COT 6930HPC and Bioinformatics

Introduction to Molecular Biology

Xingquan ZhuDept. of Computer Science and Engineering

Outline

Cell DNA

DNA Structure DNA Sequencing

RNA (DNA-> RNA) Protein

Cells are fundamental working units of every living system. A cell is the smallest structural unit of an organism that is capable of

independent function Unicellular organism (Any living being consisting of a single cell): mainly bacteria Multicellular organism (Organisms consisting of more than one cell): Plant and animal

All cells have some common features Membrane, cytoplasm

Cell is able to survive and multiply independently in appropriate environment There are estimated about 6x1013 (60 trillions) cells in a human body, of

about 210 distinct cell types Cells may have different sizes: a human red blood cell may be 5 microns in

diameter while some neurons are about 1 m long (from spinal cord to leg) Name a cell visible with naked eyes..

Life begins with Cell

Cell

Living organisms (on Earth) require ability to Separate inside from outside (lipids) Build 3D machinery to perform biological functions (proteins) Store information on how to build machinery (DNA)

The basic unit of life Every living thing is made of cells. Every cell comes from a pre-existing cell All of life’s functions are cellular

Every organism is composed of one of two radically different types of cells: prokaryotic cells or eukaryotic cells.

Prokaryotic cells are simpler than eukaryotic cells

Prokaryotes are (mostly) single cellular organisms

Eukaryotic cell has a nucleus, separated from the rest of the cell by a membrane

Eukaryotes can be single cellular (Yeast) or multicellular (animals, plants)

Organisms – Eukaryotes and Prokaryotes

Organisms – Eukaryotes and Prokaryotes

Prokaryotes Eukaryotes

Single cell Single or multi cell

No nucleus Nucleus

No organelles Organelles

One piece of circular DNA Chromosomes

No mRNA post transcriptional modification

Exons/Introns splicing

Structure of a Eukaryotic Cell

• Nucleus contains chromosomes, which are the carrier of the genetic material

• Organelles like centrioles, lysosomes, golgi complexes are enclosed compartments within the cell and are responsible for particular biological processes

• Area of the cell outside the nucleus and the organelles is called the cytoplasm

Composition of Cells

Cell membrane Boundary between cell and outside world Cell membranes consist of two layers of lipid

molecules with hydrophobic ends facing in (keeps water out)

Nucleus Contain genetic material Separated from the rest of the cell by a nuclear

membrane

The nucleus1. nuclear envelope2. nucleolus3. chromosomes

chromosomes

All Cells have common Cycles

Growth of a single cell and its subsequent division is called the cell cycleM: Mitosis

Prokaryotes, particularly bacteria, are extremely successful at multiplying.

Multicellular organisms typically begin life as a single cell. The single cell has to grow, divide and differentiate into different cell types to produce tissues and in higher eukaryotes, organs

All cells come from pre-existing cells

Molecular Biology: Studying life at the molecular level

DNA Protein RNA

mRNA rRNA tRNA

Protein synthesis Protein transcription Protein translation

Molecules of Life All Life depends on 3 critical molecules –

DNA, RNA, and Protein All 3 are specified linearly

DNA and RNA are constructed from nucleic acids (nucleotides) Can be considered to be a string written in a four-letter

alphabet (A C G T/U) Proteins are constructed from amino acids

Strings in a twenty-letter alphabet of amino acids

DNA RNA protein phenotype

Central dogma of molecular biology

DNA, RNA, Protein

Self replication and genetic code

DNA DNA → DNA (Replication)RNA DNA → RNA (Transcription / Gene Expression)Protein RNA → Protein (Translation)

Outline

Cell DNA

DNA Structure DNA Sequencing

RNA (DNA-> RNA) Protein

DNA (Deoxyribonucleic Acid ) Structure Physical structure

Double (stranded) helix Sugar & phosphate groups form backbone Complementary bases (A-T, C-G) connected by hydrogen bond 5’ = end w/ free phosphate group 3’ = end w/ free oxygen group

DNA

Composition Sequence of nucleotides Deoxyribonucleotide = deoxyribose sugar + phosphate group +

base

Nucleotide Bases

Nucleotides

The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom

(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA

DNA structure

Why 5’ and 3’

Deoxyribonucleotide = deoxyribose sugar + phosphate group + base

The deoxyribose sugar in DNA is a pentose, a five-carbon sugar. Four carbons and an oxygen make up the five-membered ring; the other carbon branches off the ring. The carbon constituents of the sugar ring are numbered 1'-4' (pronounced "one-prime carbon"), starting with the carbon to the right of the oxygen going clockwise. The fifth carbon (5') branches from the 4' carbon.

DNA - Denaturation, Hybridization

DNA For bioinformatics

DNA can be represented as a sequence of letters (A,C,G,T)

5’ A T A C G T A 3’ 3’ T A T G C A T 5’ (matching strand, redundant)

Terms Base pair (bp) – one pair of DNA bases (1 letter) Gene – section of DNA that produces a functional product Chromosome – physical linear sequence of DNA Genome – entire collection of DNA for an organism

E Coli 1 chromosome 5 x 106 bases (5 Mbps) Drosophila 8 chromosomes 2 x 108 bases (200 Mbps) Human 48 chromosomes 3 x 109 bases (3 Bbps)

DNA Replication

DNA can be replicated DNA strands are split DNA polymerase (enzyme) reads one strand (template) Builds new (complementary) strand to form duplicate DNA

DNA fascinating factEach cell has 2m of DNA

Average person has 75 trillion cells = 75 * 1012

Length of DNA in a person = 150 * 1012 m

Each person has enough DNA to go to the sun and back 500 times

Organization of DNA in chromosomes

homologous

3 bases/ amino acid

27,000 bases/ protein (1 gene)

3,000,000,000 base pairs/ genome

20,000 genes/ genome

Histone proteins

Human Genome Project

Genome

Gene: Contiguous subparts of single strand DNA that are templates for producing proteins. Chromosomes: compact chain

s of coiled DNA

Genome: The set of all genes in a given organism.

Noncoding part: The function of DNA material between genes is largely unknown.

Source: www.mtsinai.on.ca/pdmg/Genetics/basic.htm

More Terminology

The genome is an organism’s complete set of DNA. A bacteria contains about 600,000 DNA base pairs Human and mouse genomes have some 3 billion.

Human genome has 23 pairs of chromosomes. Each chromosome contains many genes.

Gene Basic physical and functional units of heredity. Specific sequences of DNA bases that encode

instructions on how to make proteins.

DNA sequences in the human genome

DNA homologies98.7%

Outline

Cell DNA

DNA Structure DNA Sequencing

RNA (DNA-> RNA) Protein

DNA Sequencing (Sanger’s Dideoxy Method) Method for identifying short DNA sequences Algorithm

Replicate DNA with (color-labeled) dideoxy-nucleotides Creates fragments of DNA

Apply gel electrophoresis Separates fragments based on size

Machine scans gel Records level of color found at each position

Software calls bases Predicts base at each position

Limitations Upper bound of 700-800 bases on sequence length Larger DNA sequences will need to be assembled

DNA Sequencing Dideoxynucleotides

Similar to normal nucleotide base Missing 3’ hydroxyl group terminates DNA sequence May be chemically modified to fluoresce under UV light

DNA Sequencing

Example for GCGAATGTCCACAACGCTACAGGTG Replicate DNA in the presence of dideoxy-Cytidine (ddC) Replication terminates when ddC is used instead of C Produces the following DNA fragments

GC GCGAATGTC GCGAATGTCC GCGAATGTCCAC GCGAATGTCCACAAC GCGAATGTCCACAACGC GCGAATGTCCACAACGCTAC

DNA Sequencing

Gel electrophoresis Place DNA fragments in gel Apply electric field Speed of fragment is determined

by size Smaller = faster Larger = slower

After given time Fragments are separated in gel Fragments are sorted by size

(number of bases)

Gel electrophoresis

DNA Sequencing

DNA Sequencing

Outline

Cell DNA

DNA Structure DNA Sequencing

RNA (DNA-> RNA) Protein

Central Dogma of Biology: DNA, RNA, and the Flow of Information

TranslationTranscription

Replication

Ribonucleic acid (RNA)

Composition Sequence of nucleotides Ribonucleotide = ribose sugar + phosphate group + base

Major difference between DNA and RNA RNA: usually single stranded RNA: ribose sugar, DNA: Deoxyribose sugar RNA: Uracil (U) instead of Thymine (T)

DNA → RNA (Transcription / Gene Expression) RNA polymerase (enzyme)

Finds gene initiation marker (codon) on DNA strand Reads DNA strand containing marker Builds (complementary) strand of messenger RNA (mRNA) Stops when gene end marker (codon) found

Resulting RNA sequence = transcript

Ribonucleotides

The five-carbon sugar (a pentose) in nucleotides has two types Deoxyribose, which has a hydrogen atom attached to its #2 carbon atom

(designated 2') : DNA Ribose, which has a hydroxyl group atom there: RNA

Transcription Example (1)

Transcription Example (2)

Transcription Example (3)

Transcription Example (4)

Transcription Example

What is Enzyme?

Proteins that catalyze (i.e. accelerate) chemical reactions They are not living things Two types of Enzyme

Join specific molecules together to form new molecules Break specific molecules apart into separate molecules

Things about Enzyme Enzymes are specific: Performing only one specific job, about

3000 types enzymes identified so far Enzymes are catalysts: Can perform that same job over and over

again, millions of times, without being consumed in the process. Enzymes are efficient: Enzymes are natural: Once they have done their job, enzymes

break down swiftly and can be absorbed back into nature

Outline

Cell DNA

DNA Structure DNA Sequencing

RNA (DNA-> RNA) Protein