specific activator gene actll-ORF4. J Ind Microbiol Biotechnol 28, 103-11 (2002).

16. Blodgett, J.A., Zhang, J.K. & Metcalf, W.W. Molecular cloning, sequence analysis, and

heterologous expression of the phosphinothricin tripeptide biosynthetic gene cluster from

Streptomyces viridochromogenes DSM 40736. Antimicrob Agents Chemother 49, 230-40

(2005).

17. Bentley, S.D. et al. Complete genome sequence of the model actinomycete Streptomyces

coelicolor A3(2). Nature 417, 141-7 (2002).

18. Redenbach, M. et al. A set of ordered cosmids and a detailed genetic and physical map for the

8 Mb Streptomyces coelicolor A3(2) chromosome. Mol Microbiol 21, 77-96 (1996).

19. Prabhu, J., Schauwecker, F., Grammel, N., Keller, U. & Bernhard, M. Functional expression

of the ectoine hydroxylase gene (thpD) from Streptomyces chrysomallus in Halomonas

elongata. Appl Environ Microbiol 70, 3130-2 (2004).


Documents

CRISPR-Cas9 strategy for activation of silent Streptomyces ... · CRISPR-Cas9 strategy for activation of silent Streptomyces biosynthetic gene ... doi:10.1038 /nchembio.2341 ... subjected