CREB and CREB-Binding Proteins Play an Important Role in the IE2

JOURNAL OF VIROLOGY, Oct. 1996, p. 6955–6966 Vol. 70, No. 100022-538X/96/$04.0010Copyright q 1996, American Society for Microbiology

CREB and CREB-Binding Proteins Play an Important Role inthe IE2 86-Kilodalton Protein-Mediated Transactivation of the

Human Cytomegalovirus 2.2-Kilobase RNA PromoterRUTH SCHWARTZ, BRIAN HELMICH, AND DEBORAH H. SPECTOR*

Department of Biology, University of California, San Diego, La Jolla, California 92093-0357 USA

Received 18 December 1995/Accepted 19 June 1996

The human cytomegalovirus (HCMV) immediate-early region 2 86-kDa protein (IE2 86) is the majortransactivator of the promoter for the 2.2-kb class of early RNAs (open reading frame UL 112–113). Previously,we reported that a DNA segment on this promoter between nucleotides (nt) 2113 and 259 was critical foractivation by IE2 86 in vivo and could be bound by IE2 86 in vitro (R. Schwartz, M. H. Sommer, A. Scully, andD. H. Spector, J. Virol. 68:5613–5622, 1994). With a set of site-specific mutations within nt284 to261, we havelocalized the essential cis-acting sequences to nt 272 to 261, which contain an ATF/CREB-binding site. TheIE2 86-binding site between nt 2113 and 285 is not essential for activation of the promoter by IE2 86 intransient-expression assays, but its presence can enhance the level of activation mediated through the se-quences located between nt 284 and 259. Electrophoretic mobility shift assays with a segment containing nt284 to 259 and nuclear extracts from human cells permissive for the HCMV infection revealed a complexband pattern. However, by supershift analysis with specific antibodies, we were able to identify CREB as themajor ATF/CREB family member in the protein-DNA complexes. Further evidence that CREB is a target forIE2 86-mediated induction, is provided by the finding that IE2 86 activates the somatostatin promoter to highlevels. Although the binding of IE2 86 to nonphosphorylated full-length CREB or DCREB is minimal, IE2 86does form complexes with p300 and the CREB-binding protein (CBP), which in turn bind to CREB and canserve as adaptor proteins for CREB function. In addition, the in vivo functional relevance of the interactionbetween IE2 86 and CBP is indicated by the ability of IE2 86 to enhance transcriptional activation mediatedby a GAL4-CBP fusion protein brought to a promoter by GAL4-binding sites.

Human cytomegalovirus (HCMV) is an opportunistic agentin immunocompromised individuals and is the major viralcause of birth defects in newborns (1, 41). Similar to otherherpesviruses, HCMV gene expression is temporally regulated(10, 39, 59, 63, 64). The immediate-early (IE) gene products,which rely primarily on host factors for their expression, aresynthesized initially after viral infection. Of this group of genes,the two genetic units in the major IE region designated IE1and IE2 have been studied in greatest detail. At least threemRNAs are encoded by this region and are translated intoproteins of 72 kDa (IE1 72; ppUL123), 86 kDa (IE2 86;ppUL122a) and 55 kDa (IE2 55; ppUL122b) (10, 18, 21, 57, 58,60, 63, 65).IE2 86 plays a major role in the activation of HCMV early

promoters, as well as of heterologous cellular and viral pro-moters (9, 13, 14, 16, 28, 35, 38, 45, 62). IE2 86 is also capableof down-regulating its own expression through direct DNAbinding to a cis repression signal (CRS) near the cap site of itspromoter (5, 6, 17, 22, 32, 34, 37, 43–45, 56, 68). In addition,IE2 86 has the ability to interact with several cellular proteins,including the TATA box-binding protein (TBP), TFIIB, Sp1,Tef-1, c-Jun, JunB, p53, and Rb (4, 12, 15, 16, 23, 35, 48,50–53).Following the expression of the IE genes and before the

onset of viral DNA replication, there is induction of the earlyclass of RNAs. It appears that transcription of the early genesrequires the prior synthesis of one or more IE proteins, but the

mechanism of this activation and the important cis-acting ele-ments and trans-acting factors have yet to be fully defined. Forseveral years, our laboratory has focused on this question andhas used as a model the HCMV early promoter for the 2.2-kbclass of RNAs (open reading frame UL 112–113), which en-codes four nuclear phosphoproteins (28, 54, 55, 66, 67). Al-though the function of these proteins in the infection is un-known, they appear to be required for HCMV DNAreplication in a transient-complementation assay (42) and cancooperate with the HCMV proteins IRS/TRS, UL 36–38, andIE1/IE2 to stimulate expression from the promoters for sixHCMV replication proteins (20, 25).In our initial transient-expression studies, we found that

activation of the 2.2-kb RNA promoter in HCMV-infectedcells was mediated through a major regulatory domain locatedbetween nucleotides (nt) 2113 and 259 (54). We also notedthat this region contained a consensus ATF/CREB-binding sitebetween nt 271 and 266 and proposed that ATF/CREB orsome related factor might be involved in regulating this gene.Subsequently, we showed that IE2 86 plays a major role in theinduction of this promoter and that the previously identifiedregion between nt 2113 and 259 is essential for this specificactivation (28, 47). Recently, we and others reported that IE286 is able to bind with high affinity to three domains on thispromoter bounded by nt 2286 to 2257, nt 2248 to 2218, andnt 2148 to 2120 (3, 47). In addition, the results of our exper-iments revealed that IE2 86 is capable of binding with loweraffinity to the sequences located between nt 2113 and 285,which are within the domain that appeared in our studies to bethe most biologically relevant (47). The recent work of Arlt etal. (3), however, suggests that the IE2 86-binding sites on thispromoter may be playing only an accessory role and that the

* Corresponding author. Mailing address: Department of Biology,0357, University of California, San Diego, 9500 Gilman Dr., La Jolla,CA 92093-0357. Phone: (619) 534-9737. Fax: (619) 534-6083.Electronic mail address: [email protected].

6955

major positive element for IE2 86-mediated transactivation islocated between nt 284 and 232. Moreover, their data indi-cate that the strong IE2 86-binding sites cannot increase tran-scription when just a TATA box is present but can enhance theoverall level of activation by IE2 86 when placed upstream ofnt 2117 on this promoter.In this study, we have further characterized the cis-acting

sequences and trans-acting factors required for activation ofthe HCMV early 2.2-kb RNA promoter, focusing on the rela-tive importance of the ATF/CREB and the IE2 86 DNA-binding sites. By mutational analysis, we have shown that theregion between nt 272 and 261, which contains the ATF/CREB-binding site, is essential for activation by IE2 86 andthat either a strong or weak IE2 86 DNA-binding site posi-tioned between nt 2113 and 285 can enhance the level ofactivation through this downstream site. We demonstrate thata main candidate for transactivation of the 2.2-kb RNA pro-moter by IE2 86 in permissive cells is the transcription factorCREB, but a role for other factors which bind to this promotercannot be excluded. In addition, we present evidence that IE286 has the ability to activate through a prototypical CREB site.Although IE2 86 is not capable of binding full-length CREBdirectly (50) and it has very little affinity for nonphosphory-lated DCREB (31), we provide evidence that IE2 86 can inter-act with the proteins p300 and CREB-binding protein (CBP),which bind to CREB and function as transcriptional coactiva-tors (2, 7, 30, 36). Furthermore, IE2 86 can enhance the acti-vation mediated by full-length CBP fused to GAL4 of a targetpromoter containing GAL4-binding sites. These results sug-gest that there is a functional interaction between IE2 86 andCBP.

MATERIALS AND METHODS

Virus and cells. Human U373-MG astrocytoma-glioblastoma cells were a giftfrom R. LaFemina (Merck Sharpe & Dohme) and were maintained in Dulbec-co’s modified Eagle’s medium (Gibco BRL) supplemented with high glucose andcontaining 5% fetal bovine serum and Mito Plus serum extender (CollaborativeResearch). HeLa cells were maintained in Dulbecco’s modified Eagle’s medium(Gibco BRL) supplemented with high glucose and containing 10% fetal bovineserum.Molecular cloning. Restriction enzymes were obtained from Bethesda Re-

search Laboratories, Inc., or Boehringer Mannheim Biochemicals and used asrecommended by the manufacturers. Competent Escherichia coli DH5a (Be-thesda Research Laboratories) were transformed with recombinant plasmids asrecommended by the suppliers.Construction of plasmids p148CAT and p93CAT, which contain various

lengths of the early promoter for the 2.2-kb class of RNAs fused to the chlor-amphenicol acetyltransferase (CAT) gene, has been described previously (54).Plasmid Del lacks sequences located between nt 284 and 259 of the promoterbut contains sequences up to nt 2113. Plasmids A, B, and C have sequences upto nt 2113 in the promoter and contain substitutions of the weak IE2 86-bindingsite located between nt 2108 and 295 for either the CRS consensus element(32), a nonconsensus sequence, or the strong binding sequence on the 2.2-kbRNA promoter located between nt 2143 and 2130, respectively. Plasmid D is a59 deletion mutant with promoter sequences up to nt 284. Mutant plasmids284CAT, 278CAT, 272CAT, and 266CAT have sequences up to nt 2113 inthe promoter and contain site-specific mutations formed by substituting 6 nt withthe EcoRI restriction site downstream from nt 284, 278, 272, and 266, respec-tively. Plasmid Comb contains the three mutations present in plasmids278CAT,272CAT, and 266CAT. Plasmids Del, A, B, C, D, 284CAT, 278CAT,272CAT, 266CAT, and Comb were constructed by PCR amplification andsubcloning of the desired fragment into the p148CAT vector previously digestedwith XbaI and SstI.The oligonucleotides used for PCR amplification of the mutated DNA frag-

ments in plasmids A, B, C, and D were, respectively, 59 GCTCTAGAGTCCCAGTCGTTTAGTGAACCGTACTGTTTAACCACGTTG 39, 59 GCTCTAGAGTCCCAGTTAAGGTAATATAATTACTGTTTAACCACGTTGCG 39, 59 GCTCTAGAGTCCCAGTCGATTTGCAGTCCGTACTGTTTAACCACGTTG39, and 59 GCTCTAGAGTCCCACGTTGCGTCGTGAC 39. Each oligonucle-otide was used in conjunction with oligonucleotide 59 TTTAGCTTCCTTAGCTCCTG 39. The PCR products of the above mutants were digested with XbaI andSstI, loaded on a 3% NuSieve (FMC BioProducts) agarose gel, and purified withthe Mermaid kit (Bio101). The desired fragments were then ligated into thep148CAT vector previously digested with XbaI and SstI.

The oligonucleotides used for PCR amplification of the mutated DNA frag-ment in mutant Del were 59 GCTCTAGAGTCCCAGTTACTTTAATAAACGTACTGTTTAAGGGTGTTGCTAGGCGGG 39 and 59 TTTAGCTTCCTTAGCTCCTG 39. The cloning procedure for plasmid Del was the same as forplasmids A, B, C, and D.The mutant DNAs cloned in plasmids278CAT,272CAT, and266CAT were

constructed by two PCR amplification steps. In the first PCR for each mutant,oligonucleotide 59 CTGCAGGTCGACTCTAGA 39 was used in conjunctionwith oligonucleotide 59 CACGAATTCACGTGGTTAAACAGTACGTT 39, 59CAAGAATTCGACGCAACGTGGTTAAACA 39 or 59CACGAATTCCGTCACGACGCAACGTG 39, respectively, for mutants 278CAT, 272CAT, and266CAT. In the second PCR for each mutant, oligonucleotide 59 TTTAGCTTCCTTAGCTCCTG 39 was used in conjunction with oligonucleotide 59 GCTCTAGAGTCCCACGTGAATTCGTGACGTTGTTTGTGGG 39, 59GCTCTAGAGTCCCACGTTGCGTCGAATTCTTGTTTGTGGGTGTTGCTAG 39, or 59GCTCTAGAGTCCCACGTTGCGTCGTGACGGAATTCGTGGGTGTTGCTAGGCG 39, respectively. The first PCR product for each mutant was digestedwith XbaI and EcoRI, and the second PCR product was digested for each mutantwith EcoRI and SstI. Triple ligations were performed for each mutant containingboth digested PCR products into the p148CAT vector previously digested withXbaI and SstI.The mutation in plasmid Comb was obtained by two rounds of PCR amplifi-

cation. For the first round of reactions, two separate PCRs were performed. Theoligonucleotides used for the first PCR were 59 CTGCAGGTCGACTCTAGA39 and 59 GAATTCGAATTCGAATTCACGTGGTTAAACAGTACGTT 39,and for the second PCR, the oligonucleotides used were 59 TTTAGCTTCCTTAGCTCCTG 39 and 59 CGTGAATTCGAATTCGAATTCGTGGGTGTTGCTAGGCG 39. The products of both PCRs were subjected to a second round ofPCR amplification with the external oligonucleotides 59 CTGCAGGTCGACTCTAGA 39 and 59 TTTAGCTTCCTTAGCTCCTG 39. The PCR product thusobtained was digested with XbaI and SstI, loaded on a 3% NuSieve (FMCBioProducts) agarose gel, and purified with the Mermaid kit (Bio101). Themutated PCR fragment was then ligated into the p148CAT vector previouslydigested with XbaI and SstI. Plasmid 284CAT was constructed in the same wayas plasmid Comb. The specific oligonucleotides used to amplify the desiredmutation in plasmid 284CAT were 59 GAATTCTTAAACAGTACGTTTATTAAAGT 39 and 59 GAATTCTGCGTCGTGACGTTGTTTG 39.DNA sequence analysis. The presence of the desired mutations in all the

plasmids constructed was determined by the dideoxy-chain termination methodof DNA sequencing (46), using the Sequenase version 2.0 DNA-sequencing kit(Amersham). [a-35S]dATP (1000Ci/mmol) was purchased from Amersham.Transient-expression assays in U373-MG cells. Human U373-MG astrocyto-

ma-glioblastoma cell monolayers were transfected with plasmid DNAs by theDEAE-dextran technique previously described by Staprans et al. (54). In allexperiments, at least two flasks per construct were transfected. All of the con-structs were assayed in at least three independent experiments. Plasmid D(271),which contains the somatostatin promoter sequences attached to a CAT reportergene, was a kind gift of M. Montminy, Salk Institute (40).Transient-expression assays in HeLa cells. HeLa cells were transfected by the

calcium phosphate coprecipitation method with the GibcoBRL calcium phos-phate transfection kit. In all experiments, at least two flasks per construct weretransfected. All of the constructs were assayed in at least two independentexperiments. The cells were transfected with 5 mg of the pGAL4-CAT reporterpGAL4/E1b TATA containing five GAL4-binding sites (33), 5 mg of the codingplasmid for effector protein GAL4-CBP (full length) or GAL4-CBP (1678-2441)(7, 30), 5 mg of a protein kinase A coding plasmid, and different quantities ofpSGIE86 (28). The amount of DNA was kept constant in all the transfections byadding plasmid pSG5. The cells were harvested 48 h posttransfection and assayedfor CAT activity as described previously (54). The GAL4-CBP constructs werekindly provided by R. Kwok and R. Goodman, Oregon Health Sciences Univer-sity.Nuclear extract preparation. Nuclear extracts were prepared from U373-MG

cell monolayers by modifications to the methods used by Dignam et al. (11) andShapiro et al. (49) as previously described (28).In vitro translation of proteins. In vitro transcription-translation reactions

were carried out with the TNT coupled reticulocyte lysate system (Promega) asspecified by the manufacturer. A vector containing the coding region for ATF-2was generously provided by M. Green, Massachusetts Medical Center, Worces-ter, Mass. T7-CREB, T7DCREB and SP6CBP were kind gifts from M. Mont-miny. T3-p300 was generously provided by R. Eckner, Dana Farber CancerInstitute.Gel shift analysis. In vitro-translated proteins or U373-MG nuclear extracts

were incubated for 30 min at 228C with various 59 32P-end-labeled double-stranded DNA sequences in the presence of 2 to 10 mg of dA-dT in a bindingbuffer containing 25 mM N-2-hydroxyethylpiperazine-N9-2-ethanesulfonic acid(HEPES; pH 7.9), 100 mM KCl, 20% glycerol, 0.1% Nonidet P-40, 10 mMZnSO4, 1 mM EDTA, 0.2 mM phenylmethylsulfonyl fluoride, 1 mM sodiummetabisulfite, 1 mM benzamidine, and 1 mM dithiothreitol. The samples werethen loaded on a 5% nondenaturing TBE polyacrylamide gel, and the gel wasdried and subjected to autoradiography. When the formed DNA-protein com-plexes were supershifted with antibodies, the nuclear extracts were first incu-

6956 SCHWARTZ ET AL. J. VIROL.

bated with 0.4 mg of antibody for 20 min at 228C and then further incubated for30 min at 228C in the presence of labeled DNA.The DNA sequences used for gel shift analysis were nt 284 to 259 of the

2.2-kb RNA promoter (w) (54); a consensus activating transcription factor(ATF)-binding sequence (40), i.e., 59 AGAGATTGCCTGACGTCAGAGAGCTAG 39 and 59 CTAGCTCTCTGACGTCAGGCAATCTCT 39 (a); and a mu-tant ATF-binding sequence, i.e., 59 AGAGATTGCCTGTGGTCAGAGAGCTAG 39 and 59 CTAGCTCTCTGACCACAGGCAATCTCT 39 (n). The mutantATF-binding sequence was used as nonspecific DNA.The oligonucleotides used for gel shift analysis of DNA with EcoRI mutations

within nt 284 to 259, which were labeled mutants I through IV and Comb, were59 GAATTCTGCGTCGTGACGTTGTTTGT 39 and 59 ACAAACAACGTCACGACGCAGAATTC 39 (I), 59 CCACGTGAATTCGTGACGTTGTTTGT 39and 59 ACAAACAACGTCACGAATTCACGTGG 39 (II), 59 CCACGTTGCGTCGAATTCTTGTTTGT 39 and 59 ACAAACAAGAATTCGACGCAACGTGG 39 (III), 59 CCACGTTGCGTCGTGACGGAATTCGT 39 and 59 ACGAATTCCGTCACGACGCAACGTGG 39 (IV), and 59 CCACGTGAATTCGAATTCGAATTCGT 39 and 59 ACGAATTCGAATTCGAATTCACGTGG 39(Comb).Anti-CREB, anti-ATF-2 and anti-ATF-4 antibodies were obtained from Santa

Cruz Biotechnology.Protein-binding assays. Protein-protein binding assays of glutathione-S-trans-

ferase (GST) fusion products were performed as previously described (28, 50).

RESULTS

Localization of the sequences in the region between nt2113and 259 required for activation of the 2.2-kb RNA promoter.We recently demonstrated that specific stimulation of theHCMV 2.2-kb RNA promoter by the IE2 86 protein in tran-sient-expression assays and superinfection experiments re-quires sequences located between nt 2113 and 259 relative tothe transcription start site (47). Activation of this promoter isdependent on the presence of IE2 86, and no basal activity isobserved in U373-MG cells transfected with the 2.2-kb RNApromoter alone. A promoter construct containing 113 nt ofupstream sequence is maximally activated by IE2 86, althoughduring HCMV infection the sequences bounded by nt 2224and 2113 do contribute to a small extent to full activation. Wealso showed that IE2 86 binds with different affinities to severaldistinct regions upstream of the transcription start site of the2.2-kb RNA promoter. There are high-affinity binding regionsbounded by nt 2286 to 2257, nt 2248 to 2218, and nt 2148to 2120, and a lower-affinity binding site bounded by nt 2113to 285, which is located within the region that is most biolog-ically relevant based on transfection and superinfection exper-iments.To further delineate the sequences between nt 2113 and

259 required for activation by IE2 86, we prepared two pro-moter deletion mutants and attached them to the CAT gene.Plasmid D contains a 59 deletion to nt 284, and plasmid Delhas wild-type promoter sequences up to nt 2113 with an in-ternal deletion of nt 284 to 259. These constructs, as well asthe promoter construct containing wild-type sequences up to nt2113 (p148CAT) and the construct containing a 59 deletion tont 258 (p93CAT), were independently cotransfected with theIE2 86 expression vector pSGIE86 into U373-MG astrocyto-ma-glioblastoma cells (which are fully permissive for HCMVinfection), and CAT activity was measured 48 h later. CATactivity was also assayed in extracts prepared from cells trans-fected with the promoter CAT constructs in the absence of IE286. In accord with our previous results, the basal activity of allconstructs in the absence of IE2 86 was at background levels(data not shown). As shown in Fig. 1, deletion of sequenceslocated 59 to nt 284 reduced activation by IE2 86 twofold.However, when nt 284 to 259 were deleted, activation by IE286 was reduced 20-fold even when nt 2113 to 285 were re-tained. This result indicates that the factor(s) that interactsthrough nt 284 to 259 is crucial for the IE2 86-mediatedtransactivation of the promoter.

The above experiment indicated that the weak IE2 86-bind-ing site, although not essential for IE2 86-mediated activation,did contribute to full stimulation of the promoter. To furtherassess the relative importance of the weak IE2 86-binding site(nt 2113 to 285), we constructed a series of additional pro-moter mutations in this region. Plasmids containing the CATreporter gene linked to the various mutated promoters werecotransfected with the IE2 86 expression vector pSGIE86 intoU373-MG astrocytoma-glioblastoma cells, and CAT activitywas assessed 48 h later. When the weak binding site was con-verted into a strong binding region corresponding to either theconsensus CRS motif or the IE2 86-binding site bounded by nt2143 and 2130 of the 2.2-kb RNA promoter (plasmids A andC, respectively), activation by IE2 86 remained at wild-typelevels (Fig. 1). On the other hand, when the weak binding sitewas mutated to a nonconsensus sequence (plasmid B), activa-tion of the promoter by IE2 86 was reduced to the same levelas observed when the sequence was deleted (approximatelytwofold). No activity above background levels was detectedwith any of these constructs in the absence of IE2 86 (resultsnot shown). These results indicate that transactivation by IE286 is not affected by the strength of the binding site bounded bynt 2113 and 285 on the promoter. Moreover, although thepresence of an IE2 86-binding site does modestly increase thelevel of activation, another factor(s), which acts through nt284 to 259, probably plays the major role in IE2 86-mediatedregulation of this promoter.IE2 86 activates the promoter in vivo through the ATF/

CREB-binding site. To define precisely which regions within nt284 to 259 of the 2.2-kb RNA promoter were important forIE2 86 transactivation, we constructed four plasmids with basesubstitutions such that single EcoRI sites were created withinnt 284 to 279, 278 to 273, 272 to 267, and 266 to 261 inthe wild-type background of p148CAT. These mutants arelabeled 284CAT, 278CAT, 272CAT, and 266CAT, respec-tively. Each of these promoter-CAT constructs was then testedfor CAT activity following cotransfection with and withoutpSGIE86. No activity above background levels was detected

FIG. 1. Schematic representation of the early 2.2-kb RNA promoter muta-tion plasmids and their observed CAT activities following cotransfection withpSGIE86. Duplicate flasks of permissive U373-MG cells were cotransfected bythe DEAE-dextran method, and the cells were harvested 48 h posttransfectionand assayed for CAT activity as described in Materials and Methods. CATactivity relative to p148CAT, the wild-type construct, is shown. Nucleotide num-bers relative to the transcription start site are indicated. Plasmid Del lacks nt284to 259 of the promoter but contains sequences up to 2113. Plasmids A, B, andC contain substitutions of the weak IE2 86-binding site located between nt 2108and 295 for either the consensus CRS element (32), a nonconsensus sequence,or the strong binding sequence on the 2.2-kb RNA promoter located between nt2143 and 2130, respectively. Plasmid D contains wild-type sequences up to nt284.

VOL. 70, 1996 INTERACTION BETWEEN IE2 86 AND CBP 6957

with any of these reporter constructs in the absence of IE2 86(results not shown). As shown in Fig. 2, the activation of284CAT and 278CAT by IE2 86 is reduced less than twofoldrelative to that of the wild type. However, the mutations inplasmids 272CAT and 266CAT cause a sevenfold drop inCAT activity compared with the wild-type plasmid, indicatingthat nt 272 to 261 are critical for IE2 86-mediated transacti-vation of the 2.2-kb RNA promoter. In the report by Stapranset al. (54), we had initially noted that a sequence similar to theATF/CREB-binding site was located between nt 271 and 266and had proposed that HCMV infection might activate thepromoter through this region. The results of the above muta-tional analysis support this hypothesis and suggest that IE2 86may effect activation of the promoter by interacting with theATF/CREB family of transcription factors.Identification of site-specific nuclear factors in cells permis-

sive for HCMV infection. We used gel retardation assays todetermine whether factors in the U373-MG nuclear extractscould bind to the sequences located between nt 284 and 259of the 2.2-kb RNA promoter. As shown in Fig. 3A, lane 2, weobserved at least four bands when using a wild-type 32P-labeledprobe containing the nt 284 to 259 sequences. Binding to thelabeled probe is specifically inhibited by an excess of unlabeledwild-type 284 to 259 oligonucleotide, whereas the complexesare unaffected by nonspecific DNA (lanes 3 and 4, respective-ly).Since the gel shift analysis with U373-MG nuclear extracts

and the wild-type probe of the promoter gave several bands, we

proceeded to define further the domains of the protein-DNAinteractions with mutant probes containing the EcoRI site sub-stitutions described above. The fragments (nt 284 to 259)containing the EcoRI sites within nt 284 to 279, 278 to 273,272 to 267, and 266 to 261 are labeled I, II, III and IV,respectively, in Fig. 4. Figure 4A, lane 3, shows that mutant I(containing an EcoRI site within nt 284 to 279) binds theproteins with less intensity than does the wild-type probe butthe general pattern of binding does not change. This is furthersupported by the data in Fig. 4B, lane 5, which show that excessunlabeled mutant I DNA efficiently competes for the bindingof labeled wild-type DNA to the nuclear extract. The observa-tion that the pattern of bands generated with mutant I is thesame as the one obtained with the wild-type probe, althoughthe intensity is lower in some experiments, suggests that thesesequences might contribute to the overall strength of the bind-ing. With mutant II (containing an EcoRI site within nt 278 to273), there is a complete loss of band 1 and the intensity ofband 3 seems to be decreased (Fig. 4A, lane 4 and Fig. 4B, lane6). Mutants III and IV (containing EcoRI sites within nt 272to 267 and 266 to 261, respectively) do not yield band 2 andshow a significant reduction in the intensity of band 3; theintensity of band 1 is also reduced in these mutants (Fig. 4A,lanes 5 and 6, and Fig. 4B, lanes 7 and 8). When using a DNAconstruct that harbors mutations II, III, and IV, none of thebands are observed (Fig. 4A, lane 1; Fig. 4B, lane 9). Althoughthere is an apparent loss of band 4 with mutants II, III, and IV,this result is not reproducibly seen (see Fig. 6B), and we there-fore believe that it may be nonspecific. These results indicatethat nt 278 to 273 are involved in forming the complex cor-responding to band 1 and that nt 272 to 261 are necessary for

FIG. 2. Schematic representation of the early 2.2-kb RNA promoter mutantplasmids and their observed CAT activities following cotransfection withpSGIE86. (A) Triplicate flasks of permissive U373-MG cells were cotransfectedby the DEAE-dextran method as in Fig. 1. CAT activity relative to p148CAT isshown. Nucleotide numbers relative to the transcription start site are indicated.X indicates the position of each EcoRI substitution. (B) Sequences within nt284to 261 in the wild-type (WT), 284CAT, 278CAT, 272CAT, 266CAT, andComb plasmids. The EcoRI substitutions are underlined.

FIG. 3. Gel shift analysis of U373-MG nuclear extracts binding to nt 284 to259 of the 2.2-kb RNA promoter. (A) DNA binding was performed in thepresence of nuclear extract (NE) as described in Materials and Methods, and thecomplexes were subjected to electrophoresis through a 5% nondenaturing poly-acrylamide gel. The labeled DNA fragment contained wild-type sequences fromnt 284 to 259. Unlabeled competitor wild-type (w) DNA or non-specific (ns)DNA (100 ng) was used in lanes 3 and 4, respectively. Lane 1 contains labeledDNA only. Lanes 2, 3, and 4 contain nuclear extract. (B) A sample identical tothat in lane 2 but from another experiment is included for a better representationof the band pattern formed.


bands 2 and 3. It also appears that there may be cooperativeinteractions between the factors binding to these sites and thatadjacent sequences contribute to the strength of the binding.ATF family members bind to the 2.2-kb RNA promoter. The

above results showed that several proteins bind to sequencesbetween nt 284 and 259 of the 2.2-kb RNA promoter. More-over, since the sequence with similarity to the ATF/CREB sitewas altered in mutants III and IV, it seemed likely that one ormore ATF/CREB family members might be present in bands 2and 3. However, because the sequence in the 2.2-kb RNApromoter does diverge from the consensus site, we proceededto test whether this domain on the promoter could bind to invitro-translated ATF/CREB proteins. As shown in Fig. 5A,lanes 2 and 3 and lanes 6 and 7, respectively, both ATF-2 andCREB are capable of binding to the 2.2-kb RNA promoter.As a complement to the above experiment, we also tested

whether the U373-MG nuclear extracts contain a protein ca-pable of binding to the consensus ATF DNA sequence. Figure5B shows a gel shift analysis with nuclear extracts and eitherlabeled consensus ATF probe or the wild-type 2.2-kb RNApromoter probe. The ATF consensus probe yields a singleband that migrates at approximately the same position as band2 generated by incubating nuclear extract proteins with thewild-type 2.2-kb RNA promoter (lanes 1 and 4, respectively).As expected, the wild-type promoter sequence efficiently com-petes for binding of the nuclear extract to either the ATF DNAor the wild-type 2.2-kb RNA promoter sequences (lanes 2 and5, respectively). In contrast, the ATF DNA competes well forthe binding of the nuclear extract to the labeled consensusATF probe (lane 3) but is less effective as a competitor forcomplexes formed between the nuclear extracts and the wild-

type 2.2-kb RNA promoter sequences (lane 6). These resultssuggest that U373-MG cells contain several proteins capable ofbinding to the 2.2-kb RNA promoter and that at least one ofthese corresponds to a member of the ATF/CREB family oftranscription factors.Gel shift analysis with specific antibodies reveal that CREB

is the major ATF family member binding to the promoter. Toidentify which of the ATF/CREB family members in theU373-MG nuclear extracts bind to the wild-type promoter orthe ATF DNA, we performed gel supershift analysis with spe-cific antibodies. As shown in Fig. 6A, lanes 3 and 8, we ob-tained a supershift when we used an anti-CREB antibody. Thisantibody does not cross-react with other members of the ATFfamily of transcription factors or with the naked DNA (resultsnot shown). Moreover, antibodies specific for ATF-2 (lanes 4and 9) and ATF-4 (lanes 5 and 10) had no effect on thegel-shift pattern.With the consensus ATF probe, it appears that CREB is the

major ATF/CREB family protein in the U373-MG cells inter-acting with this sequence, since most of the complex is super-shifted by the anti-CREB antibody. In contrast, with the wild-type promoter, CREB appears to be only one of severalproteins forming the complexes and band 2 seems to be moststrongly affected by the presence of the anti-CREB antibody.Since CREB is heat stable (19, 61), the identity of the bindingfactor as CREB was further assessed by heat denaturing thenuclear extract and supershifting with the anti-CREB anti-body. The results are shown in Fig. 6B, lanes 1 and 2, andprovide additional support for the conclusion that band 2 ofthe untreated nuclear extract contains CREB or a very similarprotein. Further evidence that the CREB-binding region is

FIG. 4. Gel shift analysis of U373-MG nuclear extracts binding to wild-type or mutant sequences encompassing nt 284 to 259 of the 2.2-kb RNA promoter. Thegel shift assay was performed as described in Materials and Methods. (A) Lanes 1 to 6 contain nuclear extract (NE); lanes 7 to 12 contain DNA only. Lanes 1 and 7contain labeled Comb DNA (c) (which contains EcoRI substitutions within nt 278 to 273, 272 to 267, and 266 to 261). Lanes 2 and 8 contain wild-type sequences(w). Lanes 3 and 9 contain an EcoRI site within nt 284 and 279 of the promoter (mutation in site I). Lanes 4 and 10 contain an EcoRI site within nt 278 to 273 ofthe promoter (mutation in site II). Lanes 5 and 11 contain an EcoRI site within nt 272 to 267 of the promoter (mutation in site III). Lanes 6 and 12 contain an EcoRIsite within nt266 to261 of the promoter (mutation in site IV). (B) Unlabeled DNA competition with the different EcoRI substitution mutants of the binding obtainedwith the wild-type sequences. All the lanes contain labeled wild-type sequences284 to259 of the 2.2-kb RNA promoter (w). Lanes 2 to 9 contain nuclear extract (NE).Lanes 3 to 9 contain 100 ng of various unlabeled DNAs used as competitors: wild-type (w), nonspecific (n), mutant I, mutant II, mutant III, mutant IV, and Comb DNA(c), respectively.


missing in mutant III (containing an EcoRI site within nt 272to 267) and very weak in mutant IV (containing an EcoRI sitewithin nt 266 to 261) is provided by the observation thatanti-CREB antibody did not supershift any bands when usingmutant III DNA and supershifted a minimal amount of proteinwhen using mutant IV DNA (Fig. 6B, lanes 10 and 12). In Fig.6B, band 4 is present in all of the mutants and is eliminated inall cases whenever antibody is added. Although this complex

may contain a CREB-related protein which binds with lowaffinity to multiple sites in this region, we believe that it is mostprobably nonspecific. Taking into consideration all of theseresults, we conclude that the transcription factor CREB or aclosely related protein binds within nt272 to261 of the 2.2-kbRNA promoter and is part of the complex contained in band 2.IE2 86 can transactivate through a classic CREB site. To

further assess the functional interaction between IE2 86 andCREB, we cotransfected U373-MG cells with a construct con-taining the somatostatin promoter, which has the prototypeCREB site, attached to a CAT gene, and an IE2 86 codingplasmid. As shown in Fig. 7, IE2 86 is capable of activating thesomatostatin promoter 100-fold relative to the basal level ob-served with the reporter construct alone (compare lanes 5 and6 with lane 4). Interestingly, the level of activation of thesomatostatin promoter by IE2 86 is the same as for the 2.2-kbRNA promoter (compare lanes 2 and 3 with lane 1). Theseresults indicate that IE2 86 has the ability to transactivatethrough a prototypical CREB site.IE2 86 binds p300 and CBP. The above finding that CREB

plays an important role in IE2 86 transactivation of the pro-moter was surprising since we had previously demonstratedthat IE2 86 does not directly bind to full-length CREB (50);however, Lang et al. have recently shown that CREB-A(DCREB), which contains a deletion of amino acids 88 to 101,binds to IE2 86 in vitro after being phosphorylated by proteinkinase A (31). We reasoned that full-length CREB and IE2 86could be interacting through an adaptor protein such as p300or CBP, both of which bind CREB and function as coactivators(2, 7, 30, 36); therefore, we tested whether IE2 86 could inter-act in vitro with these proteins. The GST-IE2 86 fusion proteinwas immobilized on glutathione-agarose beads and incubatedwith [35S]methionine-labeled in vitro-synthesized p300 or CBP.Following incubation, the protein complexes were washed ex-tensively and the bound material was analyzed by sodium do-decyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).In vitro translation of CBP results in several protein bands.Nevertheless, we report our binding assays with the full arrayof bands obtained. As shown in Fig. 8A and B, GST-IE2 86 butnot the control GST bound to both p300 and CBP. The bindingaffinity of IE2 86 to p300 is approximately five times weakerthan the strong binding interaction with TBP (results notshown), and the in vitro translation CBP products bind toGST-IE2 86 with a lower affinity than p300 does. For compar-ative purposes, we also show that IE2 86 does not bind tofull-length CREB, as previously published by Sommer et al.(50) (Fig. 8C), and that the binding to nonphosphorylatedDCREB is very weak, as reported by Lang et al. (31). Theseexperiments were run at the same time as a positive control-binding experiment involving GST-IE2 86 plus labeled TBP(Fig. 8C, lanes 9 and 10). To eliminate the possibility thatcontaminating DNA from the bacterial lysates was mediatingthe interaction between p300 or CBP and IE2 86, we repeatedthe experiments in the presence of ethidium bromide.Ethidium bromide had no effect on the level of binding of IE286 to p300 or CBP, and thus it appears that the interaction isbacterial DNA independent (results not shown for CBP). Wecan therefore conclude that IE2 86 binds to both p300 andCBP in vitro.IE2 86 can activate CBP in vivo. To determine whether

there was a functional interaction between IE2 86 and CBP/p300 in vivo, we assayed gene expression from a CAT reporterconstruct driven by a promoter containing five GAL4-bindingsites when it was cotransfected into HeLa cells with plasmidsencoding IE2 86 and a GAL4-CBP (full-length) fusion protein.As shown in Fig. 9, IE2 86 was capable of enhancing the

FIG. 5. Gel shift analysis of in vitro-translated proteins binding to the wild-type promoter and of permissive cell nuclear extracts binding to either theconsensus ATF site or to the wild-type promoter. (A) Gel shift analysis ofcomplexes formed between in vitro-translated ATF-2 or CREB and the wild-typent 284 to 259 of the 2.2-kb promoter. Lane 1 contains DNA only. Lanes 2 and3 contain increasing amounts of in vitro-translated ATF-2. Lanes 4 and 5 containincreasing amounts of in vitro mock translation mix. Lanes 6 and 7 containincreasing amounts of in vitro-translated CREB. (B) Gel shift analysis ofU373-MG nuclear extracts binding to the consensus ATF sequence or to nt 284to 259 of the 2.2-kb RNA promoter. The DNA was incubated with the nuclearextract (NE) and subjected to electrophoresis through a 5% nondenaturingpolyacrylamide gel. The labeled DNA fragments contained either wild-type (w)sequences from nt 284 to 259 (lanes 4 to 7) or consensus ATF (a) sequences(lanes 1 to 3 and 8). Lanes 1 to 6 contain U373-MG nuclear extracts (NE).Unlabeled competitor wild-type DNA (w) or ATF consensus DNA sequences (a)(100 ng) were used in lanes 2 and 5 and lanes 3 and 6 respectively. Lanes 7 and8 contain only labeled wild-type or consensus ATF DNA, respectively.


activity of GAL4-CBP up to 7.5-fold in a dose-dependent man-ner. As a control, IE2 86 and the reporter plasmid were co-transfected in the absence of GAL4-CBP. Under these condi-tions, IE2 86 had no effect on the promoter (results notshown). Further specificity of the interaction was provided bythe finding that activation of the reporter construct by a fusionprotein of GAL4 linked to only the carboxy terminus of CBP(amino acids 1678 to 2441) was not responsive to IE2 86. Theseresults indicate that IE2 86 and CBP can interact in vivo andlead to further CBP activation.

DISCUSSION

IE2 86 plays a key role in the activation of various HCMVearly promoters. It is also capable of transactivating numerousviral and cellular promoters in addition to down-regulating itsown expression (5, 6, 17, 26–28, 32, 34, 37, 38, 43–45, 54). Themechanism by which IE2 86 can regulate the activity of somany different promoters is not fully understood. Neverthe-less, the emerging picture for the way this protein functionsseems to include both DNA-protein and protein-protein inter-actions.We have used the promoter for the 2.2-kb class of HCMV

early RNAs, which depends upon IE2 86 for its activation (28,54, 55), as a model system for investigating the mechanismsunderlying IE2 86 function. Recently, we and others reportedthat the IE2 86 protein can bind to various sites located on the

2.2-kb RNA promoter (3, 47). It binds with high affinity to theregions bounded by nt 2286 to 2257, nt 2248 to 2218, and nt2148 to 2120, and with lower affinity to the sequences locatedbetween nt 2113 and 285. Since transfection and superinfec-tion experiments indicated that nt 2113 to 259 (which lack astrong IE2 86-binding site) were essential for induction of thepromoter (47), we first assessed the relative importance of theregion between nt 284 and 259 and of the weak IE2 86-binding site between nt 2113 and 285. Our data show that intransient-transfection assays, high-level activation of this pro-moter by IE2 86 exhibits an absolute requirement for thesequences between nt 284 and 259 and can occur withoutdirect binding of IE2 86 to the DNA. However, the IE2 86DNA-binding sites do appear to serve an accessory function asevidenced by the fact that when either a strong or a weakbinding site is positioned between nt 2113 and 285, the over-all level of activation is increased twofold. These results aresimilar to those recently published by Arlt et al. (3), wholocalized the essential cis-acting sequences to the region be-tween nt 284 and 232 and found that the presence of a strongIE2 86-binding site placed upstream of nt 2117 enhanced theinduction of this promoter by IE2 86.Since the most relevant region for mediating IE2 86 trans-

activation on the 2.2-kb RNA promoter seemed to be boundedby nt 284 to 259, we focused on further characterizing thecis-acting sequences and trans-acting factors interacting withthose sequences. Site-specific mutational analysis showed that

FIG. 6. Supershift analysis of factors bound to the 2.2-kb RNA promoter. (A) Supershift analysis with ATF/CREB antibodies and U373-MG nuclear extracts boundto wild-type sequences 284 to 259 of the 2.2-kb RNA promoter or to the consensus ATF sequence. The gel shift procedure was performed as described in Materialsand Methods. Lanes 1 to 5 contain labeled wild-type sequences 284 to 259 of the 2.2-kb RNA promoter (w). Lanes 6 to 10 contain labeled consensus ATF DNA (a).Lanes 1 and 6 contain DNA only. Lanes 2 to 5 and 7 to 10 contain U373-MG nuclear extract (NE). Lanes 3 and 8 contain anti-CREB antibody. Lanes 4 and 9 containanti-ATF-2 antibody. Lanes 5 and 10 contain anti-ATF-4 antibody. (B) Gel shift analysis of heat-treated or untreated nuclear extracts (NE) incubated with wild-typeor mutant sequences 284 to 259 of the 2.2-kb RNA promoter. Heat-treated nuclear extracts (D) were heated at 658C for 10 min (lanes 1 and 2). Lanes 3 to 12 containuntreated U373-MG nuclear extracts. Lanes 2, 4, 6, 8, 10, and 12 contain anti-CREB antibody. Lanes 1 to 4 contain labeled wild-type sequences 284 to 259 of thepromoter. Lanes 5 and 6 contain labeled DNA mutated in site I (EcoRI site within nt 284 to 279). Lanes 7 and 8 contain labeled DNA mutated in site II (EcoRIsite within nt 278 to 273). Lanes 9 and 10 contain labeled DNA mutated in site III (EcoRI site within nt 272 to 267). Lanes 11 and 12 contain labeled DNA mutatedin site IV (EcoRI site within nt 266 and 261). To facilitate visualization of the bands, lanes 1 and 2 and lanes 7 to 12 are longer exposures of the same gel.


the sequences between nt 272 and 261 were critical for trans-activation by IE2 86. These results, coupled with our previousobservation that a consensus ATF/CREB-binding site was lo-cated between nt 271 and 266, further supported our earlierhypothesis that activation of this promoter might involve theATF/CREB family of transcription factors (54). Additionalsupport for this comes from the recent report by Lukac andcolleagues, which shows that IE2 86 can activate a minimalpromoter containing the hsp70 TATA box and an ATF/CREBsite in CV-1 cells (35). Although the ATF/CREB site contri-bution to the transactivation of this promoter seems to bedominant, mutational analysis of nt 284 to 259 also suggeststhat there may be other cooperative interactions between thevarious subregions of the promoter.To identify the cellular factors that might interact with this

major regulatory region on the promoter, we utilized a varietyof gel retardation assays that included wild-type promoter,mutant promoter, and ATF consensus DNA probes (alone orin combination for competition assays), proteins from nuclearextracts or synthesized through in vitro translation reactions,and antibodies specific for members of the ATF/CREB familyof transcription factors. Gel retardation analysis with a probecontaining the wild-type nt 284 to 259 promoter sequencesand U373-MG nuclear extracts generated four bands. Three ofthe bands represent complexes with specific sequences, al-though cooperative interactions may influence the strength ofthe binding. Band 1 is a DNA-protein complex involving thesequence between nt 278 and 273, and bands 2 and 3 involvent272 to261. Because this latter region contains a site similarto the ATF/CREB consensus site, it seemed likely that thesebands would contain one or more of the ATF/CREB transcrip-tion factors. Additional evidence that the wild-type promotercould interact with ATF/CREB factors was provided by theexperiments showing that both in vitro-translated ATF-2 andCREB formed complexes with the DNA.To simplify interpretation of the complex pattern of bands

observed in the mobility shift assays with the U373-MG nu-clear extracts and wild-type promoter sequences, we also usedthe consensus ATF DNA sequence as a probe. This probegenerated a band that comigrated with the above-describedband 2 formed from the interaction of nuclear extract proteins

with the wild-type promoter sequences. In competition assays,we found that although the presence of excess unlabeled wild-type promoter sequences competed well with the formation ofcomplexes with either probe, the ATF consensus sequencecompeted much more effectively for the binding of the nuclearproteins to the ATF consensus probe than to the wild-typepromoter probe. These results suggest that at least one of theseveral proteins in U373-MG cells binding to the 2.2-kb RNApromoter belongs to the ATF/CREB family of transcriptionfactors.By supershift analysis with an anti-CREB antibody that does

not cross-react with other members of the ATF family of tran-scription factors, we identified one of the binding factors in theU373-MG cells as CREB or a very closely related protein.CREB seems to be the major nuclear extract protein thatinteracts with the ATF consensus probe, as evidenced by thelarge fraction of the complex that is supershifted when theanti-CREB antibody is present. In contrast, with the wild-typepromoter probe, it appeared that a smaller fraction of thecomplexes were supershifted by the anti-CREB antibody, withband 2 being most strongly affected. Preliminary results ofsupershift analysis with a highly specific antibody to ATF-1suggest that ATF-1 present in the U373-MG nuclear extractsalso binds to the promoter but to a smaller extent than CREB.Although the identities of the other proteins in the complexesare unknown, it is unlikely that any correspond to ATF-2 orATF-4, since antibodies specific for these factors did notchange the pattern of bands generated with the nuclear extract.The identification of the binding factor as CREB was furthersupported by the demonstration that the supershifted complexcontained a factor resistant to heat denaturation, as is CREB.In addition, anti-CREB antibody did not supershift any of thebands when the probe contained mutations in the sequencebetween nt 272 and 267 and supershifted only a very smallamount of complex when the probe contained mutations in thesequence between nt 266 and 261. We conclude from theseexperiments that band 2 reflects the interaction of the tran-scription factor CREB with the sequence between nt 272 and261 and that this region on the promoter is critical for IE286-mediated transactivation. However, we cannot exclude thepossibility that other factors that bind to this domain, partic-ularly those that form the complex corresponding to band 3,also contribute to activation of this promoter by IE2 86.Further evidence that IE2 86 can indeed activate through

CREB arose from experiments in which we tested the ability ofIE2 86 to transactivate the somatostatin promoter, which con-tains the prototypical CREB-binding site. IE2 86 was capableof stimulating the somatostatin promoter by 100-fold. The factthat the fold activation of the somatostatin promoter by IE2 86is identical to that obtained for the 2.2-kb RNA promoterstrongly suggests that IE2 86 acts through the CREB site onthe 2.2-kb RNA promoter. Experiments indicating that IE2 86can also activate through DCREB have been published re-cently by Lang et al. (31).A major question raised by our studies involves how CREB

transactivates the 2.2-kb RNA promoter in conjunction withIE2 86. Although IE2 86 is able to form complexes with mul-tiple cellular transcription factors and regulatory proteins, wehave been unable to detect any binding of in vitro-translatedfull-length CREB to IE2 86 under the same experimental con-ditions that allow efficient complex formation between IE2 86and TBP, TFIIB, Rb, c-Jun, and JunB (48, 50, 51). In view ofthese results, we considered the possibility that full-lengthCREB and IE2 86 do not bind to each other directly to trans-activate the 2.2-kb RNA promoter. There are at least twocellular factors, p300 and CBP, that bind to CREB after it has

FIG. 7. Activation of the somatostatin promoter by IE2 86. Duplicate flasksof permissive U373-MG cells were cotransfected by the DEAE-dextran method,and cells were harvested 48 h posttransfection and assayed for CAT activity asdescribed in Materials and Methods. The cells were cotransfected with 2 mg ofeither the D(271) somatostatin promoter construct or 148CAT (the 2.2-kb RNApromoter construct) in the presence or absence of 1 mg of pSGIE86. Lanes 1 to3 were transfected with 148CAT. Lanes 4 to 6 were transfected with D(271).Lanes 2, 3, 5, and 6 contain pSGIE86. The fold activation by IE2 86 of the twopromoters is shown at the top.


been phosphorylated at serine 133 by protein kinase A (7, 30,36). Since both p300 and CBP function as coactivators forCREB (2, 36), it seemed possible that IE2 86 was interactingwith CREB through either of these proteins. The results of ourexperiments showing that IE2 86 is capable of binding to p300and to CBP in vitro suggest that activation of the 2.2-kb RNApromoter might involve a multiprotein complex includingCREB, p300 or CBP, and IE2 86. At this point, however, wecannot exclude the possibility that the binding of IE2 86 top300 or CBP serves to modulate the transcriptional adaptorproperties of the p300/CBP proteins. There is precedent forsuch a mechanism, since the adenovirus E1A protein, throughits binding to CBP or p300, interferes with the ability of theseproteins to serve as coactivators for CREB (2, 36). Alterna-tively, IE2 86-mediated activation through CREB may be in-direct and involve the regulation of protein kinase A and hence

the phosphorylation state of CREB. Further in vivo experi-ments will be required to resolve these possibilities, and suchstudies are in progress.Just prior to submission of this communication, Lang et al.

(31) shared with us a preprint of their studies on the activationof the same HCMV early promoter. There are a number ofimportant differences in both the experimental approaches andresults, but taken together, the data are complementary andlead to similar conclusions. In their studies, Lang et al. showedthat prokaryotically expressed DCREB protects a region on the2.2-kb RNA promoter between nt 278 and 256. However,their mutational analysis did not establish a clear role for theATF/CREB-binding site in the context of the wild-type pro-moter. When they exchanged two nucleotides within this sitethat abolished binding of DCREB in DNase I protection ex-periments, activation of the promoter by IE2 86 was reduced

FIG. 8. Protein-protein interaction between IE2 86 and p300, CBP, CREB, DCREB, and TBP. p300, CBP, CREB, DCREB, and TBP were independently translatedin vitro in the presence of [35S]methionine. Each radiolabeled protein was incubated with GST or a GST–IE2 86 fusion protein immobilized on glutathione-agarosebeads. Following incubation, an aliquot was removed (input) and the remaining beads were washed extensively. The proteins in the input (I) and bound (B) fractionswere resolved by SDS-PAGE. (A) IE2 86 binding to p300. The input sample represents 1% of the total reaction. (B) IE2 86 binding to CBP. The input sample represents20% of the total reaction. A shorter exposure of the input lane with respect to the bound lane is shown. (C) IE2 86 binding to CREB, DCREB, and TBP. The inputsamples represent 10% of the total reactions. In the binding reactions performed in the presence of ethidium bromide, the proteins were bound to glutathione-agarosebeads and the mix was incubated in the presence of 100 mg of ethidium bromide on ice for 30 min. Radiolabeled p300 or CBP was added, and the protocol was continuedas described above, except that all the washes were performed in the presence of ethidium bromide. All the binding-reaction mixtures reported in this paper werewashed with (20 mM Tris-HCl [pH 8], 1 mM EDTA, 0.5% Nonidet P40) NETN containing 100 mM NaCl except for those used to test CBP binding, which were washedwith NETN containing 200 mM NaCl.


less than twofold relative to the wild type. In contrast, themutations introduced into the ATF/CREB site in our experi-ments reduced the level of activation sevenfold and signifi-cantly affected the binding of the U373-MG nuclear factors tothe promoter. Since Lang et al. did not examine the binding ofproteins in the permissive cell extracts that bound to either thewild-type or mutant 2.2-kb RNA promoter, it is possible thatthey inadvertantly created another transcription factor-bindingsite which, in the context of the wild-type promoter, couldmediate activation by IE2 86. They were able to show, how-ever, with engineered constructs that contained oligonucleo-tides corresponding to either genuine or mutated ATF/CREBsites cloned as single copies or multimers just upstream of theTATA box of this promoter, that IE2 86 could mediate acti-vation through this site. They also observed in transient-ex-pression assays a strong stimulation of transcription from areporter construct containing five GAL4-binding sites up-stream of the B-globin TATA box when it was cotransfectedwith expression plasmids for both a GAL4-DCREB fusion pro-tein and IE2 86 (31). Experiments were also performed todetermine whether IE2 86 can bind to DCREB, a protein thatcontains a deletion of amino acids 88 to 101 (69). Their dataindicated that there was a weak interaction between GST–IE286 and in vitro-translated DCREB. In our experiments, al-though some binding can be observed, it is minimally abovebackground levels. However, it appears that DCREB phos-phorylated by protein kinase A in vitro does bind more stronglyto IE2 86 (31). Since p300 or CBP binds to protein kinaseA-phosphorylated CREB (7, 30, 36), our results, coupled withthose of Lang et al., suggest that strong activation of thisHCMV early promoter through its CREB site may result fromthe ability of IE2 86 to interact with both proteins in thephosphorylated CREB-p300 or CREB-CBP complex.In addition to showing a physical interaction between IE2 86

and CBP or p300, we have assessed the functional interactionin vivo. Our results show that IE2 86, in a dose-dependentfashion, can significantly increase the activation of a target

promoter containing GAL4-binding sites by a GAL4-CBP(full-length) fusion protein. This activation is specific and doesnot occur if the fusion protein contains only the carboxy ter-minus (amino acids 1678 to 2441) of CBP linked to GAL4.Interestingly, by itself the fusion protein with full-length CBPis a weaker transactivator than the one containing only thecarboxy-terminal region (30). Since preliminary experiments inour laboratory suggest that IE2 86 can physically interact withthe carboxy-terminal domain, it is tempting to speculate that asa result of its interaction with IE2 86, the full-length CBPundergoes a conformational change to the more active form.There is increasing evidence that in addition to CREB, CBPmay function through a number of other transcriptional acti-vators (8, 24, 29), and thus some of the apparent promiscuity ofIE2 86 as an activator may be due to its interaction with CBPor p300.In conclusion, we have shown that activation of the 2.2-kb

RNA promoter by IE2 86 requires sequences located betweennt 272 and 261. Within this region, there is a binding site forthe ATF/CREB family of transcription factors, and in permis-sive cells, CREB is the major family member which binds tothis cis-acting element. The precise mechanisms underlyingactivation by IE2 86 through this site in vivo remain to beelucidated, but the data presented here, coupled with the datareported by Lang et al. (31), suggest that protein-protein in-teractions between IE2 86 and either phosphorylated DCREBor the CREB coactivators CBP and p300 may play a crucialrole. In transient-expression assays, direct binding of IE2 86 tothe DNA appears to be less important for stimulation of thispromoter, although the presence of the IE2 86 DNA-bindingsite positioned between nt 2113 and 285 does contribute tofull activation through the essential downstream element.

ACKNOWLEDGMENTS

We thank Chuck Clark for excellent technical assistance and BryanSalvant for helping with the construction of some of the mutant pro-moter plasmids. We also thank Isaac Engel, Lee Cranmer, ElizabethFortunato, Juan Carlos Gonzalez-Armas, Thomas Moreno, Christo-pher Morello, Franziska Ruchti, Steven Rodems, Marvin Sommer, andMaziar Younessian for stimulating discussions and critical reviews ofthe manuscript.This investigation was supported by NIH grant CA-34729.

REFERENCES1. Alford, C. A., and W. J. Britt. 1990. Cytomegalovirus, p. 1981–2010. In B. N.Fields and D. M. Knipe (ed.), Virology, 2nd ed. Raven Press, New York.

2. Arany, Z., D. Newsome, E. Oldread, D. M. Livingston, and R. Eckner. 1995.A family of transcriptional adaptor proteins targeted by the E1A oncopro-tein. Nature (London) 374:81–84.

3. Arlt, H., D. Lang, S. Gebert, and T. Stamminger. 1994. Identification ofbinding sites for the 86-kilodalton IE2 protein of human cytomegaloviruswithin an IE2-responsive viral early promoter. J. Virol. 68:4117–4125.

4. Caswell, R., C. Hagemeier, C.-J. Chiou, G. Hayward, T. Kouzarides, and J.Sinclair. 1993. The human cytomegalovirus 86K immediate early (IE) 2protein requires the basic region of the TATA-box binding protein (TBP) forbinding, and interacts with TBP and transcription factor TFIIB via regions ofIE2 required for transcriptional regulation. J. Gen. Virol. 74:2691–2698.

5. Cherrington, J. M., E. L. Khoury, and E. S. Mocarski. 1991. Human cyto-megalovirus IE2 negatively regulates a gene expression via a short targetsequence near the transcription start site. J. Virol. 65:887–896.

6. Chiou, C.-J., J. Zong, I. Waheed, and G. S. Hayward. 1993. Identification andmapping of dimerization and DNA-binding domains in the C terminus of theIE2 regulatory protein of human cytomegalovirus. J. Virol. 67:6201–6214.

7. Chrivia, J. C., R. P. S. Kwok, N. Lamb, M. Hagiwara, M. R. Montminy, andR. H. Goodman. 1993. Phosphorylated CREB binds specifically to the nu-clear protein CBP. Nature (London) 365:855–859.

8. Dai, P., H. Akimaru, Y. Tanaka, D. X. Hou, T. Yasukawa, C. Kanei-Ishii, T.Takahashi, and S. Ishii. 1996. CBP as a transcriptional coactivator of c-Myb.Genes Dev. 10:528–540.

9. Davis, M. G., S. C. Kenney, J. Kamine, J. S. Pagano, and E.-S. Huang. 1987.Immediate-early gene region of human cytomegalovirus trans-activates thepromoter of human immunodeficiency virus. Proc. Natl. Acad. Sci. USA84:8642–8646.

FIG. 9. In vivo interaction between IE2 86 and CBP. HeLa cells were trans-fected by the calcium phosphate coprecipitation procedure with 5 mg of thepGAL4-CAT reporter pGAL4/E1b TATA containing five GAL4-binding sites(33), 5 mg of the coding plasmids for the effector proteins GAL4-CBP (fulllength) or GAL4-CBP (amino acids 1678 to 2441) (C terminal) (7, 30), or 5 mgof a protein kinase A coding plasmid and different quantities of pSGIE86 (28),and harvested 48 h posttransfection as discussed in Materials and Methods.Activation of the GAL4-CAT reporter construct by GAL4-CBP (full length) orGAL4-CBP (amino acids 1678 to 2441) in the absence of IE2 86 was set to 1.


10. DeMarchi, J. M. 1981. Human cytomegalovirus DNA: restriction enzymecleavage maps and map locations for immediate-early, early, and late RNAs.Virology 114:23–28.

11. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcrip-tion initiation by RNA polymerase II in a soluble extract from isolatedmammalian nuclei. Nucleic Acids Res. 11:1475–1489.

12. Furnari, B. A., E. Poma, T. F. Kowalik, S.-M. Huong, and E.-S. Huang. 1993.Human cytomegalovirus immediate-early gene 2 protein interacts with itselfand with several novel cellular proteins. J. Virol. 67:4981–4991.

13. Geist, L. J., M. M. Monick, M. F. Stinski, and G. W. Hunninghake. 1994.The immediate early genes of human cytomegalovirus upregulate tumornecrosis factor-alpha gene expression. J. Clin. Invest. 93:474–478.

14. Ghazal, P., J. Young, E. Giuletti, C. DeMattei, J. Garcia, R. Gaynor, R. M.Stenberg, and J. A. Nelson. 1991. A discrete cis element in the humanimmunodeficiency virus long terminal repeat mediates synergistic trans ac-tivation by cytomegalovirus immediate-early proteins. J. Virol. 65:6735–6742.

15. Hagemeier, C., R. Caswell, G. Hayhurst, J. Sinclair, and T. Kouzarides.1994. Functional interaction between the HCMV IE2 transactivator and theretinoblastoma protein. EMBO J. 13:2897–2903.

16. Hagemeier, C., S. Walker, R. Caswell, T. Kouzarides, and J. Sinclair. 1992.The human cytomegalovirus 80-kilodalton but not the 72-kilodalton imme-diate-early protein transactivates heterologous promoters in a TATA box-dependent mechanism and interacts directly with TFIID. J. Virol. 66:4452–4456.

17. Hermiston, T. W., C. L. Malone, and M. F. Stinski. 1990. Human cytomeg-alovirus immediate-early two-protein region involved in negative regulationof the major immediate-early promoter. J. Virol. 64:3532–3536.

18. Hermiston, T. W., C. L. Malone, P. R. Witte, and M. F. Stinski. 1987.Identification and characterization of the human cytomegalovirus immedi-ate-early region 2 gene that stimulates gene expression from an induciblepromoter. J. Virol. 61:3214–3221.

19. Hurst, H. C., N. Masson, N. C. Jones, and K. A. W. Lee. 1990. The cellulartranscription factor CREB corresponds to activating transcription factor 47(ATF-47) and forms complexes with a group of polypeptides related toATF-43. Mol. Cell. Biol. 10:6192–6203.

20. Iskenderian A. C., L. Huang, A. Reilly, R. M. Stenberg, and D. G. Anders.1996. Four of eleven loci required for transient complementation of humancytomegalovirus DNA replication cooperate to activate expression of repli-cation genes. J. Virol. 70:383–92.

21. Jahn, G., E. Knust, H. Schmolla, T. Sarre, J. A. Nelson, J. K. McDougall,and B. Fleckenstein. 1984. Predominant immediate-early transcripts of hu-man cytomegalovirus AD169. J. Virol. 49:363–370.

22. Jupp, R., S. Hoffmann, A. Depto, R. M. Stenberg, P. Ghazal, and J. A.Nelson. 1993. Direct interaction of the human cytomegalovirus IE86 proteinwith the cis repression signal does not preclude TBP from binding to theTATA box. J. Virol. 67:5595–5604.

23. Jupp, R., S. Hoffmann, R. M. Stenberg, J. A. Nelson, and P. Ghazal. 1993.Human cytomegalovirus IE86 protein interacts with promoter-boundTATA-binding protein via a specific region distinct from the autorepressiondomain. J. Virol. 67:7539–7546.

24. Kamei, Y., L. Xu, T. Heinzel, J. Torchia, R. Kurokawa, B. Gloss, S.-C. Lin,R. A. Heyman, D. W. Rose, C. K. Glass, and M. G. Rosenfield. 1996. A CBPintegrator complex mediates transcriptional activation and AP-1 inhibitionby nuclear receptors. Cell 85:403–414.

25. Kerry, J. A., M. A. Priddy, T. Y. Jervey, C. P. Kohler, T. L. Staley, C. D.Vanson, T. R. Jones, A. C. Iskenderian, D. G. Anders, and R. M. Stenberg.1996. Multiple regulatory events influence human cytomegalovirus DNApolymerase (UL54) expression during viral infection. J. Virol. 70:373–382.

26. Kline, J. N., L. J. Geist, M. M. Monick, M. F. Stinski, and G. W. Hun-nighake. 1994. Regulation of expression of the IL-1 receptor antagonist(IL-1ra) gene by products of the human cytomegalovirus immediate earlygenes. J. Immunol. 152:2351–2357.

27. Klucher, K. M., D. K. Rabert, and D. H. Spector. 1989. Sequences in thehuman cytomegalovirus 2.7-kilobase RNA promoter which mediate its reg-ulation as an early gene. J. Virol. 63:5334–5343.

28. Klucher, K. M., M. Sommer, J. T. Kadonaga, and D. H. Spector. 1993. Invivo and in vitro analysis of transcriptional activation mediated by the humancytomegalovirus major immediate-early proteins. Mol. Cell. Biol. 13:1238–1250.

29. Kwok, R. P. S., M. E. Laurance, J. R. Lundblad, P. S. Goldman, H.-M. Shih,L. M. Connor, S. J. Marriott, and R. H. Goodman. 1996. Control of CAMP-regulated enhancers by the viral transactivator tax through CREB and theco-activator CBP. Nature (London) 380:642–646.

30. Kwok, R. P. S., J. R. Lundblad, J. C. Chrivia, J. P. Richards, H. P. Bach-inger, R. G. Brennan, S. G. E. Roberts, M. R. Green, and R. H. Goodman.1994. Nuclear protein CBP is a coactivator for the transcription factorCREB. Nature (London) 370:223–226.

31. Lang, D., S. Gebert, H. Arlt, and T. Stamminger. 1995. Functional interac-tion between the human cytomegalovirus 86-kilodalton IE2 protein and thecellular transcription factor CREB. J. Virol. 69:6030–6037.

32. Lang, D., and T. Stamminger. 1993. The 86-kilodalton IE-2 protein of

human cytomegalovirus is a sequence-specific DNA-binding protein thatinteracts directly with the negative autoregulatory response element locatednear the cap site of the IE-1/2 enhancer-promoter. J. Virol. 67:323–331.

33. Lillie, J. W., and M. R. Green. 1989. Transcription activation by the adeno-virus E1a protein. Nature (London) 338:39–44.

34. Liu, B., T. W. Hermiston, and M. F. Stinski. 1991. A cis-acting element in themajor immediate-early (IE) promoter of human cytomegalovirus is requiredfor negative regulation by IE2. J. Virol. 65:897–903.

35. Lukac, D. M., J. R. Manuppello, and J. C. Alwine. 1994. Transcriptionalactivation by the human cytomegalovirus immediate-early proteins: require-ments for simple promoter structures and interactions with multiple com-ponents of the transcription complex. J. Virol. 68:5184–5193.

36. Lundblad, J. R., R. P. S. Kwok, M. E. Laurance, M. L. Harter, and R. H.Goodman. 1995. Adenoviral E1A-associated protein p300 as a functionalhomologue of the transcriptional co-activator CBP. Nature (London) 374:85–88.

37. Macias, M. P., and M. F. Stinski. 1993. An in vitro system for humancytomegalovirus immediate early 2 protein (IE-2)-mediated site-dependentrepression of transcription and direct binding of IE2 to the major immediate-early promoter. Proc. Natl. Acad. Sci. USA 90:707–711.

38. Malone, C. L., D. H. Vesole, and M. F. Stinski. 1990. Transactivation ofhuman cytomegalovirus early promoter by gene products from the immedi-ate-early gene IE2 and augmentation by IE1: mutational analysis of the viralproteins. J. Virol. 64:1498–1506.

39. McDonough, S. H., and D. H. Spector. 1983. Transcription in human fibro-blasts permissively infected by human cytomegalovirus strain AD169. Virol-ogy 125:31–46.

40. Montminy, M. R., K. A. Sevarino, J. A. Wagner, G. Mandel, and R. H.Goodman. 1986. Identification of a cyclic-AMP responsive element withinthe rat somatostatin gene. Proc. Natl. Acad. Sci. USA 83:6682–6686.

41. Nankervis, G. A., and M. L. Kumar. 1978. Diseases produced by cytomega-loviruses. Med. Clin. North Am. 62:1021–1035.

42. Pari, G. S., and D. G. Anders. 1993. Eleven loci encoding trans-acting factorsare required for transient complementation of human cytomegalovirus ori-Lyt-dependent DNA replication. J. Virol. 67:6979–6988.

43. Pizzorno, M. C., and G. S. Hayward. 1990. The IE2 gene products of humancytomegalovirus specifically down-regulate expression from the major im-mediate-early promoter through a target sequence located near the cap site.J. Virol. 64:6154–6165.

44. Pizzorno, M. C., M.-A. Mullen, Y.-N. Chang, and G. S. Hayward. 1991. Thefunctionally active IE2 immediate-early regulatory protein of human cyto-megalovirus is an 80-kilodalton polypeptide that contains two distinct acti-vator domains and a duplicated nuclear localization signal. J. Virol. 65:3839–3852.

45. Pizzorno, M. C., P. O’Hare, L. Sha, R. L. LaFemina, and G. S. Hayward.1988. trans-activation and autoregulation of gene expression by the immedi-ate-early region 2 gene products of human cytomegalovirus. J. Virol. 62:1167–1179.

46. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

47. Schwartz, R., M. H. Sommer, A. Scully, and D. H. Spector. 1994. Site-specificbinding of the human cytomegalovirus IE2 86-kilodalton protein to an earlygene promoter. J. Virol. 68:5613–5622.

48. Scully, A. L., M. H. Sommer, R. Schwartz, and D. H. Spector. 1995. Thehuman cytomegalovirus IE2 86 kDa protein interacts with an early genepromoter via site-specific DNA binding and protein-protein associations.J. Virol. 69:6533–6540.

49. Shapiro, D. J., P. A. Sharp, W. W. Wahli, and M. J. Keller. 1988. A high-efficiency HeLa cell nuclear transcription extract. DNA 7:47–55.

50. Sommer, M. H., A. L. Scully, and D. H. Spector. 1994. Trans-activation bythe human cytomegalovirus IE2 86-kDa protein requires a domain that bindsto both TBP and RB. J. Virol. 68:6223–6231.

51. Sommer, M. H., and D. H. Spector. Unpublished data.52. Spector, D. J., and M. J. Tevethia. 1994. Protein-protein interactions be-

tween human cytomegalovirus IE2-580aa and pUL84 in lytically infectedcells. J. Virol. 68:7549–7553.

53. Speir, E., R. Modali, E.-S. Huang, M. B. Leon, F. Shawl, T. Finkel, and S. E.Epstein. 1994. Potential role of human cytomegalovirus and p53 interactionin coronary restenosis. Science 265:391–394.

54. Staprans, S. I., D. K. Rabert, and D. H. Spector. 1988. Identification ofsequence requirements and trans-acting functions necessary for regulatedexpression of a human cytomegalovirus early gene. J. Virol. 62:3463–3473.

55. Staprans, S. I., and D. H. Spector. 1986. 2.2-Kilobase class of early tran-scripts encoded by cell-related sequences in human cytomegalovirus strainAD169. J. Virol. 57:591–602.

56. Stenberg, R. M., J. Fortney, S. W. Barlow, B. P. Magrane, J. A. Nelson, andP. Ghazal. 1990. Promoter-specific trans activation and repression by humancytomegalovirus immediate-early proteins involves common and unique pro-tein domains. J. Virol. 64:1556–1565.

57. Stenberg, R. M., D. R. Thomsen, and M. F. Stinski. 1984. Structural analysisof the major immediate early gene of human cytomegalovirus. J. Virol.49:190–199.


58. Stenberg, R. M., P. R. Witte, and M. F. Stinski. 1985. Multiple spliced andunspliced transcripts from human cytomegalovirus immediate-early region 2and evidence for a common initiation site within immediate-early region 1.J. Virol. 56:665–675.

59. Stinski, M. F. 1978. Sequence of protein synthesis in cells infected by humancytomegalovirus: early and late virus-induced polypeptides. J. Virol. 26:686–701.

60. Stinski, M. F., D. R. Thomsen, R. M. Stenberg, and L. C. Goldstein. 1983.Organization and expression of the immediate-early genes of human cyto-megalovirus. J. Virol. 46:1–14.

61. van Dam, H., M. Duyndam, R. Rottier, A. Bosch, L. deVries-Smits, P.Herrlich, A. Zantema, P. Angel, and A. J. van der Eb. 1993. Heterodimerformation of cJun and ATF-2 is responsible for induction of c-jun by the 243amino acid adenovirus E1A protein. EMBO J. 12:479–487.

62. Walker, S., C. Hagemeier, J. G. P. Sissons, and J. H. Sinclair. 1992. A10-base pair element of the human immunodeficiency virus type 1 longterminal repeat (LTR) is an absolute requirement for transactivation by thehuman cytomegalovirus 72-kilodalton IE1 protein but can be compensatedfor by other LTR regions in transactivation by the 80-kilodalton IE2 protein.J. Virol. 66:1543–1550.

63. Wathen, M. W., and M. F. Stinski. 1982. Temporal patterns of human

cytomegalovirus transcription: mapping the viral RNAs synthesized at im-mediate early, early, and late times after infection. J. Virol. 41:462–477.

64. Wathen, M. W., D. R. Thomsen, and M. F. Stinski. 1981. Temporal regula-tion of human cytomegalovirus transcription at immediate early and earlytimes after infection. J. Virol. 38:446–459.

65. Wilkinson, G. W. G., A. Akrigg, and P. J. Greenaway. 1984. Transcription ofimmediate early genes of human cytomegalovirus strain AD169. Virus Res.1:101–116.

66. Wright, D. A., and D. H. Spector. 1989. Posttranscriptional regulation of aclass of human cytomegalovirus phosphoproteins encoded by an early tran-scription unit. J. Virol. 63:3117–3127.

67. Wright, D. A., S. I. Staprans, and D. H. Spector. 1988. Four phosphoproteinswith common amino termini are encoded by human cytomegalovirus AD169.J. Virol. 62:331–340.

68. Wu, J., R. Jupp, R. M. Stenberg, J. A. Nelson, and P. Ghazal. 1993. Site-specific inhibition of RNA polymerase II preinitiation complex assembly byhuman cytomegalovirus IE86 protein. J. Virol. 67:7547–7555.

69. Yamamoto, K. K., G. A. Gonzalez, P. Menzel, J. Rivier, and Montminy, M. R.1990. Characterization of a bipartite activator domain in transcription factorCREB. Cell 60:611–617.


Documents

CREB and CREB-Binding Proteins Play an Important Role in the IE2