Embed Size (px)
Citation preview
Notch Signalling in CD34+ Cells in Chronic Myeloid Leukaemia
A thesis submitted to the University of Manchester for the degree of PhD in the Faculty of Life Sciences
2008
Abdullah H. Al-Jedai
Contents
PageCONTENTS…………………………………………………………………………2LIST OF FIGURES………………………………………………………………….7LIST OF ABBREVIATIONS……………………………………………………….10ABSTRACT…………………………………………………………………………14DECLARATION……………………………………………………………….......15COPYRIGHT STATEMENT……………………………………………………….15ACKNOWLEDGEMENTS…………………………………………………………16
Chapter one:Introduction………………………………………..17
1.1.1 Haemopoietic stem cells (HSCs)………………………………..181.1.2 Regulation of haemopoiesis……………………………………...221.1.2.1 The stem cell niche………………………………………………………....23
1.1.2.1.1 Cell-ECM interaction………………………………………………..231.1.2.1.2 Soluble factors in the niche ………………………………………….241.1.2.1.3 Cell-cell interactions……………………………………….. ……….27
1.1.2.2 Genetic control of haemopoiesis ………………………………………….28
1.2 Notch signalling pathway ………………………………………….31
1.2.1 Notch receptors ………………………………………………………………311.2.2 Notch ligands…………………………………………………………………321.2.3 Molecular mechanisms of Notch signalling …………………………………351.2.4 Modulators of Notch signalling………………………………………………38
1.2.5 Notch signalling in haemopoiesis……………………………………………39
1.2.5.1 Notch and haemopoietic stem cell (HSC) fate decisions………………..40 1.2.5.2 Notch signalling in myeloid development………………………………..42
1.2.5.3 Notch signalling in lymphoid cell development………………………441.2.6 Notch signalling and cancer…………………………………………………47
1.2.6.1 Notch signalling in leukaemia ………………………………………..48
1.3 Chronic myeloid leukaemia (CML)………………………………521.3.1 Molecular phenotype of BCR-ABL……………………………………..531.3.2 BCR-ABL oncogenic activities…………………………………………55
1.3.2.1 Altered adhesion………………………………………………….551.3.2.2 Inhibition of apoptosis……………………………………………561.3.2.3 Proliferative signals………………………………………………561.3.2.4 Role of CrKl in BCR-ABL signalling……………………………57
1.3.3 Leukaemic stem cells (LSC) in CML………………………………….571.3.4 Imatinib mesylate………………………………………………………60.1.3.5 Experimental models of CML…………………………………………61
1.3.5.1 Cell lines……………………………………………………………611.3.5.2 Animal models……………………………………………………..61
2
1.4 Possible role for Notch in CML……………………………………62
1.5 Research aims and objectives………………………………………64
Chapter 2 Material and methods…………………………65
2.1 Cell Biology techniques…………………………………652.1.1 Cell lines……………………………………………………………………..65
2.1.1.1 K562 cell line…………………………………………………………..652.1.1.2 NALM-1 cell line………………………………………………………..652.1.1.3 ALL-SIL cell line………………………………………………………652.1.1.4 JURKAT cell line ……………………………………………………...662.1.1.5 Passage of cell lines……………………………………………………662.1.1.6 Viable Cell Count………………………………………………………662.1.1.7 Cryopreservation of Cell Lines…………………………………………66
2.1.2 Primary CML samples……………………………………………………….66
2.1.2.1 Thawing of cryopreserved CML cells…………………………………..672.1.2.2 Short term liquid culture of primary CML CD34+ cells………………..672.1.3 Retroviral transfection of K562 cells with Notch1ΔE……………………68
2.2 Flow cytometric techniques……………………………..68
2.2.1 Isolation of mononuclear cells (MNC)……………………………………682.2.2 Isolation of haemopoietic progenitor cell populations……………………682.2.3 Staining procedures for flow cytometric analysis………………………...69
2.2.3.1 FACS analysis of extra-cellular Notch1 on primary CML cells……692.2.3.2 FACS analysis of extra-cellular Notch1 on K562 cells…………….702.2.3.3 FACS analysis of intra-cellular Notch1 on K562 cells……………..702.2.3.4 The P-crkl assay…………………………………………………….71
2.3 Molecular biology techniques…………………………..73
2.3.1 RNA extraction…………………………………………………………..732.3.2 Construction of cDNA from low cell numbers by Poly-A PCR…………732.3.3 Construction of cDNA by from high cell numbers………………………782.3.4 Gene specific PCR……………………………………………………….78
2.3.4.1 Primers……………………………………………………………..782.3.4.2 Optimisation of Primer Sets………………………………………..79 2.3.4.3 PCR reaction ………………………………………………………792.3.4.4 Detection of PCR products…………………………………………79
2.3.5 Real time PCR…………………………………………81
3
2.3.5.1 Overview OF Real Time PCR……………………………………………..812.3.5.2 Real time PCR protocols…………………………………………………..82
2.3.5.2.1 Real time PCR using TaqMan®probes………………………………822.3.5.2.2 Real time PCR using SYBR® Green………………………………..82.2.3.5.3 Data analysis…………………………………………………………..832.3.5.4 Validation of the 2 –ΔΔC
T method………………………………………..83
2.3.6 Protein Analysis………………………………86
2.3.6.1. Protein extraction and determination of concentration…………………...862.3.6.2 SDS-PAGE and Western Blott……………………………………………87
2.4 Statistics ……………………………………… ………………………88
Chapter 3Investigating Notch signalling in chronic myeloid leukaemia……………………………90
3.1 Introduction ……………………………………………………90
3.2 Results…………………………………………………………..91
3.2.1. Gene expression analysis………………………………………………….91
3.2.1.1 Expression pattern of Notch genes in CML……………………………91 3.2.1.2 Expression pattern of Notch target genes……………………………....93 3.2.2 Flow cytometric analysis of Notch1 in CML………………………….. ..99
3.3. Discussion……………………………………………………...108
3.3.1 Expression pattern of Notch genes in CM…………………………………1083.3.2 Expression patterns of Notch target genes in CML……………………….1103.3.3 Expression of Notch1 protein in CML……………………………………111
Chapter 4 Investigation of BCR-ABL and Notch cross-talk in cell line models
4.1 Introduction…………………………………………...115
4.2 Results…………………………………………………1184.2.1 Validation of the P-crkl intracellular FACS assay in K562 cells…………118
4
4.2.2 The effect of cell passage number on the expression of P-crkl in K562 cells……………………………………………………….120
4.2.3 Assessment of P-crkl expression in leukaemic cell lines………………….1244.2.4 Assessment of imatinib mesylate efficacy in K562 cells using the P-crkl assay………………………………………………………..1264.2.5 Characterisation of Notch signalling in K562 cells…………………………1304.2.6 Constitutive expression of Notch1 ΔE in K562 cells…………………….....1334.2.7 The effect of Valproic acid on BCR-ABL and Notch signalling in K562 cells ………………………………………………………………….1354.2.8 The effect of GSI in K562 cells……………………………………………..1404.2.9 Cross-talk between Notch and BCR-ABL in K562 cells…………………….142
4.2.9.1 The effect of imatinib induced BCR-ABL inhibition on Notch signalling in K562 cells…………………………………………..142
4.2.9.2 The effect of Notch inhibition by GSI on BCR-ABL in K562 cells........1424.2.10 ALL-SIL cell line as a model for ABL-Notch cross-talk…………………....146
4.3 Discussion………………………………………………….149
4.3.1 The FACS based P-crkl assay as a surrogate assay for ABL kinase activity…1494.3.2 P-crkl expression in other leukaemic cell lines ………………………………1514.3.3 Inhibition of p-crkl by imantinib mesylate in K562 cells……………………1524.3.4 Notch signalling in K562 cells………………………………………………1524.3.5 Cross-talk between Notch and BCR-ABL in K562 cells……………………1544.3.6 Cross-talk between Notch and BCR-ABL in the ALL-SIL cell line model system…………………………………………………………156
Chapter 5
Cross-talk between Notch and BCR-ABL in primary CD34+ CML cells
5.1 Introduction………………………………………………………158
5.2: Results……………………………………………………………160
5.2.1 P-crkl phosphorylation can be detected in primary CD34+ CML cells by intracellular flow cytometry assay……………………………1605.2.2 Imatinib mesylate (IM) inhibits BCR-ABL activity in chronic phase CML CD34+ cells……………………………………………1625.2.3 Effect of matinib in CD34+ CML cells upregulates Hes1 Notch target gene expression…………………………………………1625.2.4 Investigating the effect of Notch inhibition on BCR-ABL activity in CD34+ CML cells………………………………………………168.
5.2.4.1 GSI induced inhibition of Notch signalling in CD34+ CML cells……1685.2.4.2 Non GSI responding CD34+ CML cells express high
5
mRNA levels of Hes1 ………………………………………………………1715.2.4.3 Gamma secretase inhibitor (GSI) increases the kinase
activity of BCR-ABL in CD34+ CML cells…………………………………1715.2.4.4 Gamma secretase inhibitor (GSI) decreased the kinase activity of BCR-ABL in CD34+ CML cells from one CML patient…………172
5.3: Discussion…………………………………………………………179
5.3.1 BCR-ABL activity can be monitored in primary CD34+ CML cells by flow cytometry……………………………………………………..1795.3.2 Imatinib mesylate inhibits BCR-ABL activity and up-regulates Notch activity in CD34+ chronic phase CML cells…………………………1815.3.3 Notch inhibition enhances BCR-ABL kinase activity in CD34+ chronic CML cells……………………………………………….185
Chapter 6: Final discussion……………………188
References ……………………………………………………………196Appendex ……………………………………………………………215
6
Final word count: 52367
List of figures
Chapter 1
Fig.1.1 The hierarchy of haemopoiesis………………………………………..21
Fig. 1.2 Regulation of haemopoiesis…………………………………………..30
Fig.1.3 Structure of human Notch receptors …………………………………..33
Fig. 1.4 Structure of Notch ligands…………………………………………….34Fig. 1.5 The CSL-dependent Notch signalling pathway………………………. 37 Fig. 1.6 Notch signalling during T and B cell development…………………..50Fig. 1.7 The t(9;22)(q34;q11) reciprocal translocation…………………………54Fig. 1.8.Signal transduction pathways associated with P210 BCR-ABL in CML…………………………………………………………………………….59
Chapter 2
Fig. 2.1. Outline of poly-A PCR technique……………………………………..77Fig. 2.2. Real Time PCR…………………………………………………………85
Chapter 3
Fig. 3.1. Notch expression of receptor genes in CD34+ populations isolated from normal bone marrow (NBM) and CML samples……………………………94Fig. 3.2. Real time PCR analysis of Notch1(N1) expression on CD34+ cell subsets from NBM and CML patients……………………………………………95Fig. 3.3. Real time PCR analysis of Notch2 expression on CD34+ cell subsets from NBM and CML patients……………………………………………………96Fig. 3.4. Expression of Notch target genes in CD34+ populations isolated from NBM and CML samples…………………………………………...97Fig. 3.5. Real time PCR analysis of Hes1 expression on CD34+ cell subsets from NBM and CML patients……………………………………………………98Fig. 3.6. Notch expression on CD34+ myeloid progenitors in CML…………..101Fig. 3.7. Notch expression on CD34+ lymphoid progenitors in CML…………103Fig. 3.8. CD34 gating strategy and the Notch expression in CD34+ CD38- cell subset in CML………………………………………………………………104 Fig. 3.9. The problem of EA1 non-specific binding within the CD34+ Thy+ cell subset…………………………………………………………105Fig. 3.10. The expression of Notch1 in the CD34+ Thy+ cell subset………………………………………………………………………..106
7
Chapter 4
Fig 4.1. Validation of P-crkl intracellular flow cytometry assay in K562 cells…121Fig 4.2. Comparison of four commercial anti rabbit secondary antibodies used in the P-crkl assay…………………………………………………………..122Fig. 4.3. The effect of cell passage number on the expression of P-crkl in K562 cell line…………………………………………………………………123Fig 4.4. Assessment of P-crkl expression in four leukaemic cell lines…………125Fig. 4.5-a. Assessment of imatinib mesylate (IM) efficacy in K562 cells using a flow based P-crkl assay.............................................................................127Fig. 4.5-b. Dose dependant effect of imatinib mesylate (IM) on the expression of P-crkl in k562 cells post 48h………………………………………128 Fig. 4.6. Effect of concentration of imatinib mesylates (IM) on P-crkl protein levels………………………………………………………………129Fig. 4.7 Expression of Notch1 and Hes1 genes in K562 cell line………………...131Fig. 4.8. FACS analysis of Notch1 expression in K562 cells…………………….132Fig. 4.9. Constitutive expression of N1ΔE in K562 cells…………………………134Fig. 4.10 Hes1 expression in K562 cells post valproic acid (VPA) treatment……136Fig. 4.11. Effect of Valproic acid (VPA) on BCR-ABL activity in K562 cells…..138Fig. 4.12. Effect of Valproic acid (VPA) on erythroid differentiation in K562 cells……………………………………………………………………..139Fig. 4.13. Inhibition of Notch signalling by a gamma seretase inhibitor (GSI) in K562 cells………………………………………………………………141Fig. 4.14. Expression of Hes1 in K562 cells post 48h treatment of imatinib mesylate (IM)…………………………………………………………144Fig. 4.15. The effect of Notch inhibition on BCR-ABL activity in K562 cells……………………………………………………………………145Fig. 4.16. Evaluation of the ALL-SIL cell line as a model for ABL-Notch cross-talk………………………………………………………….147Fig. 4.17. Expression of Hes1 in ALL-SIL cells post 48h treatment of imatinib mesylate (IM)……………………………………………148
Chapter 5
Fig. 5.1. Application of P-CrKl assay to primary chronic myeloid leukaemia (CML) samples……………………………………………161Fig. 5.2. Inhibition of BCR-ABL activity by imatinib mesylate (IM) in CD34+ cells isolated from CML patients……………………164Fig 5.3. Evidence of resistance to imatinib mesylate (IM) in CD34+ from two CML patients……………………………………………..165Fig. 5.4. Hes1 gene expression post imatinib mesylate (IM) treatment in CD34+ cells isolated from imatinib sensitive CML patients……………….166Fig. 5.5. Hes1 gene expression post imatinib mesylate (IM) treatment in CD34+ cells isolated from IM resistant CML patients…………..167Fig. 5.6. Hes1 gene expression after gamma secretase inhibitor (GSI) treatment in CD34+ cells isolated from CML patients 2, 4, and 5……………169Fig. 5.7. Hes1 gene expression after gamma secretase inhibitor (GSI) treatment in CD34+ cells isolated from pateint 1 and 6…………………170Fig. 5.8. Hes1 gene expression in CD34+ CML cells………………………….173
8
Fig. 5.9. Assessment of P-crkl in CD34+ CML cells following inhibition of Notch by gamma secretase inhibitor (GSI)………………………174Fig. 5.10. Assessment of P-crkl in gamma secretase inhibitor (GSI) non responsive CD34+ CML cells………………………………………175Fig. 5.11. P-crkl in CD34+ CML cells treated with gammas secretase inhibitor (GSI)…………………………………………………………………176Fig. 5.12. GSI treatment induced both Notch and BCR-ABL inhibition in CD34+ cells from one CML sample………………………………….177Fig. 6.1. Proposed model for Notch and BCR-ABL cross-talk in CML……………194Fig.6.2. The cooperative model of activated Notch and BCR-ABL signalling in chronic phase CML…………………………………………………...195Appendix1 …………………………………………………………………………215
9
Abbreviations
ABL (c-ABL) V-abl Abelson murine leukemia viral oncogene homolog 1
ADAM A Disintegrin And Metalloprotease
ALCL Anaplastic Large Cell Lymphoma
ALDH Aldehyde dehydrogenase
AML Acute Myeloid Leukaemia
Ank Ankyrin repeats
APP Amyloid precursor protein
B-ALL B-cell acute Lymphoblastic Leukaemia
BAM Bag-of-marbles
B-CLL B-cell Chronic Lymphocytic Leukaemia
BCR Breakpoint cluster region protein
BHLH Basic-Helix-Loop-Helix
BM Bone Marrow
BMP Bone Morphogenic Protein
BMT Bone Marrow Transplant
CADASIL Cerebral Autosomal Dominant Arteriopathy with Subcortical
Infarcts and Leukoencephalopathy
CBF1 C promoter Binding Factor 1
CD Cluster of Differentiation
CDKs Cell cycle Dependent Kinases
CLP Common lymphoid progenitors
CML Chronic Myeloid Leukaemia
cDNA complementary Deoxyribose Nucleic Acid
Crkl Chicken tumor virus CT10 regulator of kinase-like protein
CSL (CBF1, Suppressor of Hairless, Lag-1) family of transcription factors
CXCR-4 Chemokine (C-X-C motif) Receptor 4
10
DMEM Dulbecco's Modified Eagle's Medium
DMSO Dimethylsulphoxide
dNTP Deoxynucleotyde Triphosphate
Dtx Deltex
EBD EGF-motif binding domain
EBNA2 Epstein—Barr virus (EBV) nuclear antigen 2
ECM Extracellular matrix
ECN Extracellular Notch domain
EGF Epidermal growth factor
ELR EGF-like repeats
FACS Fluorescence-Activated Cell Sorting
FBS Fetal Bovine Serum
FITC Fluorescein isothiocyanate
FLT3 FMS-Like Tyrosine kinase 3
Fz Frizzled
GAGs Glycosaminoglycans
GAPDH Glyceraldehydes-3-Phosphate Dehydrogenase
G-CSF Granulocyte Colony Stimulating Factor
GM-CSF Granulocyte Macrophage Colony Stimulating Factor
GMP Granulocyte Macrophage Progenitors
GPA Glycophorin A
GRB2 Growth factor receptor-bound protein 2
GSCs Germ Stem Cells
GSK3-β Glycogen synthase kinase-3beta
HBSS Hank’s Balanced Salt Solution
HD Hodgkin disease
HD domain Heterodimerization domain
HDAC Histone deacetylase
Hes1 Hairy and Enhancer of Split
HGF Haemopoietic Grwoth Factor
Hox Homebox
HRS Hodgkin and Reed-Sternberg
HSCs Haemopoietic stem cells
11
ICSBP Interferon Consensus Sequence Binding Protein
IFN-γ Interferon gamma
IL-3 Interleukin-3
IL-4 Interleukin-4
IL6 Interleukin-6
IM Imatinib Mesylate
JAK2 Janus kinase 2
Lin Lineage specific antigens
LNR Lin 12/ Notch repeats
LSC Leukaemic Stem Cell
MAPK Mitogen-Activated Protein Kinase
M-CSF Macrophage Colony Stimulating Factor
MDS Myelodysplastic Syndrome
MM Multiple Myeloma
MNC Mononuclear Cells
MTor Mammalian target of rapamycin
NCR Notch CytokineResponse domain
NCS Newborn Calf Serum
NLS Nuclear Localization Signal sequences
NOD/SCID Non-Obese Diabetic/ Sever Combind Immuno Deficient
PB Peripheral Blood
PcG Polycomb Group
PCR Polymerase Chain Reaction
P-crkl Phosphorylated crkl
PE Phycoerythrin
PEST Proline-glutamate-Serine-Threonine-rich
(Ph)+ Philadelphia chromosome positive
PI3K phosphatidylinositol 3-kinase
PI Propidium iodide
PolyA PCR Poly Adenylated polymerase Chain Reaction
PPR PTH/PTHrP Receptors
PT⍺ Pre-T cell receptor ⍺
Ptc Patched
PTEN phosphatase and tensin homologue
12
RBP-Jκ Recombination signal sequence Binding Protein-J kappa
RT Room temperature
RT-PCR Reverse transcription polymerase chain reaction
SCF Stem cell factor
SCLC Small cell lung cancer
SDF-1 Stromal Derived Factor 1
SFEM Serum Free Expansion Media
Shh Sonic hedgehog
Su(H) Suppressor of hairless
STAT Signal Transducer and Activator of Transcription
TACE Tumour necrosis factor-Alpha Converting Enzyme
TAD Transcription Activation Domain
T-ALL T-cell Acute Lymphoblastic Leukaemia
TAN-1 Translocation-Associated Notch homolog-1
TCR T Cell Receptor
TGF β Transforming Growth Factor β
TNF-α Tumour Necrosis Factor-alpha
TPO Thrombopoietin
VLA-4 Very Late Antigen-4
VPA Valproic acid
VWF Von Willebrand’s Factor
Wnt Wingless-type MMTV integration site family
13
(Abstract)
Notch signalling is critical for haemopoietic stem cell self-renewal and survival. Chronic Myeloid Leukaemia (CML) is a stem cell disease characterised by the presence of the Philadelphia (Ph) chromosome, and subsequent expression of the BCR-ABL oncogene. The well established role for Notch signalling in human T-cell acute lymphoblastic leukaemia (T-ALL) and the reported interaction between Notch and ABL in different developmental contexts in Drosophila raise the possibility that Notch signalling may be dysregulated in CML. Therefore, this project aims to investigate whether Notch signalling is altered in CML and to study possible cross-talk between Notch signalling pathway and BCR-ABL in CML.
The gene expression patterns of all four human Notch genes and the Notch target gene HES1 were studied in CD34+ stem and progenitor cells isolated from CML patients. Poly-A PCR followed by real time PCR analysis was used to quantitate gene expression levels in comparison with levels in equivalent populations isolated from normal bone marrow (NBM). The expression of Notch1 receptor protein levels expressed on the cell surface was also investigated by flow cytometry. Results showed an up-regulation of Notch1 and Notch2 genes and the target gene Hes1 on the most primitive CD34+ Thy+ subset of CML CD34+ cells as compared with NBM. In addition, Notch1 receptor protein was expressed in distinct lymphoid and myeloid progenitors within the CD34+ population of CML cells. These results suggest that Notch signalling may be highly activated in CML primitive progenitors.
To investigate the possible crosstalk between Notch and ABL in vitro human cell line model systems were assessed as possible models to study the interactions between Notch and ABL signalling and the FACS based P-crkl assay was optimised as a rapid method to assess ABL activity. The data showed that K562 and ALL-SIL cell lines are sufficient model systems to investigate the cross-talk between the Notch and ABL signalling pathways. The imatinib induced inhibition of ABL activity in K562 and ALL-SIL cells resulted in significant up-regulation of Notch activity as assessed by Hes1 expression. Similarly, GSI inhibition of Notch signalling in K562 cells resulted in hyperactivation of ABL kinase activity as assessed by P-crkl levels.
The antagonistic relationship between Notch and ABL signalling observed in cell lines were further confirmed in CD34+ cells from chronic CML patients. Treatment of CD34+ CML cells with imatinib led to significant up-regulation of Notch activity whereas inhibition of Notch signalling with GSI in CD34+ CML cells resulted in increased ABL activity.
It can be concluded therefore, that Notch signalling may be dysregulated in the chronic phase of CML. In addition, the data presented in this project demonstrate for the first time the cross-talk between Notch signalling and ABL signalling in cell line model systems as well as in primary CD34+ CML cells. Future work is required to address the possible mechanisms that underlie the findings observed here and to
14
investigate the biological consequences of the interplay between Notch and ABL signalling in CML.
Declaration and Copyright Statement
Declaration
No portion of the work referred to in the thesis has been submitted in support of an
application for another degree or qualification of this or any other university or other
institute of learning.
Copyright Statement
Copyright in text of this thesis rests with the author. Copies (by any process) either in
full, or of extracts, may be made only in accordance with instructions given by the
author and lodged in the John Rylands University Library of Manchester. Details may
be obtained from the Librarian. This page must form part of any such copies made.
Further copies (by any process) of copies made in accordance with such instructions
may not be made without the permission (in writing) of the author.
The ownership of any intellectual property rights which may be described in this
thesis is vested in The University of Manchester, subject to any prior agreement to the
contrary, and may not be made available for use by third parties without the written
permission of the University, which will prescribe the terms and conditions of any
such agreement.
Further information on the conditions under which disclosures and exploitation may
take place is available from the Vice-President and Dean of the Faculty of Life
Sciences.
15
Acknowledgments
I would like to gratefully acknowledge the enthusiastic supervision of Dr. Anne-Marie
Buckle for her warm encouragement, support and thoughtful guidance throughout my
PhD project.
Special thanks are due to Dr. Nick Chadwick for his continuous help in experimental
design and excellent advice and help in molecular biology techniques. I am grateful to
Dr. Virginia Portillo for her constant support and help with flow cytometry, and Susan
Slack, for her help with cell culture. I also wish to express my Appreciation to my
colleagues Sarah Hoyle, for her help with Westerns and real time PCR, and Dr. Carl
Fennessy for his useful IT support and his help in the lab.
I am forever indebted to my mother and my wife for their understanding, endless
patience, eternal optimism, and encouragement when it was most required. Finally,
this project would not have been possible without the financial support of the
government of Saudi Arabia who provided me the Ph.D. scholarship.
16
Chapter 1: Introduction
The study of the molecular and cellular mechanisms that control blood cell production
in the bone marrow is one of the rapidly developing fields in haematology. An
understanding of bone marrow niche elements and the regulatory signalling pathways
which dictate developmental fate decisions of haemopoietic cells in health and disease
is vital for both medicine and developmental biology. For instance, the discovery and
cloning of soluble haemopoietic growth factors (HGF), which are critical for blood
cells survival, proliferation, and differentiation, was a major breakthrough in medicine
and transplantation settings for the treatment of cancer. The importance of cell-cell
interaction in the bone marrow (BM) niche has been emphasised by the discovery of a
new role for sets of signalling molecules such as Notch and Wnt proteins which are
emerging as critical regulators of normal haemopoiesis.
Notch signalling is an evolutionary conserved mechanism that controls cell fate
decisions in various body sites both in vertebrates and invertebrate (Ohishi et al.
2003). Much of our knowledge about Notch is gained from Drosophila developmental
biology. The phenotype of Notch was first described in Drosophila by Morgan in
1916 in a mutant fly with ‘notches’ in its wings and the gene causing this phenotype
was found to be required for the wing outgrowth (Simpson, 1998; and Lai, 2004).
However, the first example of the involvement of Notch in malignant transformation
in humans was described in a subset of T-cell acute lymphoblastic leukaemia (T-
ALL) carrying the t (7; 9) (q34; q34.3) translocation in which a constitutive
expression of Notch was involved in the leukaemogenesis process (Ellisen et al.
1991).
17
It has been shown since then that Notch signalling is critical for haemopoietic stem
cell self-renewal and survival (Varnum-Finney et al. 2000; Stier et al. 2002) and in
cell fates specification during lymphopoiesis (Pear et al. 2003; Radtke et al. 2004).
Dysregulation of Notch activity has been shown to be associated with malignant
transformation in various organs including the haemopoietic compartment. The
contribution of Notch signalling to haematologic malignancies is well established in
T-ALL leukaemia (Bellavia et al. 2002; and Weng et al. 2004) and has been
suggested in other malignancies such as B-CLL (Hubmann et al. 2002), Hodgkins
lymphoma, and anaplastic large cell lymphoma (Jundt et al. 2002).
The involvement of Notch signalling in myeloid leukaemias has been suggested
recently (Chiaramonte et al. 2005). Intriguingly, myeloid leukaemias such as AML
and CML are stem cell diseases in which leukaemic stem cells (LSC) retain the
unique potentials of normal haemopoietic stem cells (HSCs), such as self-renewal
capacity, to initiate and maintain leukaemia (Jordan and Guzman, 2004). The concept
of cancer stem cells and the critical and well established role of Notch signalling in
the HSCs self-renewal make Notch signalling an attractive pathway to study in
myeloid leukaemias. Recently, Armstrong et al. (2008) demonstrated the major role
of the Notch pathway activation in human T-ALL development and in the long term
growth and maintenance of leukaemia-initiating cells.
This chapter aims to review the main concepts of haemopoiesis and Notch signalling
pathway in the literatures, and to analyse how blood cells are affected by Notch
signalling during normal development and in the malignant transformation process.
This chapter aims also, based on recent findings, to establish a hypothesis of altered
Notch signalling in chronic myeloid leukemia (CML). An altered signalling activity
such as this would reveal part of the mysterious molecular mechanisms which drive
leukaemic transformation in CML and may provide a molecular target for therapeutic
strategies in CML.
1.1.1 Haemopoietic stem cells (HSCs)
Haemopoiesis is the process of blood production. In the adult this takes place in the
BM, and is maintained throughout life by stem cells. Haemopoiesis can be described
18
as hierarchical with the rare HSCs at the top of the hierarchy giving rise first to
progenitors and then to precursors with single lineage commitment and ending in
differentiated mature cells of different lineages (Fig. 1.1). HSCs are stem cells that
reside mainly in the bone marrow and to a lesser extent in other tissues such as
peripheral blood and placenta. HSCs enjoy the unique properties of stem cells. First,
they are capable of producing the major haempoietic cell types as needed. Secondly,
HSCs self-renew to generate daughter stem cell to maintain enough HSCs pool in the
body to sustain the requirement of high numbers of specialised blood cells during
physiologically stressful conditions. Thirdly, HSCs have an extreme proliferation
potential which enable them to meet the high demands of haemopoiesis throughout
the normal adult life span (Szilvassy, 2003).
Although most HSCs remain quiescent and do not enter the cell cycle, HSCs undergo
cell divisions to self-renew and differentiate, or either, through asymmetric cell
division, to differentiate and generate more mature and specialised blood cells (Rao
and Mattson, 2000). A balance between the numbers of stem cells, committed
progenitors, and differentiated haemopoietic cells in the bone marrow is maintained
throughout an individual’s life. The fate of HSCs in the bone marrow is highly
regulated at the molecular level through complex sets of internal and external signals
that will be discussed below. The knowledge of these regulatory elements is essential
for the improvement of the current clinical use of HSCs for the treatment of patients
with haematological disordesr.
Human haemopoietic stem cells are extremely rare and difficult to identify. However,
several phenotypic and functional characteristics in vitro and in vivo have been used
to identify HSCs. Immunophenotypically, HSCs are characterized by the expression
of several antigens such as CD34, Thy-1 (CDw90), CD117 and the absence of co-
expression of HLA-DR or CD38 without expression of lineage specific antigens
(Lin). The more differentiated CD34+ haemopoietic progenitors are CD38+, Thy-1
negative, and might express one of lineage specific markers such as CD19 for B
lymphoid progenitors, CD7 for T lymphoid progenitors, CD33 for myeloid
progenitors, CD71 or glycophorin-A for erythroid precursors, and CD41 or CD61 for
megakaryocytic progenitors (Steidl et al. 2003). Interestingly, some reports have
described a small subpopulation of HSC that is CD34 - CD38- Lin- and there is
19
evidence that these cells can give rise to CD34+ HSCs (Zanjani et al. 1998, Bathia et
al. 1998).
Different approaches, using phenotypic and/or functional markers, have been
attempted to isolate HSCs. The classical HSC marker CD34 has been used routinely
to identify and isolate HSCs by flow cytometry. Recently, CD133 (the human
homologue of prominin 5-transmembrane glycoproteins) has been proposed to be a
prominent HSC marker. (Bonde et al. 2004). Purification strategies, which are based
on both, conserved stem cell function as well as on phenotype, have been suggested to
be more representative of stem cells than the classical phenotypic approach. For
example, the use of metabolic markers such as rhodamine and Hoechst 33342 dye
efflux, and the enzyme ALDH (Aldehyde dehydrogenase) yielded repopulating cells
of high stem cell activity in vivo (Bonde et al. 2004).
The 'gold standard' method of identifying HSCs is based on their capacity to
repopulate the entire haemopoietic system in lethally irradiated recipients following
transplantation. Three models have been used for this purpose which are the non-
obese diabetic-severe combined immunodeficient mouse model (NOD/SCID), the
beta2 microglobulin-deficient (B2m null) NOD/SCID (β2m null NOD/SCID) and the
sheep foetus model which, unlike the mouse models, does not require myeloablation
before transplantation (Bonnet et al. 2003; Kollet et al. 2000). Repopulating assays
using the mouse model have revealed that there appear to be two kinds of HSCs;
long-term (LT-HSC) and short- term (ST-HSC) repopulating stem cells. If bone
marrow cells from the transplanted mouse can, in turn, be transplanted to second
lethally irradiated mouse and restore its haemopoietic system over four months, they
are considered to be long-term stem cells that retain their self-renewal capacity. On
the other hand, short-term stem cells can immediately regenerate all the different
types of blood cells in the transplanted mouse, but lack the ability to renew
themselves if transplanted to another lethally irradiated recipient (Coulombel, 2004).
In mouse the LT-HSC self-renew for more than four months whereas the ST-HSC has
the ability to self-renew for six to eight weeks only. The ST-HSC then advance to the
multipotent progenitor (MPP) cells that can self-renew for less than two weeks
(Shizuru et al. 2005).
20
In the last few years, several reports have demonstrated the non-lineage restricted
potentials of HSCs and their capacity to transdifferentiate into a variety of non
haemopoietic cell types such as neural cells, hepatocytes, cardiomyocytes, and
endothelial cells, a process termed as plasticity. However, other studies have
challenged the concept of stem cell plasticity and suggest that cell fusion, rather than
transdifferentiation may explain the acquisition of non-lineage phenotypes and
functions (Steidl et al. 2003). Despite the debate in the scientific literature on the
molecular mechanisms responsible for these observations, the accumulating data
suggests that new therapeutic potentials of haemopoietic stem cells can be used in
areas such as heart and brain degenerative diseases.
21
Fig.1.1 The hierarchy of haemopoiesis.
Haemopoiesis can be described as hierarchical process with the rare HSCs at the top of the hierarchy giving rise first to committed progenitors and then to precursors with single lineage commitment and ending in terminally differentiated mature cells of various lineages. Haemopoiesis is dependent on long-term self renewing HSCs (LT-HSC) which gives rise to short-term self renewing HSCs (ST-HSC) which, in turn, differentiate to produce multipotent progenitor cells (MPP). MPPs differentiate into Common Lymphoid Progenitors (CLP) or Common Myeloid Progenitors (CMP). The CLP differentiate into cells of the lymphoid (T cells, B cells and natural killer (NK) cells whereas the CMP further subdivide into Megakaryocyte/Erythroid progenitor (MEP) and Granulocyte–Macrophage progenitor (GMP) which give rise to functional mature myeloid cells. Both the CMP and the CLP can be induced to differentiate to dendritic cells. (Modified from Larsson and Karlsson, 2005)
1.1.2 Regulation of haemopoiesis
The process of haemopoiesis involves complex interactions between the intrinsic
genetic processes of haemopoietic cells and the diverse extrinsic regulatory and
signalling molecules in their niche. These interactions determine whether HSCs,
progenitors, and differentiated cells remain quiescent, proliferate, differentiate, self-
renew, or undergo apoptosis (Fig. 1.2). In general, the intrinsic and extrinsic
regulatory mechanisms of haemopoiesis work together to maintain a balance between
all these cellular processes to fulfil the requirement of blood cell production in normal
steady states, as well as in the event of stress such as bleeding or infection. For
instance, under normal conditions, the majority of HSCs and many progenitors are
adherent to the niche and are not cycling, whereas many of the more mature blood
progenitors are proliferating to generate mature functioning blood cells. Apoptosis
balances the rate of proliferating progenitors in the absence of stress. However, during
stress or injury, the stored pools of cells in the BM are released to the site of injury.
Concurrently, diverse regulatory molecules in the niche signal the quiescent HSCs
and progenitors to proliferate and differentiate while decreasing the rate of apoptosis
(Smith, 2003). When the stress ceases, the kinetics of haemopoiesis return to base line
levels and the anti-apoptotic and proliferative processes wind down. A variety of
environmental and genetic regulatory mechanisms involved in haemopoiesis will be
discussed here.
Programmed cell death (apoptosis) is involved in the regulation of haemopoiesis at
different levels of haemopoietic cells development. At the HSCs level, apoptosis
regulates the size of the HSC pool by regulating HSCs production and elimination in
response to steady or stressful physiological demands (Kondo et al. 2003). HSCs
express primarily the anti-apoptotic protein BCLxL of the BCL2 family members that
protects HSCs from apoptosis and enhance their survival. Survival of HSCs and
22
haemopoietic precursors is mediated by the availability of certain haemopoietic
cytokines in the niche and deprivation from cytokines induces apoptosis. Cytokines
show target cell selectivity in preventing apoptosis. For example, stem cell factor
selectively promotes survival of primitive hematopoietic cells, IL-3 inhibit apoptosis
in more committed progenitors, whereas Flt ligand is selective for progenitors
committed to the myeloid lineage (Wickremasinghe and Hoffbrand, 1999). Other
cytokines such as IFN-γ and TNF-α modulate haemopoietic cells survival in the bone
marrow by inducing apoptosis via increasing expression of FAS on the surface of
haemopoietic progenitors (Maciejewski et al. 1995).
1.1.2.1 The stem cell niche
The stem cell microenvironment or niche is a term that describes the diverse
combination of differentiated cells which surround stem cells and secrete a rich extra-
cellular matrix and substrates that modulate stem cell self renewal and regulate stem
cell survival and functions (Calvi et al. 2003; Fuchs et al. 2004). The ability of stem
cells to reside within niches is an evolutionally conserved phenomenon, which has
been shown to be vital for stem cell survival and functions. For instance, studies on
Drosophila germ stem cells (GSC’s) have shown that direct physical interactions
between stem cells and their surrounding cells in the niche are crucial for maintaining
stem cell survival and self- renewal. In Drosophila ovaries, terminal filament and cap
cells line the basal lamina (BL) and constitute a niche for GSC’s where GSC’s are in
physical contact with cap cells. When female GSC’s divide, the daughter cells, which
are in contact with cap cells, remain as stem cells whereas cells that lose cap contact
lose their stemness and differentiate and initiate oogenesis (Fuchs et al. 2004).
In mice, adult haemopoietic stem cells (HSCs) reside in the bone marrow niche where
they traverse along the inner surface of the bone which is lined by osteoblasts. The
BM niche comprises osteoblasts, extracellular matrix (ECM), and marrow stromal
cells which are heterogeneous themselves comprising fibroblasts, reticular cells,
macrophages, adipocytes, and endothelial cells. The bone marrow niche is defined by
cell-cell interactions, cell-ECM interactions, and exposure to diverse soluble factors
including cytokines and various signalling molecules (Frisch et al. 2008).
23
1.1.2.1.1 Cell-ECM interactions
Extracellular matrix (ECM) is composed of three major classes of molecules:
structural proteins such as collagen and elastin, specialized proteins such as
fibronectin and laminin, and proteoglycans which consist of a protein core to which is
attached long chains of glycosaminoglycans (GAGs). The general effect of adhesion
of HSCs and progenitors to the marrow ECM is suppression of proliferation and
prevention of apoptosis (Arai and Suda, 2007).
Several adhesion molecules on the HSCs membrane such as integrins,
immunoglobulin-like molecules, cadherins, selectins, and mucins mediate adhesion of
HSCs to the basal lamina of extra cellular matrix. To be able to reside in their niche,
HSCs express high levels of the integrins α4β1 (also termed VLA-4) and α5β1,
which bind to fibronectin on ECM to promote adhesion to the bone marrow stroma.
Integrins binding to fibronectin inhibit differentiation and promote HSCs survival and
quiescence through the inhibition of cell cycle dependent kinases (CDKs) such as P27
(Cheng et al. 2000). Moreover, it has been shown that loss or alteration of integrin
expression leads to the departure of HSCs from their niche either through
differentiation or apoptosis (Nervi et al. 2006). Similarly, c-kit, which belongs to the
immunoglobulin super-family, has been found to be highly expressed in HSCs in
normal steady state and is down-regulated in mobilised cells (Kondo et al. 2003). C-
kit signalling is known to promote survival and proliferation through its binding to
stem cell factor and has been shown to be involved in the JAK2 signalling pathway
which triggers potent self-renewal effect on HSCs (Zhao et al. 2002).
Of particular interest, is the unique ability of a niche to retain its stem cells, a process
referred to as homing. This feature has been demonstrated in HSCs transplantation
studies in which the homing molecule VLA-4 was found to be vital for successful
engraftment (Craddock et al. 1997).
1.1.2.1.2 Soluble factors in the niche
In vitro studies have shown that various cytokines and growth factors in the bone
marrow niche are secreted by cells adjacent to HSCs which, depending on their
24
concentration or specific combination, support survival, or proliferation and
differentiation of haemopoietic progenitors and stem cells.
Cytokines
Cytokines are low-molecular- weight regulatory proteins or glycoproteins secreted by
stromal cells, white blood cells, and other cells in response to different stimuli.
(Goldsby et al. 2003). Once secreted, they bind to specific receptors on the membrane
of target cells and trigger signal transduction pathways, which ultimately cause gene
activation and alter gene expression in the target cells. The haemopoietic growth
factors (HGFs) represent a group of cytokines with well-defined effects on the
haemopoietic system. The main biological function of HGF, is to act as means for
short-range intercellular communication that influences self-renewal, survival,
proliferation, and differentiation of haemopoietic cells at different stages of
haemopoietic maturation (Fetscher & Mertelsmann, 2002). Growth factors that are
secreted by stromal cells have been shown to enhance the proliferation of early
haematopoietic stem and progenitor cells are FLT3, SCF, erythropoietin, IL6 and
thrombopoietin (TPO) (Krause, 2002).
Chemokines
These are molecules in the bone marrow niche that regulate blood cell trafficking and
homing. β1-Integrins such as VLA-4 and VLA-5, which are expressed on CD34+ cells,
play a dominant role in adhesive interactions to mechanically tie HSCs in the niche.
Moreover, β1-Integrins regulate HSCs proliferation and survival through different
mechanisms, such as the inhibition of cell cycle dependent kinases (CDK’s) such as
P27 and the activation of the RAS/ MAPK signal transduction pathway, which result
in an increased expression of c-myc which is known to shorten the G1 phase of the
cell cycle (Steidl et al. 2003). The β2-integrin LFA-1 plays a similar role in adhesion
and trafficking of CD34+ haemopoietic cells and progenitor cells. L-selectins mediate
the initial contact of leukocytes with endothelium and might also be involved also in
homing of HSCs (Krause, 2002). The adhesion molecule CD44, which binds to
hyaluronic acid and fibronectin, has been shown to be highly expressed in CD34+
cells in the bone marrow in steady state conditions as compared to CD34+ cells in
peripheral blood (Lataillade et al. 2005). This finding supports the notion of the
importance of CD44 in haemopoiesis and stem cell trafficking. Indeed, CD44
25
monoclonal antibodies against CD44 inhibit adhesion to bone marrow stroma and
stopp haemopoiesis in murine long-term bone marrow cultures (Christ et al. 2001).
An important interaction between haemopoietic cells and their niche is mediated by
the α-chemokine stromal-derived factor 1 (SDF-1) and its receptor CXCR-4. SDF-1,
produced by bone marrow stromal cells, binds to CXCR-4 receptor on CD34+ cells
and plays a critical role in HSCS and haemopoietic cells migration. As haemopoietic
cells in the bone marrow differentiate, they express low levels of the CXCR-4
receptor in preparation to leave the bone marrow niche (Steidl et al. 2003). Recently,
it has been reported that CD44 and its hyaluronic acid ligand cooperated with SDF-1
in the trafficking of CD34+ cell to the BM, demonstrating a cross-talk between CD44
and CXCR4 (Avigdor et al. 2004).
Another key family of the growth factors in the HSCs niche is the transforming
growth factor β (TGF β) family, which is known to play a role in maintaining HSC in
a quiescent stem cell state. It has been shown that osteoblasts receive the TGF β signal
and respond by increasing their numbers and thus, indirectly promote HSCs stemness
by causing more stem cells to adhere to osteoblasts (Zhang et al. 2003). This indirect
mode of action of TGF β on mammalian HSCs is in contrast to the direct mode of this
niche factor on the GSC’s in Drosophila where DPP (member of the TGF β family) is
secreted by cap cells and bind directly to receptors on GSC’s to support their self -
renewal by suppressing the differentiation factor BAM (Fuchs et al. 2004).
Wnt proteins represent a growing family of secreted signalling
molecules in the bone marrow niche that have been shown to be
critical for HSCs self renewal and proliferation (Ryea et al, 2003).
Wnt proteins bind to FZ-family receptors on HSCs and trigger the Wnt-catenin
signalling pathway which, ultimately leads to accumulation of -catenin in the
cytoplasm before it translocates to the nucleus and facilitate transcription of target
genes. Purified mouse HSCs that have been transduced with the active form of -
catenin showed high proliferation and maintained the immature phenotype of HSCs
in long-term cultures (Staal and Clevers, 2005).
26
The Hedgehog (Hh) pathway is another cascade that plays a crucial role in HSC
proliferation. Sonic hedgehog (Shh) is one of three trans-membrane proteins that
comprise the Hh family in humans and that mediates signalling through cell-to-cell
contact between adjacent cells expressing the Patched receptor (Ptch). Alternatively,
Hh ligands can be found as soluble molecules in the niche, where they can stimulate
cells in the niche that express the Ptc receptor .Shh, Ptc, and Smo (Smoothened,
another Hh receptor) are expressed in primitive human CD34+ CD38- Lin- cells as well
as in stromal cells which imply that both HSCs and marrow stromal cells can
transduce the Hh signals (Bhardwaj et al. 2001; Szilvassy, 2003). It has been
shown that the interaction between HSCs and Hh ligands is critical for HSCs survival
and expansion ex vivo. This effect is mediated via regulation of the bone morphogenic
protein (BMP)/ TGFβ superfamily (Kondo et al. 2003).
1.1.2.1.3. Cell-cell interactions
HSCs communicate with osteoblasts, stromal cells, committed haemopoietic
progenitor cells and other HSCs via receptor/ligand interactions in their niche. It has
been demonstrated that physical contact between HSCs and osteoblasts is critical for
stem cells to retain their unique properties of self-renewal and quiescence. When mice
are genetically altered to increase osteoblast numbers, the numbers of HSCs increased
significantly and their ability to remain quiescent without further differentiation was
dependent on their ability to adhere physically to the osteoblasts through N-cadherin-
mediated adhesion junctions (Zhang et al. 2003). The molecular glue that anchor stem
cells to osteoblasts in the BM niche is known as adherens junctions, which are formed
by two important molecules, cadherin and catenins (Fuchs et al. 2004).
The contribution of osteoblasts to HSCs niche in mammals was elegantly studied by
Calvi et al (2003). They found that in mice genetically altered to produce activated
PTH/PTHrP receptors (PPR) specifically on osteoblasts, PPR signalling resulted in
increase of osteoblast numbers and over expression of the Notch ligand Jagged 1 and
subsequent promotion of HSCs self renewal through Notch activation (Calvi et al.
2003). In line with this, Visnjic and others employed a genetic strategy, to selectively,
and reversibly, eliminate osteoblasts from bone and found that osteoblast ablation led
to dramatic loss of bone marrow cellularity and a reduced number of early
haemopoietic progenitors (Visnjic et al. 2004). Another important cell-cell interaction
27
in the bone marrow niche is the interaction between Notch receptors on HSCs and
Notch ligands expressed by stromal cells. Notch signalling is known to be critical for
HSCs self- renewal and survival and will be discussed later in detail.
If HSCs receive the appropriate signal to differentiate in a steady state, or in response
to stressful demands, they lose contact with neighbouring osteoblasts and cell matrix
and differentiate to specific cell lineages, before they head towards the central bone
marrow cavity and traverse into the circulation.
1.1.2.2 Genetic control of haemopoiesis
The sequential differentiation decisions in haemopoiesis from HSCs to intermediate
progenitors and fully differentiated cells are highly regulated within the cell. Using
knock-out animal models and gene expression profiling, it has been found that distinct
expression patterns of genes and transcription factors are needed in different
developmental stage of haemopoiesis. For instance, Steidl et al. (2003) have found a
higher expression of genes for cell cycle progression in BM-CD34+cells as compared
to PB-CD34+ cells. In the same study, they have identified the genes responsible for
the transition from quiescence to active cycling CD34+. Furukawa and co-workers
have studied the expression patterns of cell cycle genes in different differentiation
stages in haemopoiesis. They have demonstrated a universal up-regulation of cdc2,
cdk4, cyclin A, cyclin B, and p21, and down-regulation of p16 during differentiation
of haemopoietic cells (Furukawa et al. 2000).
In addition, there are gene expression patterns that are specific for certain
haemopoietic lineages, which mean that cell cycle control genes are modulated during
haemopoiesis to control the differentiation and proliferation of haemopoietic cells.
Transcription factors also play a vital role in the differentiation of HSCs and
progenitor cells. Bmi-1, which is a member of the polycomb group (PcG) family of
genes, has been shown to be highly expressed in HSCs and declines during
haemopoietic development. Competitive repopulation studies have demonstrated that
Bmi-1 is crucial for HSCs self-renewal (Stein et al. 2004). The homebox (Hox) genes
exhibit distinct pattern of expression during haemopoietic differentiation (Stein et al.
28
2004). HoxB4, for example, is abundantly expressed in immature haemopoietic cells
including HSCs, but declines with lineage differentiation, which underlines a possible
central role of this transcription factor in early haemopoiesis. Another member of the
Hox transcription factor family, HoxA10, is critical for the regulation of myeloid
differentiation. Similarly, PU1 and GATA-1 transcription factors have been shown to
initiate myeloid differentiation (Steidl et al. 2003). Similarly, the Pax5 transcription
factor has been shown to be vital for the development of B cell progenitors (Nutt et al.
2001). Other transcription factors have also been found to be indispensable for other
haemopoietic lineages proliferation and differentiation. These findings support the
notion that distinct expression patterns of transcription factors steer the balance
between self-renewal and commitment to differentiation of haemopoietic stem cells.
Two models have been proposed for the genetic dictation of haemopoietic cells fate
decisions during haemopoiesis. The stochastic model argues that the developmental
fate of haemopoietic cells is predetermined by intrinsic genetic processes to occur in
certain sequence and timing and the external environmental signals then act to
modulate these genetic effects (Smith, 2003). The instructional model, however,
suggests that the external environmental signals may play a primary role in directing
cells toward various developmental fates by inducing the appropriate genetic change.
29
30
Extrinsic control by the niche
Genetic control
Fig. 1.2 Regulation of haemopoiesis. Extrinsic and intrinsic (genetic) mechanisms control HSC quiescence, self-renewal and differentiation. Extrinsic mechanisms involve the interaction between HSC and the microenvironment. Physical association between HSC and osteoblasts or other cells in the niche trigger diverse signal transduction pathways that initiate expression of downstream target genes. Intrinsic (genetic) mechanisms can also dictate the haemopoietic cells fate decisions during haemopoiesis. (Modified from Rizo et al. 2006)
1.2 Notch signalling pathway
Notch signalling is an evolutionary conserved mechanism that controls cell fate
decisions in various sites in the body, in both vertebrates and invertebrates (Ohishi et
al. 2003). Notch signalling involves binding between a Notch receptor on one cell and
a ligand on the neighbouring cell, which triggers the cleavage of the intra-cellular
domain of Notch from its membrane-bound tether and a subsequent translocation to
the nucleus, where it activates transcription of the CSL family of transcription factors
(CBF1 or RBP-Jκ in vertebrates, Su(H)) in drosophila, or LAG-1 in Caenorhabditis
elegans). This activation leads to increased transcription of certain target genes, such
as the Hairy and Enhancer of Split (HES)-1 gene (Mumm and Kopan, 2000).
The phenotype of the Notch gene of Drosophila was discovered by Morgan in 1916
in a mutant fly with ‘notches’ in its wings, and the gene was found to be required for
the wing outgrowth (Simpson, 1998; and Lai, 2004). However, it was not until 1983
that the Drosophila Notch gene was cloned (Kidd et al. 1983; Artavanis-Tsakonas et
al. 1983). Notch has since been found to be a key player in a wide range of
developmental processes throughout different organisms, ranging from the fruit fly to
the human. Some 13 years after the cloning of Drosophila’s Notch gene, four
mammalian Notch genes were cloned, known as Notch 1-4. Notch 1 was the first
Notch protein to be identified in Human and was initially named TAN-1 – for
Translocation-Associated Notch homologue-1 – (Das et al. 2004). It was cloned as a
gene involved in the t(7;9)(q34;q34.3) chromosomal translocation found in a subset of
human T-cell leukaemia (Gridley, 2004).
1.2.1 Notch receptors
Mammalian Notch genes encode four Notch receptors, Notch 1-4. These are large
(300 KDa) single pass trans-membrane proteins that are cleaved within the trans-
Golgi network during biosynthesis by a Furin-like convertase. This cleavage occurs at
31
the site known as S1 and yields a heterodimer cell surface receptor (Maillard et al.
2003; Baron, 2003).
Notch receptors consist of two domains, which remain non-covalently bound together
by a calcium-dependent interaction. The extra-cellular domain (ECN) consists of 29-
36 tandem epidermal growth factor (EGF-like) repeats that bind Notch ligands, and
three Lin 12/ Notch repeats which are crucial for maintaining Notch in a resting
conformation before ligand binding (Nam et al. 2002). The The Notch transmembrane
domain (NTM) consists of a transmembrane region and the intracellular Notch
domain (ICN). The intracellular Notch domain (ICN) contains a RAM domain, a cdc
10/ ankyrin-like repeats flanked by two nuclear localisation signal sequences (NLS),
and a c-terminal proline-glutamate-serine-threonine-rich (PEST) domain, which is
important for regulating protein stability (Fig.1.3). In the Drosophila Notch and
human Notch 1 and 2, the ICN also has a transcription activation domain (TAD),
which is absent in Notch 3-4. Moreover, the ICN has a Notch cytokine response
domain (NCR), which may be involved in cytokine signalling. Notch 4 has a shorter
intracellular domain that lacks one of the NLS and the whole NCR domain The RAM
domain and ANK repeats are binding sites for the downstream transcription factor
CBF-1/RBPJ, which is the human homologue of Drosophila Su(H) (Ohishi et al.
2003). Although the RAM domain is the primary binding site for the transcription
factor CBF-1/RBPJ, the ANK repeats facilitate this binding, and more importantly,
they are the binding sites of many important proteins that modulate Notch signalling,
such as Deltex and Mastermind (Kojika and Griffin, 2001; Fleming, 1998).
1.2.2 Notch ligands
Two Notch ligands (Delata and Serrate) have been identified in Drosophila and five
ligands have been identified in mammals (Jagged1, Jagged2, Delta-like1, Delta-like3,
and Delta-like4) (Maillard et al. 2003). Notch ligands are trans-membrane proteins,
which are composed of an extra-cellular domain, transmembrane domain and a
relatively short cytoplasmic tail (Fig 1.4). The extra-cellular domain consists of N-
terminal domain (NT) of 100-165 amino acids and a unique amino-terminal DSL
domain (named for Delta, Serrate from Drosophila, and Lag-2 from C. elegans). Both
the NT domain and the DSL domain constitute the EGF-motif binding domain (EBD),
which has been found to be indispensable for proper interaction with Notch
32
expressing cells (Fleming, 1998). It is also the EBD region of the ligand protein that
regulates ligand recognition and specificity by modulators such as a fringe gene
product. Next to the EBD domain and before the transmembrane domain (TM) lie the
EGF-like repeats (EGFR) and an additional cysteine-rich region, which is found only
in Serrate and Jagged related groups. Although it has been shown that the EGFR
domain is not essential for Notch signalling, missense mutation studies suggest that it
may be important for stabilising ligand / receptor interaction (Tax et al. 1994;
Fleming, 1998). The function of the cysteine-rich region is not clear, but it may be
important in ligand specificity since this domain is not found in delta-like ligands.
Moreover, it has been demonstrated that the TM domain and the cytoplasmic portion
of Notch ligands are crucial for Notch activation (Fleming, 1998). In Drosophila, it
has been found that endocytosis of ligands after binding Notch receptor is essential
for the activation of Notch signalling (Kojika and Griffin, 2001).
33
Fig.1.3 Structure of human Notch receptor. The extracellular Notch protien
(ECN) is composed of epidermal growth factor like repeates (EGFR), Lin12 Notch
repeats (LNR) and the heterodimerization (HD) domain while the intracellular
Notch protien (ICN) is composed of a RAM domain, a series of cdc10/ Ankyrin
repeats (ANK) flanked by two nuclear localization signal sequences (NLS) (not
shown here), a Notch cytokine response domain (NCR) which is absent in Notch
4, a transcriptional activation domain (TAD) which is absent in Notch 3 and 4, and
a c-terminal PEST region (P). The Notch transmembrane domain (NTM) consists
of a transmembrane region and ICN. The sites of the proteolytic cleavages S1,S2,
and S3 are indicated.
HD HD RAM ANK NCR TAD PEST
Notch transmembrane domain (NTM)Notch extracellular domain
S1 S2 S3
Proteolytic sites
ICN
LNREGF like repeats
TM
34
Fig. 1.4 Structure of Notch ligands. Notch ligands are composed of an
extracellular domain, transmembrane domain (TM) and a relatively short
cytoplasmic tail. The extracellular domain consists of N-terminal domain (NT) and a
unique amino-terminal DSL domain. Both, the NT domain and the DSL domain
constitute the EGF-motif binding domain (EBD), which has been found to be
indispensable for proper interaction with Notch receptors and modulators. Next to
the EBD domain and before the transmembrane domain (TM) lie the EGF-like
repeats (EGFR). An additional cysteine-rich region, which is found only in the
Serrate and Jagged ligand family (Modified from Guidos, 2002).
Cys- rich EGF-like repeatsDSL
EGF-like repeatsDSL
Delta
Jagged/ Serrate
NT
NT
TM
Intracellular region Extracellular region
EBD
1.2.3 Molecular mechanisms of Notch signalling
Physical interaction between specific EGF repeats in the DSL domain of a ligand and
the EGF repeats of the ECN receptor protein triggers two successive cleavages,
resulting in the release of ICN and its subsequent translocation into the nucleus. The
first cleavage, mediated by an ADAM metaloprotease (TACE in vertebrates, and
possibly Kuzbanian/SUP-17 in invertebrates), occurs external to the transmembrane
domain (S2 cleavage site), and releases the majority of the extra-cellular Notch
domain. The second cleavage occurs within the trans-membrane domain (S3 site)
(Fig. 1.3) and is mediated by-secretase, a multi-protein complex with secretase
activity whose components include presenilin, nicastrin, Aph1 and Pen2 (Fortini,
2002, Baron, 2003; Lai, 2004). This cleavage releases soluble ICN into the cytoplasm,
which then translocates to the nucleus..
Once in the nucleus, the ICN binds directly through its RAM and ANK domains to
the CSL transcription factor (CBF1 in vertebrates, Su(H)) in drosophila, or LAG-1 in
Caenorhabditis elegans), and converts it from a transcriptional repressor into a
transcriptional activator (Fig. 1.5). It has been shown that the binding of ICN to CSL
displaces co-repressor complexes from CSL (such as histone deacetylase (HDAC))
and recruits, through ANK and TAD domains of ICN, different transcriptional co-
activators such as mastermind in Drosophila (MAML1 in mammals) to convert
CSL into transcriptional activator. In this way transcription of Notch downstream
target genes (e.g. HES) which eventually control specific developmental decisions in
different cellular contexts (Mumm and Kopan, 2000; Lai, 2004; and Wu et al. 2002).
The most widely characterised mammalian Notch target gene is Hes1, although Hes5
is also known to be involved in Notch signalling (Kojika and Griffin, 2001).
The HES genes in mammals encode basic-helix-loop-helix (bHLH) transcription
factors, in which the basic domain is needed for DNA binding and the HLH domain
mediates interactions with other bHLH proteins. Once activated by Notch, CSL binds
the regulatory sequences of the HES gene in the nucleus (GTGGGAA), and up-
regulates expression of its encoded bHLH proteins (Artavanis-Tsakonas et al. 1999).
bHLH transcription factors contain peculiar WRPW sequences at the carboxyl
35
terminus, which recruit transcriptional repressors such as Groucho in Drosophila or
its mammalian homologue TLE. The overall effect is the repression of the
transcription of downstream target genes, necessary for cell fate decisions in
processes such as myogenesis, somitogenesis, sex determination, vasculogenesis,
lymphocytes development and neurogenesis (Davis and Turner, 2001, Iso et al. 2003).
Examples of bHLH transcription factors include MASH1 (HASH1 in human), which
is important in neurogenesis. Over-expressed HES1 can repress MASH1
transcription, and thus act as a negative regulator of neurogensis,
by directly repressing a pro-neural gene, MASH1. Similarly, HES1
acts as the effector of Notch signalling to repress myoD
transcription in myoblasts, and thereby restrict muscle formation
(Davis and Turner, 2001). CD4 is another candidate target gene for
HES1, where over-expression of HES1 leads to the down-regulation
of the endogenous CD4 expression in CD4+ CD8- TH cells (Kim and
Siu, 1998). The HES family is not the only known effector of Notch in mammals as
a new bHLH family has been isolated and named as HERP (reviewed in Iso et al.
2003) and a wide range of additional Notch target genes such as C-myc, cycline D1,
and deltex have been recently identified (Aster et al. 2008).
Despite the linear picture of the Notch signalling pathway described above, several
lines of evidence support the existence of CSL-independent Notch signalling
pathways in Drosophila and vertebrates (reviewed by Martinez Arias et al. 2002).
However, the exact mechanisms of these alternative pathways await further
explanation.
36
37
S3
S2
S1
Sending cell
Receiving cell
Nucleus
GSI
Fig. 1.5 The CSL-dependent Notch signalling pathway. Notch receptor is present on the cell surface as heterodimer. Upon binding with a ligand on adjacent cell, two proteolytic cleavages at sites (S2) and (S3) occur which liberate the intra cellular domain of Notch (ICN) in the cytoplasm. ICN translocates to the nucleus and binds to the transcription factor CSL, which displaces co-repressors (CoR) and recruits co-activators (CoA) including MAML, leading to transcriptional activation of downstream target genes including Hes1,Deltex, and C-Myc. (Modified from Aster et al. 2008)
1.2.4 Modulators of Notch signalling
Notch signalling is finely regulated through several modulators that act at the extra-
cellular, cytoplasmic or nuclear levels. The EGF repeats on the extra-cellular domain
of Notch receptor undergo O-fucosylation and O-glucosylation which modulate
various activities of Notch such as Notch-ligand interaction and intracellular
trafficking of Notch (Acar et al. 2008). Examples of the extra-cellular modulators of
Notch signalling which influence receptor-ligand interaction may include fringe and
Ofut1. Fringe is a glycosyltransferase protein that controls the specificity of Notch-
ligand binding. In Drosophila, fringe physically interacts with the extra-cellular
domain of Notch and modifies O-linked fucose on specific Notch EGF-repeats;
including EGF repeat 12 (EGF12), to restrict Notch activation to the delta ligand
(Panin and Irvine, 1998; Schweisguth, 2004). Three vertebrate homologues of fringe
have been identified, (L fringe, M fringe, and R fringe – that control the specificity of
receptor-ligand binding in different cellular contexts (Kojika and Griffin, 2001). The
O-fucosylation of Notch is catalysed by a GDP-fucose protein O-fucosyltransferase
encoded by the Ofut1 gene. The regulation of the Ofut1 gene expression is vital for
normal Notch signalling, as over-expression of Ofut1 or loss of its function disturbs
ligand-Notch interaction and blocks Notch signalling (Schweisguth, 2004).
Interestingly, it has also been shown that ubiquitination of Delta ligand in Drosophila
up-regulates Delta signalling activity and promotes Notch activity through as yet
unrevealed mechanisms (Schweisguth, 2004). Recently, Acar et al (2008) isolated a
gene named rumi in Drosophila which encodes the O-glucosyltransferase protein
Rumi. The authors showed that Rumi is essential for Notch-ligand binding and
proposed that lack of O-glucosylation of Notch in rumi mutants results in a defect in
Notch folding and signalling.
Several cytoplasmic modulators of Notch signalling have been described. Numb
negatively regulates Notch, probably through a direct protein-to-protein interaction
that requires the phosphotyrosine-binding (PTB) domain of Numb and the RAM
38
domain of Notch. Numb is a unique protein, which is known to be asymmetrically
segregated to only one of the two daughter cells in sensory organ development. A cell
acquiring the Numb protein adopts a fate different to its sister cell. Therefore, Notch
continues to function positively in the daughter cell that does not inherit Numb. It has
been demonstrated that Numb may influence cell fate by negatively regulating the
Notch signalling pathway (Guo et al. 1996). Numb inhibits Notch signalling by
preventing the intra-cellular domain of Notch from translocating to the nucleus.
Recently, it was shown that this was achieved in mammals through promoting the
ubiquitination of Notch1, leading to the degradation of the intracellular domain
following receptor activation (McGill and McGlade, 2003).
Another Notch regulator is Deltex. Deltex was originally identified in Drosophila as
cytoplasmic positive regulator of Notch signalling, through direct interaction with the
ANK repeats of ICN (Mastuno et al. 1995). However, recent investigation of Deltex
action in mammalian cells suggests that enforced expression of Deltex inhibits Notch
signalling, probably through its competition with ICN for transcriptional co-activators
(Izon et al. 2002). Moreover, it has been found that a significant fraction of DTX1 (a
mammalian homologue of Drosophila Deltex) interact physically in the nucleus with
the transcriptional co-activator p300, leading to transcription repression of the
MASH1 target gene, and the subsequent inhibition of neuronal differentiation
(Yamatomao et al. 2001). This finding suggests a possible Notch-independent role of
Deltex in transcription regulation. Collectively, it seems that the role of Deltex on
Notch signalling is cell context dependent.
Additional nuclear modulators of Notch have been identified in Drosophila include
SEL-10 and Suppressor of Deltex (SU(Dx) ), both of which are inhibitors of Notch
signalling. Suppressor of Deltex is an E3 ubiquitin ligase, that binds to target proteins
and adds ubiquitin. It has been suggested that SU(Dx) may interact with ICN and
induce ubiquitation, and thus lead to its degradation (Kojika and Griffen, 2001).
39
1.2.5 Notch signalling in haemopoiesis
Notch receptors (N1-4) have been identified in haemopoietic progenitors. Notch-1 has
been shown to be expressed in a wide range of haemopoietic cells at different levels
of maturation including CD34+ lin- precursors and CD34+lin+ precursors, as well as
lymphoid, myeloid, and erythroid precursors. Notch1 hase been also detected in
peripheral blood T and B lymphocytes, monocytes and neutrophils (Milner and Bigas,
1999). The expression patterns of Notch-1 and 2 in different haemopoietic lineages
are distinct, ranging from low levels in CD34+ precursors to high levels in monocytes
(Ohishi et al. 2000; Walker et al. 2001; Singh et al. 2000, and Jonsson et al. 2001).
Moreover, the expression patterns of Notch 1-4 genes in various maturation stages of
T and B lymphocyte development have been studied recently (detailed in Saito et al.
2003).
Notch ligands have also been found in haemopoietic tissue including foetal liver, BM
and thymus, and in populations of haemopoietic cells. Jagged-1, Delta-1 and Delta -4
have been detected in bone marrow stromal cells, whereas Jagged-1 is expressed in
haematopoietic cells such as macrophages, megakaryocytes and mast cells (Ohishi et
al. 2003). These findings, and the evolutionally conserved role of Notch signalling in
cell fate decisions, suggest a role of Notch signalling in haemopoiesis.
1.2.5.1. Notch and haemopoietic stem cell (HSC) fate
decisions
Several lines of evidence have shown that Notch signalling is at the centre of
regulating stem cell fate choices, in terms of self-renewal and/or differentiation. In a
recent study, inhibition of Notch signalling in mice caused accelerated differentiation
of HSCs in vitro and depletion of HSCs in vivo. Interestingly, Notch signalling
activity has been demonstrated to be high in HSC and progenitor cells in the bone
marrow niche (Duncan et al. 2005). In line with this finding, it has been shown that
constitutive Notch-1 signalling in haemopoietic stem cells and progenitors allows the
establishment of immortalised cell lines, which retain the capacity to generate either
40
lymphoid or myeloid cells both in vitro and in vivo (Varnum-Finney et al. 2000).
Similar findings have been demonstrated in RAG-1 deficient mouse stem cells, where
over-expression of Notch-1 promoted stem cell self-renewal over differentiation (Stier
et al. 2002). Similarly, constitutively active Notch-4 promotes HSCs self-renewal,
while inhibiting differentiation and altering lymphoid development (Vercauteren and
Sutherland, 2004; Ye et al. 2004).
Studies on Notch ligands have supported the notion of the crucial role of Notch
signalling in influencing HSCs fate decisions and suggested the potential use of Notch
ligands for ex vivo expansion of HSCs. When cultured with human Jagged-1, human
HSCs showed increased survival and expansion potential in vivo (Karanu et al. 2000).
A similar effect was reported when mouse Jagged-2 promoted the survival of murine
primitive haematopoietic precursors without exogenous cytokines (Tsai et al. 2000).
Moreover, the soluble form of human Delta-like-1 suppressed the acquisition of
differentiation markers by murine haemopoietic progenitor cells (Lin ) cultured in
vitro with cytokines, and promoted the self-renewal of the primitive haemopoietic
precursor cells (Han et al. 2000). Taken together, studies on Notch receptors and
ligands show that Notch signalling is critical for HSCs self-renewal and survival.
The exact mechanisms and pathways by which Notch regulates the developmental
fates of HSCs are still a mystery. However, such effects are most likely to be
mediated through cross-talk between Notch and various complex signalling pathways,
cell cycle modulators and secreted factors in the bone marrow niche. It has been
proposed that cytokines may play an important role in the effects of Notch on HSCs
(Kojika and Griffin, 2001). Cytokines may modify the Notch- induced self-renewal of
HSCs through their interaction with a specific region on Notch 1-3, termed the Notch
Cytokine Response region (NCR) (Bigas et al. 1998). Different modulators of Notch
may also modify the action of Notch on HSCs fate decisions, in response to various
physiological demands.
Interestingly, it has been shown that Wnt signalling contributes to the differential
expression of known Notch targets in HSCs, and that Wnt and Notch may work
together to promote self-renewal of HSCs (Duncan et al. 2005). One critical target
molecule of the Notch-1-induced self-renewal of HSCs is the transcription factor c-
41
myc. It has been demonstrated that the expression of c-myc is enhanced during Notch-
1-induced self-renewal of murine HSCs, and that Notch-1 activates the c-myc
promoter directly (Satoh et al. 2004). It is apperant, therefore, that Notch-1
inhibits differentiation and promotes self-renewal of HSCs by up-regulating c-myc,
which is known to shorten the G1 phase of cell cycle and induce G1/S transition
(Stein et al, 2004).
1.2.5.2. Notch signalling in myeloid development
The effect of Notch on the differentiation and proliferation of myeloid cells is still
controversial. Various in vitro studies using cell lines support the notion that Notch
may inhibit the differentiation of immature myeloid progenitors. For instance, the
constitutively activated ICN of mouse Notch-1 inhibited granulocytic differentiation
of the myeloid progenitor cell line 32D (Milner et al. 1996). In another study by the
same group, the inhibitory effect of Notch-1 and -2 on differentiation of myeloid cells
has been shown to be cytokines dependent and that this is controlled through the NCR
region of Notch. Notch-1 has been demonstrated to inhibit granulocytic differentiation
of 32D myeloid progenitor cells in response to G-CSF, and Notch-2 in response to
GM-CSF (Bigas et al. 1998). Interestingly, the expression of constitutively active
Notch-4 also inhibited differentiation of human myeloid leukaemia (HL-60) cells, and
caused their accumulation in the G0/G1 phases of the cell cycle (Ye et al. 2004).
Moreover, in vitro co-culture experiments have shown that the soluble forms of
human Notch ligands Jagged-1 and Delta-1 inhibit the differentiation of myeloid
progenitors in 32D cells and in mice (Li et al. 1998; Han et al. 2000).
Contradictory to the notion that Notch signalling inhibits myeloid differentiation, in
vitro and in vivo studies suggest that Notch promotes rather than inhibits, myeloid
differentiation. For example, it has been shown that the induction of murine Notch-1
activity in 32D myeloid progenitor cells promotes differentiation (Schroeder and Just,
2000). Schroeder and Just argued that the discrepancy between their results, and
those of Milner, was due to the lack of a RAM domain in the construct used by the
latter. Tohda et al also found that the immobilised Notch ligand, Delta-1, induced the
differentiation of AML cells in two AML cell lines (Tohda et al. 2003). Furthermore,
42
activation of Notch-1 in the FDCP-mix myeloid cell line resulted in the generation of
differentiated myeloid cells with loss of self-renewal capacity (Schroeder et al. 2003).
The latter study demonstrated the role of the PU.1.transcription factor as a target gene
for Notch in its regulatory effect on myeloid cells.
Theses in vivo studies lend further support to the concept that Notch signalling in
myeloid differentiation is of promoting rather than inhibitory nature. Myeloid
differentiation was not shown to be repressed in transduced haemopoietic progenitors
that express activated Notch (Ohishi et al. 2003).
Several issues should be addressed in order to critically analyse the conflicting
outcomes of the in vitro studies of Notch signalling in myeloid development. Firstly,
variations in the ICN constructs used in different studies may lead to different
outcomes, such as those observed in studies that used 32D cells. Secondly, the
inherent differences in Notch receptors and ligand expression and function in isolated
cells, or in cell lines used, may have a major impact on the different outcomes of the
above studies. Thirdly, soluble ligands of Notch, which were used in studies that
suggested an inhibition of differentiation in myeloid cells, may not accurately
represent actually the functioning membrane-bound ligands presented by stromal
cells. In fact, these forms may act as dominant negative forms as shown in Drosophila
(Sun and Artavanis-Tsakonas, 1997).
In addition, manipulation of Notch expression, in terms of whether a constitutive or
inducible expression is attempted, may influence the differentiation capacity of
myeloid cells. It has been shown that some retroviral transfection attempts of
producing constitutively activated Notch yielded clones or mutants that lacked
differentiation instructive potential (Schroeder et al. 2003). It has been argued that it
is likely that such mutants may have been used in some studies that suggest a Notch-
induced block of myeloid differentiation. Finally, the nature of the outcomes of Notch
signalling in myeloid development may depend on the cellular context, such as
presence or absence of cytokines and other signalling molecules in the bone marrow
niche, and therefore it is possible that Notch mediates different cellular outcomes in
different cellular contexts.
43
Notch signalling has been investigated in monocytes and it has been found that
immobilised Delta-1 induced apoptosis in monocytes in response to M-CSF, and
inhibited monocytes from differentiation into macrophages in response to GM-CSF
(Ohishi et al. 2003). In the same study, Delta-1 promoted the differentiation of
monocytes into dendritic cells in response to GM-CSF and IL-4. Notch signalling has
also been found to regulate myeloid differentiation along erythroid and
megakaryocytic lineages. It has been reported that Notch-1 inhibits the
differentiation of erythroid/megakaryocytic cells by inhibiting GATA-1 activity in the
erythroid/megakaryocytic cell line K562 (Ishiko et al. 2005). However, only erythroid
differentiation has been shown to be inhibited in K562 cells by activated Notch (Lam
et al. 2004). Further studies with careful experimental designs, which take into
consideration all of the possible sources of discrepancies mentioned above, are needed
in order to reach a final model for the role of Notch in myeloid cell development.
1.2.5.3 Notch signalling in lymphoid cell development
Lymphoid development is a highly regulated process in which functional lymphocytes
are produced from common lymphoid progenitors (CLP). Development of functional
mature lymphocytes from CLP is a finely regulated, stepwise process, that depends on
the expression of different transcription factors. Studies in loss and gain of function,
suggest that Notch signalling is indispensable for developmental decisions of
lymphoid cells at different stages of maturation (Fig. 1.6.).
Radtke et al provided the first evidence that Notch signalling regulates B Vs T lineage
specification (Radtke et al. 1999). Radtke et al used transgenic mice expressing a
conditional Notch1 knockout allele to demonstrate that loss of Notch-1 caused a block
in T-cell development, and promoted B-cell development that derive from thymic
precursors. The block in T cell development has been found to occur at or before the
earliest intrathymic precursor stage (defined as lineage negative
CD44+CD25−CD117+) (Wilson et al. 2001).
Gain of function studies lent further support to these findings, in which enforced
expression of constitutively active Notch1, (ICN1) in murine HSC, led to ectopic T
44
cell development in the bone marrow that was thymus independent, while inhibiting
B-cell development at the earliest stages (Pui et al. 1999). Collectively, these studies
suggest that at the level of CLPs, Notch-1 signalling has to be kept inactive in the BM
compartment to allow B cell development, and to inhibit ectopic thymic-independent
T cell development. At the same time Notch1signalling is necessary and sufficient for
T cell fate specification once a CLP enters the thymus (Pear et al. 2003).
Since Notch receptors and ligands are expressed in normal bone marrow, certain
regulatory mechanisms must exist to modulate Notch signalling and allow normal B
cell development in the bone marrow (Radtke et al. 2004). For instance, it has been
shown that the B lineage commitment factor, Pax5, inhibits transcription of Notch1,
providing a possible mechanism that allows B cell development in the BM, despite
expression of Notch-1. Other possible mechanisms that antagonise Notch signalling
and allow B cell development in the bone marrow may include Notch inhibitory
modulators such as Fringe (Koch et al. 2001) and Deltex1 (Izon et al. 2002), as
demonstrated by enforced expression studies.
The Notch signalling effects on T cell development have been shown to be mediated
by the CSL transcription factor since an inducible deletion of CSL produced a
phenotype which is similar to that shown in Notch-1 conditional knockout mice (Han
et al. 2002). However, the molecular mechanisms by which Notch influences
lymphoid commitment remain largely unknown. One possible mechanism is that
Notch blocks B cell commitment through the inhibition of the E47 function, which is
the gene product of E2A. E2A is an important transcription factor during early stages
of B cell development (Pui et al. 1999; Kojika and Griffen, 2001). Furthermore, it has
been suggested that Notch-1 may promote T-cell development by upregulating
expression of T-cell specific genes, such as pre T-cell receptor ⍺ (pT⍺), which
encodes a critical component of pre-TCR (Reizis and Leder, 2002).
The involvement of Notch signalling in the T cell developmental decision of adopting
either ⍺β or γδ T cell lineage is still controversial. The first model of a Notch-1
mediated effect at the ⍺β versus γδ maturation choice, proposed that Notch1
signalling promotes ⍺β T cell development at the expense of γδ T cell development.
45
This notion stems from a study in which BM precursors with only one functional
Notch1 allele (Notch1+/ــ) give rise to relatively more γδ than ⍺β T cells, compared to
wild-type precursors in chimeric mice, reconstituted with a mixture of Notch1+/+ and
Notch1+/ــ BM-derived cells (Washburn et al. 1997). The other model of Notch in ⍺β
versus γδ lineage commitment argues that Notch-1 signalling may promote ⍺β T cell
development but it does not influence γδ T cell development. This was evidenced by a
study in which inactivation of Notch1 gene in the thymus, before pre-TCR expression,
severely impaired ⍺β but not γδ T cell development (Wolfer et al. 2002).
The role of Notch signalling in the CD4/CD8 fate choice remains largely unresolved.
Initially, it has been proposed that Notch1 promotes the development of CD8 + T cells
at the expense of CD4+ cells (Robey et al. 1996). Another group who used transgenic
mice expressing slightly longer form the ICN reported maturation of both CD4+ and
CD8 + T cells (Deftos et al. 2000).
A more recent study showed that both transgenic mice used by the two groups display
a decrease in mature CD4+ T-cells and an increase in mature CD8+ T cells, suggesting
that Notch1 signalling does indeed influence the CD8 versus CD4 lineage choice
(Fowlkes and Robey, 2002). To make things more complicated, loss of functions
experiments in which the Notch1 gene was inactivated in mice, did not show any
developmental skewing toward CD4+ T cells, suggesting that Notch1 is dispensable
for the CD4/CD8 lineage decision (Wolfer et al. 2001). Whether the CD4/CD8
lineage choice is regulated in normal lymphopoeisis by other Notch receptors in a
redundant fashion, remains to be confirmed in order to validate the loss of function
experimental findings. Collectively, there is no consensus as yet on the Notch-1
instructive role in the CD4/CD8 decision.
Notch-3 signalling has been postulated to be involved in different peripheral T cell
functions such as the regulation and expansion of CD4+ CD25+ regulatory T cells and
the promotion of Th1 differentiation from CD4+ T cells in response to antigen
stimulation (Radtke et al. 2004). As for the possible functions of Notch signalling in
B cell development, it is well documented, as explained above, that lack of Notch-1
signalling promotes B cell development in the bone marrow at early stages of B cell
46
lymphopoiesis. The other possible role of Notch in B cell development is the
stimulation of differentiation of marginal zone B cells (MZB) in the spleen, as
demonstrated in an RBP-J knockout study (Tanigaki et al. 2002). Since Notch-2 is the
most highly expressed Notch receptor in B cells, it has been speculated that Notch-2
is a likely candidate for the Notch-induced marginal zone B cell effect (Pear and
Radtke, 2003). This was confirmed by a study in which conditional inactivation of
Notch-2 in the BM resulted in the loss of marginal zone B cells without affecting T
cell development (Saito et al. 2003).
Several questions regarding the role of Notch signalling in lymphoid development are
still to be answered. For example, what are the downstream target genes that mediate
the effects of different Notch receptors and what is the role of different Notch
modulators in haemopoiesis. Of importance also is which ligand specifically triggers
different Notch functions in vivo and whether Notch receptors operate in the
haempoietic compartment in a redundant fashion. Finally, the interactions between
Notch signalling and other signalling pathways, such as NF-B and the ras/MAPK
pathway, during T cell development are not well established and might be a focus for
future investigations (Allman et al. 2002).
1.2.6 Notch signalling and cancer
Although many aspects of the involvement of Notch in developmental biology have
been revealed during the last decade, much less is known about the involvement of
Notch signalling in human diseases, and particularly in the process of malignant
transformation.
Notch-3 alterations have been associated with non-malignant human diseases such as
‘cerebral autosomal dominant arteriopathy with subcortical infarcts and
leukoencephalopathy’ (CADASIL) syndrome, a neurodegenerative disease (Joutel et
al. 2000). However, the first example of the involvement of Notch in malignant
transformation in humans was described in a subset of T-cell acute lymphoblastic
leukaemia (T-ALL), carrying the t(7;9) (q34;q34.3) translocation in which a
constitutive expression of ICN was involved in the leukaemogenesis process (Ellisen
et al. 1991). Direct proof of oncogenic potential of activated Notch-1 was obtained in
47
bone marrow transplant assay (BMT), in which retroviral expression of activated
ICN1 in HSCs induced T-ALL in mice (Pear et al. 1996).
Similarly, overexpression of ICN domain of Notch-3 induces T-cell leukaemias
(Bellavia et al. 2002). Jundt et al (2002) have reported high expression of Notch1 in
Hodgkin and anaplastic large cell lymphoma. Notch oncogenic activity in non-
haematological malignancies has also been reported for example, in breast cancer in
mice, in which N4 was involved (Callahan and Raafat, 2001). Other reports have
demonstrated the involvement of Notch1 signalling in breast cancer in human
(Weijzen et al. 2002) and in human cervical cancer (Talora et al. 2002). Interestingly,
Notch deficiency, rather than activation, can also contribute to cancer development.
For example, it has been shown that Notch1 loss of function resulted in basal-cell-like
carcinomas, or squamous cell carcinomas, in mice (Nicolas et al. 2003).
In most cellular contexts of Notch-induced tumourigenesis, altered Notch acts as an
oncoprotein that exhibits oncogenic functions such as those discussed in Notch-
mediated T-ALL leukaemias. However, various lines of evidence suggest that Notch
may also act as a tumour suppressor, or may exhibit both oncogenic and tumour
suppressive potentials depending on the cellular context (Radtke and Raj, 2003).
1.2.6.1 Notch signalling in leukaemia
The longest established role of Notch signalling in leukaemia is that of Notch1 and T-
ALL characterised by a t(7;9) (q34;q34.3) chromosomal translocation. As the gene at
the chromosome 7 locus, that is fused to the TCR β promoter/enhancer, is very similar
to Drosophila Notch, it was named TAN1 for ‘translocation-associated Notch
homologue’, and subsequently became known as human Notch1 (Radtke and Raj,
2003). TAN-1 is a truncated Notch1 molecule that encodes a dysregulated,
constitutively active intracellular domain (ICN-1) (Ellisen et al. 1991). Although the
complete in vivo molecular mechanism by which ICN1 transforms haemopoietic
progenitor cells is not well established, it has been found that ICN1-mediated
oncogenic function in t(7;9) T-ALL is dependent on a second T-cell-specific signal
that is mediated by the pre-TCR (Allman et al. 2001). The leukaemogenesis potential
of ICN1 was further investigated in bone marrow transplant (BMT) reconstitution
48
models, in which retrovirally transduced HSCs were transferred to lethally irradiated
mice, and constitutive expression of the human ICN1 led exclusively to CD8+CD24+
(immature single positive, ISP) or CD4+CD8+ double positive (DP) T cell
leukaemia/lymphomas, with simultaneous inhibition of B-cell development
(Zweidler-McKay and Pear, 2004).
Despite the ability of activated Notch1 to induce T-cell leukaemia in mice, less than
1% of human T-ALLs exhibit the t(7;9) translocation. However, activating mutations
in NOTCH1 independent of t(7;9) have been identified in the heterodimerization (HD)
and PEST domains of Notch1 in most Notch-dependent T-ALL cell lines, and in
approximately 55% of primary T-ALLs (Weng et al. 2004). Activating mutations in
Notch1 have since been reported in mouse models of T-ALL (O'Neil et al. 2006)
The importance of Notch signalling in T-ALL has been further
elucidated by the finding that Notch3 is expressed in almost all T-ALL cases in
humans (Bellavia et al. 2002). In this study, Notch3 was consistently expressed in a
sample of 30 human T cell acute leukaemias, and the expression was dramatically
reduced or absent in patients in clinical remission. Furthermore, Notch-3 expression
in those patients was associated with the expression of its target gene, HES1, and of
the gene encoding pTα. The combined expression of the genes encoding Notch3, pTα
and HES1 in human T-ALL suggests that a signalling defect at a specific stage in T-
cell development, the pre-TCR checkpoint, is responsible for T-cell leukaemogenesis
(Screpanti et al. 2003). It has been suggested that the altered Notch-3 signalling
disrupts the normal interaction between pre-TCR signalling and NF-κB signalling in
T-cell development. This in turns is thought to lead to the disruption of differentiation
of early thymocytes and results in the development of T cell leukaemia (Bellavia et al.
2003).
The precise mechanisms by which Notch contributes to T-cell leukaemias are not
fully understood. However, it is postulated that several signal-transduction pathways
might co-operate in Notch-induced leukaemogenesis. For instance, pre-TCR
signalling has been shown to be essential for Notch-1 and Notch-3 induced
leukaemogenesis (Allman et al. 2001; Bellavia et al. 2002). However, whether pre-Tα
is a direct Notch target is controversial (Zweidler-McKay and Pear, 2004). It has been
49
proposed that pre-TCR signalling may promote Notch-induced leukaemia through
inhibition of E2A, a gene that is critical in T and B cell development and which acts
as a tumour suppressor (Bellavia et al. 2003). Another pathway that may co-operate
with Notch signalling in T-ALL leukaemogenesis is the NFκB pathway. This notion
was supported by the findings that Notch3-IC transgenic mice exhibited constitutive
NFκB activity (Bellavia et al. 2000), and that truncated Notch-1 expression resulted
in up-regulation of NFκB2 in T cells (Oswald et al. 1998). Collectively, Notch
signalling may contribute to T-ALL leukaemogenesis through its co-operation with
pre-TCR signalling to inhibit the E2A tumour suppression gene and by activation of
NFκB, which regulates apoptosis and proliferation of T-cells.
50
Fig. 1.6 Notch signalling during T and B cell development. Notch signalling has been shown to promote T cell over B cell commitment and favour the commitment towards the ⍺β lineage. Signalling through the Notch1 receptor has been shown to be involved in regulating V-DJ rearrangement of the TCRβ locus. Finally Notch signalling has been proposed to influence lineage decisions when DP (CD4+CD8+) thymocytes must choose between the CD4+ (CD4+CD8−) and the CD8+ (CD4−CD8+) cell fates. Notch signalling should be kept inactive in the B cell progentitors in the bone marrow to allow B cell development (Adopted from Pear and Radtke, 2003).
The involvement of Notch signalling in B-cell malignancies has been suggested in
many B-cell neoplasms such as B-CLL (Hubmann et al. 2002; Duechler et al. 2005),
Hodgkin’s disease and anaplastic large cell lymphoma (Jundt et al. 2002), and in
multiple myeloma (Jundt et al. 2004). The Hubmann group found that Notch-2 is
overexpressed in B-CLL cases, and may be involved in the regulation and
overexpression of CD23, a hallmark of B-cell chronic lymphocytic leukaemia (B-
CLL) cells which is linked to the failure of apoptosis in B-CLL cells (Hubmann et al.
2002). This data was further confirmed in a recent study by the same group in which
the induction of apoptosis by proteasome inhibitors in B-CLL cells was associated
with down-regulation of Notch-2 and CD23 expression (Duechler et al. 2005).
Moreover, Jundt et al (2002), using cell lines and primary cells, have demonstrated
that Notch-1 is highly expressed in B- and T-cell derived tumours of Hodgkin’s (HD)
and anaplastic large cell lymphoma (ALCL). In this study, mRNA expression of the
Notch1 ligand, Jagged1, was highly expressed in neighbouring cells of Hodgkin’s and
Reed-Sternberg cells in vivo, which suggest that Jagged1-induced Notch-1 signalling
might contribute to the pathobiology of HD. This notion was further supported by the
overexpression of Hes-1, target gene of Notch signalling, following in vitro culture of
HRS and ALCL cells in the presence of Jagged1 (Jundt et al. 2002).
Notch signalling has also been proposed to be involved in the pathogenesis of
multiple myeloma (MM). Jundt et al have demonstrated that Notch receptors and their
ligand, Jagged1, are highly expressed in cultured and primary MM cells and that
Notch signalling promotes proliferation of myeloma cells (Jundt et al. 2004).
Similarly, Notch1-4 have been found to be expressed by myeloma cells in different
MM cell lines (Nefedova et al. 2004). Upon ligand activation, only Notch-1 signalling
in myeloma cells, protected cells from drug-induced apoptosis, by inhibiting their
entry to the cell cycle. Whether Notch signalling contributes to myelomagenesis by
inducing proliferation of MM cells (Jundt et al. 2004) or by inhibiting growth of MM
cells and inducing anti-apoptotic mechanisms (Nefedova et al. 2004), seems to be
dependent on the cellular context and availability or absence of toxic agents.
The role of Notch signalling in myeloid leukaemias is not yet known. However, high
expression of Jagged1 has been reported recently in 20 primary AML samples
(Chiaramonte et al. 2004). Jagged1 expression in AML samples was significantly
51
higher than its expression in the T-ALL or B-ALL patients. In light of the finding that
only low levels of Notch1 and its target genes were detected in this study, a possible
autonomous role of Jagged1 in supporting AML growth has been proposed. This is in
line with the finding that expression of acute myeloid leukaemia (AML) PML/RAR
and AML1/ETO fusion proteins results in activation of Jagged1/Notch signalling in
blasts derived from AML patients (Alcalay et al. 2003). This has been suggested to
confer self-renewal properties to leukaemic blasts in AML. Interestingly, the gene
expression profiling of stem cells in myelodysplastic syndrome (MDS), AML, and
CML has revealed a selective expression of the gene encoding Delta-like Notch
ligand in MDS patients (Miyazato et al. 2001).
1.3 Chronic myeloid leukaemia (CML)
CML results from the malignant transformation of a haemopoietic stem cell. This
myeloproliferative disease, which accounts for 10-20% of chronic leukaemias, is
characterised by a t(9,22) reciprocal chromosomal translocation, generating the
Philadelphia (Ph) chromosome in more than 90% of CML patients. The disease can
be divided clinically into three phases, a chronic phase, an accelerated phase, and a
terminal blastic phase. Clinically, chronic phase disease is characterised by
splenomegaly and high white cell count of mainly myeloid lineage cells with normal
differentiation. If untreated, the disease progresses gradually to the accelerated phase
until it becomes more refractory to treatment. Progression to the blastic phase, which
is an acute leukaemia, then occurs in a few months where the more differentiated
marrow cells are displaced by 30% or more immature blasts of either myeloid or
lymphoid origin (Pallister, 1998).
During the chronic phase, which lasts about 3-5 years, the only chromosomal
abnormality present on leukaemic stem cells and myeloid progenitors is the t(9;22)
(q34;q11). However, the progression into the accelerated and blastic phases is
accompanied by the acquisition of additional genetic abnormalities in most cases,
which may involve the loss of tumour suppressors or the activation of many proto-
oncogenes in the bone marrow microenvironment (Ren, 2005).
52
The t(9;22) chromosomal translocation characteristic of CML results in a fused 8.5 kb
BCR-ABL gene and an abnormal fusion protein, p210 BCR/ABL. The fusion of BCR
sequences to ABL during the t(9,22) translocation, increases the tyrosine activity of
ABL and brings new domains, highly critical for oncogenic activities of BCR-ABL,
such as the growth factor receptor-bound protein 2 (GRB2) SH2 binding site (Ren,
2005). In contrast to the native c-ABL which shuttles between the nucleus and the
cytoplasm, the p210 BCR-ABL is exclusively located in the cytoplasm (Marley and
Gordon, 2005). It has been shown that cytoplasmic localisation of BCR-ABL is vital
for avoiding apoptosis (Melo, 2001).
The new fusion protein has five-fold higher tyrosine kinase activity than the normal c-
ABL protein, an activity that has been shown to be essential for its transforming
potential (Clarkson et al. 1997). In addition, the new location of the constitutively
active ABL kinase in BCR-ABL oncoprotein may provide access to novel substrates
and interactions. It appears that the BCR-ABL fusion protein binds various substrates
in the cytoplasm to activate various signalling pathways in CML stem cells and
primitive progenitors and co-operates with cytokines to induce self-renewal,
proliferation and survival of leukaemic stem cells (Clarkson et al. 2003).
1.3.1 Molecular phenotype of BCR-ABL
The BCR-ABL fusion protein can vary in size from 190 to 230 kD, depending on the
breakpoint in the BCR gene. Splicing at the M, m, and µ breakpoints in BCR produces
three BCR-ABL variants which are P190 BCR-ABL (e1a2 junction), p210 BCR-ABL
(b2a2 or b2a3 junctions), and p230 BCR-ABL (e19a2 junction) (Fig. 1.7). Most
patients with chronic-phase CML express a 210-kD protein which is also found in
about 20% of Philadelphia positive acute lymphoblastic leukaemia (ALL) patients.
Very few CML patients express the 230-kD protein which is associated with a very
mild form of CML, denominated Ph-positive neutrophilic CML (Ph+ N-CML). The
P190 BCR-ABL protein is associated with most Philadelphia positive (ALL) patients
(Kantarjian et al. 2006).
53
54
Fig. 1.7 The t(9;22)(q34;q11) reciprocal translocation. (A) The t(9;22) translocation results in the formation of a shortened chromosome 22 (the Philadelphia chromosome) carrying the BCR–ABL fusion gene. In addition, the translocation results in a longer chromosome 9 that carries the ABL–BCR fusion gene. The fusion of BCR sequences to ABL during the t(9,22) translocation, increases the tyrosine activity of ABL and leads to constitutive tyrosine kinase activity in the BCR-ABL protein but not in the ABL-BCR protein. (B) Locations of the breakpoints in the ABL and BCR genes. Exons are shown as boxes, and breakpoints are indicated by arrows. Splicing at the m, M, or µ breakpoints in BCR produces three distinc proteins. These three BCR-ABL variants are named P190 (e1a2 junction), P210 (b2a2 or b3a2 junction), and P230 (e19a2 junction). Most CML patients express the P210 BCR-ABL. (Taken from Smith et al (2003) and Inokuchi (2006)).
A
B
1.3.2 BCR-ABL oncogenic activities
BCR-ABL induce malignant transformation in Ph+ cells via three major mechanisms:
altering adhesion to stromal cells and extra-cellular matrix, inhibiting apoptosis, and
activating signalling pathways with mitogenic potentials such as RAS and MAP
kinase pathways (Deininger et al. 2000). Depending on the cellular context, BCR-
ABL can bind adaptor proteins and phosphorylate substrate molecules and signalling
proteins which have different physiological functions in the cytoplasm to exhibit its
oncogenic activities (Fig 1.8). These substrates of BCR-ABL can be grouped into
adapter molecules including (such as GRB2 and CRKL) , proteins with catalytic
functions (such as the nonreceptor tyrosine kinase Fes or the phosphatase Syp), and
proteins associated with organisation of the cytoskeleton and cell membrane (such as
paxillin and talin) (Ren, 2005; and Deininger et al. 2000).
1.3.2.1 Altered adhesion
Normal BM progenitors adhere to stroma through a variety of cell surface adhesion
receptors, including the α4β1 and α5β1integrin receptors which bind to cell adhesion
molecules on the stroma. Interaction between integrins and the cytoskeleton plays a
critical role in modulating integrin function both by affecting receptor conformation
and ligand binding affinity (Schwartz et al. 1995). Gordon et al. (1989) showed that
CML progenitors fail to adhere to BM stroma. Salesse and Verfaillie (2002) have
shown the presence of abnormal association between the α4β1 and α5β1integrin
receptors and the cytoskeleton proteins which impairs the normal adhesion function of
β1integrins. The authors demonstrated in a human CML model that the p210 BCR-
ABL is directly responsible for the defect in adhesion in CML progenitors.
BCR-ABL localisation in the cytoplasm results in increased binding to actin and
phosphorylation of a number of neighboring cytoskeletal proteins including FAK and
paxillin which may alter normal integrin signalling and contribute to abnormal
adhesion receptor function (Shet et al. 2002). Because CML cells exhibit reduced
adhesion to fibronectin and bone marrow stroma cells they escape the integrin-
mediated proliferation control, and enjoy high proliferation potential (Salesse &
Verfaillie, 2002). In addition, some populations of CML progenitors but not normal
progenitors express α2β1 and α6β1 integrin receptors that interact with basement
55
membrane components, lamin and collagens (Lundell et al. 1997). These abnormal
findings in the function and expression of certain cell surface adhesion molecules,
may explain the premature release of massively expanded myeloid progenitors in the
blood of CML patients.
1.3.2.2 Inhibition of apoptosis
Inhibition of apoptosis is a feature of CML progenitors. This has been demonstrated
in haematopoietic cell lines and murine bone marrow cells (Kabarowski & Witte,
2000). BCR-ABL may inhibit apoptosis by inhibiting the activation of caspases by
blocking the release of cytochrome C from the mitochondria (Amarante-Mendes et al.
1998). In addition, BCR-ABL has been shown to up-regulate the anti apoptotic
proteins Bcl-2 and BclxL (Deininger et al. 2000). Moreover, BCR-ABL may inhibit
apoptosis through the phosphorylation of the pro-apoptotic protein Bad (Neshat et al.
2000) and the down-regulation of ICSBP tumour suppressor protein (Hao et al. 2000)
(Fig. 1.8).
1.3.2.3 Proliferative signals
In addition to altering adhesion and inhibiting apoptosis, BCR-ABL
activates various signalling pathways that contribute to proliferation
of CML cells. This may confer proliferative capacity, independent of
cytokines requirements for growth and survival in CML cells. It has
been shown that BCR-ABL, through specific functional domains,
interacts with signalling proteins which in turn activate downstream
signalling pathways including the RAS, MAPK, JAK-Stat, PI3 kinase,
and Myc pathways. For example, activation of RAS has been shown
to occur through autophosphorylation of the tyrosine 177 domain of
BCR-ABL which provides a docking site for the adapter molecule
GRB-2, which then binds to SOS protein which in turn activates RAS
signalling pathway (Fig. 1.8) (Deininger et al. 2000). Stat1 and Stat5
transcription factors, components of Jak-Stat pathway, have been
shown to be constitutively phosphorylated in many BCR-ABL positive
56
cell lines and primary CML cells (Chai et al, 1997). In addition, BCR-
ABL has been shown to bind and phosphorylate the GAB2 protein,
which then recruits and activates phosphatidylinositol 3-kinase
(PI3K) signalling pathway (Sattler et al, 2002).
In addition, BCR-ABL, promotes proliferation and survival by inducing expression of
cytokines such as Interleukin-3 (IL3), G-CSF AND GM-CSF, and by down-regulating
transcription factors that inhibit proliferation and survival such as ICSBP and JUNB
(Ren, 2005).
1.3.2.4 Role of CrKl in BCR-ABL signalling
The adaptor protein Crkl is the most prominent tyrosine-phosphorylated proteins in
CML and appears to play a key role in mediating the oncogenic activities of the BCR-
ABL oncoprotein (Oda et al. 1994; Singer et al. 2006). BCR-ABL binds and
phosphorylates CrKl directly through the SH3 domain. The phosphorylated CrKl (P-
crkl) interacts with specific target proteins and mediate the formation of signal
transduction pathways. For example, the BCR–ABL-dependent activation of the PI3K
pathway has been shown to be mediated by BCR–ABL interaction with Crkl (Sattler
et al. 1996a). CrkL has also been found to be the linking protein between Bcr-Abl and
Stat signaling (Rhodes et al. 2000). In addition, Crkl, can also activate the Ras
signalling pathway in fibroblasts as well as in haemopoietic cells (Deininger et al.
2000; and Arai et al. 2002). CrKL is also involved in the regulation of cellular
motility of CML cells and in integrin-mediated cell adhesion by association with other
cytoskeleton proteins such as paxillin, the focal adhesion kinase Fak (Sattler et al.
1996b).
Interstingly, it has been shown that that tyrosine-phosphorylation of Crkl is a direct
consequence of BCR-ABL expression and that phosphorylation of Crkl could be used
as a diagnostic indicator for BCR-ABL activity in Ph+ leukaemia (ten Hoeve et al.
1994).
1.3.3 Leukaemic stem cells (LSC) in CML
Various studies have shown that CML is a clonal disease of haemopoietic stem cell
origin. The Ph chromosome and the BCR-ABL transcript have been
57
detected in all haematopoietic lineages, except natural killer cells
(Tahakashi et al, 1998). The leukaemic stem cells (LSC) in CML are
very primitive cells that are Ph+, BCR-ABL+ and can be identified in
vitro by long-term culture-initiating cells (LTC-IC) assay. It has been
shown that about 80% of Ph+ LTC-IC cell in CML are positive for
CD34 and Thy-1 cell surface markers (Petzer et al. 1996). Moreover, the
LSC in CML were found to have the phenotype of CD34+ CD38-, a phenotype
similar to normal HSCs (Petzer and Gunsilius, 2003). Therefore, it is
acceptable that in CML patients in which the circulating LTC-IC population is
mainly Ph+, the CD34+CD38- or CD34+ Thy-1 + populations are highly enriched
with leukaemic stem cells (LSC). In addition to being CD34+ CD38- Thy-1
+, LSCs in CML are highly enriched in the CD34+ HLA-DR+
population (Verfaillie et al, 1992). This is in line with the finding that
CD34+ HLA-DR− cells in CML are polyclonal (Delfroge et al, 1999).
There is evidence that normal haemopoietic stem cells (HSCs) are
relatively well preserved in newly diagnosed CML patients, but tend to rapidly
decline with time (Frassoni et al, 1999). However, the leukaemic stem
cells (LSCs) seem to be more predominant than normal HSCs in
CD34+ CD38- / CD34+ Thy-1 + cell populations in chronic phase of
CML. Maguer-Satta et al (1996) demonstrated the presence of BCR-ABL
mRNA in about 80% of the CD34+ CD38- cells in patients with
chronic phase CML. In line with this, Grand et al (1997) found that
the majority of CD34+ CD38- cells were Ph+ and express BCR-ABL
transcript. Similar findings were reported in five (out of nine) CML
patients in presentation (Holyoake et al. 2001). Recently, FISH analysis
of 10 CML chronic phase patients showed that the majority of the
primitive CD34+ CD38- cells, both before and following IM exposure,
were BCR-ABL positive (Copland et al, 2006). Contradictory to
previous reports, others found that normal HSCs frequently
outnumber the LSCs in the chronic phase of CML (Dube et al, 1984).
58
Interestingly, it has been shown that CML stem cells can be traced
at least to haemangioblast like cells, earlier than the pluripotent
HSCs (Fang et al, 2005).
59
Figure 1.8.Signal transduction pathways associated with P210 BCR-ABL in CML. Tyrosine phosphorylation of BCR–ABL substrates results in the consequent activation of multiple signal transduction pathways. Ras activation in is mediated by BCR–ABL interaction with the adaptor molecules Grb2 or the adaptor protein Crkl. Activation of signalling pathwas downstream of the RAS pathway results in promoting proliferation and transformation of BCR-ABL+ cells. Proliferative signals are also gained by the BCR-ABL induced expression of IL3 and GM-CSF cytokines. BCR-ABL has also been shown to bind and phosphorylate the GAB2 protein, which then recruits and activates the (PI3K) signalling pathway which interacts with downstream pathways including AKT and NFkB to inhibit apoptosis. Protection from apoptosis can also occur through the activation of STAT signalling pathway via interaction with Crkl adaptor or following direct phosphorylation of STAT proteins by BCR-ABL. Direct or Crkl mediated binding of BCR-ABL to actin and phosphorylation of a number of neighboring cytoskeletal proteins including FAK and paxillin alter normal adhesion of BCR-ABL+ cells to the stroma.
RAS
GRB2
BCR ABL
SOS
P
GAB2
P
Crkl
P
SHC P
PI3K
C-JUN
MAPK RAF
ERKJNK
Proliferation and transformation
F-actin FAKPaxillinVinculin
AKT
ICSBP
Altered adhesion
STAT5 P
PTEN
NFkB
Anti apoptosis
BCL-x BCL2 BAD
IL3
GM-CSF
C-MYC
Proliferation
1.3.4 Imatinib mesylate
Imatinib mesyalyte (also known as STI-571 or Gleevec) was discovered in 1996 as a
small molecule that specifically inhibits few kinases including BCR-ABL, c-Kit, and
platelet growth factor receptor (Druker et al. 1996). Imatinib mesylate is an ATP
competitive inhibitor and therefore it selectively inhibits BCR-ABL tyrosine activity
by occupying the ATP-binding site in the kinase domain of ABL, thereby maintaining
the protein in inactive conformation (Nagar, 2007). Because the kinase domain is
similar in wild type c-ABL and BCR-ABL, imatinib may be expected to inhibit c-
ABL as well. However, the inhibition of normal c-ABL function was only reported in
cardiomyocytes (Kerkela et al. 2006).
In 2001 the United States Food and Drug Administration (FDA) approved the drug
for the treatment of Philadelphia chromosome positive chronic phase CML (400
mg/d) and blastic phase CML (600 mg/d) after failure of interferon-α therapy. Clinical
trials showed that imatinib was highly effective in newly diagnosed chronic phase
CML patients, in which the drug induced greater than 90% haematologic response
and greater than 80% cytogenetic response. However, CML patients in accelerated
and blastic phases showed less sensitivity to imatinib (Druker et al. 2006).
Although most patients in chronic phase achieved haematological and cytogentic
remission, minimal residual disease could be detected in most patients by sensitive
real time PCR (Jorgensen and Holyoake, 2007). Bhatia et al (2003) showed the
persistence of about 20% leukaemic stem cells that were CD34+ BCR-ABL+ as well
60
as LTC-ICs in patients who achieved complete cytogenic response. Copland et al
(2006) showed that the more primitive CD34+ CD38- cells in chronic phase CML
patients are resistant to imatinib, in vitro. Taken together, these findings show that
although the majority of CML cells in chronic phase respond very well to imatinib,
the rare primitive leukaemic stem cells that maintain the disease remain insensitive to
the drug.
1.3.5 Experimental models of CML
1.3.5.1 Cell lines
Fibrolast lines and haemopoietic cell lines have been extensively used to study the
biology of CML. Although expression of BCR-ABL has been shown to transform
mouse fibroblast cell lines and reproduced many of the properties of CML cells, the
biological effects are diverse, depending on the type of fibroblasts used. In addition,
the interaction between certain BCR-ABL domains in transformed fibroblasts and
other signalling proteins does not represent a good model for CML disease. This is
simply because certain BCR-ABL domains and signalling proteins are functionally
vital in fibroblast transformation, but not in haemopoietic cells (Deininger et al.
2000). Therefore, BCR-ABL+ haemopoietic cell lines such as K562 and BV173 may
provide a CML model that overcomes the limitations of fibroblast cell lines.
However, one limitation of haemopoietic CML cell lines is that they are derived from
blast crisis and thus, are not ideal models for the chronic phase of CML. The
importance of BCR-ABL+ cell lines remains that they contributed to our
understanding of the basic biology of CML, and that the BCR-ABL tyrosine kinase
activity can be turned off with imatinib mesylate (STI571 or Gleevec) to study
activity of other signalling pathways in CML.
1.3.5.2 Animal models
Animal models represent better physiological systems than cell lines for the study of
CML molecular biology because they provide the opportunity to study the oncogenic
61
activities of BCR-ABL+ haemopoietic cells within their normal niche. The most
commonly used animal models are mice with haemopoietic cells that express BCR-
ABL through various approaches such as transgenic, knock-in or retroviral
transduction techniques.
Engraftment of BCR-ABL transformed cell lines in syngeneic mice produced a form
of acute leukaemia and does not provide a suitable model for chronic phase CML.
Similar results were obtained in transgenic mouse models before the use of the Tec
promoter (specific for haemopoietic cells) which was able to target the expression in
the appropriate cells (Honda et al. 1998). An interesting transgenic mouse model of
P210 BCR-ABL, under control of tetracycline, recently provided evidence that BCR-
ABL is required for both initiation and maintenance of leukaemia (Huettner et al.
2000).
Transplantation of non-obese diabetes, severe combined immunodeficiency (NOD-
SCID) mice with large inoculum of chronic phase human BCR-ABL+ cells has been
shown to provide an excellent model to study certain aspects of CML biology
(Deininger et al. 2000). Transduction of murine bone marrow cells with BCR-ABL
retroviruses has also been used as a CML model since 1990. A major improvement to
this system was the use of murine stem-cell retroviral vector to express the BCR-ABL
oncogene in haemopoietic cells which produced a myeloproliferative disease (MPD)
that was similar to the chronic phase of human CML with high efficiency (Ren,
2005).
The problems with some animal models are that they either produced other
haemopoietic neoplasms in mice or failed to yield a similar disease at frequency
sufficient to utilise it in the study of CML pathogenesis (Petzer and Gunsilius,
2003). Another limitation in CML animal models is the difficulty of
ruling out disease modification by host factors (Deininger et al. 2000).
1.4 Possible role for Notch in CML
CML is a stem cell disease and the differentiated cells in CML constitute the bulk of
leukaemic cell mass whereas the leukaemic stem cells responsible for the disease
maintenance are, like normal HSCs, very rare. It has been shown that imatinib
62
mesylate (also known as STI571, or gleevec) is highly toxic to the more differentiated
CML progenitors but not to the leukaemic stem cells which remain viable in a
quiescent state, even in the presence of growth factors and gleevec (Graham et al.
2002). Therefore, it is possible that CML stem cells’ survival and self-renewal
capacities are related to the same signalling pathways that regulate these potentials in
normal HSCs such as Notch and Wnt signalling pathways.
Jamieson et al (2004) have shed new light on the interaction between leukaemic stem
cells in CML and Wnt signalling pathways, which is important for normal HSC self-
renewal, as discussed above (Ryea et al, 2003). Granulocyte-macrophage
progenitors (GMP) from patients with CML in blast crisis have been
shown to have elevated levels of -catenin, the major effector of
Wnt signalling pathway, which resulted in enhanced self-renewal
capacities of GMP and thus acquisition of stem cell phenotype
(Jamieson et al. 2004). Notch signalling integrates with Wnt signalling pathway to
confer self-renewal capacities to HSCs, since intact Notch signalling was required for
Wnt-mediated maintenance of undifferentiated HSCs (Duncan et al. 2005). Moreover,
fusion oncoproteins PML/RAR and AML1/ETO in AML have been associated with
activation of Notch signalling which may confer self-renewal properties to leukaemic
stem cells in AML (Alcalay et al. 2003).
Transcriptional targets of Notch signalling, such as c-myc, which is essential in
Notch-mediated self-renewal potential of HSC (Satoh et al. 2004) and for Notch1
oncogenic role in T-ALL (Girard et al. 1996), also play a critical role in the malignant
transformation mediated by ABL in CML (Afar et al. 1994). Furthermore, signalling
pathways such as RAS, which is involved in the transformation process in CML and
activated by BCR-ABL fusion protein (Ren, 2005), has been shown to activate Notch
signalling (Weijzen et al. 2002). Taken together, Notch may also be involved in the
self-renewal potentials of leukaemic stem cells in CML.
Studies on axons development in Drosophila support the hypothesis of possible co-
operation between ABL protein kinase and Notch signalling. It has been found that
Notch interacts genetically with ABL as Notch, and ABL mutations synergise to cause
63
synthetic lethality in Drosophila axons (Ginger, 1998). Interestingly, Ginger has
demonstrated that Disabled (Dab) interacts physically to the RAM region of the
intracellular domain of Notch in vitro. Given the fact that Dab interacts genetically
and physically with ABL kinase, it appears that Dab acts as an adaptor in the
cytoplasm between Notch and ABL in response to a signal from Notch ligands
(Ginger, 1998). In another study, Ginger and colleagues have found that Delta ligand
and Notch provides a guidance signal to the developing axon by regulating the ABL
kinase signalling pathway (Crowner et al. 2003).
The fact that Disabled protein has been shown to interact directly with Notch1 in
CML CD34+ cells in humans (Ostrowska et al. unpublished) justifies the hypothesis of
possible interaction between ABL fusion protein in leukaemic stem cells in CML and
Notch receptor via the Disabled adaptor protein. Although ABLl-Notch interaction in
Drosophila has been shown to be only CSL-independent (Crowner et al. 2003), it is
possible that Notch-ABL interaction, if proven, might be either CSL-dependent or
CSL-independent in human. This is simply because ABL protein in Drosophila shows
no nuclear localisation unlike the mammalian ABL which can translocate to the
nucleus (Saglio and Cilloni, 2004). All the previous findings and the notion that
Notch co-operates with several signal-transduction pathways to induce
leukaemogenesis make it possible for Notch to be integrated with the BCR-ABL
fusion protein in leukaemogenesis of CML.
1.5 Research aims and objectives
The overall aims of this project are to determine whether there is a role for altered
Notch signalling in chronic myeloid leukaemia (CML). Currently, the role of Notch
signalling in CML is not yet established. However, several clues raise the possibility
that Notch might be involved in CML as detailed in section 1.4. In a nutshell, CML is
a clonal disease, which originates from transformed haemopoietic stem cells and
Notch is essential in the self-renewal of these haemopoietic stem cells. In addition, the
hallmark of CML leukaemogenesis is the presence of BCR-ABL fusion protein, and
the ABL protein has been shown to co-operate with Notch in Drosophila. The
64
hypothesis of this project therefore is that Notch signalling might be altered in CML
and that Notch may interact with ABL protein expressed in CML cells.
To test this hypothesis, the expression of Notch receptors in CML samples and normal
control HSCs will be determined using monoclonal antibodies and flow cytometry.
The expression of Notch1-4 at the message level will be investigated using PCR
technique. The expression of Notch target genes Hes1 and Herp1-2 will be measured
using PCR to determine the activity of Notch signalling in CML. The possible cross-
talk between Notch and BCR-ABL will be investigated in cell line models as well as
in primary CML CD34+ cells.
Chapter 2: MATERIAL AND METHODS
2.1 Cell Biology techniques
2.1.1 Cell lines
2.1.1.1 K562 cell line
K562 cells are human chronic myeloid leukaemia suspension cells in myeloid blast
crisis which carry the Philadelphia chromosome with a BCR-ABL b3-a2 fusion gene.
K562 cells were maintained in RPMI 1640 (Sigma) supplemented with 10% (v/v)
fetal bovine serum (FBS - Sigma), 2 mM L-glutamine (Invetrogen) and 0.1 mg/ml
penicillin and streptomycin (Invetrogen) at 37 °C with in 5% CO2. The K562 cells
were not used beyond passage 20 before returning to a stock of low passage number
stored in liquid nitrogen.
2.1.1.2 NALM-1 cell line
NALM-1 cells are human chronic myeloid leukaemia suspension cells in lymphoid
blast crisis which carry the Philadelphia chromosome with a BCR-ABL b3-a2 fusion
gene. NALM-1 cells are difficult to culture and grow very slowly in the culture
medium so it might be of benefit to start culture in 24-well plates. NALM-1 cells were
maintained in RPMI 1640 (Sigma) supplemented with 10% (v/v) fetal bovine serum
65
(FBS - Sigma), 2 mM L-glutamine and 0.1 mg/ml penicillin and streptomycin at 37
°C with in 5% CO2.
2.1.1.3 ALL-SIL cell line
ALL-SIL cells are human T-ALL (T cell acute lymphoblastic leukemia) suspension
cells that carry the NUP214-ABL1 fusion gene. They are also found in the literature as
SIL-ALL. They are slow growing cells so it may be of advantage to first culture the
cells in a 24-well-plate with 20% FBS. ALL-SIL cells were maintained in RPMI 1640
(Sigma) supplemented with 10% (v/v) fetal bovine serum (FBS - Sigma), 2 mM L-
glutamine and 0.1 mg/ml penicillin and streptomycin at 37 °C with in 5% CO2.
2.1.1.4 JURKAT cell line
JURKAT cells are human T-ALL suspension cells which are negative for the BCR-
ABL fusion gene. They grow singly or in clumps in suspension. JURKAT cells were
maintained in RPMI 1640 (Sigma) supplemented with 10% (v/v) fetal bovine serum
(FBS - Sigma), 2 mM L-glutamine and 0.1 mg/ml penicillin and streptomycin at 37 °C
with in 5% CO2.
2.1.1.5 Passage of cell lines
K562 and JURKAT cell lines were sub-cultured every 3-4 days and transferred to
fresh media to maintain long phase growth. Due to differences in doubling time the
splitting ratio was 1:9 for K562 cells and 1:3 for the JURKAT cells. The NALM-1
and ALL-SIL cells were sub-cultured every week by splitting the cells at 1:2 ratio
with fresh media.
2.1.1.6 Viable Cell Count
Viable cell numbers were determined by using the trypan blue exclusion method. A
cell suspension was diluted 1:1 with a 0.4% solution of trypan blue (Sigma). Viable
cells were counted using a haemocytometer.
66
2.1.1.7 Cryopreservation of Cell Lines
1x107 cells ml-1 were slowly re-suspended in FBS (Sigma) with 10% (v/v) Dimethyl
sulphoxide (DMSO) (Sigma) and added to cryogenic vials in 1 ml aliquots (Corning).
These were then frozen at -20 °C for 1 hour, kept at -80 °C overnight before being
cryopreserved in liquid nitrogen for long-term storage.
2.1.2 Primary CML samples
Fresh or frozen peripheral blood samples from non-treated patients with chronic
myeloid leukaemia (CML) in chronic phase were used in this project. Cord blood
samples were used as normal controls.
.
2.1.2.1 Thawing of cryopreserved CML cells
A special thawing solution referred to as ‘DAMP’ solution was used for thawing of
cryopreserved CD34+ CML cells from liquid Nitrogen. DAMP thawing solution was
prepared in total volume of 500 ml by using the following recipe:
DNase I (2 vials at ~2500 U/vial (1mL), StemCell Technologies) 2 mL
Magnesium chloride (400X, 1.0 M stock) 1.25 mL
Trisodium citrate (0.155M, Sigma) 53 mL
Bovine Serum Albumin (20%, Sigma) 25 mL
Dulbecco’s PBS (magnesium/calcium free) to 500 mL
Frozen CD34+ CML cells were thawed quickly by immersing in a 37 C water bath
before being opened under sterile conditions and transferred into a sterile 10 ml
Falcon tube. 10 ml of warm thawing solution were added dropwise to the cells over
10 minutes and centrifuged at 389g for 5 minutes. The washing step was repeated
twice with DAMP thawing solution before the cells were filtered by a cell strainer
(BD) and counted. 1 x 10 6 / ml CD34+ cells were cultured overnight in a 24 well
culture plate in serum free expansion medium (SFEM) supplemented with a five
growth factor cocktail (see 2.1.2.2) at 37 C in 5 % CO2. This initial 24h culture helps
67
the cells to revive and expand before they are being subjected to any treatment or used
in future experiments.
2.1.2.2 Short term liquid culture of primary CML CD34+ cells
CD34+ cells were cultured in serum free expansion medium (SFEM) (StemCell
Technologies) supplemented with 1% glutamine (100 mM) and 1% penicillin–
streptomycin (100 mM). SFEM was further supplemented with a five growth factor
cocktail comprising 100 ng/ml Flt3- ligand, 100 ng/ml stem cell factor, 20 ng/ml each
of interleukin (IL)-3, IL-6 and granulocyte colony stimulating factor (GCSF) (all from
R&D systems). To prepare a ready to use cytokine cocktail, cytokines were combined
together and diluted in phosphate buffered saline (PBS) containing 0.1% BSA/PBS to
create a 100x working stock solution which was stored at 4 C for up to 3 weeks.
2.1.3 Retroviral transfection of K562 cells with Notch1ΔE
200 µl of 50 µg/ml Retronictin (TaKaRa) was added to each well of a 24 well plate
before being placed at 4 °C overnight. The following day, the Retronectin solution
was removed before 1 ml of 1% (w/v) bovine serum albumin (BSA- Sigma) in 1x
PBS to each well for I hour at RT to reduce non-specific binding. Next, the
supernatant was removed, prior to 1 x 105 K562 cells in log phase growth were mixed
with 1 ml of retroviral supernatant which contain either Notch1ΔE or the empty
vector pmX (Chadwick et al. 2008). Cells were then placed in duplicate onto the
Retronectin coated wells and centrifuged for 45 minutes at 1000 xg at 20 °C before
being incubated at 37 °C in 5% CO2 overnight and left for 48 hours. The cells were
then harvested and the GFP positive cells were FACS sorted and cultured in the K562
cells media [2.1.1.1].
2.2 Flow cytometric techniques
2.2.1 Isolation of mononuclear cells (MNC)
68
Isolation of mononuclear cells from blood samples was done using ficoll-paque
(Amersham Pharmacia Biotech) density gradient separation under sterile conditions.
Samples were diluted 1:1 with sterile Hanks Balanced Salt Solution (HBSS)
supplemented with 5% Newborn Calf Serum (NCS) (Invitrogen). 20 ml of the diluted
blood was then carefully layered onto 10 ml Ficoll in a 50 ml falcon tube and
centrifuged at 1500 rpm (389 g) for 30 minutes at room temperature (RT). Next, the
mononuclear cells were harvested from the interface layer and transferred into a new
tube and washed twice with 50 ml HBSS / 5% NCS by centrifugation at 1500 rpm
(389 g) at RT for 7 minutes and cell count and viability were done between washes.
The pellet was then re-suspended in known volume of HBSS / 5% NCS for FACS
sorting, or processed for liquid nitrogen freezing.
2.2.2 Isolation of haemopoietic progenitor cell populations
Haemopoietic progenitor cell populations from normal cord blood and CML samples
were isolated by positive selection for CD34 expressing cells using StemSep™ kit
(StemCell Technologies) according to the manufacturers’ instructions. In summary,
the isolated MNC were re-suspended in HBSS / 5% NCS and incubated with 100 µl
selection cocktail per ml of cells on ice for 10 minutes. 60 µl magnetic colloid /ml
cells were then added to the cells and incubated on ice for 10 minutes. Cells were then
washed with 3 ml HBSS/5% NCS and resuspended in 2 ml HBSS/5% NCS. Next, a
MidiMax column (Miltenyi) was washed with 2ml HBSS/5% NCS and cells were run
through column in 1ml aliquots, the column was then washed with 2 ml HBSS/ 5%
NCS. The magnet was then removed and the bound cells were eluted from the column
with a plunger in 2 ml HBSS/ 5% NCS. The eluted CD34 cells were then pooled and
viability assessed before cells were pelleted and then re-suspended in 100 µl
containing 1:20 CD34-APC, 1:20 Thy-PE and 1:20 lin-FITC cocktail. After
incubation for 20 minutes at 4 °C in the dark, cells were washed with 2 ml HBSS/5%
serum and re-suspended in 1 ml HBSS/5% serum for sorting. Cells were sorted into a
24 well plate using a FACS Vantage (Becton Dickinson) flow cytometer. Sorted cells
were then transferred into RNAse free eppendorf tubes.
2.2.3 Staining procedures for flow cytometric analysis
2.2.3.1 FACS analysis of extra-cellular Notch1 on primary CML cells
69
In order to study the expression patterns of Notch1 on CML cells, the mononuclear
cells from frozen samples were stained with EA1 monoclonal antibody, which
recognises the extra-cellular domain of Notch1, as well as with a set of antibodies that
identify different myeloid and lymphoid haemopoietic progenitors. First, cells were
washed twice in HBBS/5% NCS and filtered with nylon mesh filter before 105 cells
were transferred to a FACS tube and pelleted at 389 g (1500 rpm) for 5 minutes at
4°C. After removing the supernatant, the cells were re-suspended in 50 µl EA1 or IgG
primary antibodies at the optimum dilution (see table 2.1) and incubated in the dark at
4°C for 20 minutes. The cells were then washed in 2 ml HBBS/5% NCS and
centrifuged at 1500 rpm (389 g) for 5 minutes at 4°C. The supernatant was discarded
and the cells were re-suspended in 50 µl secondary antibody and incubated in the dark
for 20 minutes at 4°C. Cells were then washed as before, and pelleted at 1500 rpm
(389 g) for 5 minutes before the supernatant was removed and the conjugated
antibody at appropriate dilution was added. After another 20 minutes, incubation
period, the cells were washed in 2 ml HBBS/5% NCS, pelleted and re-suspended in
300 µl diluted propidium iodide (PI) for analysis. CD34 antibody was added in all
tubes in order to limit the study of Notch1 and other surface molecules expression to
CD34+ population in normal blood and CML samples. IgG1 hybridoma supernatant
was used as isotype control for all surface markers studied. Flow cytometric analysis
was performed on a FACS Vantage (Becton Dickinson) flow cytomter, and
CellQuest® software was used for data analysis.
2.2.3.2 FACS analysis of extra-cellular Notch1 on K562 cells
In order to study the expression of the extra-cellular Notch1 (ECN1) on the cell
surface of K562 cells, 1 x 106 K562 cells were directly stained with EA1 monoclonal
antibody according to the same staining protocol described in 2.1.3.1. The EA1
primary antibody was used at 1:100 dilution (stock conc. is 2 mg/ml), the IgG1
hybridoma supernatant at equivalent concentration to the primary antibody was used
as an isotype control. Because K562 cells are negative for CD34 surface antigen the
analysis gate used here included all live K562 cells.
2.2.3.3 FACS analysis of intra-cellular Notch1 on K562 cells
70
This method was used to analyse the expression of the intra-cellular Notch1 (ICN1) in
K562 cells. At least 1 x 105 K562 cells were suspended in 100 µl fixing reagent
(Caltag) and incubated at RT for 15 minutes. The cells were then washed with 2 ml
HBSS /5% NCS and centrifuged for 5 minutes at 1500 rpm (389 g). The supernatant
was removed and and the cell pellet was resuspended with 25 µl permibilzing reagent
(Caltag). The b-TAN20 primary antibody which recognises the ICN1 domain was
added directly to the cells at 1:5 dilution (stock conc. is 40 µg/ ml) and the cells were
mixed and incubated at RT in the dark for 40 minutes. The cells were washed twice in
2 ml HBBS/5% FBS and centrifuged at 1500 rpm (389 g) for 5 minutes at 4°C. The
secondary antibody (anti-rat IgG2 FITC) was then added at 1:50 dilution to the cells
which were incubated at RT in the dark for 30 minutes. The cells were then washed
with 2 ml of HBBS/5% FBS and spun at 389 g for 5 minutes. Finally, the cells were
resuspended in 300 µl of HBSS ready for FACS analysis. An appropriate isotype
control (IgG2 rat antibody) was used at a concentration equivalent to the primary
antibody.
2.2.3.4 The P-crkl assay
Crkl is a prominent substrate of the BCR-ABL oncoprotein in CML and binds to both
BCR-ABL and c-Abl. Crkl is prominently and constitutively tyrosine phosphorylated
in CML cells and is not phosphorylated in normal haemopoietic cells (Oda et al.
1994). The levels of phosphorylated crkl (P-crkl) were measured by intra-cellular
FACS technique and the P-crkl expression was utilised as a marker for ABL kinase
activity in this project. Cells from various cell lines or from primary CD34+ CML
cells were harvested from culture media and washed once in 3 ml HBBS/5% FBS. At
least 1 x 105 cells were resuspended in 100 µL fixing reagent (Caltag Laboratories)
and incubated at RT for 15 minutes. The cells were then washed once with 3 ml
HBBS/ 5% FBS and centrifuged at 389 g for 5 minutes. The supernatant was removed
and the cells were resuspended with 25 µl permeabilizing reagent (Caltag
Laboratories) and 2.5 µl of P-crkl primary antibody (New England Biolabs) was added
directly to this buffer. The cells were then vortexed and incubated at RT for 40
minutes before being washed twice with 3 ml HBBS/ 5% FBS. After resuspending the
71
cells in 100 µl buffer the secondary antibody was added directly at appropriate
dilution and the cells were mixed and incubated at RT for 30 minutes in the dark.
Next, the cells were washed twice and analysed by flow cytometry. The P-crkl results
were reported as the mean fluorescence intensity (MFI). The isotype control used in
the P-crkl assay was rabbit IgG at a concentration equivalent to that of the primary
antibody. Positive and negative controls for the P-crkl assay were K562 and JURKAT
cells respectively. The secondary antibody used for measuring the P-crkl levels in cell
lines was the pre-diluted PE F(ab')2 Donkey anti-Rabbit IgG (BD biosciences)
whereas the FITC monoclonal mouse anti-rabbit antibody (Sigma) was used at 1:20
dilution to assess P-crkl expression in CD34+ CML cells.
Monoclonal Ab Fluorochrome conjugate
Target/ lineage specificity
Dilution Supplier
EA1 FITC or PE Ubiquitous 1:100 In house
b-TAN20 FITC Ubiquitous 1:5 DSHB
P-crkl FITC or PE ABL+ HCs 1:40 Cell signaling
CD90 (Thy-1) PE Primitive HCs 1:20 pharmingen
CD34 APC Primitive HCs 1:20 BD
CD38 FITC T, B and CD34+ committed cells
1:50 BD
CD14 FITC Myeloid cells 1:50 BD
CD15 FITC Myeloid cells 1:25 BD
72
CD16 FITC Myeloid cells 1:50 BD
CD33 PE Myeloid cells 1:50 BD
CD7 FITC T cells 1:25 BD
CD3 FITC T cells 1:25 BD
CD19 FITC B cells 1:20 BD
CD45 PE Pan HCs 1:50 BD
Glycophorin-A FITC Erythroid cels 1:50 BD
IgG1 FITC Control 1:20 BD
IgG1 PE Control 1:20 BD
2.3 Molecular biology techniques
2.3.1 RNA extraction
Using RNAse and DNAse free filter tips, sorted cells were transferred to DNAse and
RNAse free eppendorf tubes in a laminar flow cabinet and centrifuged for 3 minutes
at 3000 rpm (1840g) at 4 °C. The supernatant was then removed and the pellet was re-
suspended in 200 µl RNAzol B (Biogenesis) before being vortexed and kept on ice
for 5 minutes. 20 µl of chloroform (Sigma) was then added, and the solution was
vortexed and spun at 13 000 rpm (12470 g) at 4 °C for 15 minutes. Next, the upper
aqueous layer was aspirated into a new eppendorf tube. An equal volume of
Isopropanol (Sigma) was added, mixed, and then incubated at -70 °C for two hours
(up to 1 week). The samples were thawed and pelleted at 13 000 rpm at 4 °C for 30
minutes, before the supernatant was removed and the pellet washed twice with 70%
ethanol (molecular biology grade Sigma) for 10 minutes at 4 °C. The supernatant was
then removed and the pellet was air dried for 1-2 hours before re-suspended in 10 µl
sigma water.
73
Table 2.1 Monoclonal antibodies and the dilutions used in flow cytometric staining experiments. (HCs: Haemopoietic cells, BD: Becton Dickonson, DSHB: The Developmental Studies Hybridoma Bank at the university of IOWA).
2.3.2 Construction of cDNA from low cell numbers by Poly-A PCR
This protocol was typically used for the isolation of RNA from less than 1x105 cells.
Poly-A PCR is a powerful technique for the investigation of gene expression in rare
cell populations such as haemopoietic stem cells. Poly-A PCR results in the unbiased
amplification of cDNA representing all poly adenylated RNA in a sample as small as
a single cell (Brady and Iscove, 1993). Bias for short length cDNA sequences in a
sample is avoided by limiting the length of the initial cDNA produced to an average
length of 350 bp regardless of the size of the original RNA template. Principles of the
poly-A PCR technique are summarised in figure 2.1. Table 2.2 shows a list of the
solutions used in the ploy-A procedure.
cDNA reaction
A first strand buffer was freshly prepared by mixing 192 µl lysis buffer with 4 µl
Rnase inhibitor (Fermentas) and 4 µl primer mix freshly diluted 1:4 with water
(Sigma). 10 µl of this buffer was then transferred to fresh tube and 0.5-1 µl RNA (up
to 100 ng) was added to it. The mixture was then heated for 1 minute at 65 ºC before
it was allowed to cool for 3 minutes at 18 ºC. After cooling on ice, 0.5 µl AMV
Reverse Transcriptase (Roche) was added to each sample, and incubated at 37 ºC for
15 minutes and then heat inactivated at 65 ºC for 10 minutes and placed on ice.
cDNA tailing reaction
An equal volume of fresh 2X tailing buffer, including 0.5 µl Terminal Transferase
(Roche), was added to the samples, before being incubated for 15 minutes at 37 ºC
and heat inactivated by incubating at 65 ºC and then placed on ice.
Poly-A PCR
74
A PCR mix was prepared using the following ratios: 40 µl MMM : 2.7 µl Not1 dT
oligonucleotide (MWG Biotech): 1.5 µl Taq Polymerase (Roche). The final
concentrations of all PCR solution components were as follow:
Tris-HCl pH 8.3 23.5 mMKCl 117.4 mMMgCl2 8.2 mMdNTPS 2.2 mMTriton X-100 0.23%BSA 47 g/mlNot140 oligo 8.33 M
B/M Taq Polymerase 84.84 units/ml
10 µl of the PCR mix was added to 5 µl tailed cDNA and amplified using the
following cycle profile:
25 cycles consisting of 1 minute at 94 ºC, 2 minutes at 42 ºC, and 6 minutes at 72 ºC
linked to another 25 cycles consisting of 1 minute at 94 ºC, 1 minute at 42 ºC, and 2
minutes at 72 ºC.
Reamplification of poly-A cDNA
The globally amplified cDNA, from the previous step, was diluted 1:100 using sigma
water. Next, a 25 µl reaction was prepared by mixing the following: 1µl of the 1:100
diluted global cDNA, 19 µl sigma water, 2.5µl of 10x Taq Buffer (+MgCl2), 2.5 µl of
2.5 mM dNTPS (Roche), 0.25 µl of 150µM NotI Oligo-dT (MWG Biotech), and 0.25
µl 5U/µl Taq Polymerase (Roche). Samples were then run on a PCR program with
the following conditions: 25 cycles consisting of 1 minute at 94 ºC, 1 minute at 42 ºC,
and 2 minutes at 72 ºC. To determine the efficiency of the PCR reaction, 1µl of the
PCR product was run on 1.5% w/v agarose gel.
75
Solution Contents Supplier Final concentration
cDNA/Lysis Buffer
-1 ml 5X First Strand Buffer.- 10 l BSA (Mol Biol Grade 20 mg/ml).- 250 l 10% NP-40.- 3.55 ml Water.
Gibco/BRL- Roche.
- Sigma.- Sigma.
NA.
Primer mix -800 l TaKaRa 2.5 mM dNTPs.- 24 l dT24 (200uM)
- TaKaRa - 2.5 mM. - 5.8 µM
76
2X Tailing Buffer
-1 ml 5X Tailing Buffer.
- 25µl 100 mM dATP. - 1.475 ml water
-Gibco/BRL
- Roche.- Sigma.
-200 mM K cacodylate pH 7.2, 4 mM CoCl2, 0.4 mM DTT
- 1 mM
5X Tailing Buffer
- 0.5 Mpotassium cacodylate PH 7.2.- 10 mM CoCl2.
- 1 mM DTT.
-Gibco/BRL
MMM Buffer -1000 µl 10X Taq Buffer.
- 20 µl 1M MgCl2.- 375 µl 25 mM dNTPs- 10 µl 20mg/ml BSA.- 100 µl 10% Triton X-100.- 2.35 ml H2O
- Roche.
- Roche.- Roche.- Roche.- Sigma.- Sigma.
- 25.94 mM Tris-HCl pH 8.3.- 129.7 mM KCl
- 9.07 mM- 2.43 mM- 51.88 g/ml- 0.26%
77
Table 2.2. List of solutions used in poly-A PCR reaction.
AAAAAA
(1) Reverse transcription
3’5’
mRNA
AAAAAATTTTTTcDNA
dATP Terminal Transferase
3’5’
5’3’
TTTTTTAAAAAATailed cDNA1
(2) Poly-A addition
Reverse Transcriptase
(3) PCR amplification Oligo dT primers + TAQ polymerase
AAAAAATTTTTTAAAAAA
x-TTTTTTcDNA1
5’3’
5’ 3’cDNA2
(4) Amplification
Pool of globally amplified cDNA
5’3’
2.3.3 Construction of cDNA by from high cell numbers
High Capacity cDNA Reverse Transcription Archive Kit (Applied Biosystems) was
used for the cDNA production from cell numbers in excess of 1x105 cells. The High
Capacity cDNA Kit offers superior reverse transcription capacity, efficiency, and
linearity over other commercial kits and has the performance necessary for accurate
quantitation of RNA targets.
A 20 µl volume of the PCR mix from table 2.3 was mixed with 5 µl of RNA. The
reaction mixture was amplified by PCR using the following cycling parameters: 10
minutes at 25 ºC, followed by 2 hours at 37 ºC. All procedures were done using
DNase/ RNase free filtered tips and all reagents were kept on ice during the
preparation of the PCR reaction mix.
78
Table 2.3. Amplification reaction mixture from the High Capacity cDNA Kit
Figure 2.1. Outline of poly-A PCR technique. Preparation of cDNA for poly-A PCR starts by the addition of reverse transcriptase and Oilgo(dT) primer that anneals to the poly-A tail presen at the 3' end of the Mrna (1). Next, an oligo (dA) is added to the 3' of the first strand cDNA using terminal m-RNA transferase to produce tailed cDNA (2). PCR amplification of the dA/dT- bracketed cDNA is then performed using a modified oligo (dT) primer and Taq polymerase to synthesise the global cDNA pool (3). Finally, the poly-A cDNA can then be reamplified using the protocol described in 2.3.2 (4). Bias for short length cDNA sequences in a sample is avoided by limiting the length of the initial cDNA produced to an average length of 350 bp regardless of the size of the original RNA template. Modified from Brady and Iscove (1993).
Kit Component Volume (µl)
10X RT Buffer 2.5
25X dNTPs 1.25
10X Random Hexamers 2.5
Reverse transcriptase (20 U ml-1) 1.25
Sigma H2O 12.5
2.3.4 Gene specific PCR
2.3.4.1 Primers
For each gene studied, PCR primer pairs were designed to be directed towards the
mRNA sequence present within 280-300 bases of the poly-A tail. Table 2.4 shows the
sequences of the set of primers used in the gene expression studies. Most of the
primers were designed with the help of the Primer3 program at
http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi. All primers were
resuspended in H2O (Sigma) to a stock concentration of 100 µM, and used at a
working concentration of 10 µM after further dilution with H2O (Sigma).
2.3.4.2 Optimisation of Primer Sets
To optimize the annealing temperatures for each set of primers gradient PCR was
performed using an Eppendorf Mastercycler gradient PCR thermocycler. The gradient
PCR thermocycler is capable of producing a gradient across the block for the
annealing temperature. Gradient PCR was performed in 10 µl reactions consisting of
5 µl PCR ReddyMix (ABgene), 0.5 µl of forward and reverse primers, 3 µl water
(Sigma) and 1 µl of human genomic DNA diluted 1:500 (Promega). The following
cycle parameters for gradient PCR were used: 5 minutes at 95 ºC linked to 30 cycles
consisting of 1 minute at 94 ºC, 1 minute at gradient annealing temperature between
5-65 ºC, and 1 minute at 72 ºC. This was followed by final cycle for 5 minute at 72
ºC.
2.3.4.3 PCR reaction
79
In a PCR hood, using dedicated pipettes and filter tips, primers were diluted down to a
working dilution of 10µM and a master mix was prepared at 4ºC using the following
recipe in 10µl Reaction:
Reagent Conc. Vol (µl ) Final Conc.
PCR ReddyMix (ABgene) 5.0Primer1 10 µM 0.3 300 nMPrimer2 10 µM 0.3 300 nMWater (Sigma) 3.4
Next, 9 µl of the mastermix was aliquoted into PCR tubes or wells (if using a PCR
plate) and 1 µl of cDNA was added. The reaction was then amplified using the
following cycle parameters: 5 minutes at 95 ºC linked to 28-30 cycles consisting of 1
minute at 94 ºC, 1 minute at specific primer pair annealing temperature (table 2.4),
and 1 minute at 72 ºC. Water (Sigma) was used as negative control.
2.3.4.4 Detection of PCR products
Agarose gel electrophoresis was used to resolve and visualise DNA bands. 1.5 %
agarose was prepared by adding 1.5 g high gel agarose (Sigma) to 100 ml of 0.5
xTBE. The agarose was dissolved by heating in a microwave. Once dissolved and
cooled 5 µl of 1:20000 diluted Vistra Green (Amersham Pharmacia) was added as the
staining agent. The gel was allowed to set before it was placed in an electrophoresis
tank filled with 0.5 X TBE buffer. Next, 5 µl of the PCR product was loaded into the
wells and run for 30-45 minutes at 120 volts. PCR products not amplified with
ReddyMix were first diluted 1:6 with Orange G loading buffer. The size of the
products was determined by loading the GeneRuler 100bp ladder (Fermentas) along
with the samples. Finally, the resulting gel was observed on a Typhon 8600.
Gene name Primer Primer Sequence 5’ – 3’ Length(bp)
Size(bp)
T ºC
Notch1hN1F GTGAGGGACGTCAGACTTGG 20
166 58 ºChN1R AACATCTTGGGACGCATCTG 20
hN2F AAAGCATCTGTCAAATAGGAAAC 23
80
Notch2 205 58 ºC
hN2R TAAGGAATGTTACAAACCAATCA 23
Notch3hN3F CAAGCTGGATTCTGTGTACCTAGT 24
202 56 ºChN3R CCCCAGCAAGGCTATGGAACA 21
Notch4hN4F ATATTTATTGGGCACCTACTAATG 23
166 58 ºChN4R ATAGCAATAGCAGTGGCTAGAAG 23
Hes1Hes1F GTATTAAGTGACTGACCATG 20
140 54 ºCHes1R TCAAACATCTTTGGCATCAC 20
Herp1Herp1F TCATTTCTCTACTGTGTGGAG 21
155 60 ºCHerp1R GTGGTATGTAAAGACTCTTGC 21
Herp2Herp2F CTAATTTTCCTGGGACTGCC 20
216 60 ºCHerp2R TCAAACCCAGTTCAGTGGAG 20
GAPDHGAPDHF CCAGCAAGAGCACAAGAGGAAGAG 24
180 56 ºCGAPDHR AGCACAGGGATACTTTATTAGATG 24
BCR-ABL BCR-ABL FTCCACTCAGCCACTGGATTTAA 22
60 ºCBCR-ABL R
TGAGGCTCAAAGTCAGATGCTACT 24
2.3.5 Real time PCR
2.3.5.1 Overview OF Real Time PCR
Real time PCR is the ability to monitor the progress of PCR in real time. Real time
PCR technique uses the fluorogenic 5´ nuclease chemistry (TaqMan®) or SYBR®
Green I dye chemistry to allow for the quantification of gene expression in the early
phase of PCR reaction. This is in contrast to the conventional PCR method which uses
Agarose gels for detection of PCR amplification at the end-point of the PCR reaction.
This difference in principle of detection makes real time PCR far more sensitive
approach to use in gene expression studies than the traditional PCR method. Gene
quantification by real time PCR can be performed by absolute or relative
quantification. The absolute gene quantification is used to measure the input copy
number of a target gene by using a standard curve. The relative gene quantification is
used to analyze changes in gene expression in a given sample relative to another
reference control sample.
81
Table 2.4 Oligonucleotide primer sequences and annealing temperatures (T).
Real time PCR experiments were performed using either TaqMan® probes or SYBR®
Green. TaqMan® probes are specific sequences of DNA that recognise and bind the
target DNA between the primers. Each probe is labelled with a reporter, fluorescein-
5-carboxamide (FAM) at the 5’ site, and a quencher, carboxytetramethylrhodamine
(TAMRA) at its 3’ site. While the FAM and TAMRA molecules are attached to the
same probe, FAM fluorescence is quenched by TAMRA. During the real time PCR
reaction the 5’ exonuclease activity of Taq polymerase releases the reporter (FAM)
from the probe so its fluorescence in no longer quenched by TAMRA and as a result
FAM emits a fluorescence signal as the real time PCR reaction progresses.
Fluorescence from FAM is measured after each PCR cycle and correlate to the
amount of the PCR products formed during the PCR reaction. SYBR® Green is a
minor-groove DNA binding dye that fluoresces upon binding to double stranded
DNA. As the DNA amplification proceeds in the real time PCR reaction SYBR®
Green dye binds to each new copy of double-stranded DNA and the result is an
increase in fluorescence intensity proportional to the amount of PCR product
produced. Because the SYBR Green binds to any double-stranded DNA, it can also
bind to nonspecific double-stranded DNA sequences including primer dimmers.
Therefore, it was necessary to run a dissociation curve for each amplification to
ensure no non-specific amplification has occurred (Fig. 2.2).
2.3.5.2 Real time PCR protocols
2.3.5.2.1 Real time PCR using TaqMan®probes
This method was used to measure Notch1, Notch2, and Hes1 genes on cDNA samples
from CML patients as well as normal bone marrow samples. The primers used in real
time PCR are listed in table 2.5. cDNA samples were diluted 1:100 with H2O (Sigma).
Each reaction was made up to a total volume of 25 μl, with 10 μl of diluted cDNA,
12.5 μl of 2x Power SYBR® Green master mix and 0.5 μl of each 10 μM primer and
0.05 μl of 100 μM probe. This mixture was added to a 96 well plate (Bioplastics) and
sealed with StarSeal 96 well plate sealant (STARLAB) and the plate was then
centrifuged to ensure reagents were at the bottom of the wells. The ABI 7300 PCR
machine (Applied Biosystems) was used for data collection and analysis. The analysis
software was set up to ignore SYBR® Green and only look for amplification
involving the TaqMan® probe. The cycling parameters used were 95 °C for 10
82
minutes, followed by 40 cycles of 95 °C for 15 seconds and 60 °C for 1 minute. To
minimize contamination, filtered tips were used and plates and reagents were kept on
ice at all times.
2.3.5.2.2 Real time PCR using SYBR® Green
This method was used to measure Hes1 gene expression on cell lines and on primary
CML samples following treatment with IM, GSI, and VPA drugs. cDNA samples
were diluted 1:50 with H2O (Sigma). Each reaction was made up to a total volume of
15 μl, with 5 μl of diluted cDNA, 7.5 μl of 2x Power SYBR® Green master mix and
0.3 μl of each 10 μM primer and 1.9 μl of sigma H2O. The reaction mixture was
added to 96 well plate and analysed by the ABI 7300 PCR machine as described
above [2.3.5.2.1]. Following the PCR amplification the PCR plate were re-run to
obtain a dissociation curve to ensure no non-specific amplification has occurred (Fig.
2.2)
2.3.5.3 Data analysis
The real time PCR data in this project were analysed using the relative gene
quantification method to study changes in gene expression. The relative change in
gene expression was determined using the 2 –ΔΔCT method (Livak and Schmittgen,
2001) which is also known as the Comparative CT method. The CT value is the cycle
number at which the level of fluorescence exceeds the level of background
fluorescence and passes the fixed threshold. The CT value is indicative of the relative
amount of the target gene in a sample because samples with a low starting amount of
template require more PCR cycles to produce a fluorescence signal above the
background level, and therefore have a high CT value whereas samples with a high
amount of template require fewer cycles to reach the fixed threshold and therefore
have a low CT. In the 2 –ΔΔCT method, the CT (Cycle threshold) values of a sample are
compared to those of a biological calibrator sample such as a non-treated sample or
RNA from normal tissue. The CT values of both the calibrator and the sample of
interest are normalised to an appropriate endogenous housekeeping gene such as
GAPDH to ensure that similar levels of total cDNA found in each sample.
Calculation of relative gene expression using the the 2 –ΔΔCT method
83
The internal control gene (housekeeping gene) used in this project was GAPDH
whereas the biological calibrator was either normal control sample from healthy
donors or untreated sample depending on the experimental design. The CT values
provided from real-time PCR instrumentation were imported into a spreadsheet. To
analyse the gene expression of Notch genes in CML samples the gene expression in
CML and NBM samples was normalised to the GAPDH house keeping gene and
represented as DCt values. For each sample the mean DCt value was calculated.
Comparison of gene expression between NBM and CML samples was derived from
subtraction of NBM DCt values from CML DCt values to give a DDCt value, and
relative gene expression was calculated as 2 –ΔΔCT. Due to the inherent variations in
gene expression between different normal bone marrow (NBM) samples it is not
surprising that the DDCt values for the biological calibrator (NBM) will not be zero
and therefore the relative gene expression values (2 –ΔΔCT) from NBM samples will not
be equal to one.
Using the 2 –ΔΔCT method in experiments where the change in gene expression was
studied in a sample following a drug treatment, the data are presented as the fold
change in gene expression normalized to an endogenous reference gene (GAPDH)
and relative to the untreated control. Comparison of gene expression between treated
and untreated cells was derived from subtraction of untreated cells DCt values from
treated cells DCt values to give a DDCt value, and relative gene expression was
calculated as 2 –ΔΔCT. For the untreated control sample, DDCt equals zero and 20 equals
one, so that the fold change in gene expression relative to the untreated control equals
one, by definition. For the treated samples, evaluation of 2 –ΔΔCT indicates the fold
change in gene expression relative to the untreated control.
2.3.5.4 Validation of the 2 –ΔΔCT method
For calculation to be valid, the amplification efficiencies of the target and the
housekeeping genes must be approximately equal. This can be established by looking
at how ΔCT varies with template dilution. If the plot of cDNA dilution versus ΔCT is
close to zero, it implies that the efficiencies of the target and housekeeping genes are
very similar. This was calculated for Hes1 and GAPDH primers prior to their use with
84
SYBR® Green PCR and the obtained value was 0.021 indicating the 2 –ΔΔCT method
can be used to generate relative quantitative data using the Hes1 and GAPDH primers.
Target Primer Primer Sequence 5’ – 3’ AnnealingTemp °C
Notch1
hN1F TCCCCCGGCTCTACGG60 hN1R ACACAGTAAAAATCAACATCTTGGGAC
hN1TP CCGCGTGGTGCCATCCCC
Notch2
hN2F AGCCATAGCTGGTGACAAACAG60
hN2R CAACTACTTCGCATTTCCATTGG
hN2TP AGGCACCTTGTCCCTGAGCAACC
Hes1
Hes1TF GCCACCCCTCCTCCTAAACTC60
Hes1TR TCAAAGAGAAGGAGGCAAGGAAA
Hes1TP CAACCCACCTCTCTTCCCTCCGGA
85
(A) Real Time PCR
(B) PCR dissociation curve
Table 2.5. Primers used for real time PCR.
2.3.6 Protein Analysis
2.3.6.1. Protein extraction and determination of concentration
K562 cells were centrifuged at 5000 rpm (1840g) for 2 minutes before being
transferred to an eppendorf tube and resuspended in 100 µl RIPA buffer (Table 2.6)
containing freshly added phosphatase inhibitor and protease inhibitors. The
phosphatase inhibitor used in protein extraction was 1 mM Na3 VO4 (Sigma) whereas
the protease inhibitors were 1 mM Phenylmethanesulfonyl fluoride (Sigma) and 5 µg/
ml Leupeptin. After leaving the cells with RIPA buffer for 5 minutes on ice the
eppendorf tube was spun at 7900 g for 10 minutes at 4 °C. The supernatant was then
transferred to a fresh eppendorf tube and stored at -20 °C.
Reagent Concentration Supplier
86
Fig. 2.2. Real Time PCR. (A) An example of real time PCR reaction. The X-axis represents the PCR
cycle number and the Y-axis represents the magnitude of fluorescence signal (ΔRn). The green line represents the fixed threshold. The CT value is the cycle number at which the level of fluorescence exceeds the level of background fluorescence and passes the fixed threshold. The intersection of the green line with the amplification curves on their exponential phase gives a CT value, which can be used to calculate the relative amounts of cDNA present in different samples.
(B) An example of the dissociation curve performed after a SYBR® Green PCR. Non specific amplification of primer dimers is not detected here as they dissociate at around 70 °C. The dissociation curve observed here is indicative of specific amplification of the desired PCR product.
Table 2.6: RIPA buffer ingredients and concentrations.
Tris-Chloride (PH 7.4) 20 mM Sigma
Sodium Chloride 150 mM Sigma
EDTA 5 mM Sigma
Nonidet P40 (NP-40) 1% (w/v) Sigma
The concentration of protein was determined by the comparison of absorbance to
standards of known concentration. The standards were made up by preparing different
dilutions of BSA (Sigma) in water to have final concentrations of 1.25, 2.5, 5, 10, 15,
and 20 µg/ ml respectively (Table 2.7).
Standard concentration (µg/ ml) 1.25 2.5 5 10 15 20
Volume of 2mg/ ml BSA (µl) 0.61
2
1.25 2.5 5 7.5 10
Volume of water (µl) 9.38
8
8.75 7.5 5 2.5 0
The standards were then made to 1000 μl containing 200 μl of 1:5 diluted BIORAD
Protein Assay reagent (BIO-RAD), respective volume of BSA (table 2.6), 1μl RIPA
buffer and H2O. From this mixture, 300 μl was added to a 96 well plate in triplicate.
For each sample, 1 μl of sample was added to 799 μl of H2O and 200 μl of 1:5 diluted
BIORAD Protein Assay reagent before 300 μl were added in triplicate to the wells of
a 96 well plate. The absorbance values of each of the samples were measured on an
ELx800 plate reader (BIOTEK) and compared to a blank control containing only H2O
and BIO-RAD Protein Assay. The KC junior software (BioHit) was used to create a
standard curve from which the equation of the graph was used to calculate the protein
concentrations in the samples.
2.3.6.2 SDS-PAGE and Western Blott
Sodium dodecyl sulphate poly acrylamide gel electrophoresis (SDS-PAGE) method
was used to separate the proteins in the cell lysates.
Protein separation
Glass plates were washed with ethanol and assembled. The running gel solution
(Table 2.8) was made with TEMED added last and then the solution was poured into
87
Table 2.7. Standards for protein concentration determination.
the glass plates. After approximately 15 minutes the stacking gel (Table 2.8) was
prepared and added with a comb being inserted to form wells. The protein samples
where diluted with sigma water in order to have the same protein concentration in all
samples. Protein samples were then boiled in 2x sample buffer and H2O in a volume
of 15 μl for 5 minutes, briefly centrifuged. Once the gel had set, the plates were
moved to the tank, which was filled with 1x running buffer (Table 2.8) containing 1%
SDS (v/v). Protein samples were loaded onto the gel along with 3 μl Precision Blue
marker (BIO-RAD). Electrophoresis was carried out at 150 v until the marker reached
the bottom of the gel.
Protein Transfer and antibody staining
Following the separation of protein by gel electrophoresis, the proteins were
transferred to a nitrocellulose membrane (Sigma) by electrophoresis. The gel was
removed from the tank and soaked in transfer buffer (20% 1x running buffer and 80%
methanol). Two Hybond-N pads (Amersham Pharmacia) and a nitrocellulose
membrane were soaked in the transfer buffer before a sandwich was made up
consisting of a pad, the membrane, the gel and another pad. After removing air
bubbles the sandwich was placed in a Transblot Semi Dry Transfer Cell (BIO-RAD)
and run at 100 mA for 115 minutes. Next, the membrane was removed and placed in
20 ml Blocking buffer (1x PBS containing 5 % Marvel (Tesco) and 1% (v/v)
TWEEN® 20 (Sigma)) for 1 hr at RT on shaking platform to prevent non-specific
binding to the membrane. The membrane was then transferred to a heat-sealable bag
with 2 ml of antibody solution (the primary antibody diluted in 1x PBS containing 1%
Marvel and 1% (v/v) TWEEN® 20) and left on a shaking platform for 2 hrs at RT or
at 4 °C overnight. The membrane was then washed once with water and three times
with PBST (1x PBS containing 1% (v/v) TWEEN® 20) for 15 minutes at RT on
shaking platform. The secondary antibody was added as described above for the
primary antibody. After incubation for one hour at RT the membrane was washed for
4 times at 10 minutes intervals at RT on shaking platform. After removing the excess
solution the membrane was placed onto saran wrap and mixed with
Chemiluminescence Substrate Kit (Pierce) according to the manufacturer’s
instructions, before being placed in an autoradiography cassette with a piece of Kodak
Biomax film and developed in a Fuji film FPM800A automated developer.
88
2.4 Statistics
Comparison between two different biological samples
Since the CML and NBM samples are biological samples in which normal
distribution of the samples is unlikely and because the two groups were not matched
pairs the Mann-Whitney test was the appropriate test to compare the differences in
gene expression between NBM and CML samples.
Comparison between the means of one sample matched pairs
To compare between the means of one sample before and after a drug treatment a
paired T-test was carried out. The GraphPad Prism statistical package (GraphPad
Software Inc., USA) was used to run statistical tests in this project.
Materials Supplier Volume (μl)
Running Gel
Acrylamide Sigma 1500
1.88 M Tris pH 8.8 Melford 1200
0.5% SDS Sigma 1200
Distilled H2O Self 2100
Tetramethylethylenediamine(TEMED)
Sigma 5
10% (w/v) ammonium persulphate(APS) in H2O
Sigma 30
Stacking gel
Acrylamide Sigma 330
6.8 M Tris pH 6.6 Melford 400
0.5% (v/v) SDS Sigma 400
89
H2O Self 870
TEMED Sigma 2
10% (w/v) APS in H2O Sigma 10
2x Sample Buffer
1 M DTT Sigma 1000
10% SDS (w/v) Sigma 2000
1 M Tris pH 6.8 Melford 800
1% Bromophenol Blue (w/v) Sigma 100
Glycerol Amersham 1500
Distilled H2O Self 4600
10x Running Buffer
Material Supplier Preparation
Tris (30.2 g) Melford PH adjusted to 8.3 and madeup to 1 l. For SDS-PAGE, 5ml of 10% SDS was added to495 ml of 1x buffer.
Glycine (144 g) BDH
Chapter 3
Investigating Notch signalling in chronic myeloid leukaemia
3.1 Introduction
The role of Notch signalling in normal haemopoiesis and in malignant transformation
is well established. It was originally found that the Notch1 receptor gene is expressed
in human CD34+ hematopoietic precursors, including the more primitive CD34+ Lin-
cell subset (Milner et al. 1994). Subsequently it was shown that Notch1 is also
expressed in lymphoid, myeloid, and erythroid precursor populations, as well as in
more mature progentors (Milner and Bigas, 1999) suggesting that Notch functions in
multiple lineages and at various stages of haemopoiesis. The expression of the Notch
90
Table 2.8. SDS-PAGE and western Blott reagents.
ligand Jagged was also reported in human bone marrow stroma and Jagged1-Notch
signalling was shown to promote the cell survival of human CD34+ cells (Walker et
al. 1999).
Interestingly, Notch1 and Notch4 transcript expression were found to be expressed at
significantly higher levels in the more primitive human CD34+ CD38- populations as
compared with the more mature CD34+ CD38+ progenitors (Vercauteren and
Sutherland, 2004). The authors also found that constitutive activation of Notch1 or
Notch4 in human CD34+ lin- cells results in the maintenance of stem cells as shown
by the increase in long-term culture initiating cells in vitro.
The link between Notch signalling and leukaemia has been established in T-ALL in
which the t(7;9) breakpoint translocations involving the Notch1 gene results in
expression of constitutively activated intracellular Notch1 protein which has been
shown to induce T-ALL in a mouse transplantation model (Pear et al. 1996). The role
of dysregulated Notch signaling in T-ALL has been further emphasized by the finding
that more than 50% of human T-ALLs have activating mutations that involve the
extracellular heterodimerization domain and/or the C-terminal PEST domain of
Notch1 (Weng et al. 2004).
The role of Notch signalling in chronic myeloid leukaemia is not well characterised.
Notch signalling activity has been reported to be downregulated in the blastic phase of
CML as compared to the chronic phase of the disease (Sengupta et al. 2007).
However, this study was limited in that Notch signalling was only investigated in the
total CD34+ cells rather than in the leukaemic stem cells in the chronic phase of
CML. It also did not evaluate Notch signalling activity in the chronic phase of CML
as compared to normal haematopoeitc stem cells.
The aim of this chapter is to investigate Notch signalling in the CD34+ cells in the
chronic phase of CML by measuring the gene expression levels of Notch receptors
91
and their target genes by conventional and real time PCR. The expression of Notch1
will also be investigated at the protein level using flow cytometry.
3.2 Results 3.2.1. Gene expression analysis
Poly-A cDNA samples derived from both normal bone marrow samples and CML
samples were used to study the expression patterns of Notch receptors and Notch
target genes by conventional semiquntitative PCR. The results of these experiments
were further quantified by real time PCR studies. In all gene expression studies,
GAPDH was used as a housekeeping gene.
3.2.1.1 Expression pattern of Notch genes in CML
The expression of Notch1, Notch2, Notch3, and Notch4 receptors was studied in four
CML patient samples along with four normal bone marrow samples which had
previously been prepared in the lab by Dr. S. Ainsworth using the PolyA PCR
technique. Cells in each sample had been fractionated into CD34+ Thy+, CD34+ Thy-
and total CD34+ subsets to enable the study of gene expression in haemopoietic
progenitors at different maturation levels and sorted cells were of 95% purity. Figure
3.1 shows the PCR profiles of both normal and CML samples. The housekeeping
gene glyceraldehydes-3-phosphate dehydrogenase (GAPDH) was used to assess the
quality of cDNA samples and to check the uniformity of DNA content among
different samples.
Notch1 was expressed in all normal samples and in all three haemopoietic CD34+,
Thy+, and Thy- subpopulations. One exception was the CD34+ population in NBM4
which was surprising since both the Thy+ and Thy- subsets expressed Notch1. This
was also the case for the CML samples with no clear evidence of differences in the
expression between the CD34+, Thy+, and Thy- subpopulations were seen (Figure
3.1).
92
Notch2 was weakly expressed in normal and CML samples and in all three CD34+
subpopulations (Figure 3.1). The initial PCR analysis was done at 28 cycles and
showed very weak bands in normal cDNA samples so the number of amplification
cycles was increased to 30 cycles in order to visualise clearer bands. The annealing
temperature for Notch2 primers was also adjusted after determining the optimum
annealing temperature to be 58 °C by gradient PCR. Under these conditions weak
bands could be seen in all samples.
The study of Notch3 on normal and CML samples did not reveal any message using
the PCR conditions and the set of primers described here (results not shown). This
was repeated and the activity of Notch 3 primers was confirmed on human genomic
DNA, as a positive control, where PCR showed clear bands under the same
experimental conditions.
Notch4 was not constantly expressed and was seen in 2/4 normal CD34+ and in 2/4
CML CD34+ samples (Figure 3.1).
In order to determine whether there were any quantitative differences between the
Notch expression seen in normal BM and CML CD34+ populations real time PCR
was performed. Data from Real time PCR experiments showed no significant increase
in Notch1 expression in CD34+ CML samples as compared to normal bone samples.
Similarly there was no difference in Notch1 expression in the CD34+ Thy-
subpopulation. However, a 3-4 fold increase was seen in CD34+ Thy+ cell subset. A
Mann-whitney statistical test showed that this upregulation was only significant in the
most primitive CD34+ Thy+ cell subset (Figure 3.2).
Notch2 was shown to be overexpressed in all CML samples and in all different
subpopulations investigated here by real time PCR (n=4) (Figure 3.3). There was
more than a 100 fold increase in Notch2 expression in the CD34+ Thy+, CD34+
Thy- , and in the total CD34+ cell subsets as compared with NBM samples. However,
the increased level of expression was only significant in the CD34+ Thy+ and in the
total CD34+ cell subsets (P value= 0.02 for both cell subsets). Although real time
PCR showed an upregulation of Notch2 in the CD34+ Thy- cell subset, this was not
statistically significant by the Mann-Whitney test (P value= 0.057).
93
3.2.1.2 Expression pattern of Notch target genes
The expression of Notch target genes Hes1, Herp1, and Herp2 was studied in CML in
order to assess the activity of Notch signalling in CML as compared to normal CD34+
cells. Results showed that neither Herp1 nor Herp2 were expressed in either normal
marrow samples or CML patient samples (Figure 3.4). Interestingly, Hes1 appeared to
be expressed in some normal samples and some CML samples with no precise pattern
of activity discernable. This suggests that Notch signalling was activated in these
samples. There was no obvious pattern of Hes1 expression at the haemopoietic
differentiation levels in the normal or CML samples studied here. It is worth
mentioning that the initial number of PCR cycles for HES1 was 30 cycles. This had to
be increased to 32 cycles to clearly show the difference in gene expression between
normal samples and CML patient samples (Figure 3.4).
Quantitative real time PCR analysis demonstrated that that Hes1 was overexpressed in
CML. A greater than 100 fold change increase in the Hes1 expression was observed
in all CML samples and in all the CD34+ cell subsets studied (n=4) (Figure 3.5). The
Mann-Whitney statistical test showed that the overexpression of Hes1 in the CD34+
Thy+ and total CD34+ cell subsets was highly significant (P= 0.007) and significant
(P= 0.0.2) respectively. On the other hand, the upregulation of Hes1 in the CD34+
Thy- cell subset was just outside the biological level of significance (P= 0.057).
94
Thy+
Thy -
CD34+
Thy+
Thy -
CD34+
Thy+
CD34+
Thy+
Thy -
CD34+
Notch2GAPDH
Thy+
Thy+
Thy+
Thy+
Thy -
CD34+
Thy -
Thy -
Thy -
CD34+
CD34+
CD34+
Notch2GAPDH
NB
M9
NB
M4
NB
M2
NB
M1
CML4
CML3
CML1
CML2
Notch1 Notch1Notch4 Notch4
HGDNA
95
Figure 3.1. Notch expression of receptor genes in CD34+ populations isolated from normal bone marrow (NBM) and CML samples. PCR reactions are shown for four normal bone marrow samples on the left panel and for four CML samples on the right panel. For each sample the expression within each of the CD34+, Thy-, Thy+ subpopulation is shown. The gene expression profiles for Notch1, Notch2, and Notch4 are shown. Notch3 is not shown as no gene expression was seen in any of the NBM and CML samples. The housekeeping gene GAPDH was used as a control to assess the quality of cDNA in each sample. The number of PCR amplification cycles was 28. Lower left panel shows human genomic DNA (HGDNA) which was used as a positive control for each set of oligonucleotides.
0
1
2
3
4
5
6
7
8
Thy+ Thy- CD34+
Rel
ativ
e g
ene
exp
ress
ion
N1-CML
N1-NBM
*
CD34 + CD34 +
96
Figure 3.2. Real time PCR analysis of Notch1(N1) expression on CD34+ cell subsets from NBM and CML patients. Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. For each sample the mean DCt value was calculated. Comparison of gene expression between NBM and CML samples was derived from subtraction of NBM DCt values from CML DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. Significant upregulation was observed in the CD34+ Thy+ cell subset (P≤ 0.05). Statistical significance was calculated using Mann-Whitney test. (* = P ≤0.05).
0.1
1
10
100
1000
10000
100000
Thy+ Thy- CD34+
Rel
ativ
e g
ene
exp
ress
ion
N2 -CML
N2-NBM
*
*
CD34 + CD34 +
97
Figure 3.3. Real time PCR analysis of Notch2 expression on CD34+ cell subsets from NBM and CML patients. Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. For each sample the mean DCt values was calculated. Comparison of gene expression between NBM and CML samples was derived from subtraction of NBM DCt values from CML DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. Results showed an upregulation of Notch2 in CD34+ CML cells. This upregulation was significant in both the CD34+ Thy+ and in the total CD34+ cells (P≤ 0.05). The expression of Notch2 in the CD34+ Thy- was very close to significance (P= 0.057). Statistical significance was calculated using Mann-Whitney test. (* = P ≤0.05).
Thy+
Thy -
CD34+
Thy+
Thy -
CD34+
Thy+
CD34+
Thy+
Thy -
CD34+
GAPDH
Thy+
Thy+
Thy+
Thy+
Thy -
CD34+
Thy -
Thy -
Thy -
CD34+
CD34+
CD34+
NB
M9
NB
M4
NB
M2
NB
M1
CML4
CML3
CML1
CML2
Hes1 GAPDH Hes1Herp1 Herp1Herp2 Herp2
HGDNA
Figure 3.4. Expression of Notch target genes in CD34+ populations isolated from NBM and CML samples. PCR reactions for HES1, HERP1, and HERP2 are shown for four different normal bone marrow samples (NBM) (left panel) and four different CML samples (right panel). The number of PCR amplification cycles was 28 except for HES1 where the PCR reaction was carried out at 32 cycles. All samples were run in duplicates and the house keeping gene GAPDH was used to assess the quality of each cDNA sample. The lower left panel shows human genomic DNA (HGDNA) which was used as a positive control for each set of oligonucleotides.
980.01
0.1
1
10
100
1000
10000
100000
1000000
Thy+ Thy- CD34+
Rel
ativ
e g
ene
exp
ress
ion
CML
NBM
**
*
CD34 + CD34 +
3.2.2 Flow cytometric analysis of Notch1 in CML
The gene expression studies in section 3.2.1 showed that Notch1 and Notch2 were up-
regulated at the message level in the CD34+ Thy+ population in CML patients in
chronic phase. This finding along with the observation of elevated levels of Hes1 in
CD34+ populations including CD34+ Thy+ susbset suggested that Notch signalling
may be overactivated in CML patients. This observation raised the possibility that
99
Figure 3.5. Real time PCR analysis of Hes1 expression on CD34+ cell subsets from NBM and CML patients.Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. For each sample the mean DCt values was calculated. Comparison of gene expression between NBM and CML samples was derived from subtraction of NBM DCt values from CML DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. Results showed an upregulation of Hes1 in CD34+ CML cells. This upregulation was significant in both the CD34+ Thy+ cell subset (P≤ 0.01) and in the total CD34+ cells (P≤ 0.05). The expression of Hes1 in the CD34+ Thy- cell subset was very close to significance (P value = 0.057). Mann-Whitney statistical test was used here to compare the difference in Hes1 expression between CML and NBM samples. (* = P ≤0.05, ** = P ≤0.01).
Notch1 may be also over-expressed at the protein level. To address this question,
mononuclear cells from three CML patients in chronic phase were stained with EA1,
a monoclonal antibody produced in the Buckle lab that recognises the extracellular
domain of Notch1 (Dr. V. Portillo, personal communication, Appendix 1).
Initial FACS staining experiments demonstrated the presence of Notch1 on the cell
surface of live CD34+ population from CML patients. When FACS profiles were
compared to those in normal cord blood samples, broadly similar staining profiles
were seen. The analysis of expression of Notch1 in CML was then expanded to cover
a wide range of primitive stem cell populations, myeloid, and lymphoid committed
cells using lineage specific surface markers expressed within the CD34+
compartment. These markers were selected to demonstrate the expression of myeloid
progenitors (CD33, CD14, CD15, CD16), B-cell lymphoid progenitors (CD19), T-cell
lymphoid progenitors (CD3, CD7), and the more primitive Thy-1 (CD90)
haemopoietic stem cell marker. Another primitive cell discriminator used was CD38,
as stem cells are enriched in the CD38- subset of the CD34+ compartment.
Using multi-parameter flow cytometry, triple colour stainig was used with a CD34
monoclonal antibody, a lineage/ primitive cell marker, and the EA1 antibody included
in all tubes. All antibodies were of the IgG1 isotype. To correct for background
fluorescence in each FACS tube, a mouse IgG1 hybridoma supernatant, which was
tested to be negative for Notch1 protein (Dr. V. Portillo, personal communication),
was used as an isotype control for the EA1 antibody. Since cryopreserved CML
samples were used in the analysis, thawed cells were filtered by nylon mesh filter to
remove large clumps of dead cells. Dead cells were also excluded from the analysis
by staining cells with propidium iodide (PI) and acquiring only live cells.
FACS analysis showed that the percentage of CD34+ population varied between 7 %
and 30 % out of the total mononuclear cells in the CML samples examined here. From
this CD34+ population, 35 % (± 1.8) of cells expressed Notch1 (n=4) (Fig. 3.6).
Notch1 was expressed on the surface of subpopulations of (CD34+ CD14+, and
CD34+ CD33+) myeloid progenitors. FACS staining did not detect neither CD34+
CD15+ nor CD34+ CD16+ myeloid progenitors (Figure 3.6).
100
There was no or little expression of B-lymphoid (CD34+ CD19+) and of the T-
lymphoid (CD34+ CD3+) progenitors but CD34+ CD7+ progenitors could be found.
Interestingly 24.5 % ± 9.6 of the CD34+ CD7+ progenitors expressed Notch1 (n=4)
(Fig. 3.7). Finally the presence of Notch1 in the very primitive haemopoietic CD34+
Thy+ and CD34+ CD38- progenitors was assessed (Figure 3.8 & Figure 3.9). The
initial staining of EA1 in CD34+ Thy+ cells showed a diagonal pattern of staining
which seems non-specific and could not be corrected using the software compensation
tool during acquisition of cells before analysing the expression pattern. Therefore, the
staining was repeated with an extra step of blocking with purified mouse IgG to
prevent non-specific binding in the reaction which was successful in improving the
pattern of staining and produced well compensated FACS plots (Figure 3.9). The data
obtained from three CML samples showed that Notch 1 was expressed in 21.6 % of ±
2.3 of the CD34+ Thy+ population (Figure 3.10).
Table 3.1 indicates percentages of Notch1 expression among different CD34+ cells
subsets in CML samples as compared with expression on cord blood (Cord blood data
provided by Dr. V. Portillo).
101
CD14 CD14
IgG1
CD15
EA1
CD15
CD16 CD16
CD34 CD34
CD33 CD33
A B
C D
E F
G
H
I K
4.5 ± 2.1
9 ± 6.6
0.5 ± 0.5
33.5 ± 19.9
35 ± 1.8
102
Figure 3.6. Notch expression on CD34+ myeloid progenitors in CML. Mononuclear cells from CML samples were stained with CD34, specific myeloid lineage markers and the anti extra cellular Notch (antibody EA1). Staining for CD34 gated cells is shown. Panels A, C, E, and G show costaining with lineage marker and isotype control. Panels B, D, F, and H show costaining with lineage marker and the EA1 antibody. Panel I shows costaining with CD34 and isotype control and panel K shows costaining with CD34 and EA1.IgG1 hybridoma supernatant was used as an isotype control. Data shown is from one experiment representative of three different patient samples.
103
EA1
CD3
IgG1
CD7 CD7
CD3
CD19IGG1
A B
C D
E F
3.6 ± 1.4
24.2 ± 9.6
1.6 ± 1.6
104
Figure 3.7. Notch expression on CD34+ lymphoid progenitors in CML. Mononuclear cells from CML samples were stained with CD34, specific lymphoid lineage marker and the anti extra cellular Notch antibody EA1. Staining for CD34 gated cells is shown. Panels A, and C show costaining with lymphoid lineage marker and isotype control. Panels B, D, and F show costaining with the lineage marker and the EA1 antibody. IgG1 hybridoma supernatant was used as an isotype control except with CD19 in which mouse IgG1 FITC and PE (panel E) was used to set the quadrant markers for background fluorescence signal. Data shown is from one experiment representative of three different patient samples.
CD38
CD34
EA1IgG1
(B)
(A)
IgG1EA1
CD34
SSC
15.3 ± 2.1
35 ±1.8
105
Figure 3.8. CD34 gating strategy and the Notch expression in CD34+ CD38- cell subset in CML. Mononuclear cells from CML samples were costained with CD34 and anti Notch1 antibody (EA1).and the stem cell markers CD34, and CD38. The first plot (A) shows the CD34 gating strategy used in all FACS plots in this study. The expression of Notch1 in the total CD34+ population in CML is shown in the right hand plot on (A) as compared to the isotype control IgG1 in the middle plot. Panel B shows the Notch1 expression in the primitive CD34+ CD38- cell subset which is enriched for stem cells. The percentage of Notch1 in the CD34+ CD38- is 15.3 ± 2.1 (n=3).
Thy-1
IgG1 EA1
A
B
106
Figure 3.9. The problem of EA1 non-specific binding within the CD34+ Thy+ cell subset. The expression of Notch1 in the CD34+ Thy+ cell subset showed a nonspecific diagonal pattern of staining (panel A) before it was corrected by including extra blocking step in the reaction (panel B). After staining with EA1 antibody, cells were incubated with purified mouse IgG1 for 10 minutes before the addition of CD34 antibody in the final step of the reaction. Because both EA1 and CD34 were mouse antibodies, the blocking step seems to be necessary to prevent nonspecific binding of CD34 antibody. This approach was repeated twice in two different CML samples.
CD34 CD34
Thy
Thy Thy
IgG1 Ea1
21.6 ± 2.3
107
Figure 3.10. The expression of Notch1 in the CD34+ Thy+ cell subset. Mononuclear cells from CML samples (N=3) were costained with EA1 and the stem cell marker thy-1. The upper panel shows the gating strategy where only cells positive for both CD34 and Thy-1 antibodies where used in the analysis of EA1 expression. The lower panel shows that Notch1 is expressed in the primitive CD34+ thy+ population in CML. The percentage of EA1 in CD34+ Thy+ cells is 21.6 ± 2.3 (n=3). IgG1 hybridoma supernatant was used as an isotype control.
Cell subset Mean of expression of EA1 in
CML (±SEM)Mean of expression of EA1 in
CB (±SEM)
Total CD34+ 35 ±1.8 21 ±10
CD34+ Thy-1+ 21.6 ± 2.3 12 % ± 3
CD34+ CD14+ 4.5 ±2.1 ND
CD34+ CD15+ 9 ±6.6 ND
CD34+ CD16+ 0.5 ±0.5 ND
CD34+ CD33+ 33.5 ± 19.9 26 ±5
CD34+ CD7+ 24.5 ±9.6 33 ±7
CD34+ CD3+ 3.6 ±1.4 ND
CD34+ CD19+ 1.6 ±1.6 20 ±7
CD34+ CD38- 15.3 15
Table 3.1. The average expression of EA1 in different cell lineages in CML and cord blood (CB).FACS analysis of Notch1 in different myeloid, lymphoid, and more primitive lineages in CML was done by costaining mononuclear cells with both EA1 antibody and a lineage specific cell surface marker. Results shown here are representative of the total CD34+ cells in each sample. The mean of expression refers to percentage of each cell population in the left column that was positive for EA1. The means of expression were measured from four different CML samples (n=4). The data from CD34+ CML cells were compared to data obtained from crod blood samples (Right column). The EA1 expression was investigated in the CD34+ CD38- cell subset in two CML samples and two CB samples (n=2).
3.3. Discussion
3.3.1 Expression pattern of Notch genes in CML
A study of Notch receptor genes N1-4 was carried out in four CML patients in chronic
phase in order to investigate the status of the Notch signalling pathway in CML. Since
108
CML is a disease that originates in the haemopoietic stem cell compartment, cDNA
from CD34+ cells were used in order to have data representative of the progentitor
compartment. The study of Notch signalling in CML was restricted to the chronic
phase of the disease where the only known genetic abnormality is the BCR-ABL
fusion gene. Since cells acquire several and complex genetic changes beside the BCR-
ABL fusion gene as they transform to blast crisis phase, it becomes more difficult to
interpret interactions between Notch signalling components and the BCR-ABL.
The expression pattern of the Notch receptor genes has not been studied in CML
before. The conventional PCR data showed that there was no preferential expression
of the gene in the three fractionated cell subsets studied. It appeared that the
expression of Notch1 during the chronic phase of CML can be traced at least to the
very primitive CD34+ Thy+ haemopoietic cells and the expression continues in the
less primitive CD34+ Thy- cell compartment. The highly sensitive real time PCR
approach confirmed the previous findings. Interestingly, the quantitative real time
PCR data showed an up-regulation of Notch1 in CML samples. This up-regulation
was significant in the more primitive CD34+ Thy+ cell subset in the bone marrow.
Apart from gene array expression profiling studies, expression of Notch receptor
genes has not been fully characterised before in CML. Bruchova et al (2002) used an
array technology to study the gene expression profile of hundreds of genes in the
chronic phase of CML and showed that Notch1 is down-regulated in CML
mononuclear cells. However, their findings cannot be compared with the results of
this study because of differences in sampling and techniques between the two studies.
The current study looked at Notch1 expression only in the CD34+ cell subsets in
CML including the mostly enriched stem cell CD34+ Thy+ cell subset whereas
Bruchova group sample was rather heterogeneous and included all mononuclear cells.
The finding that Notch1 is significantly up-regulated in the most primitive CD34+
Thy+ in the chronic phase of CML is interesting. This raises the possibility that Notch
signalling is involved in the survival or self-renewal of leukaemic stem cells in CML.
This possibility is supported by a recent study which demonstrated that leukaemic
stem cells in CML are dependent for their self-renewal on the Wnt pathway, a
pathway that like the Notch pathway is important for normal haemopoietic stem cell
109
survival and self-renewal. Zhao et al (2007) showed, using a conditional β-catenin -/-
mouse, that in vivo chronic myeloid leukaemia progression is dependant on β-catenin
and that loss of β-catenin significantly reduces BCR-ABL- induced CML
development.
As for Notch2, normal bone marrow samples (NBM) showed very weak expression in
all samples when the PCR reaction was performed at 28 cycles. Interestingly, at 30
cycles, the expression of Notch2 appeared to be expressed in NBM and CML samples
with no obvious favoured expression in one of the three cell subsets studied here.
Although Notch2 was difficult to detect by conventional PCR, real time PCR data
showed clearly an up-regulation of Notch2 by more than 100 fold in all of the three
CD34+ cell subsets tested here. Although there was no obvious favoured expression
in any one of the three cell subsets, the over-expression of Notch2 was significant in
the CD34+ Thy+ and in the total CD34+ cell subset.
The transcripts of Notch3 could not be detected in normal bone marrow and CML
samples. Primer specificities and PCR reaction conditions for Notch3 were validated
by applying the same conditions on human genomic DNA and Jurkat cells (a human T
cell lymphoblast-like cell line). The results showed clear bands for Notch3 in both
genomic DNA and Jurkat cells which confirms the finding that Notch3 is absent in
CD34+ cells in both normal marrow and in CML patients in chronic phase (Data not
shown).
The conventional PCR data demonstrated that Notch4 is sporadically expressed in
both normal bone marrow and CML samples. Judging from the semi-quantitative
PCR experiments, it looks that there was no obvious difference in the level of Notch4
expression between normal marrow samples and those of CML samples. However, it
appeared that Notch4 may be preferentially expressed in CD34+ Thy+ cells in most
CML samples (3 out of 4). It is not clear whether this observation may be of clinical
significance or not.
The presence of Notch1 and Notch2 genes on normal CD34+ haemopoietic cells is
consistent with previous reports (Milner and Bigas, 1999; Vercauteren and
110
Sutherland, 2004). Notch3 expression could not be detected in normal CD34+ cells
under the conditions described here which is consistent with the results of Singh et al.
(2000). In contrast, Vercauteren and Sutherland (2004) reported a low expression of
Notch3 transcripts in normal CD34+ cells in bone marrow from normal healthy
individuals. This discrepancy between this study results and those of Vercauteren and
Sutherland could be explained by differences in the sensitivity of primers used in the
two experiments. In addition, it could be that the Notch3 transcripts may be under the
level of detection in normal CD34+ cells in the samples studied here.
The PCR results presented here demonstrated the presence of Notch4 in some normal
CD34+ haemopoietic cell samples. This expression is in line with the findings of
others (Vercauteren and Sutherland, 2004). The current data that shows the presence
of Notch4 in normal CD34+ haemopoietic cells is interesting because Notch4 has
previously been thought to be an endothelial specific gene (Uyttendaele et al. 1996).
3.3.2 Expression patterns of Notch target genes in CML
The detection of the intracellular domain of Notch receptors (ICN) in the nucleus, as a
landmark of active Notch, has been proven to be very difficult. Since Notch signalling
directly activates Hes1 transcription, the use of Hse1 expression level has been widely
used as an alternative method to detect the activity of Notch signalling in
haemopoietic system (Pear and Radtke, 2003).
A possible implication of the up-regulation of Notch1 and Notch2 in CML is that
Notch signalling may be activated. To test this, the expression of the Notch target
genes Hes1, Herp1, and Herp2 was studied in the same CML samples. Although the
message of both Herp1 and Herp2 could not be detected, it appeared that the Hes1
target gene was expressed in most CML samples.
The semi-quantitative PCR experiments performed in this study were confirmed by
real time PCR and the data suggests that Notch signalling is active in CML patients in
chronic phase. The real time PCR data also showed that Hes1 is up-regulated in the
CD34+ Thy+, CD34+ Thy-, and in the total CD34+ cell subsets as compared with
NBM. This up-regulation was significant in the CD34+ Thy+ cell subset and total
111
CD34+ cell subsets. Activation of Notch signalling in CML reported here can be
attributed to in vivo stimulation of Notch signalling by Notch ligands expressed on the
cell surface of stromal cells or on haemopoietic progenitors. It is also possible that
mutations in the Notch receptor genes may induce activations of Notch signalling
independent of ligand binding. However, it remains to be investigated if Notch is
mutated in chronic phase CML.
Effects of Notch activation may include effects on stem cell self-renewal or
differentiation. A possible consequence of this activation may include the promotion
of myeloid differentiation in the chronic phase of CML. This possible effect of Notch
signalling in myeloid differentiation has been described before on myeloid cell lines
(Schroeder and Just, 2000; Schroeder et al. 2003; Tohda et al. 2003). Although others
have reported conditions where Notch signalling inhibit differentiation (Bigas et al.
1998), activation of Notch signalling on the CD34+ Thy+ subset is a strong candidate
for possibly leukaemic stem cell expansion as normal stem cells are shown to expand
when Notch signalling is stimulated (Stier et al. 2002).
3.3.3 Expression of Notch1 protein in CML
Over-expression of the Notch1 receptor in CML at the gene level warranted the
investigation of Notch1 receptor protein expression in CML samples. EA1 is a novel
monoclonal antibody which was generated in the lab by other members of the
research team and its specificity for human Notch1 was confirmed by ELISA (Dr. V.
Porttilo, personal communication). Unlike other antibodies available for human
Notch1 which only detects the intracellular domain of Notch1 (ICN1), EA1 is the first
available antibody that recognises the extracellular domain of Notch1 (ECN1). This
characteristic of EA1 avoids the need for permeabilizing cells before staining them
which is required by other anti human Notch1 antibodies. Therefore, EA1 can be used
to stain live intact blood cells in multiparametric flow cytometric approach. The
antibody also specifically detects Notch1 protein on the surface of the cell is available
for ligand binding and subsequent signal transduction.
112
The use of flow cytometry in the investigation of Notch1 protein allowed the
characterisation of the expression levels of human Notch1 receptor on different
haemopoietic progenitors within the CD34+ population in CML.
Study of the expression patterns of Notch1 in CD34+ cells from cord blood samples
was performed previously by Dr. Porttilo and these data were used here as normal
control for the expression of Notch1. The flow cytometric staining results in CML
samples demonstrated the expression of Notch1 in 35 % of gated CD34+ cells
compared with only 21 % of CD34+ cells in cord blood. The presence of low
expression of Notch1 protein has been reported before in normal CD34+ cells in
normal bone marrow (Ohishi et al. 2000) and in embryonic liver (Dando et al.
20005).
Notch1 was expressed in lymphoid and myeloid haemopoietic progenitors within the
CD34+ cells in CML samples. Notch1 was also detected in the very primitive CD34+
Thy+ and CD34+ CD38- populations in CML samples. The percentage of CD34+
Thy+ cells expressing Notch1 in CML samples was 21.6 ± 2.3 (n=3) compared with
12 % ± 3 in cord blood samples. The difference in Notch1 expression between the
CD34+ Thy+ cell subset in CML and that in cord blood was not significant by the
Mann-Whitney statistical test. Because of this and because of the low number of CML
samples analysed here no conclusions could be drawn from this variation.
The expression of Notch1 was also confirmed in another stem cell enriched subset in
CML which is the CD34+ CD38- cell subset. The mean percentage of cells expressing
Notch1 in this primitive compartment was 15.3 % (n=2) compared with 15 % in
CD34+ cells in cord blood suggesting that the expression was similar between normal
and CML cells.
There were very low or undetectable numbers of CD34+ CD3+ and CD34+ CD19+
cells in the CML samples tested here which did not allow the study of Notch1 in these
two populations. This low level of expression was in correlation with the
immunophenotype of CD34+ cells in CML in chronic phase (Normann et al. 2003).
However, it is documented that these populations express Notch1 in cord blood
samples (Dr. V. Porttilo, personal communication).
113
FACS analysis showed the presence of Notch1 in CD34+ myeloid progenitors
including CD34+ CD14+ cells and CD34+ CD33+ cells. It is not clear why only
about 20% of CD34+ CD33+ myeloid cells express Notch1 in contrast to the CD34+
CD14+ cells in which most of them co-express Notch1. CD16+ cells could not be
detected whereas the total number of granulocytes (CD15+) in CML samples was
unexpectedly very low (3-5 %). It is not clear whether this is normal in cryopreserved
CML samples or whether this is an artificial event due to possible prolonged
cryopreservation or thawing and handling of CML specimens.
The data also showed the co-expression of the lymphoid marker CD7 on CD34+
CML in approximately 40% of gated CD34+ cells, a finding that has been shown to
be of prognostic importance in CML patients in chronic phase (Normann et al. 2003).
24.5 % (±9.6) of the CD34+ CD7+ cells expressed Notch1 on their surface. CD7 is
not only expressed in mature T- and natural killer (NK) cells, but it is regarded as an
early haemopietic marker (Normann et al. 2003). It has been suggested that CD34+
CD7+ cells may include very primitive stem/progenitor cells capable of
differentiating into lymphoid and myeloid lineages (Chabbanon et al. 1992).
Recently, it has been suggested that CD34+ CD7+ cells may be involved in
maintenance and clonal progression of Ph-positive cells in CML patients in chronic
phase (Kosugi et al. 2005). It can be speculated, therefore, that the expression of
Notch1 in the primitive CD34+ CD7+ population is of clinical significance.
No clear conclusions can be drawn from the study of Notch1 protein in CML samples
in terms of the presence of elevated Notch1 expression in CML. Even if Notch1
upregulation in CML at the m-RNA level did not clearly translate into increased
protein levels this does not contradict with the finding that Notch signalling is
activated in CML as assessed by Hes1 up-regulation. The activation of Notch
signalling does not necessarily occur via ligand dependant mechanisms. For instance,
Mutations in Notch1 in T-ALL render Notch1 susceptible to ligand-indpendant
cleavage at S2 site and subsequently be constitutively active regardless the fact it is
not overexpressed on the cell surface (Aster et al. 2008). Mizuno et al. (2008) have
reported that Notch1 is a common retroviral integration site in which retrovirus
integration formed a constitutively active form of Notch and accelerated leukaemia
114
development in a CML mouse model. Considering the fact Notch1 mutations have not
been examined yet in CML, such mutations may explain the hyperactivity of Notch in
CML reported in this study. Moreover, fusion oncoproteins PML/RAR and
AML1/ETO in AML have been associated with activation of Notch signalling which
may confer self-renewal properties to leukaemic stem cells in AML (Alcalay et al.
2003). It is tempting therefore to propose that BCR-ABL fusion protein may cross-
talk with Notch signalling to confer survival signals in CML.
Nonetheless, this is the first time the presence of Notch1 protein is reported in the
CD34+ population in blood samples of CML patients in chronic phase. Moreover, the
expression of Notch1 at the protein level in the CD34+ Thy+ and CD34+ CD38- cell
subsets is interesting because these populations are enriched for leukaemic stem cells
in CML.
Chapter 4: Investigation of BCR-ABL and Notch cross-talk in cell line models
4.1Introduction
115
The data from chapter three showed that Notch signalling, as assessed by levels of
Hes1 expression, is upregulated in CD34+ cells, including the more primitive CD34+
THY-1 + cell subset in chronic phase CML patients as compared to CD34+ cells from
normal donors. Activation of the Notch pathway has been shown to confer cell
survival properties on normal haemopoietic stem cells (Stier et al. 2002; and Carlesso
et al. 1999) and this raises the possibility that leukaemic stem cells (LSCs) in chronic
phase CML may benefit from activated Notch signalling conferring survival signals.
It has been found that inhibition of BCR-ABL alone by imatinib mesylate (IM) does
not result in loss of self renewal capacity or cell death within the primitive CD34+
CD38- cell compartment in chronic phase CML in vitro (Copland et al. 2006). This
has led some researchers to propose a model which suggests that BCR-ABL requires
cooperating genetic events at the stem and/or progenitor level to establish a Ph+
leukaemia (Burchert et al. 2007). Recently, Mizuno et al. (2008) have demonstrated
that overexpression or enhanced kinase activity of BCR/ABL and altered expression
of Notch1 synergises to induce acute leukemia in a transgenic model for CML. This
finding and previous genetic interaction evidence of ABL and Notch synergism in
Drosophila development (Giniger, 1998; and Crowner et al. 2003) may justify the
need to investigate the hypothesis of possible cross-talk between BCR-ABL and
Notch in CML.
A range of model systems including cell lines derived from leukaemia patients and
animals engineered to express BCR-ABL have been used in the past to study the
molecular interactions between BCR-ABL and other signalling pathways (Ren, 2005).
In this project leukaemic cell lines will be investigated as possible candidate models
to explore the proposed interaction of BCR-ABL and Notch signalling in human CML
cells. A good candidate model for the study of BCR-ABL and Notch cross-talk should
fulfill the basic criteria of having an intact BCR-ABL and Notch components, and to
have a demonstrable response to Notch and BCR-ABL pathways modulators. CML
cell lines present a suitable model system in which to investigate the molecular
mechanisms underlying signalling pathways involved in the pathogenesis of CML and
to identify potential therapeutic targets. In fact, much of our understanding of the
116
basic biology of CML comes from studies that have used BCR-ABL+ cell lines. One
draw back is that all the available CML cell lines are derived from the blastic phase of
the disease and, thus, contain genetic lesions in addition to BCR-ABL. The K562 line
has been used in the cloning and analysis of the t(9;22)(q34;q11) breakpoints which
involve the genes ABL and BCR (Drexler et al. 1999). In addition, many of the
signalling pathways downstream of BCR-ABL and the proteins that interact with
BCR-ABL were identified in BCR-ABL+ cell lines (Ren, 2005). An important
advantage of the CML cell lines is that most of them remain dependent on BCR-ABL
tyrosine kinase activity for their proliferation and survival, as shown by their
susceptibility to the effects of BCR-ABL inhibitors (Deininger et al. 2000). This is a
very useful criterion of the BCR-ABL+ cell lines as in vitro model systems in which
the BCR-ABL tyrosine kinase activity can be turned off with imatinib to study
activity of other signalling pathways.
BCR-ABL activity assay
The measurement of BCR-ABL activity in CML is critical for the assessment of the
disease progression and response to BCR-ABL targeted therapy. The nuclear adaptor
protein Crkl has been reported as the major and constitutive tyrosine-phosphorylated
protein in chronic phase CML patients and in CML cell lines (Oda et al. 1994).
Another study showed that the level of crkl phosphorylation correlated well with the
level of BCR-ABL expression and that BCR-ABL tyrosine kinase activity can be
determined by measuring the phosphorylation of its down stream substrate crkl
(Hoeve et al. 1994). Barnes et al. (2005) showed that the levels of Phosphorylated
crkl (P-crkl) correlate very well with BCR-ABL levels in different stages of CML and
that P-crkl expression can be used as an indicator of disease progression.
Due to its specificity and stability, the expression of P-crkl has been accepted as a
reliable method to assess BCR-ABL status and have proved to be a vital practical
method for evaluating the effect of imatinib treatment on BCR-ABL kinase activity in
CML cell lines and in primary CML cells (Gorre et al. 2001; and Singer et al. 2006).
In all of the studies cited so far Western blotting was used as a method to assess P-
crkl expression in BCR-ABL expressing cell lines and primary CML cells. However,
this approach is time consuming and requires large number of cells which may not be
117
achievable in the more primitive cell populations in primary CML cells. The recent
availability of phosphorylation-specific antibody that detects only phosphorylated crkl
in BCR-ABL + cells has made it possible to use flow cytometry instead of Western
blotting to measure P-crkl levels in CML cells (Wetzel et al. 2005). However, this
approach has only been used by two groups to date. The P-crkl flow cytometry based
assay therefore will be validated in this chapter with a view to its use as a tool for the
assessment of BCR-ABL activity in the context of BCR-ABL and Notch cross-talk.
Upregulation of the Notch target gene Hes1 has been shown to occur as a result of
Notch activation and association with the transcription factor RBP-Jk (Jarriault et al..
1995). Since then the expression of Hes1 has been widely used and accepted as an
indicator of Notch activity (Kageyama et al. 2000). Hes1expression therefore will be
used in this project to assess Notch signalling in cell lines as well as in primary cells.
Aims of this chapter:
The aims of this chapter were:
1- To establish the optimal staining conditions and appropriate controls for the
FACS based P-crkl assay before it is being utilised in this project as a marker
for ABL kinase activity and as in vitro sensitivity assay for imatinib mesylate.
2- To validate a human cell line based in vitro model system for the study of the
cross-talk of ABL and Notch signalling.
3- To investigate the cross-talk between ABL and Notch signalling in cell line
model systems using inhibitors of both signalling pathways.
.
4.2 Results
4.2.1 Validation of the P-crkl intracellular FACS assay in K562 cells
118
The ability to detect phosphotyrosine proteins in BCR-ABL+ cell lines by flow
cytometry was first published by Desplat et al. (2004). The authors used a
Phosphotyrosine (p-tyr) monoclonal antibody to analyse by FACS the intracellular
level of the tyrosine hyperphosphorylation of cellular proteins induced by BCR-ABL
in BCR-ABL+ cell lines. This approach was further improved by the availability of a
monoclonal antibody which specifically recognises phosphorylated crkl, a nuclear
adaptor protein and a substrate of BCR-ABL that is constitutively phosphorylated in
CML. P-crkl expression levels have been accepted as a surrogate assay to assess the
constitutive BCR-ABL tyrosine kinase activity in BCR-ABL+ cells. At the time of
this project two groups had attempted, with different protocols, to analyse P-crkl
expression in BCR-ABL+ cells by flow cytometry (Wetzel et al. 2005; and Hamilton
et al. 2006). To use the FACS based P-crkl assay as a method for the assessment of
BCR-ABL activity in this project, it was essential to validate the assay and optimise
its parameters and controls.
The K562 cell line is a CML-derived leukemia cell line, established in 1970 from the
pleural effusion of a 53-year-old woman with CML in myeloid blast crisis (Drexler et
al. 1999). K562 cells were used as a positive control and as a model to validate the
various staining steps and conditions of the intracellular FACS staining of P-crkl. This
is because K562 cells are BCR-ABL+ and have been shown to have high levels of
phosphorylated crkl (Hoeve et al. 1994). To control for non specific binding a rabbit
IgG polyclonal antibody at equivalent concentration of the P-crkl antibody was used
as an isotype control in each experiment. To stain for P-crkl in K562 cells the cells
were re-suspended in 100 µl of fixative (Fix and Perm kit, Caltag, UK) for 15 minutes
and washed next with 3 ml of HBSS (5% FBS) before being incubated for 40 minutes
with 25 µl permeabilising reagent and the primary anti-P-crkl antibody (New England
Biolabs (UK) Ltd, Hitchin, UK).Cells were then washed twice and incubated for 40
minutes with a PE conjugated anti rabbit secondary antibody (BD, UK). The wash
step was repeated twice and the cells were analysed by flow cytometry. Parallel
intracellular staining experiments were also performed in K562 cells to investigate the
effect of critical staining conditions such as fixation, secondary antibody background
signal, and optimal concentration for primary antibody. The data showed that fixation
and permeabilisation of K562 cells alone without antibody staining showed higher
background fluorescence signal than that of unfixed cells (Fig. 4.1). K562 cells
119
stained with the P-crkl antibody and the PE conjugated anti rabbit secondary antibody
(BD) showed a distinct fluorescence signal that was clearly distinguishable from the
isotype control signal. Interestingly, the staining of K562 cells with only the
secondary antibody showed a low background signal as compared with the isotype
control. In another experiment the P-crkl antibody was titrated to determine the lowest
concentration at which the antibody can be used. This showed that the P-crkl antibody
can be still used at 1:40 dilution without obvious loss of fluorescence signal intensity
as compared to 1:10 dilution recommended by the manufacturer (Fig 4.1).
Selection of the best secondary antibody can improve immunostaining and reduce
false positive or negative staining. Therefore, the specificity and fluorescence
intensity of four commercial anti rabbit secondary antibodies in the P-crkl assay was
investigated. K562 cells were fixed and permeabilised as described above. Cells were
then stained with P-crkl primary antibody diluted 1:40 and then stained with one of
the following secondary antibodies: PE F(ab')2 Donkey anti-Rabbit IgG (BD), PE
polyclonal donkey anti-rabbit antibody (Abcam), FITC monoclonal mouse anti-rabbit
antibody (Sigma), FITC polyclonal goat anti-rabbit antibody (Caltag) (Fig. 4.2). The
FACS analysis showed that the PE conjugated secondary antibody from BD was
superior to the Abcam antibody in terms of specificity and signal intensity. The
Abcam PE secondary antibody showed little P-crkl expression in K562 cells and this
expression was less specific as demonstrated by the overlap between the fluorescence
peak of the P-crkl stained cells and that of the isotype control. K562 cells stained with
P-crkl and the Sigma FITC secondary antibody showed a staining pattern similar to
that of the BD PE secondary antibody in terms of specificity. However, the
fluorescence signal was lower than that observed with the BD PE secondary antibody.
In contrast, K562 cells stained with P-crkl and the Caltag FITC secondary antibody
showed very strong fluorescence signal but with low specificity as compared with the
Sigma FITC secondary antibody (Fig 4.2). The staining patterns of the previous
secondary antibodies showed clearly that only the BD PE and Sigma FITC secondary
antibodies are suitable to be used in the FACS based P-crkl assay with the advantage
of the former in terms of fluorescence signal intensity. It can bee seen from previous
data that the optimum staining conditions were obtained with the primary P-crkl
antibody at 1:40 dilution (2.25 µg/ ml) and with the use of the BD PE secondary
antibody. As for fixation and peremeabilisation methods, several kits were evaluated
120
including Caltag fix and perm kit, BD Cytofix/ Cytoperm kit (cat. No 554722). In
addition, different fixing times and temperatures and other permeabilisation methods
were attempted such as cold 90% methanol for 30 minutes on ice. There was no
obvious difference between all these fixation and permeabilisation methods in terms
of P-crkl expression in K562 cells (data not shown). Therefore, an optimised staining
protocol was used in all P-crkl assay experiments performed in this chapter which
involves the use of the Caltag fix & perm kit followed by probing with primary P-crkl
antibody at 1:40 dilution and then staining with BD PE secondary antibody.
4.2.2 The effect of cell passage number on the expression of P-crkl in
K562 cells
During the time of performing different optimisation experiments of the P-crkl assay
the K562 cells were propagated for weeks in culture. It was noticed that the P-crkl
expression was gradually lost on K562 cells over this time period. To confirm this
observation and to further investigate the effect of passage number on P-crkl
expression in K562 cells a new batch of K562 cells was taken out of liquid nitrogen
and monitored every two weeks for the expression of P-crkl. Data showed that the P-
crkl levels were stable for about 8 weeks in culture which is equivalent to 16 passages
(Fig. 4.3). Around week 10 (passage 20) K562 cells showed reduced phosphorylation
of P-crkl which was demonstrated by FACS analysis in the form of two populations
of K562 cells with only one population maintaining the expression of P-crkl. K562
cells passaged for more than 12 weeks (> 24 Passages) lost the expression of P-crkl
(Fig. 4.3). These findings were confirmed in three separate experiments at different
time points before the completion of this project and led to the acceptance of only
minimally passaged K562 cells as a positive control for the P-crkl assay and as a
BCR-ABL+ in vitro model.
121
•Unstained
•Fixed- unstained
•P-crkl stained
•Unstained
•only 2° Ab
•Isotype control
•P-crkl stained
•Unstained
•Isotype control
•1:10 dilution
•1:20 dilution
•1:40 dilution
A
B
C
122
Fig 4.1. Validation of P-crkl intracellular flow cytometry assay in K562 cells. Critical staining conditions in the P-crkl intracellular staining were validated in K562 cells. (A) FACS analysis of the effect of fixation on background staining for P-crkl in K562 cells. Background staining on unfixed-unstained cells is shown in blue, and on fixed-unstained cells in green. P-crkl expression as determined after fixation is shown in red. (B) Analysis of effect of secondary antibody staining in P-crkl assay. Background staining on unfixed-unstained cells is shown in blue, and on fixed cells stained only with PE anti rabbit secondary antibody in ligh blue. Fixed cells stained with rabbit IgG (isotype control) and the secondary antibody are shown in green and P-crkl expression is shown in red. (C) Titration of the primary P-crkl antibody. Cells were fixed and stained with different dilutions of the primary P-crkl antibody (red, green, and light blue histograms). Unstained-unfixed cells and isotype control (in concentration equivalent to the primary antibody dilution) are shown in blue and purple respectively.
BD PEAbcam PE
Sigma FITC Caltag FITC
A B
C DPE PE
FITC FITC
123
Fig 4.2. Comparison of four commercial anti rabbit secondary antibodies used in the P-crkl assay. K562 cells were fixed, permeabilised and stained with P-crkl primary antibody diluted 1:40 and then stained with: (A) PE polyclonal donkey anti-rabbit antibody (BD) (B) PE polyclonal donkey anti-rabbit antibody (Abcam) (C) FITC monoclonal mouse anti-rabbit antibody (Sigma) (D) FITC polyclonal goat anti-rabbit antibody (Caltag). In each panel the P-crkl staining patterns of the secondary antibodies is shown in pink. Staining signals of unstained cells and cells stained with the isotype control are shown in blue and green respectively.
Unstained K562Isotype controlP-crkl PE
Unstained K562Isotype controlP-crkl PE
A
BPE
PEC
PE
Unstained K562Isotype controlP-crkl PE
4.2.3
Assessment of P-crkl expression in leukaemic cell lines
Following the establishment of the optimal staining conditions and the appropriate
controls for the P-crkl flow cytometry assay in K562 cells the P-crkl expression was
investigated in three other leukaemic cell lines: the BCR-ABL+ NALM-1, the ABL
activated SIL-ALL, and the BCR-ABL negative JURKAT cell lines.
The NALM-1 cells are BCR-ABL+ cells which were established from the blastic
phase of a CML patient. Phenotypically the NALM-1 cells express the lymphoid
markers CD19, CD20 and the plasma cell marker CD138 (Wetzel et al. 2005). This
CML cell line may offer an additional in vitro model for the study of BCR-ABL and
Notch cross-talk if both BCR-ABL and Notch activity were confirmed. Therefore,
124
Fig. 4.3. The effect of cell passage number on the expression of P-crkl in K562 cell line. K562 cells were taken out from liquid nitrogen and maintained in culture for 12 weeks. Cells were passaged every 3-4 days and P-crkl expression was assessed by flow cytometry every two weeks. (A) FACS staining of P-crkl in K562 cells kept between 2-8 weeks in culture (passage 4-16). (B) FACS staining of P-crkl in K562 cells in week 10 (passage 20). (C) FACS staining of P-crkl in K562 cells passaged for more than 12 weeks (> 24 Passages). In each panel unstained k562 cells are shown in blue, isotype control in green, and k562 cells stained with PE conjugated P-crkl antibody in red.
BCR-ABL activity was assessed in NALM-1 cells by the P-crkl assay. However, crkl
phosphorylation could not be detected in NALM-1 cells when these cells were
intracellularly stained with P-crkl antibody and the BD PE conjugated secondary
antibody (Fig. 4.4). The P-crkl assay was repeated three times with the same finding.
The SIL-ALL cells (also known as ALL-SIL) were established from a T cell Acute
Lymphoblastic Leukaemia (T-ALL) patient. The SIL-ALL cells express the novel
NUP214-ABL1 fusion gene with hyper ABL kinase activity. In addition, these cells
have Notch1 activating mutations which result in constitutive active Notch signalling
(Quinta´s-Cardama et al. 2008). The reported activation of both ABL and Notch
signalling pathways in SIL-ALL cell line makes it a possible in vitro model for the
study of the cross-talk of ABL and Notch. Therefore, the P-crkl expression was
assessed in the SIL-ALL cells. SIL-ALL cells were intracellularly stained with P-crkl
antibody as decribed above before being analysed by flow cytometry. Results showed
the expression of P-crkl in SIL-ALL cells in three separate experiments (Fig.4.4).
This expression was lower than the P-crkl expression in K562 cells.
Finally it was important to confirm the specificity of the P-crkl assay in a BCR-ABL
negative cell line. The Jurkat cells were assessed for P-crkl expression by the P-crkl
assay and results showed the absence of phosphorylated crkl in theses cells (Fig. 4.4)
This finding further confirms the specificity of P-crkl assay in detecting crkl
phosphorylation in BCR-ABL+ or ABL+ cells.
125
NALM-1
JURKATSIL-ALL
K562A B
C D
PE
4.2.4 Assessment of imatinib mesylate efficacy in K562 cells using the P-crkl assay
Imatinib mesylate (IM) has been developed as a potent inhibitor of the ABL protein
tyrosine kinases (Holtz et al. 2002). In the past, the inhibitory effect of IM on BCR-
ABL kinase activity has been demonstrated as a reduction of P-crkl expression
detected by western blotting (Chu et al. 2004). Expression of P-crkl following IM
treatment has also been investigated recently by flow cytometry in K562 cells
(Hamilton et al. 2006). In order to validate IM as a BCR-ABL inhibitor in the context
of ABL and Notch cross-talk the effect of IM was investigated in K562 cells by the
FACS based P-crkl assay using the same P-crkl assay parameters which have been
established earlier in this chapter. K562 cells were cultured in decreasing
concentrations of IM (10, 5, 1, 0.5, and 0.1 µM) for 48 h before being assayed for the
126
Fig 4.4. Assessment of P-crkl expression in four leukaemic cell lines. The expression of P-crkl protein as assessed by flow cytometry is shown for the BCR-ABL positive cell line K562 (A), nalm-1 (B), the ABL positive cell line ALL-SIL (C) and the BCR-ABL negative cell line Jurkat (D). In all experiment the BD PE conjugated secondary antibody was used with an isotype control (in green) and P-crkl antibody (in red). The filled histogram in dark blue represent the background signal of unstained cells.
expression of P-Crkl by FACS as described above. Treated cells showed dose
dependent inhibition of P-crkl expression as compared to untreated cells (Fig 4.5-a).
The reduction of crkl phosphorylation post IM can be seen as a shift to the left of the
fluorescence histogram to the fluorescence channel of the isotype control. The
reduction of P-crkl post IM exposure was also shown as a reduction of the mean
fluorescence intensity (MFI). The MFI was calculated for treated cells and for the no
drug control cells as relative MFI to the isotype control in each condition in order to
accurately determine the specific fluorescence signal in the reaction. The MFI of IM
treated cells was then compared with the MFI of the no drug control cells (Fig. 4.5-b).
This result was confirmed in another two experiments with similar outcomes.
To confirm the specificity of the P-crkl antibody in the FACS-based P-crkl assay, the
effect of IM on P-crkL was also assessed by Western blot on K562 cells. K562 cells
were cultured in the presence or absence of IM for 48 h. Western blot was performed
as described in materials and methods with the same specific anti-P-crkl primary
antibody (1:1000) (New England Biolabs) and an anti-rabbit IgG, horseradish
peroxidase-linked secondary antibody (1:2000) (New England Biolabs). The
membranes were then stripped in 1 X Stripping Solution (Thermo scientific) for 15
min at RT and re-probed with anti actin antibody (1:1000) (New England Biolabs) in
5% BSA/phosphate buffered saline with BSA, to confirm equal sample loading.
Results were similar to those obtained with the FACS based P-crkl assay and a dose
dependent reduction of P-crkl expression was observed post 48h treatment with IM
(Fig. 4.6).
127
10µM 5 µM
1 µM 0.5 µM
0.1 µM
A-1 A-2
A-3 A-4
A-5
PE
128
Fig. 4.5-a. Assessment of imatinib mesylate (IM) efficacy in K562 cells using a flow based P-crkl assay. K562 cells cultured in decreasing concentrations of IM (10, 5, 1, 0.5, and 0.1µM) for 48 h were assayed for the expression of P-Crkl by FACS (A1-5) P-crkl expression in cells treated with imatinib mesylate is shown in green and in untreated cells in red. The histograms in purple represent the isotype control in each experiment. Data shown is from one experiment representative of three separate experiments (n=3).
0
10
20
30
40
50
60
70
80
90
100
110
0 0.1 0.5 1 5 10
IM (µM)
Mea
n fl
oure
scen
cein
tens
ity
129
Fig. 4.5-b. Dose dependant effect of imatinib mesylate (IM) on the expression of P-crkl in k562 cells post 48h. P-crkl expression of (IM) treated and untreated K562 cells represented as mean flourescence intensity (MFI). MFI presented here was measured by subtracting the MFI of treated or untreated cells from the MFI of the isotype control in each condition. Dose of IM is plotted in X axis and MFI of IM treated cells relative to MFI of no drug control cells in Y axis. Data shown is from one experiment representative of three separate experiments (n=3).
Actin
P-crkl
0.5
µM
IM
1 µ
MIM
5 µ
MIM
10 µ
MIM
0.1
µM
IM
0 µ
MIM
5 µ
MIM
0 µ
MIM
K562 Jurkat
4.2.5 Characterisation of Notch signalling in K562 cells
The well preserved BCR-ABL kinase activity in K562 cells offers an opportunity to
investigate possible interaction between BCR-ABL and other signalling pathways.
This cell line may present a good in vitro model system to study the possible cross-
talk between BCR-ABL and Notch if the Notch signalling components were proven to
be intact. Therefore, Notch signalling was investigated in K562 cells at the mRNA
and protein levels in order to evaluate the activity of Notch in these blast phase CML
cells.
The semi-quantitative RT-PCR was performed in cDNA prepared from K562 cells
and this showed clearly the expression of Notch1 (Fig. 4.7). However, the Notch
target gene Hes1 could not be detected even after increasing the number of PCR
130
Fig. 4.6. Effect of concentration of imatinib mesylates (IM) on P-crkl protein levels. K562 and Jurkat cells cultured in decreasing concentrations of IM (10, 5, 1, 0.5, and 0.1µM) for 48 h were harvested for analysis of P-Crkl protein levels by western blot (upper panel). The blot was reprobed with an anti-pan-actin antibody to compare sample loading (lower panel).
amplification cycles to 32 cycles. CEM cells were used as a positive control since
they represent a cell line with markedly enhanced Notch-1 levels (Weng et al. 2004).
Next, Notch1 receptor protein expression was investigated by flow cytometry. FACS
analysis showed that the extra cellular domain of Notch1 (ECN1) was partially
expressed as detected by the EA1 antibody which specifically detects the ECN1 (Fig.
4.8). To investigate the intracellular domain of Notch1 (ICN1) K562 cells were fixed
and permeabilised before being stained with the b-tan20 antibody. FACS ananlysis
showed that the ICN1 was highly expressed in K562 cells (Fig. 4.8).
131
Notch1
Hes1
CEMK562
BCR-ABL
132
Fig. 4.7 Expression of Notch1 and Hes1 genes in K562 cell line. cDNA was prepared from K562 cells, and from a cell line known to have active Notch signalling (CEM). Transcript levels were measured by RT-PCR. RTPCR products were resolved by agarose gel electrophoresis and visualised by vistra green. Duplicate RT-PCR data is shown for the expression of Notch1 and Hes1 in K562 cells (upper two panels). The lower panel shows BCR-ABL expression in K562 cells. Data shown is from one experiment representative of three independent experiments (n=3). The number of PCR amplification cycles was 32 for all three genes.
IgG1 FITCEA1 FITC
b-tan 20 FITC
1% ± 0.1
90% ± 1.6
IgG1 FITC
< 1% ± 0.05
< 1% ± 0.5
Fig. 4.8. FACS analysis of Notch1 expression in K562 cells. K562 cells were stained with EA1 antibody which detectes the extracellular domain of Notch1 (ECN1) and the protein expression was analysed by FACS (upper right panel). K562 cells subjected to fixation and permeabilisation, then stained with b-tan 20 antibody which recognise the intracellular domain of Notch1 (ICN1) are shown in the lower right panel. Appropriate isotype controls were used in each staining (upper and lower left panels). Data shown is from one experiment representative of three separate experiments (n=3). The mean percentage of cells positive for each staining with the associated standard error of the mean is shown in each panel
4.2.6 Constitutive expression of Notch1 ΔE in K562 cells
Since Notch activation in K562 cells was not evident as assessed by the expression of
Hes1 by conventional PCR, a gain of function approach was needed to further
investigate the cross-talk of Notch and BCR-ABL in K562 cells. Therefore, it was
decided to establish a K562 cells that are stably transfected with Notch1ΔE plasmid.
This gain of function approach was used before to constitutively activate Notch
signalling in cell lines (Chadwick et al. 2008). Unlike the intra cellular Notch1
domain (ICN1), Notch1ΔE construct have a membrane tether region upstream of the
start of the ICN region and is constitutively activated by gamma secretase, which
enables the use of GSI to inhibit Notch activity.
The inhibitable Notch1ΔE used here was previously cloned into transfection vectors
and tested by Dr Nicholas Chadwick (Faculty of Life Sciences, University of
Manchester). In order to establish a stable source of K562 cells with hyperactive
Notch activity, K562 cells were retroviral transfected with either the Notch1ΔE or the
empty vector pMX and maintained in culture for weeks in order to use these cells in
future Notch and BCR-ABL cross-talk studies. However, the number of K562 cells
transfected with Notch1ΔE showed a steady decrease in culture when monitored
every 48-72h by GFP expression by flow cytometry. To see whether the constitutive
expression of Notch affected the survival of K562 cells, GSI was added at 10 µM to
both the K562 cells that were transfected with Notch1ΔE and to the K562 cells that
were transduced with the empty pMX vector. Cell survival in the culture was then
monitored for both conditions every week by counting the live cells using GFP
133
expression and FACS analysis. Results demonstrated that the GSI rescue the
Notch1ΔE transfected cells from being lost in culture as compared to K562 cells
transfected with the empty vector (Fig. 4.9).
134
68 % 70%
32 % 47 %
PMX PMX + GSI
N1 ΔE + GSIN1ΔE
GF
P
GF
P
Fig. 4.9. Constitutive expression of N1ΔE in K562 cells. K562 cells were transfected with either N1ΔE or the Pmx empty vector and kept in culture for three weeks in the absence (left panel) or presence (right panel) of gamma secretase inhibitor (GSI). Cell survival in the culture was monitored every week by GFP expression and shown as the percentage of gated live cells in each condition.
4.2.7 The effect of Valproic acid on BCR-ABL and Notch signalling in K562 cells
The last approach failed to produce cells with hyperactive Notch signalling that can
be maintained in culture for long periods or can be frozen for future experiments.
Therefore, the search continued for another approach to activate Notch in K562 cells.
Until now no small-molecule activators of Notch-1 signaling in haemopoietic cells
have been described. However, it has been shown recently that Valproic acid (VPA)
treatment of human gastrointestinal and pulmonary carcinoid tumor cell lines resulted
in Notch-1 signaling activation which was associated with increase in the expression
of both full-length Notch-1 and the active Notch-1 intracellular domain (NICD)
(Greenblatt et al. 2008). In addition, VPA treatment activates Notch1 signaling in
Small cell lung cancer (SCLC) cells and inhibits proliferation in SCLC cells (Platta et
al. 2008). Similar Notch activation effect was described in neuroblastoma cell lines in
which VPA treatment led to activation of Notch signalling as shown by increased
levels of intracellular Notch-1 and Hes-1 protein expression (Stockhausen et al.
2005).
In all of the previous tumors Notch activity was observed only at baseline levels or as
transient up-regulation of Hes1 and treatment with VPA, which is a well-established
histone deacetylase (HDAC) inhibitor, resulted in activation of Notch signalling.
Since Notch signalling was shown to be reduced in the blastic phase of CML as
compared to the chronic phase of the disease (Sengupta et al. 2007) and that K562
135
cells were established from the blastic phase of CML It was hypothesized that VPA
may activate Notch signalling in K562 cells.
To investigate whether treatment of K562 cells with VPA can activate Notch
signalling or not, K562 cells were cultured in the presence or absence of 4 mM VPA
for 72h and the gene expression of Hes1 was measured by real time PCR. Results
showed a significant down-regulation of Hes1, an effect similar to that of GSI (Fig.
4.10). This finding was confirmed in three different experiments.
136
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ VPA
*
Rel
ativ
e g
ene
expr
essi
on
Fig. 4.10 Hes1 expression in K562 cells post valproic acid (VPA) tratment. K562 cells were treated with 4mM VPA for 72h and the gene expression of Hes1 was measured by real time PCR. Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. Comparison of gene expression between treated (red bar) and untreated cells (blue bar) was derived from subtraction of untreated K562 cells DCt values from treated K562 cells DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. The result shown here is from one experiment representative of three different experiments (n=3). Statistical significance was calculated using student t-test. (* = P ≤0.05).
Next the effect of VPA induced inhibition of Notch was examined on the BCR-ABL
activity in K562 cells. To investigate this K562 cells were cultured with or without 4
mM VPA for 72h and the P-crkl assay was performed to assess the BCR-ABL activity
following VPA treatment. FACS analysis showed an increase in P-crkl expression as
compared with P-crkl levels in untreated cells (Fig. 4.11). This result was reproduced
in three separate experiments.
To find if VPA effect on Notch signalling was associated with any effect on the
differentiation of the erythroleukaemic K562 cells the erythroid differentiation was
evaluated on K562 cells following exposure to VPA. K562 cells were cultured with or
without 4 mM VPA for 72h and the cells were then incubated with FITC conjugated
glycophorin A (GPA) as a marker of erythroid differentiation for 30 minutes at RT.
Cells where then washed with 3 ml of HBSS (5% FBS) before being analysed by flow
cytometry. Appropriate isotype control was included in the experiment to control for
non specific binding. Results showed that treatment of K562 cells with VPA for 72h
markedly decreased the expression of GPA (Fig 4.12). This effect was confirmed in
three independent experiments
137
138
P-crkl (PE)
Isotype controlUntreated cellsVPA treated
Fig. 4.11. Effect of Valproic acid (VPA) on BCR-ABL activity in K562 cells. K562 cells were treated with 4mM VPA for 72h and the activity of BCR-ABL was assessed by FACS analysis of P-crkl expression (green). P-crkl expression of untreated cells and background flourescence of isotype control are shown in red and blue respectively. The data shown is from one experiment representative of three independent experiments (n=3).
4.2.8 The effect of GSI in K562 cells
As it had proven difficult to set up a model of K562 cells with experimentally
activated Notch1 the activation of the pathway was re-examined in unmanipulated
cells, this time using a more sensitive real time PCR assay. In these experiments real
time PCR was applied to cDNA samples from K562 cells before and after treatment
with the Notch inhibitor GSI. Interestingly the results using this approach showed that
the expression of Hes1 was detectable in unmanipulated K562 cells and furthermore
this expression could be down regulated by exposure to GSI (Fig 4.13). This effect
139
49% 29%
Isotype control Glycophorin-A Glycophorin-A
Glycophorin-A (FITC)
Isotype controlVPA treatedUntreated
A
B
VPA treatedUntreated
Fig. 4.12. Effect of Valproic acid (VPA) on erythroid diffrentiation in K562 cells. K562 cells were treated with 4mM VPA for 72h and the expression of glycophorin-A (GPA) was analysed by FACS. An appropriate isotype control (first plot in A) was utilised to only include positive cells for GPA among untreated cells (middle plot in A) and treated cells (last plot in A) . Fluorescence intensity of GPA from the same conditions in (A) is represented in histogram format in (B). Data is from one experiment representative of three independent experiments (n=3).
was reproducible in three separate experiments. This data suggests that Notch
signalling is active in K562 cells and that these cells may therefore be a suitable
model for investigating cross talk with BCR-ABL.
140
PCR cycle number
K562 K562 + GSI
Del
ta R
un
4.2.9 Cross-talk between Notch and BCR-ABL in K562 cells
Results from this chapter suggest that the BCR-ABL+ K562 cells may offer an in
vitro model system to investigate the cross-talk between BCR-ABL and Notch.
Beside the constitutive activity of BCR-ABL in K562 cells which can be inhibited by
imatinib the K562 cells express the Notch target genes Hes1 at levels that can be
inhibited by the Notch inhibitor GSI. Therefore the possible interaction between
BCR-ABL and Notch in CML can be investigated by using inhibitors of either
pathway before looking at changes in downstream target gene or protein expression.
In order to avoid possible loss of BCR-ABL activity in culture only K562 cells with
less than 12 passages were used in all K562 experiments.
141
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ GSI
**
Rel
ativ
e g
ene
expr
essi
on
Fig. 4.13. Inhibition of Notch signalling by a gamma seretase inhibitor (GSI) in K562 cells. Real time PCR of the Notch target gene Hes1 is shown. cDNA was prepared from cells treated with vehicle control (DMSO) or 10 µM GSI for 24h. Hes1 expression on K562 cells is shown in real time in the upper plot. Hes1 expression was normalised to the GAPDH house keeping gene and represented as DCt values. Comparison of gene expression between treated (red bar) and untreated cells (blue bar) was derived from subtraction of untreated K562 cells DCt values from treated K562 cells DCt values to give a DDCt value, and relative gene expression (y axis) was calculated as 2-DDCt (Lower plot). Data shown here is from one experiment representative of three separate experiments (n=3). Statistical significance was calculated using student t-test. (** = P ≤0.01).
4.2.9.1 The effect of imatinib induced BCR-ABL inhibition on Notch
signalling in K562 cells
K562 cells were cultured in the presence or absence of 10 µM imatinib for 48h.
Following the confirmation of P-crkl inhibition in K562 cells by flow cytometry the
RNA was extracted and the cDNA was prepared using the High Capacity cDNA
Archive Kit (Applied Biosystems). Results showed that Hes1 was upregulated in
K562 cells after 48h treatment with 10 µM imatinib (Fig 4.14). This up-regulation
was significant in three different experiments (P≤ 0.01).
4.2.9.2 The effect of Notch inhibition by GSI on BCR-ABL in K562
cells
Gamma secretase inhibitor (GSI) has been widely used as a useful tool to study
Notch signalling. GSI has been shown to inhibit Notch signalling in normal CD34+
cells and in T-ALL cell lines (Chadwick et al. 2007; Kogoshi et al. 2207). To
investigate the effect on BCR-ABL activity following Notch inhibition K562 cells
were cultured with DMSO as a vehicle control or with 10 µM GSI for 24h. The dose
and time point used here were tested before in the lab and shown to induce Notch
inhibition in leukaemic cell lines (Dr. N. Chadwick, personal communication). The
cells where then harvested and the intracellular P-crkl assay was performed as
described in 2.2.3.4. An aliquot of the same treated and untreated samples where used
for RNA extraction and cDNA preparation. Hes1 expression was assessed by real
time PCR to confirm the inhibition of Notch activity by GSI in K562 cells (Fig. 4.13).
Real time PCR results showed down-regulation of transcriptional target gene Hes1 in
the GSI treated K562 cells. The FACS analysis of the same cells showed a dramatic
increase in P-crkl expression in the GSI treated cells as compared to no drug control
cells (Fig 4.15). These results were reproduced in three separate experiments.
142
1430
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8** Control
IM +
Rel
ativ
e g
ene
expr
essi
on
144
Fig. 4.14. Expression of Hes1 in K562 cells post 48h treatment of imatinib mesylate (IM). Real time PCR of the Notch target gene Hes1 in K562 cells after 48h treatment with 10 µM imatinib mesylate (IM). Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. Comparison of gene expression between treated (red bar) and untreated cells (blue bar) was derived from subtraction of untreated K562 cells DCt values from treated SIL cells DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. The result shown here is from one experiment representative of three different experiments (n=3). Statistical significance was calculated using student t-test. (** = P≤ 0.01).
•Isotype control
•Untreated
•+ GSI
P- crkl PE
4.2.10 ALL-SIL cell line as a model for ABL-Notch cross-talk
The reported activity of ABL and Notch signalling in ALL-SIL cell line makes it a
further possible in vitro model for the study of the cross-talk of ABL and Notch. The
FACS based P-ckrl assay showed the expression of P-crkl as a marker for the ABL
kinase activity in ALL-SIL cells. To see if the ABL activity can be switched off by
the ABL inhibitor imatinib mesylate (IM) and to ask whether the P-crkl assay can be
utilised as an IM sensitivity assay the effect of IM was investigated on ALL-SIL cells
by P-crkl assay. ALL-SIL cells were cultured in the presence or absence of 10 µM
imatinib mesylate (IM) for 48h. The cells were then stained with P-crkl primary
antibody and PE secondary antibody (BD) as described above. K562 cells were used
in this experiment as a positive control for the P-crkl assay and for the efficacy of IM.
Results showed that ABL kinase is active in ALL-SIL cells and this activity is evident
145
Fig. 4.15. The effect of Notch inhibition on BCR-ABL activity in K562 cells. K562 cells were cultured for 24h in the presence or absence of gamma secretase inhibitor (GSI) and BCR-ABL activity was assessed by P-crkl assay. P-crkl expression for cells treated with 10 µM GSI for 24h is shown in red. P-crkl expression of untreated cells and background flourescence of isotype control are shown in green and blue respectively. The data shown is from one experiment representative of three independent experiments (n=3).
by the phosphorylation of crkl in the absence of IM (Fig 4.16). Treatment of ALL-SIL
cells with IM resulted in clear reduction of P-crkl expression to levels equivalent to
those of the isotype control. This experiment was repeated three times with similar
results.
The finding that ABL is active in ALL-SIL cells and that this activity can be switched
off by IM made it possible to investigate the effect of ABL inhibition on Notch
signalling in ALL-SIL cells. To assess Notch activity in ALL-SIL cells following
ABL inhibition with IM the expression of the Notch target gene Hes1 was
investigated by real time PCR. ALL-SIL cells were cultured in the presence or
absence of 10 µM imatinib for 48h and then one aliquot of the cells from each
condition was harvested to perform the FACS based P-crkl assay and the other aliquot
was used for RNA extraction. Following the confirmation of P-crkl inhibition in
ALL-SIL cells by flow cytometry the RNA from same experiment was reverse
transcribed and cDNA was prepared using the High Capacity cDNA Archive Kit
(Applied Biosystems). Results showed that Hes1 was upregulated in ALL-SIL cells
after 48h treatment with 10 µM imatinib (Fig 4.17). This up-regulation was
significant in three different experiments (P≤ 0.05).
146
P-crkl untreated
Isotype
P-crkl-untreated
IM treated
A
B
P-crkl IM treated
Isotype
C
147
Fig. 4.16. Evaluation of the ALL-SIL cell line as a model for ABL-Notch cross-talk. FACS analysis of P-crkl levels in the ALL-SIL cell line. ALL-SIL cells stained with P-crkl primary antibody and PE secondary antibody (BD) (in red) and isotype control (in blue) (A). Expression of P-Crkl in ALL-SIL cells after incubating the cells for 48h with 10 µM imatinib mesylate (IM) is shown in green and isotype control in blue (B) . P-crkl expression of IM treated cells is shown in green as compared to untreated cells in red (C). The data shown is from one experiment representative of three independent experiments (n=3).
0
2
4
6
8
10
12
14
16
18
*
Rel
ativ
e g
ene
expr
essi
on
Control
+ IM
4.3 Discussion
4.3.1 The FACS based P-crkl assay as a surrogate assay for ABL kinase activity
Data from this chapter showed that the P-crkl assay is a fast and reliable method to
assess the ABL kinase activity and response to imatinib (IM) in cell line models.
Certain technical aspects of the assay, however, may affect the interpretation of the
data and need to be addressed. For example it was evident that the choice of the
appropriate isotype control was critical for obtaining the right levels of P-crkl
expression and that the use of secondary antibody alone as a substitute of the rabbit
IgG isotype control may yield false increase in the P-crkl expression in the tested
cells. The well established method of analyzing levels of phosphorylated proteins by
flow cytometry is by subtracting the mean fluorescence intensity (MFI) of the
148
Fig. 4.17. Expression of Hes1 in ALL-SIL cells post 48h treatment of imatinib mesylate (IM). Real time PCR of the Notch target gene Hes1 in ALL-SIL cells after 48h treatment with 10 µM imatinib mesylate (IM). Gene expression was normalised to the GAPDH house keeping gene and represented as DCt values. Comparison of gene expression between treated (red bar) and untreated cells (blue bar) was derived from subtraction of untreated SIL cells DCt values from treated SIL cells DCt values to give a DDCt value, and relative gene expression was calculated as 2-DDCt. The result shown here is from one experiment representative of three different experiments (n=3). Statistical significance was calculated using student t-test. (* = P ≤0.05).
phospho antibody–labeled sample from the MFI of the corresponding isotypic control
(Desplat et al. 2004). Therefore, using secondary antibody as a negative control
would result in a lower MFI as compared to the MFI of the IgG isotype control and
this incorrectly would results in higher estimation of the P-crkl content in the P-crkl
labeled sample.
The P-crkl validation experiments performed here suggest that the BD PE F(ab')2 anti
rabbit secondary antibody is superior to other secondary antibodies tested in K562
cells in terms of fluorescence intensity and specificity. This was the only antibody
among the others tested here which was recommended by the manufacturer for
intracellular flow cytometric staining. The Fc-mediated non-specific binding of this
antibody to Fc receptor-bearing cells was reduced by removing the whole IgG and Fc
fragments which resulted in more specific binding to the P-crkl primary antibody.
The Sigma FITC secondary antibody showed a staining pattern similar to that of the
BD PE secondary antibody in terms of specificity. This specificity may be explained
by the fact that this antibody is a monoclonal antibody to rabbit IgG which is devoid
of binding to other species. Although the BD PE secondary antibody was brighter
than the Sigma FITC secondary antibody in terms of fluorescence intensity, they both
represent a good choice to use as secondary antibodies in the P-crkl assay. This is
particularly important when investigating the P-crkl levels in certain cell subsets
where surface staining of other cell surface markers is also required in the P-crkl
assay.
This data is in agreement with Hamilton et al. (2006) who showed the positive
expression of P-crkl in K562 cells when they intracellularly stained K562 cells with
the P-crkl primary antibody and the Sigma FITC secondary antibody. However, the P-
crkl levels in K562 cells reported by Hamilton and co-workers were higher than the
isotype control used in their study by about two fluorescence channels. We only found
one fluorescence channel difference between the isotype control and the P-crkl
labeled cells even when the BD PE secondary antibody was used in the assay. Our
results are similar to those of the manufacturer of the P-crkl antibody in terms of the
relative fluorescence difference between the isotype control and the P-crkl labeled
K562 cells.
149
K562 cells proved to be a good positive control that can be used in the FACS based P-
crkl assay. However, careful monitoring of the BCR-ABL kinase activity by the P-
crkl assay over a long time period demonstrated gradual reduction of P-crkl content in
K562 cells. The data showed that K562 cells should not be used as a control in the P-
crkl assay if the cells were cultured for more than 20 passages. The passage number
effect on the protein expression of cell lines has been reported before. For example,
the expression and activity of the multidrug resistance protein (MDR1) in Caco-2 cell
line has been demonstrated to be higher in lower passages and then decline at higher
passage numbers (Siissalo et al. 2007). In addition, alkaline phosphatase activity was
reduced signficantly in high-passage Caco-2 cells compared to low-passage cells (Yu
et al. 1997). In another study, it has been shown that low and high passage RAW
264.7 cells can be transfected equally but protein expression is significantly reduced
in the high-passage cells (Jacobsen1 and Hughes, 2007).
The reduced expression of phosphorylated crkl in high passage K562 cells can be
explained by two possible mechanisms. Firstly, it is possible that K562 cells may
undergo differentiation after certain passage numbers and this may reduce the kinase
activity of BCR-ABL. It has been reported that myeloid differentiation is associated
with down-regulation of BCR-ABL tyrosine activity (Oda et al. 1994). The second
mechanism which may explain the reduction of phosphorylated crkl may be the
presence of elevated levels of tyrosine phosphatases in differentiated K562 cells
which may mediate a dephosphorylation reaction. In support of this is the finding that
differentiation of K562 cells was associated with the expression of protein tyrosine
phosphatase SHP-1 which results in dephosphorylation of a specific set of tyrosyl
phosphoproteins down stream of BCR-ABL (Bruecher-Encke et al. 2001).
4.3.2 P-crkl expression in other leukaemic cell lines
The data in this chapter also showed that P-crkl is hardly detectable in a second BCR-
ABL positive cells line - NALM-1. This result is in agreement with Wetzel et al.
(2005) who showed by flow cytometry that the P-crkl expression is very low in the
NALM-1 cell line as compared to K562 cells. It is unknown whether the low
expression of P-crkl in the NALM-1 cells was due to a weak kinase activity of BCR-
ABL or low abundance of the crkl protein in the NALM-1 cells. However, this
150
finding may suggest that the NALM-1 cell line is not a suitable model to investigate
the cross-talk of Notch and BCR-ABL. The P-crkl assay of the BCR-ABL negative
Jurkat cell line did not show positive expression of P-crkl which further confirms the
specificity of the P-crkl assay and that the Jurkat cells can be utilised as a negative
control in the P-crkl assay.
The finding that P-crkl is clearly expressed in the ALL-SIL cells confirms the intact
activity of the ABL kinase in the ALL-SIL cells and shows that crkl protein is also a
substrate down stream of the NUP214-ABL1 fusion protien. This is the first time that
the P-crkl expression is demonstrated in ALL-SIL cell line by the FACS based P-crkl
assay. The level of P-crkl expression in ALL-SIL cells was relatively low compared
to that demonstrated in K562 cells. This finding is in agreement with the recent
finding that the NUP214-ABL1 fusion protein has a lower in vitro tyrosine kinase
activity than the kinase activity observed with BCR-ABL (De Keersmaecker et al.
2008b). Since the Notch activity is well documented in ALL-SIL cells (Graux et al.
2004; and Keersmaecker et al. 2008), the finding that the ABL fusion protien exhibits
a constitutive tyrosine kinase activity that can be assessed by the P-crkl assay may
make the ALL-SIL cell line a possible experimental model to study the cross-talk
between Notch and ABL signalling pathways.
4.3.3 Inhibition of p-crkl by imantinib mesylate in K562 cells.
After establishment of the P-crkl assay as a rapid and sensitive method to validate the
BCR-ABL activity in K562 cells, the effect of IM on BCR-ABL activity could be
evaluated. The efficacy of imatinib mesylate (IM) as a BCR-ABL inhibitor was
confirmed in K562 cells by the FACS based P-crkl assay with doses of 5 µM and 10
µM achieving more than 90% reduction of P-crkl expression. The sensitivity and
specificity of this assay has been shown in this chapter to correlate very well with the
Western blotting technique. These findings are in agreement with those reported by
Hamilton et al. (2006).
4.3.4 Notch signalling in K562 cells
151
In order to establish whether K562 was a suitable model of the activated Notch profile
seen in primary CD34+ CML cells, the expression of the Notch-1 receptor and the
Notch target, Hes-1 was investigated in K562 cells. The study of Notch signalling in
K562 cells showed that the intracellular domain of Notch1 (ICN1) is highly expressed
in K562 cells. However, the extra cellular domain of Notch1 (ECN1) could not be
detected by FACS analysis using the EA1 monoclonal antibody. Gene expression
profiling using the conventional PCR technique showed the presence of Notch1 at the
mRNA level in K562 cells. The failure to detect the Notch1 expression on the cell
surface of K562 cells is not surprising as the ECN1 could not be detected in our lab in
other cell lines including CEM and TFI cell lines which exhibit active Notch
signalling (Dr. N.Chadwick, personal communication). It is unlikely that the
specificity of the EA1 antibody was responsible for the failure to detect ECN1 in
K562 cells because we were able to detect ECN1 in primary CML cells as shown in
chapter 3. In addition, ECN1 was detected before in our lab in the HEK293 cells
transfected with full-length Notch1 (Dr. V. Portillo, personal communication). It
therefore appears that Notch-1 is expressed at very low levels on the surface of the
K562 cells, possibly because only low levels are normally expressed in this cell type,
or perhaps as a result of the type of mutation seen in T-ALL where the extracellular
domain is not stably expressed. Another possible explanation for the inability to
detect ECN1 in K562 cells is that Notch1 may be modulated at the cell surface by
glycosylation. As described in chapter one glycosylation is a process in which a
glycosyltransferase protein modifies the EGF repeats on the ECN1 to modulate
various activities of Notch such as Notch-ligand interaction, Notch folding and
intracellular trafficking of Notch (Acar et al. 2008). Modification of the EGF repeats
by glycosylation regulates the specificity of Notch binding to different ligands and it
is tempting therefore to speculate that glycosylation of the extra cellular domain of
Notch1 in K562 cells may mask the EA1 binding to its epitope on ECN1. In support
of this notion, glycosylation modification of the AT1 receptor (Angiotensin II
receptor subtype I) in COS-7 cells caused a dramatic decrease in cell surface
expression of AT1 receptor (Lanctot et al. 2005).
The activity of Notch in K562 cells was initially assessed by Hes1 expression by
conventional RT-PCR. This approach showed no Hes1 expression at the message
level which is similar to the result reported by Yin et al. (2008) who also used the
152
conventional RT-PCR method to measure the gene expression of Hes1 in K562 cells.
However, Hes1 expression was clearly detected by using the more sensitive real time
PCR method. The discrepancy between Hes1 gene expression data obtained by the
RT-PCR and that obtained by real time PCR can be attributed to the fact that the latter
is far more sensitive than the former due to the use of more sensitive fluorescent dyes
in the PCR reaction and the ability to detect the target gene at the exponential stage of
amplification. The expression of Hes1 in K562 cells was further confirmed by using a
gamma secretase inhibitor which induced down-regulation of Hes1 expression as
demonstrated by real time PCR. Taken together, the previous findings show that K562
cell line fulfills the basic criteria as a good candidate model for the study of BCR-
ABL and Notch cross-talk in terms of having intact and inhabitable activity of both
signalling pathways.
As it had initially proven difficult to detect Hes-1 by conventional PCR, attempts
were also made to devise a K562 model with activated Notch signalling.
Ectopic expression of constitutively activated Notch-1 E in K562 cells induced a
dramatic decrease in K562 cell numbers via apoptosis and/ or inhibition of
proliferation as evidenced by loss of transfected cells from the culture. This effect was
confirmed by the ability of GSI to rescue the transfected K562 cells. The data
presented here is in agreement with Yin et al. (2008) who showed that over-
expression of the constitutively active Notch1 repressed the growth of the K562 cells
in vitro.
The attempt to activate Notch signalling by VPA in K562 cells resulted in unexpected
outcomes. VPA exhibited an inhibitory action on Notch signalling in K562 as
demonstrated by the down-regulation of the Notch target gene Hes1 and the VPA
induced inhibition of Notch signalling resulted in increased phosphorylation of crkl. It
is evident therefore that VPA works as Notch inhibitor in K562 cells and produces
similar effect to that of GSI on BCR-ABL activity. This effect of VPA on BCR-ABL
in K562 cells lends further support to the antagonistic interaction between the Notch
signalling pathway and BCR-ABL in the blastic phase of CML which was seen with
GSI treatment of K562 cells. The action of VPA on Notch signalling demonstrated
here in K562 cells is in contrast to previous published reports which proposed that
VPA is an activator of Notch signalling in various cancer cell lines (Stockhausen et
al. 2005; Greenblatt et al. 2008; and Platta et al. 2008). However, it can be argued
153
that none of these studies were performed in haemopoietic cells or leukaemic cell
lines and therefore the action of VPA on Notch signalling may be cell context
dependant. The data showed that inhibition of Notch in K562 cells by VPA was
associated by repression of erythroid differentiation as assessed by the expression of
glycophorin-A. This is in agreement with a recent study in which ectopic Notch
activation in FDCP-mix cells accelerated differentiation along the erythroid lineage
(Henning et al. 2007). This effect of VPA on erythroid differentiation may be
mediated by Wnt signalling as VPA has been reported to activate Wnt signalling
(Wiltse, 2005). Since Wnt activation has been shown to block erythroid
differentiation in mice (Kirstetter et al. 2006), it is possible that VPA may inhibit
erythroid differentiation in K562 cells by activating Wnt signalling.
4.3.5 Cross-talk between Notch and BCR-ABL in K562 cells
Inhibition of BCR-ABL by IM in K562 cells resulted in significant up-regulation of
Notch activity as assessed by Hes1 gene expression. This is the first demonstration of
an interaction between Notch and BCR-ABL in CML cells, although the biological
consequences of Notch activation in K562 cells following IM treatment remain to be
fully investigated. It can be seen from the effect of ectopic expression of Notch in
K562 cells attempted in this chapter that Notch activation may inhibit proliferation or
induce apoptosis in K562 cells. However, it should be noted that K562 cells, unlike
the chronic phase CML primary samples in chapter 3, are from the blastic phase of
CML. In agreement with this, Robert-Moreno et al. (2007) have shown that activation
of Notch positively regulates apoptosis in the MEL erythroleukemia cells and in
primary erythroid cells in mice. Notch mediated apoptosis in IM treated K562 cells
may explain the profound sensitivity of K562 cells to IM as assessed by reduction of
P-crkl expression. It is possible that activation of Notch signalling following IM in
K562 cells may result in increased levels of Notch mediated apoptosis.
The exact mechanism by which IM up-regulates Notch activity in K562 cells remain
to be elucidated. GSK3β is a serine/threonine kinase and is a component of the Wnt
signaling pathway. It has been shown in cell line models that GSK3β positively
modulate Notch signalling by protecting the intracellular domain of Notch1 (ICN1)
from proteasome degradation (Foltz et al. 2002). It has also been reported that GSK3β
154
is inhibited by the protein serine-threonine kinases Akt which is a down stream
substrate of the BCR-ABL oncoprotien in CML (Cantley, 2002). It is possible
therefore that IM may activate GSK3β by inhibiting BCR-ABL and that the activated
GSK3β may subsequently stabilises the ICN1 and thereby up-regulates the Notch
target gene Hes1.
The inhibition of Notch signalling in K562 cells by GSI resulted in a marked increase
in P-crkl expression. This effect implies that Notch signalling may negatively regulate
BCR-ABL in the K562 cell line and that down-regulation of Notch may directly or
indirectly enhance the activity of BCR-ABL. K562 cells are in the blsatic phase of
CML and the association between Notch downregulation and progression to the
blastic phase has been proposed recently (Sengupta et al. 2008).
In addition, it is well documented that BCR-ABL expression and crkl phosphorylation
are higher in progenitor cells of CML patients in blast crisis than those of chronic
phase patients (Barnes et al. 2005). It can be seen therefore that the effect of GSI
induced Notch inhibition on BCR-ABL activity in K562 cells may mirror the status of
Notch and BCR-ABL signalling pathways in the blastic phase primary CML cells.
The precise mechanism by which Notch modulate BCR-ABL in the blastic phase
remain to be identified. One model that can be postulated for Notch and BCR-ABL
crosstalk in the blastic phase of CML is that the blastic phase CML cells remain
dependant on BCR-ABL activity for their proliferation and that down-regulation of
Notch signalling maintains the oncogenic activity of BCR-ABL. These observations
highlight the importance of considering the cell context when investigating these
signalling pathways, and that although K562 and other leukaemic cells are useful
tools as models for signalling, in order to examine the signalling in the context of
chronic phase CML, primary tissue samples need to be used.
4.3.6 Cross-talk between Notch and BCR-ABL in the ALL-SIL cell
line model system
However it is clear from the work on T-ALL-SIL cells that the observed interactions
between the pathways are not confined to blast crisis CML cells. The ALL-SIL cells
proved to be a good model system to further validate the cross-talk between Notch
155
and BCR-ABL. It can been seen that this in vitro model system fulfills the basic
criteria to investigate the interaction between Notch and BCR-ABL signalling in
terms of the well documented active and inhabitable Notch signalling (Graux et al.
2004; and Keersmaecker et al. 2008) and in terms of the presence of a constitutively
activated tyrosine kinase which is sensitive to the ABL kinase inhibitor IM. The
findings of P-crkl expression and inhibition of the P-crkl levels by IM in the ALL-SIL
cells as assessed here by the FACS based P-crkl assay are in agreement with the data
reported by Graux et al. (2004) and those by Quinta´s-Cardama et al. (2008) who
used western blotting to demonstrate P-crkl expression and the effect of IM on crkl
phoshphorylation in the ALL-SIL cells. The previous results indicate that NUP214-
ABL1 is a constitutively activated tyrosine kinase that may activate similar pathways
as BCR-ABL.
The inhibition of the NUP214-ABL1 kinase activity by IM resulted in significant
upregulation of the Notch target gene Hes1. This effect recapitulated the IM induced
effect on K562 cells in which the inhibition of ABL kinase activity led to activation of
Notch signalling. Therefore the finding that the aberrant ABL activity may antagonize
Notch signalling in leukaemic cells as found in K562 cells can be extended to a
second cell line, ALL-SIL cells. The precise mechanism by which IM induces
activation of Notch in K562 and ALL-SIL cells remain to be investigated. However, it
is possible that this may be mediated by the GSK3β kinase which has been proposed
in the previous section.
156
Chapter 5: Cross-talk between Notch and BCR-ABL in primary CD34+ CML cells
5.1 Introduction
The rare leukaemic stem cells (LSCs) in chronic phase CML remain a challenge to the
currently available BCR-ABL targeted treatment options (Elrick et al. 2005). BCR-
ABL + CD34+ CD38- cells which are enriched with LSCs do not respond to imatinib
mesylate (IM) in vitro (Graham et al. 2002). In vivo, LSCs are most likely to be
responsible for the minimal residual disease seen in most patients who were treated
with IM and achieved complete cytogenic response (Jorgensen and Holyoake, 2007).
Current knowledge suggests that resistance to IM in chronic phase CML patients may
be due to either ABL tyrosine kinase mutations and/ or persistence of disease due to
157
BCR-ABL independent mechanisms (Deininger and Holyoake, 2005). In line with
this notion, LSCs in CML have been shown to be resistant to Dasatinib, a novel SRC/
BCR-ABL inhibitor, which is reported to inhibit the majority of kinase mutations in
IM-resistant CML (Copland et al. 2006). These findings raise the possibility that
LSCs in CML, beside their dependence on BCR-ABL, may depend on other survival
pathways that were underestimated by current CML molecular targeted therapy.
Since the LSCs in CML have the same phenotypic and functional characteristics of
normal haemopoeitic stem cells (HSCs), it is very likely that they also share the same
self-renewal and survival pathways such as the Notch, Wnt, and Hedgehog signalling
pathways. Recently, it has been reported that Wnt and Hedgehog signalling pathways
are essential for the survival of LSCs in CML.
Zhao et al (2007) showed in a conditional β-Catenin knockout mice that β-catenin
deletion causes a profound reduction in the ability of mice to develop BCR-ABL
induced CML which demonstrates that Wnt signalling is required for self-renewal of
LSCs in CML. More recently, Hu et al (2008) showed in a CML mouse model the
existence of a LSC survival pathway that was not inhibited by imatinib even though
IM inhibited BCR-ABL phosphorylation and provided evidence of the essential role
of Wnt signalling for survival and self-renewal of CML LSCs. However, another
report challenges the view that Wnt signalling is a BCR-ABL independent survival
pathway for the LSCs in CML. It has been shown that BCR-ABL physically interacts
with β-catenin and that BCR-ABL levels control the degree of β-catenin stabilisation
(Coluccia et al. 2007). In the same study the authors confirmed in primary cells and in
a cell line model that imatinib mesylate (IM) inhibited β-catenin expression in blastic
phase of CML.
Interestingly, Dierks et al (2008) showed, in human and mice, that Hedgehog
signalling is activated in LSCs in CML through up-regulation of the Hedgeohg's
transmembrane receptor Smo and that Smo is essential for the expansion of the LSC
pool in mice. To determine if Hedgehog signalling was dependent on BCR-ABL
kinase activity, the authors used imatinib to inhibit ABL in murine BCR-ABL+ LSCs
and found that the transcripts levels of the Hedgohog target gene Gli1 was decreased
by only 20%.
158
Data from chapter three shows clearly that Notch signalling is hyperactive in the most
primitive LSCs as well as in CD34+ progenitor cells in the chronic phase of CML
patients. Knowing that Notch signalling is essential for the survival and self-renewal
of normal HSCs and possibly LSCs in CML, it was intriguing therefore to ask if there
is cross-talk between Notch and BCR-ABL signalling pathways. This is particularly
important to elucidate possible active survival pathways in CML LSCs that are BCR-
ABL independent and are not targeted yet by ABL kinase inhibitors alone. The
results shown in chapter four indicates that there may be cross-talk between ABL and
Notch signalling in ABL+ leukaemic cell lines.
This chapter aims first to apply the p-crkl FACS based assay to monitor the BCR-
ABL activity in primary CML cells. It also aims to investigate the nature of Notch and
BCR-ABL interaction in CD34+ chronic phase CML cells by two approaches. Firstly,
by inhibition of BCR-ABL kinase activity by the kinase inhibitor imatinib and
determining the effect of that on Notch signalling by real time PCR. Secondly, by
inhibiting Notch signalling by a gamma secretase inhibitor (GSI) and looking at the
BCR-ABL kinase activity by the p-crkl assay.
5.2: Results
5.2.1 Crkl phosphorylation can be detected in primary CD34+ CML cells by intracellular flow cytometry assay
The P-crkl FACS based assay has been used as a surrogate marker to monitor the
BCR-ABL kinase activity in CML and other malignancies and as a parameter for the
efficacy of imatinib and other tyrosine kinase inhibitors (Copland et al. 2006). The P-
crkl assay was validated in K562 cells in chapter four and the staining conditions were
assessed before application of the assay to primary CD34+ CML cells.
In initial experiments CD34+ CML cells from frozen CML samples were fixed and
stained with anti-P-crkl primary antibody and PE secondary antibody as established
for K562 cells in chapter four. However, no positive P-crkl staining was seen using
this method in primary cells. This finding led to a re-evaluation of the staining method
159
for use with primary cells. Firstly, the experiment was performed on cells thawed and
stained on the same day, whereas others have cultured primary in cytokines before
assessing P-crkl expression (Dr. Sophia Hatziieremia, University of Glasgow,
personal communication). CD34+ cells where therefore cultured overnight in serum
free medium supplemented with cytokine cocktail comprising 100 ng/ mL Flt3-
ligand, 100 ng/ mL stem cell factor, and 20 ng/ mL each of interleukin (IL)–3, IL-6
and granulocyte-colony stimulating factor (G-CSF) for 24 hours before assay.
However, under these conditions CD34+ cells still did not show P-crkl expression
when stained with anti-P-crkl primary antibody and PE secondary antibody. Therefore
modifications of the staining conditions including fixation and permeabilisation
procedures, primary antibody concentration, and type of secondary antibody used in
the assay were reassessed. It was found that P-crkl could not be detected when the PE
secondary antibody (BD) was used but was detected when Sigma FITC secondary
antibody was used (Figure. 5.1). This observation was only evident with the primary
CD34+ CML cells as parallel experiments on K562 cells showed positive P-crkl
expression with both PE as well as FITC anti-rabbit secondary antibodies, which is
consistent with experiments results reported in chapter four. Therefore, a protocol
using FITC anti rabbit secondary antibody was adopted for the remaining experiments
to detect P-crkl in primary CD34+ cells.
160
K562
K562 CML
PE
FITC
CML
A
B
▲ Unstained
▲Isotype control
▲P-crkl
▲Isotype control
▲P-crkl
5.2.2 Imatinib mesylate (IM) inhibits BCR-ABL activity in chronic
phase CML CD34+ cells
Inhibition of BCR-ABL activity was the first approach taken to investigate cross-talk
between Notch and BCR-ABL. It has been shown in chapter four that imatinib
mesylate (IM) can inhibit BCR-ABL kinase activity in the CML cell line K562. Since
this chapter aims to study the cross-talk between Notch and BCR-ABL in primary
CD34+ CML cells, the efficacy of IM on primary CD34+ CML was tested by using
the FACS based P-crkl assay. CML samples from leukapheresis products from
patients with chronic phase CML (n=5) were highly enriched for CD34+ and cultured
for 24h in serum free medium (SFM) which was supplemented with the five growth
factor cocktail described in section 5.2.1. CML cells were then treated with Imatinib
mesylayte (10 uM) for 72h and the inhibitory effect of IM on CD34+ CML cells was
assessed by the P-crkl flow cytometric assay. At the time of assessment of P-crkl
161
Fig. 5.1. Application of P-CrKl assay to primary chronic myeloid leukaemia (CML) samples. Mononuclear cells from frozen aliquots of primary CML cells were cultured for 24h in cytokines cocktail before being fixed and stained with P-crkl primary antibody and either PE (A) or FITC (B) conjugated anti-rabbit secondary antibodies. The P-crkl staining patterns in CML samples are shown in the right hand side plots in A and B and K562 cells which were run as a positive control are shown in the left plots. Cells stained with P-crkl PE are shown in red, whereas unstained cells and isotype control are shown in blue and green respectively (panel A). The P-crkl FITC stained cells are depicted in green and isotype control in red (panel B). CML data shown is from one primary CML sample representative of three separate samples from CML patients.
content most of the samples were found to be > 90% CD34+. In two samples in which
the CD34+ percentage was 70% the CD34 gating strategy at time of analysis was used
to ensure that only CD34+ cells assessed for P-crkl expression. To control for the
sensitivity of the P-crkl assay and the efficacy of IM, the assay was performed on
untreated and IM treated K562 cells in parallel with the P-crkl assay on primary CML
cells. Figure 5.2 and 5.3 show the inhibitory effect of IM on BCR-ABL in CML
samples. Expression of P-crkl was clearly reduced on CD34+ from three CML
samples as compared to untreated samples. However, there was some expression of P-
crkl in two CML samples after 72h of IM treatment (Figure 5.3) suggesting a level of
resistance to IM in these two patients.
5.2.3 Effect of Imatinib in CD34+ CML cells upregulates Hes1 Notch
target gene expression
Next, the effect of IM induced BCR-ABL inhibition on CD34+ CML cells on Notch
signalling was investigated. All CML samples were enriched for CD34+ cells using
magnetic CD34 selection. After culture with or without imatinib (as described in
section 5.2.2) the percentage of CD34 cells in culture was assessed by FACS and
RNA was extracted directly from cultured cells if they were > 90% CD34+ or FACS
sorted if they were < 90% CD34+. The Notch target gene Hes1 was used as an
indicator of Notch activation and Hes1 transcript levels were investigated by real time
PCR in IM treated CD34+ CML cells. Figure 5.4 shows Hes1 gene expression
following 72h IM treatment of CD34+ cells isolated from imatinib sensitive CML
patients (CML1, 3, and 6). There was a 4 fold increase (n=3 ± 1.1) in Hes1 gene
expression following treatment of CD34+ CML cells with IM. This increase was
statistically significant in all three individual CML samples that showed up-regulation
of Hes1.
To ask if Hes1 up-regulation was only found in IM sensitive CD34+ CML cells the
expression of Hes1 was also investigated in CD34+ from the two CML samples that
showed resistance to IM (CML2 and 4). In both CML samples Hes1 expression in IM
treated CD34+ cells was minimally reduced or similar to untreated cells (Figure 5.5)
with no significant difference in gene expression observed in either samples. It can be
concluded therefore that only CD34+ CML cells that were IM sensitive showed
162
activation of Notch, as assessed by induction of Hes1 gene expression, when BCR-
ABL is inhibited.
CML-untreated
P-crkl (FITC)
BA CML + IM C K562 + IM
3
6
K562- untreated D
1ND
163
164
Fig. 5.2. Inhibition of BCR-ABL activity by imatinib mesylate (IM) in CD34+ cells isolated from CML patients. Primary CD34+ cells were isolated from three CML patients (CML3,CML6, and CML1) and cultured overnight with growth factors alone before being kept in the absence (A) or presence (B) of 10 µM IM for 72h. CD34+ cells were then harvested and the P-crkl assay was performed by FACS to assess the activity of BCR-ABL in treated and untreated cells. In each case at least 70% of cells analysed for P-crkl expression were CD34+. Where possible, P-crkl staining of untreated K562 cells (C) and IM treated K562 cells (D was performed at the same time as positive controls for the P-crkl assay and imatinib mesylate efficacy. The P-crkl FITC stained cells are shown in green and isotype control in red in all plots.
CML + IMCML- untreated
P-crkl (FITC)
A BK562 + IM
4
K562- untreatedC D
2ND
165
Fig 5.3. Evidence of resistance to imatinib mesylate (IM) in CD34+ from two CML patients. CD34+ cells from two CML patients (CML4 and CML2) were isolated and cultured for 24h before being treated with 10 µM IM for 72h. CD34+ cells were then harvested and the P-crkl assay was performed by FACS on untreated (A) and IM treated cells (B) to assess the response to IM. In each case at least 70% of cells analysed for P-crkl expression were CD34+. In one case P-crkl staining of untreated K562 cells (C) and IM treated K562 cells (D) was performed at the same time as positive controls for the P-crkl assay and imatinib mesylate efficacy. The P-crkl FITC stained cells are shown in green and isotype control in red in all plots.
0
1
2
3
4
5
6
7
8
Control
+ IM
0
1
2
3
4
5
6
Control
+ IM
Rel
ativ
e ge
ne
exp
ress
ion
Rel
ativ
e ge
ne
exp
ress
ion
CML1
CML3
CML 6
0
0.5
1
1.5
2
2.5
3
3.5
Control
+ IM
***
**
*
Rel
ativ
e ge
ne
exp
ress
ion
166
Fig. 5.4. Hes1 gene expression post imatinib mesylate (IM) treatment in CD34+ cells isolated from imatinib sensitive CML pateints. CD34+ cells isolated from the same CML patients shown in fig. 5.2 were cultured in the presence (light bar) or absence (blue bar) of 10 µM IM for 72h. Live CD34+ cells were then sorted and the gene expression profile of the Notch target gene Hes1 was investigated by real time PCR. Relative gene expression was calculated using the DDCt method. Statistical significance was calculated using student t-test. (* = P ≤0.05, ** = P ≤0.01, *** = P ≤0.001).
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Control
+ IM
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ IM
Rel
ativ
e ge
ne
exp
ress
ion
Rel
ativ
e ge
ne
exp
ress
ion
CML2
CML4
5.2.4 Investigating the effect of Notch inhibition on BCR-ABL
activity in CD34+ CML cells
Results from chapter three showed that Notch signalling is hyperactive in CD34+
cells including the most primitive stem cell enriched CD34+ Thy-1+ cell subset in
chronic phase CML patients. The results from chapter 4 showed that GSI induced
Notch inhibition led to increase of ABL kinase activity in K562 and ALL-SIL cell
lines. To further investigate the nature of cross-talk between Notch and BCR-ABL in
CML, the gamma secretase inhibitor GSI-IX was used to induce Notch inhibition on
CD34+ CML cells before assessing the effect of Notch inhibition on BCR-ABL
activity on those cells.
5.2.4.1 GSI induced inhibition of Notch signalling in CD34+ CML cells
Gamma secretase inhibitors (GSI) have been widely used as a useful tool to study
Notch signalling. It was therefore important to determine whether GSI could induce
inhibition of Notch signalling in CD34+ CML cells before looking at BCR-ABL
167
Fig. 5.5. Hes1 gene expression post imatinib mesylate (IM) treatment in CD34+ cells isolated from IM resistant CML pateints. CD34+ cells isolated from the same CML patients shown in fig. 5.3 were cultured in the presence (light bar) or absence (blue bar) of 10 µM IM for 72h. Live CD34+ cells were then sorted and the gene expression profile of the Notch target gene Hes1 was investigated by real time PCR. Relative gene expression was calculated using the DDCt method. Student t-test in both CML samples showed no significant difference in Hes1 expression between treated and untreated cells.
activity status following GSI treatment. Therefore, Hes1 expression post GSI
treatment was investigated as an assay for the efficacy of GSI on Notch activity in
CD34+ CML cells.
CD34+ CML cells from five patients were cultured as described above with a five
growth factor cocktail (as described in section 5.2.1) for 72h in the presence or
absence of 10 µM GSI before carrying out real time PCR for the Notch target gene
Hes1. Figure 5.6 shows that CD34+ cells in three CML samples (CML2, 4, and 5)
responded very well to the inhibitory action of GSI as evident by down-regulation of
Hes1. This down-regulation was significant in two samples and not significant in one
sample (P= 0.09).
CD34+ cells from two CML samples (CML1 and 6) showed no evidence of a
response to GSI treatment as assessed by a decrease in the expression of Hes1 mRNA
(figure 5.7). To confirm these findings the real time PCR experiments were repeated
with more concentrated cDNA samples but this again showed no significant
difference of Hes1 gene expression between untreated and GSI treated CD34+ CML
cells.
168
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Control
+ GSI
*Rel
ativ
e ge
ne
exp
ress
ion
CML2
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ GSI
Rel
ativ
e ge
ne
exp
ress
ion
CML4
P=0.09
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ GSI
Rel
ativ
e ge
ne
exp
ress
ion
*
CML5
169
Fig. 5.6. Hes1 gene expression after gamma secretase inhibitor (GSI) treatment in CD34+ cells isolated from CML patients 2, 4, and 5. CD34+ cells were isolated from CML patients and cultured in the presence (red bar) or absence (blue bar) of 10 µM GSI for 72h. Live CD34+ cells were then sorted and the gene expression of the Notch target gene Hes1 was investigated by real time PCR. Relative gene expression was calculated using the DDCt method. Data shown is from three CML samples (n=3). Statistical significance was calculated using student t-test. (* = P ≤0.05).
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Control
+ GSI
Rel
ativ
e ge
ne
exp
ress
ion
CML1
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
1.8
Control
+ GSI
Rel
ativ
e ge
ne
exp
ress
ion
CML6
5.2.4.2 Non GSI responding CD34+ CML cells express high mRNA levels of Hes1
The finding that GSI treatment failed to downregulate Hes1 in CD34+ cells from two
CML samples was interesting given the finding in chapter three of high levels of Hes1
expression in CD34+ cells from CML patients as compared with NBM. It was not
possible to perform GSI inhibition experiments on the CML samples which were used
to demonstrate upregulation of Hes1 in the CD34+ populations (chapter three). The
CML cells tested in section 5.2.4.1 were from frozen material from CML patients
whose Notch signalling activity was not confirmed. It was possible that the observed
failure to respond to GSI treatment in the two CML samples described here may be
due to low Hes1 transcript levels to start with. Therefore, Hes1 gene expression was
measured in the CD34+ cells in all CML samples used in this chapter by real time
PCR and compared to CD34+ cell from normal bone marrow. It was found that Hes1
expression was upregulated in CD34+ cells in all six CML samples as compared to
normal CD34+ cells from normal bone marrow. This upregulation was statistically
significant (P ≤0.01) and confirmed the findings in chapter three. This data exclude
170
Fig. 5.7. Hes1 gene expression after gamma secretase inhibitor (GSI) treatment in CD34+ cells isolated from pateint 1 and 6. CD34+ cells were isolated from CML patients and cultured in the presence (red bar) or absence (blue bar) of 10 µM GSI for 72h. Live CD34+ cells were then sorted and the gene expression of the Notch target gene Hes1 was investigated by real time PCR. Relative gene expression was calculated using the DDCt method. Student t-test in both CML samples showed no significant difference in Hes1 expression between treated and untreated cells.
the possibility that failure of CD34+ cells to respond to GSI in samples 2 and 4 was
due to low levels of Hes1 mRNA in the starting material. Taken together these
observations also suggest that the high levels of Hes1 in some of these samples are the
result of gamma secretase independent Notch signalling.
5.2.4.3 Gamma secretase inhibitor (GSI) increases the kinase activity of BCR-ABL in CD34+ CML cells
To further explore the cross-talk between Notch and BCR-ABL, the effect of the
Notch inhibitor GSI on BCR-ABL activity was investigated in CD34+ CML cells.
CD34+ CML cells from five patients were cultured as described before with a five
growth factors cocktail (as described in section 5.1) for 72h in the presence or absence
of 10 µM GSI before measuring BCR-ABL activity by the FACS based P-crkl assay.
At the time of P-crkl assay the percentage of CD34+ cells in the culture was measured
and counted to be between 70-90% in all samples. CD34+ gating strategy was applied
at the time of the P-crkl assay to samples which were found to have < 90% CD34+
cells in order to have at least 90% CD34+ cells in all CML samples analysed for their
P-crkl expression. The BCR-ABL positive K562 cells were used as a positive control
for the P-crkl assay in each case.
To calculate the change in P-crkl expression the mean fluorescence intensity (MFI) of
GSI treated or untreated CD34+ cells was first determined by subtracting the MFI of
P-crkl stained cells from the MFI of isotype control in each condition. The MFI of
GSI treated cells was then compared to the MFI of untreated cells and the change in
P-crkl expression was reported as percentage.
Interestingly, FACS data showed that GSI treatment increased the P-crkl expression
in CD34+ cells between 18-42 % as compared to total P-crkl in untreated CD34+
cells. Figure 5.9 shows increase in the P-crkl expression in CD34+ CML cells from
GSI responsive CML samples (CML2, 4, and 5) that showed downregulation of Hes1
mRNA post GSI treatment. This data suggests that the increase in P-crkl expression
on these samples is most likely Notch dependant. However, it appears that the other
two CML samples which did not show Notch inhibition by PCR post GSI treatment
(CML 1 and 6) also exhibited an 18- 40% increase in crkl phosphorylation (figure
171
5.10). The increase in P-crkl in CD34+ CML cells (n=5) was statistically significant
as shown in figure 5.11 (P< 0.01).
5.2.4.4 Gamma secretase inhibitor (GSI) decreased the kinase activity of BCR-ABL in CD34+ CML cells from one CML patient
In contrast to the results shown earlier for five CML patients, GSI treatment of
CD34+ cells from one CML patient (CML3) showed inhibition of BCR-ABL activity
as can be seen from the reduction of P-crkl expression by 30% as compared to no-
drug control (figure 5.12). CD34+ cells from this sample responded very well to the
GSI induced inhibition and showed downregulation of Hes1 post 72h GSI treatment.
Therefore, the effect of GSI treatment on BCR-ABL activity on CD34+ cells from
this sample is most likely a Notch mediated effect. Interestingly, CD34+ cells from
the same patient were sensitive to imatinib treatment since after 72h incubation with
10 µM IM the P-crkl expression was markedly reduced as compared to untreated cells
(figure 5.12). Imatinib treatment caused significant upregulation of Hes1 in CD34+
cells (P< 0.001). This is the only CML sample which showed BCR-ABL inhibition
following the inhibition of Notch signalling by GSI.
The findings of Notch and BCR-ABL cross-talk from all six CML patients tested here
are summarised in table 5.12.
1721
10
100
1000
10000
100000
1000000 NBM
CML
CML1 CML2 CML3 CML4 CML5 CML6
**
**
**
**
**
**
Log
fol
d c
han
ge in
gen
e ex
pre
ssio
n
173
Fig. 5.8. Hes1 gene expression in CD34+ CML cells. The gene expression profiles of the Notch target gene Hes1 was investigated by real time PCR. Data is shown from CD34+ cells isolated from six CML patients in chronic phase and CD34+ control cells from three normal bone marrow (NBM) samples. Relative gene expression was calculated using the DDCt method. The log fold change in Hes1 gene expression in each CML sample is plotted against the mean of Hes1 expresion in the three NBM samples. Statistical significance was calculated using the Mann-Whitney test. (** = P ≤0.01).
CML+GSI
P-crkl (FITC)
BA CML-untreated
2
4
5
40%
42%
Untreated k562C
18%
174
Fig. 5.9. Assessment of P-crkl in CD34+ CML cells following inhibition of Notch by gamma secretase inhibitor (GSI). Primary CD34+ cells were isolated from three CML patients (CML2, CML4, and CML5) and cultured overnight with growth factors alone before being kept in the absence (A) or presence (B) of 10 µM GSI for 72h. CD34+ cells were then harvested and the P-crkl assay was performed by FACS to assess the activity of BCR-ABL in treated and untreated cells. At least 90% of cells analysed for P-crkl expression were CD34+. In each case P-crkl staining of untreated K562 cells (C) was performed at the same time as a positive control for the P-crkl assay. The increase in P-crkl expression in GSI treated versus untreated cells is shown as a percentage. The P-crkl FITC stained cells are shown in green and isotype control in red in all plots. The GSI induced inhibition of Notch in all CML samples shown here was confirmed by real time PCR (see Fig.5.6).
CML- untreated CML + GSI Untreated K562C
40%
18%
1
6
BA
175
Fig. 5.10. Assessment of P-crkl in gamma secretase inhibitor (GSI) non responsive CD34+ CML cells. Primary CD34+ cells were isolated from two CML patients and cultured overnight with growth factors alone before being kept in the absence (A) or presence (B) of 10 µM GSI for 72h. CD34+ cells were then harvested and the P-crkl assay was performed by FACS to assess the activity of BCR-ABL in treated and untreated cells. At least 70% of cells analysed for P-crkl expression were CD34+. In each case P-crkl staining of untreated K562 cells (C) was performed at the same time as a positive control for the P-crkl assay. The increase in P-crkl expression in GSI treated versus untreated cells is shown as a percentage. The P-crkl FITC stained cells are shown in green and isotype control in red in all plots. In the two CML samples shown here Notch activity was not inhibited by GSI as revealed by real time PCR (see fig. 5.7).
P-crkl (FITC)
Mea
n %
P-c
rkl
0
5
10
15
20
25
30
35
40
45
control
+ GSI
**
176
Fig. 5.11. P-crkl in CD34+ CML cells treated with gammas secretase inhibitor (GSI). CD34+ cells from five CML patients in chronic phase were cultured in the absence (blue bar) or presence (red bar) of 10 µM GSI for 72h. The change in BCR-ABL activity was assessed by the FACS based P-crkl assay. P-crkl expression was measured by mean fluoresnece intensity (MFI) units in each condition. MFI of P-crkl in GSI treated CD34+ cells was compared to no-drug control in each sample and the percentage of increase in P-crkl was calculated. Data shown here represent the mean of five CML samples. Statistical significance was calculated using student t-test (** = P ≤0.01).
177
+GSI +IMUntreated
0
1
2
3
4
5
6
7
8
Control
+ IM
0
0.2
0.4
0.6
0.8
1
1.2
Control
+ GSI
Rel
ativ
e ge
ne e
xpre
ssio
nR
elat
ive
gene
exp
ress
ion
**
***
A
- 30%
P-crkl (FITC)
B
C
178
Figure 5.12. GSI treatment induced both Notch and BCR-ABL inhibition in CD34+ cells from one CML sample. CD34+ cells from CML 3 patient were cultured overnight with cytokines and then treated with GSI or IM for 72h before assessing P-crkl expression (A). The increase in P-crkl expression in GSI treated versus untreated cells is shown as a percentage. The P-crkl FITC stained cells are shown in green and isotype control in red in all plots. Hes1 gene expression was investigated by real time PCR on CD34+ cells treated for 72h with GSI (B) or with IM (C). Relative gene expression was calculated using the DDCt method. Statistical significance was calculated using student t-test. (** = P ≤0.01, *** = P ≤0.001).
Effect of GSI on ABL activity
Response to GSI)Hes1 expression(
Effect of IM on Notch activity
Response to IM (P-crkl assay)
Sample
P-crkl overexpressionNo responseHes1 up-regulationSensitive
P-crkl overexpressionHes1 downregulationNo effectResistant
P-crkl reductionHes1 downregulationHes1 up-regulationSensitive
P-crkl overexpressionHes1 downregulationNo effectResistant
P-crkl overexpressionHes1 downregulationNo effectSensitive
P-crkl overexpressionNo responseHes1 up-regulationSensitive
Table 5.1. Summary of Notch- BCR-ABL cross-talk data following treatment of CD34+ CML cells from six CML patients with GSI and IM.
5.3: Discussion
Cross-talk between BCR-ABL and Notch has been investigated in cell lines in chapter
four. Although most of the interactions between BCR-ABL and other signalling
pathways have been described in blastic phase cell lines, this may not represent the
behaviour of this oncoprotien in chronic phase disease in vivo (Marley and Gordon,
2005). Therefore, it was important to use patient derived material to investigate the
possible cross-talk between BCR-ABL and Notch signalling in chronic phase CML.
5.3.1 BCR-ABL activity can be monitored in primary CD34+ CML cells by flow cytometry
The activity of BCR-ABL has been shown to be responsible for initiating and
maintaining the leukaemic clone in the chronic phase of CML (Quintás-Cardama and
Cortes, 2008). Western blotting and immunoprecipitation have proven technically
challenging tools to monitor BCR-ABL interactions with other signalling molecules
and/or substrates in primary CML cells (Marley and Gordon, 2005). The development
of the FACS based P-crkl assay to monitor BCR-ABL activity provides a more
reliable method to monitor BCR-ABL activity and its response to drugs in CML
patients. This intracellular flow cytometric assay which detects phophorylated crkl by
using an anti-phospho crkl (P-crkl) antibody, only requires small cell numbers from
patient samples and, unlike western blotting, can be performed in few hours
(Hamilton et al. 2006).
179
The P-crkl assay was validated in K562 cells in chapter four but has to be validated in
primary CML samples before it can be used as a marker for BCR-ABL activity in
patient samples. Data from this chapter shows that the choice of secondary antibody
is a critical step in P-crkl staining of primary CD34+ CML cells. P-crkl expression
could not be detected in CD34+ cells from chronic CML patients when the PE
(Becton Dickinson) conjugated anti rabbit antibody was used. This is in contrast to the
blastic phase CML cell line K562 which showed very bright P-crkl expression with
PE conjugated secondary antibody (see chapter four). This discrepancy is most likely
due to inherent differences between primary chronic phase CD34+ CML cells and the
blastic phase K562 cells. The CD34+ CML cells are relatively small cells (Jørgensen
and Holyoake, 2007). It is possible that uptake of PE fluorochrome, a 240-kDa
protein, by the CD34+ CML cells is difficult to achieve due to the large molecular
weight of PE molecule as compared to FITC fluorochrome which has a molecular
weight of only 389 daltons.
A thorough literature search showed that only few studies have attempted the
intracellular flow cytometric P-crkl assay to monitor BCR-ABL in CML patients. In
most of these studies, the FITC conjugated anti rabbit secondary antibody was used
against P-crkl primary antibody in CD34+ CML cells (Jiang et al. 2007b; Hamilton et
al. 2006; and Copland et al. 2006). In contrast, Jilani et al (2008) have used a PE
conjugated secondary antibody (Santa Cruz Biotechnology) to detect crkl
phosphorylation in imatinib-treated versus imatinib-naïve CML patient
peripheral blood cells. Although the authors showed a positive PE fluorescence
signal in the naïve CML cells, they used mononuclear cells from CML patients rather
than limiting their study to the more primitive CD34+ cells. In addition to studying
cell population other than the CD34+ cells studied here, Jilani and co-workers used a
different permeabilisation reagent and a secondary antibody from different supplier
which makes comparison between their findings and data reported here more difficult.
Nonetheless, within the conditions described here, the use of the PE conjugated
secondary antibody (BD) to detect crkl phosphorylation in CD34+ CML cells did not
show positive P-crkl signal.
180
Data on P-crkl FACS staining showed higher levels of P-crkl expression on K562
cells as compared to primary CD34+ CML cells when cells stained with P-crkl
antibody and the FITC conjugated secondary antibody. It is well documented that
levels of crkl phosphorylation correlates well with the levels of BCR-ABL expression
(Hoeve et al. 1994). It has been shown that BCR-ABL expression and activity as well
as crkl phosphorylation is higher in progenitor cells of patients in blast crisis than in
those of chronic phase patients (Barnes et al. 2005). Therefore it is perhaps not
surprising to see higher P-crkl expression in the blastic phase CML cell line K562 as
compared to CD34+ chronic CML cells.
5.3.2 Imatinib mesylate inhibits BCR-ABL activity and up-regulates
Notch activity in CD34+ chronic phase CML cells
One of the approaches used in this chapter to study BCR-ABL and Notch cross-talk in
chronic phase CML was to investigate the effect of BCR-ABL inhibition on Notch
activity. Therefore, the BCR-ABL inhibitor imatinib mesylate (IM) was utilised in
this chapter as a tool to inhibit BCR-ABL activity in CD34+ cells.
The results showed that BCR-ABL activity was inhibited by IM in CD34+ cells of 4/6
patients. This effect was shown as marked reduction of crkl phosphorylation post 72h
of 10 µM IM treatment (n=4). This is in agreement with Chu et al (2004) who showed
that imatinib exposure in doses between 1-5 µM resulted in inhibition of crkl
phosphorylation in CML CD34+ cells in a dose-dependent manner and as early as
after two hours of IM treatment. The authors used western blot analysis to examine
the IM effect on crkl phosphorylation, a method which was found to correlate very
well with the FACS based P-crkl assay used in this project (see chapter four).
Copland and colleagues (2006) showed that the majority of CD34+ CML cells were
sensitive to 5 µM IM at 16 hours and showed clear reduction of P-crkl. However, they
also reported that the surviving CD34+ cells showed minimal reduction in P-crkl at 72
hours. The authors interpreted this as enrichment of IM resistant population post 72h
of IM treatment. Data presented in this chapter showed also two CML samples that
181
did not respond to IM at 72h and showed minimal reduction of crkl phosphorylation
(Figure 5.3) which may reflect the time point used. In fact, the 72h time point was
chosen in our study in order to have enhanced IM mediated inhibition of BCR-ABL
activity. Holtz et al (2002) reported that IM induced more significant suppression of
CML CFCs after a 96-hour exposure as compared with 24-hour exposure.
Resistance of CML stem cells to imatinib is likely to be multifactorial and the
underlying mechanisms may depend on stage of disease, genetic instability within the
malignant clone, and duration of treatment (Copland et al. 2006). For instance, it has
been shown that the level of BCR-ABL expression determines the resistance to
imatinib and that elevated expression of BCR-ABL in CD34+ progenitor cells from
CML patients in blast crisis make them much less sensitive to imatinib as compared to
chronic CD34+ CML cells (Barnes et al. 2005). In chronic phase CML and in newly
diagnosed patients at least two mechanisms for imatinib resistance are postulated:
mutations in the tyrosine kinase domain which may be present in some patients even
before IM treatment (Roche-Lestienne et al. 2002; and Jiang et al. 2007a) and/or
disease persistence, resulting from inherent insensitivity of CML stem cells to IM due
to BCR-ABL independent survival signals (Deininger and Holyoake, 2005). The more
primitive CD34+ CD38- cell subset which constitutes about 5% of the total CD34+
CML cells and the quiescent CML stem cells which are about 1% of CD34+ cells
have been shown to be resistant to imatinib (Copland et al. 2006; Copland et al.
2008). It was found that the levels of BCR-ABL and P-crkl are higher in those more
primitive CD34+ populations as compared to the total CD34+ cells. In addition, no
BCR-ABL mutations where detected in IM resistant CD34+ CD38- cells which may
suggest that their IM resistance may be due to BCR-ABL independent mechanisms
(Cpland et al. 2008). It is possible therefore that the IM resistance shown here in total
CD34+ cells from two CML patients is due to either BCR-ABL mutations on the
CD34+ cells or due to the presence of higher percentages of the most primitive
CD34+ CD38- cells in theses CML samples as compared with the other IM sensitive
CML samples studied in this chapter.
Data presented here and by others shows that IM has an immediate effect on CD34+
CML cells on most chronic phase patients. CD34+ cells that were confirmed by the
182
FACS based P-crkl assay to be IM sensitive were used to study the effect of BCR-
ABL inhibition on Notch signalling activity.
Real time PCR data showed that IM induced inhibition of BCR-ABL in CD34+ cells
resulted in significant up-regulation of Hes1, the Notch target gene, in three CML
patients. This finding is interesting as it shows for the first time that BCR-ABL
signalling pathway may interact with the Notch signalling pathway in CD34+ chronic
CML cells. This effect was observed only in CML samples which were IM sensitive
(CML1, CML3, and CML6) and a similar effect was not obsereved in IM resistant
samples. It should be noted also that IM does not target Notch directly and does not
influence gamma secretase activity in vitro (Eisele et al. 2007). Therefore it can be
concluded that up-regulation of Hes1 post imatinib treatment was a BCR-ABL
mediated effect.
The concentration of growth factors (GF) used in culturing CD34+ CML cells is
critical to the interpretation of drug responses and biological activities of this cell
population. For example, Chu et al (2004) showed that imatinib led to unexpected
activation of MAPK pathway in CD34+ CML cells and demonstrated by comparing
high and low concentrations GF conditions that the increased MAPK activity was
growth factor dependent effect. In addition, it may be speculated that CD34+ cells
may proceed toward terminal differentiation under high-concentration GF
conditions.
The concentration of growth factors used in this study is regarded by some groups as
a "high concentration" growth factor cocktail (Jiang et al. 2007b; Copland et al.
2008). This was used for the short term cultures used in this study in order to
stimulate cell division and achieve BCR-ABL inhibition in CD34+ CML cells as
these cells showed much more increased resistance to imatinib when cultured in low
growth factors concentrations (Jiang et al. 2007b). The intra cellular domain of Notch
receptors have been shown to have a cytokine response region (NCR) which could
modulate the activity of Notch in response to different cytokines (Bigas et al. 1998).
If Notch activation reported here was in response to cytokines in the culture then it
should have occurred in both IM treated and untreated CD34+ CML cells. However,
Notch activation was only observed in IM treated CD34+ cells.
183
Interestingly, Copland et al (2008) showed that imatinib in the presence of high–
concentration growth factors led to increased numbers of CML stem/ progenitor cells
via its anti-proliferative effects. Moreover, careful precautions were taken to ensure
that IM induced effect reported here was limited to the CD34+ cell population. For
example, PCR experiments were performed on cDNA from either CD34+ sorted cells
or cells that were enriched by magnetic selection and confirmed to have > 95%
CD34+ cells at the end of IM culture. In addition, the CD34 expression of cultured
cells was monitored every day by FACS and results showed an enrichment of CD34+
cells at the end of 72h culture (data not shown). Therefore, it is unlikely that the
imatinib effect on Notch activation was due to growth factors induced differentiation
of CML cells.
Imatinib did not have significant effects on crkl phosphorylation in normal CD34+
cells (Chu et al. 2004; and Hamilton et al. 2006). This suggests that enhanced Notch
signalling post imatinib treatment may be specific to CD34+ CML cells. This effect
of imatinib on Notch activity was previously shown in the CML cell line K562 as
well as in the ABL+ cell line SIL-ALL (chapter four).
The mechanism by which imatinib induces activation of Notch in CD34+ CML cells
is remain to be investigated. Dishevelled is a an essential cytoplasmic component and
key player in the Wnt signalling pathway in which its phosphorylation leads to
stabilisation of β-catenin and activation of Wnt signalling (Katoh and Katoh, 2007).
In contrast, there is evidence that Dishevelled binds physically to Notch and serves to
down-regulate Notch signalling in Drosophila (Panin and Irvineseminars, 1998).
Since imatinib has been shown to inhibit Wnt signalling in CML cells (Coluccia et al.
2007), it is possible that imatinib up-regulates Notch signalling by inhibiting
Dishevelled and thus abolish the inhibitory effect of Dishevelled on Notch signalling.
The activation of Notch signalling following imatinib treatment is interesting when
compared with the effects of this BCR-ABL inhibitor on other cell survival pathways
such as Wnt and Hedgehog signalling on CD34+ CML cells. As mentioned earlier,
IM inhibited Wnt signalling and decreased the expression of Hedgehog target genes
by 20%. In contrast, imatinib led to Notch activation on CD34+ CML cells. This is
184
may be confusing as Notch signalling has been shown to be active on the sasme CML
samples tested here even before exposure to imatinib. One possible explanation is that
IM induced Notch activation may represent a compensatory response to inhibition of
BCR/ABL tyrosine activity in CD34+ CML cells. In fact, Notch activation post IM
treatment may explain the enrichment of CD34+ cells reported here and by others at
the end of CD34+ culture. In support of this hypothesis is the finding that Notch1
activation inhibits differentiation of hematopoietic stem cells both in vitro and in vivo
and results in enhanced stem cells numbers (Stier et al. 2002). Moreover, activation of
Notch4 in normal human marrow or cord blood cells resulted in enhanced stem cell
activity and reduced differentiation (Vercauteren and Sutherland, 2004).
5.3.3 Notch inhibition enhances BCR-ABL kinase activity in CD34+
chronic CML cells
Gamma secretase is a protease that is composed of a high molecular weight
multicomponent complex of transmembrane proteins. This enzyme act beside Noch
receptor on other substrates like the amyloid precursor protein (APP) resulting in the
production of β-amyloid protein involved in Alzheimer’s disease pathology. Gamma
secreatse processes also other substrates like ErbB4, E-cadherin, and CD44 (Tian et
al. 2003). The mechanisms by which gamma secretase reacts with these different
substrates remains unknown.
Gamma secretase inhibitor (GSI) treatment of CD34+ CML cells resulted in Hes1
down-regulation in most CML samples studied here. However, GSI treatment failed
to show a decrease in Hes1 mRNA in CD34+ cells from two CML patients. This was
unexpected as GSI has been shown to inhibit Notch signalling in normal CD34+ cells
and in T-ALL cell lines (Chadwick et al. 2007; Kogoshi et al. 2207). However, failure
to inhibit Notch activity by GSI treatment was reported in cancer cells by two groups.
Kogoshi et al (2007) showed that GSI did not decrease Hes1 mRNA in two leukaemic
cell lines including one myeloid cell line. Zhang et al (2008) studied the role of
Notch in osteosarcoma and confirmed the activation of Notch pathway genes and
target genes including Hes1 in osteosarcoma cell lines. However, GSI did not down-
regulate Hes1 mRNA in the osteosarcoma cell line COL. These findings and the data
185
reported here can be explained by two possible mechanisms. Firstly, it is likely that
Hes1 expression in cells that fail to show Hes1 response to GSI is Notch receptor
independent and therefore cannot be down-regulated by GSI. For example, it has been
shown in Raji B-lymphoma cells that EBNA2 protein activates the transcription factor
RBP-J and activates Notch signaling while bypassing the Notch
protein (He et al. 2008). The other possibility is that GSI non responding cells may
have an as-yet uncharacterised activating mutation in the Notch pathway. Such
mutations may result in truncated forms of Notch receptors that do not require ligand
binding or gamma secretase activity for nuclear translocation and active signalling.
An example is the t(7,9) translocation found in 1% of T-ALL cases and results in the
formation of the truncated active Notch1 (TAN1) which is constitutively active and
not inhibited by GSI (Grabher et al. 2006).
Interestingly, CD34+ cells from those two CML patients who did not respond to GSI
showed significant up-regulation of Hes1 when BCR-ABL activity was inhibited by
imatinib. It is possible therefore that BCR-ABL may act as a Notch repressor and its
inhibition activates down stream proteins which activates the transcription factor
RBP-J directly and results in Notch activation while bypassing the Notch receptor.
This hypothesis may be supported by the finding presented in chapter three that Notch
proteins are not over-expressed in CML.
Since Notch signalling was postulated here as a possible candidate for BCR-ABL
independent resistance to imatinib, it was anticipated that GSI treatment would result
in reduction of BCR-ABL activity. However, it appears that GSI treatment
significantly enhanced crkl phosphorylation in CD34+ CML cells. This effect on
BCR-ABL activity was observed in most CML samples treated with GSI (n=5)
regardless of the effectiveness of GSI in inhibiting the Notch pathway activity. It can
be seen therefore that GSI cannot be used in drug combinations to overcome imatinib
resistance in CD34+ cells in CML.
Keersmaecker et al (2008a) investigated the effect of combining gamma secretase
inhibitor with imatinib in the ALL-SIL cell line. Since these T-ALL cells had Notch1
activating mutations as well as the ABL fusion protein the authors attempted to
186
combine inhibitors of Notch and ABL to see if this combination could offer a
therapeutic advantage over using GSI alone to inhibit cell growth. However, it was
found that the inhibitory effect of imatinib on cell proliferation was antagonised by
GSI when the two drugs were added at the same time. Although the authors could not
see an increase in ABL phosphorylation by western blotting following GSI treatment,
the data presented here shows, through an unidentified mechanism yet, a significant
increase in P-crkl phosphorylation in CD34+ CML cells post GSI treatment. This may
suggest that Notch antagonises ABL in CML and inhibition of Notch may increase
the activity of BCR-ABL in the contest of CD34+ cells in CML.
Similar interaction between Notch and ABL was described in Drosophila. Genetic
interaction studies on the mechanisms that regulate the ISNb motor nerve
development in Drosophila have shown that Notch and ABL, via unknown
mechanism, act antagonistically and that their gain- and loss-of-function phenotypes
equally suppress one another in ISNb (Crowner et al. 2003). The mechanism by
which Notch antagonises ABL in CML is not yet clear and further research is required
to elucidate other signals or pathways that control this interaction.
Gamma secreatse inhibitors may also inhibit other targets like the amyloid precursor
protein (APP), ErbB4, E-cadherin, and CD44 (Tian et al. 2003). However, a link
between the inhibition of any of these substrates and increased BCR-ABL activity in
CML seems unlikely.
187
Chapter 6: Final discussion
The Notch signalling pathway has been suggested to play a vital role in HSC survival
and self renewal (Duncan et al. 2005). Aberrant NOTCH1 expression has been
identified as a causative factor in the development of a subset of T-cell acute
lymphoblastic leukemia (T-ALL) (Ellisen et al. 1991) and activating mutations in
Notch1 have been identified in more than 50% of human T-ALL (Weng et al. 2004).
However, the role of Notch signalling in other leukaemias is not well established. The
data from this project demonstrates for the first time that expression of Notch1 and
Notch2 at the mRNA level is up-regulated in CD34+ cells from chronic phase CML
patients as compared with CD34+ cells from normal donors. Furthermore Notch
signalling, as assessed by Hes1 expression, is also up-regulated in this cell subset in
chronic phase CML patients, indicating a hyperactivation of the Notch signalling
pathway.
The mechanisms underlying the activation of Notch signalling demonstrated here in
chronic phase CML patients remain to be elucidated. However, Notch1 activating
mutations have been identified in T-ALL cells and have been shown to contribute to
leukaemogenesis by facilitating ligand-independent pathway activation or by
increasing the half-life of active Notch1 intracellular domain (ICN1) (Weng et al.
2004). In T-ALL cells inhibition of aberreant Notch signalling by GSIs leads to
188
decreased proliferation (Weng et al. 2004) and increased sensitivity to apoptosis
(Chadwick et al. submitted), suggesting that Notch activation contributes to the
transformation of the cells through these effects. Therefore, one possibility is that
activating Notch mutations also occur in CML and that these are responsible for the
increased signalling seen in this study. Consequently it would be intriguing to
examine in future studies whether activating Notch1 mutations are found in CML.
A second possibility is that Notch activity is high in CML CD34+ cells as a result of
changes in ligand concentration in the leukaemic microenvironment. It does not
appear likely that there would be alterations in Notch ligand expression on non-
leukaemic cells in the microenvironment, but there remains the possibility that an up
regulation of ligand on neighboring leukaemic cells is occurring. A detailed analysis
of ligand expression on CML and normal cells would indicate whether this was the
case.
A third possibility is that Notch signalling is up regulated as a result of cross talk with
the BCR-ABL signalling pathway and this possibility was investigated in the present
study. The interaction between Notch and ABL has been observed before in
Drosophila where Notch and abl mutations interact synergistically to produce
synthetic lethality and defects in axon extension (Giniger, 1998). The author has also
shown in another study that Notch and its ligand Delta function in the ISNb motor
nerve patterning in Drosophila mainly to antagonise ABL (Crowner et al. 2003).
This shows clearly that the cross-talk between Notch and ABL may be synergistic or
antagonistic depending on the developmental context. Most recently Mizuno et al.
(2008) have demonstrated that over-expression or enhanced kinase activity of BCR-
ABL and altered expression of Notch1 synergises to induce acute leukemia in a
transgenic model for CML. To test the hypothesis that Notch and BCR-ABL may
interact in CML, leukaemic cell line models were characterised for the expression of
intact and inhibitable Notch and ABL activity. After establishing the optimised
parameters for the FACS based P-crkl assay in this project as a surrogate marker of
ABL kinase activity and by utilizing the BCR-ABL inhibitor imatinib mesylate (IM)
it was confirmed that K562 and ALL-SIL cell lines have a constitutive active ABL
kinase activity that can be blocked by IM enabling a study of the effects of BCR-ABL
189
on the Notch signalling pathway. On the other hand, Notch activity was evident in
K562 cells as assessed by the expression of Hes1 by real time PCR and this activity
was responsive to the inhibition induced by GSI allowing the study of the effects of
Notch signalling on BCR-ABL activity. Active Notch signalling in the ALL-SIL cells
is well documented by others (Quinta´s-Cardama et al.. 2008; and De Keersmaecker
et al.. 2008). It can be concluded therefore that both K562 and ALL-SIL cell lines
may offer themselves as suitable in vitro models to investigate the cross-talk between
Notch and ABL signalling pathways. By using inhibitors of both Notch and ABL
signalling, it was found for the first time that the Notch and ABL pathways antagonise
each other in K562 and ALL-SIL leukaemic cell lines.
These data were then confirmed in primary CD34+ cells isolated from chronic phase
CML patients. The treatment of CD34+ CML cells with IM resulted in significant
upregulation of the Notch target gene Hes1 in three out of the four CML samples that
responded to IM treatment. Likewise FACS data showed that GSI treatment
significantly increased the P-crkl expression in CML CD34+ cells. Taken together
this data implies that Notch and BCR-ABL antagonise each other in primary tissue
from chronic phase CML patients. The exact mechanisms underlying the GSI induced
activation of BCR-ABL signalling and the IM induced activation of Notch signalling
are unknown.
Giniger at al. (1998) suggested two possible mechanisms to explain the cross talk
observed between Notch and ABL in Drosophila. He proposed that Notch may
directly bind to ABL (or possibly bind via an adapter protein) and through this direct
physical association the two pathways may regulate each other. Alternatively the two
molecules may not physically interact but may interact at the level of the downstream
components of the pathway. The proposed interaction in this project between Notch
and BCR-ABL in chronic phase CML warrants further investigation including co-
immunoprecipitation studies to explore the molecular level at which this interaction
occurs and whether this interaction is direct or requires other cellular mediators or
common signalling pathways.
The possibility of cross talk between downstream components is interesting because it
has been demonstrated recently in T-ALL cells that Notch activation positively
190
regulates the phosphatidylinositol 3-kinase (PI3K)/AKT pathway (Palomero et al.
2007). Activation of the PI3K/AKT downstream of Notch signalling was found to be
mediated via inhibition of PTEN (phosphatase and tensin homologue) by the Notch
target gene Hes1. Hes1 was up-regulated in the ALL-SIL T-ALL cell line, a cell line
that has constitutive Notch and ABL kinase activities, following the exposure to IM as
demonstrated in chapter 4. It is possible, therefore, that Hes1 up-regulation following
IM exposure in CML cells may also activate the PI3K/AKT pathway and confer anti
apoptotic signals to CML cells regardless of the BCR-ABL repressed activity (Fig.
6.1). More work is needed to investigate whether the activation of the PI3K pathway
by Notch signalling reported in T-ALL also occurs in CML cells.
Although IM has been shown to inhibit BCR-ABL activity in CD34+ chronic phase
CML cells, only a mild increase in apoptosis was demonstrated in these cells (Chu et
al. 2004). Moreover, it has been shown that IM treatment activated the PI3K/ Akt/
mammalian target of rapamycin (mTor)- anti apoptotic pathway in chronic phase
CML patients as well as in BCR-ABL+ Lama cells (Burchert et al. 2005). This was
unexpected because BCR-ABL is upstream of the PI3K/AKT pathway and blocking
the BCR-ABL activity by IM was anticipated to repress the anti-apoptotic activity of
the PI3K signalling and induce apoptosis. The authors proposed that the IM-induced
compensatory PI3K-Akt/mTor activation may represent a novel mechanism for the
persistence of BCR/ABL-positive cells in IM treated CML patients. In fact, the IM
induced activation of Notch signalling reported in this project may also help to
explain why blocking BCR-ABL activity by IM is not enough to switch off the
PI3K/AKT/mTor anti apoptotic activity.
It is also possible that the antagonistic effects between Notch and BCR-ABL
signalling seen in this study are a reflection of the involvement of additional pathways
active in the CML cells. In the experiments presented here modulation of the Notch
and BCR-ABL pathways have been investigated. However, haematopoietic progenitor
cells have been reported to secrete Wnt (Duncan et al. 2005) and the possibility that
this pathway may therefore be active in these experiments cannot be ruled out. IM has
been shown to inhibit Wnt signalling in CML cells (Coluccia et al. 2007) and in the
murine myeloid progenitor cell line 32Dcl3 (Tickenbrock et al.. 2008) in a way that
may involve inhibition of Dishevelled and activation of GSK3β, both of which are
191
key players in the canonical Wnt signalling pathway. Dishevelled has been reported to
bind to Notch and down-regulate Notch signalling in Drosophila (Panin and
Irvineseminars, 1998). In contrast, it has been shown in cell line models that GSK3β
positively modulates Notch signalling by protecting the intracellular domain of
Notch1 (ICN1) from proteasome degradation (Foltz et al. 2002). Taken together, IM
may activate Notch signalling by modulating the Wnt components Dishevelled and
GSK3β (Fig. 6.1). It is also possible that IM may activate Notch signalling by
blocking the inhibitory action of BCR-ABL on its downstream substrate GSK3β.
Although the in vitro inhibitor based loss of function approaches described here
suggest that Notch and BCR-ABL antagonise each other, the co-existence of activated
Notch and BCR-ABL in vivo in chronic phase CML suggest a cooperative interaction
between the two signalling pathways. One possibility is that both BCR-ABL and
Notch signalling are equally critical for CML cell survival and resistance to apoptosis
and that in vitro inhibition of one of the two signalling pathways may trigger a
compensatory activation of the other pathway to compensate for the loss of total
survival signals (Fig. 6.2). This hypothetical model would require regulatory
molecules in the cytoplasm to sense the reduction of the survival signals from one
pathway and respond by increasing the activity of the other pathway to compensate
for the reduction in total anti-apoptotic signals in BCR-ABL+ cells. These regulatory
molecules themselves may be part of a feedback loop of Notch and BRC-ABL
signalling targets. This model may also explain the activation of Notch signalling in
chronic phase CD34+ CML cells before any manipulation of these pathways.
The outcome of Notch signalling is known to be highly cell context specific. For
example it may lead to resistance to apoptosis in some cell contexts (Sade et al.
2004), and lead to sensitivity to apoptosis in other cell types (Zweidler-McKay et al.
2005). In this study BCR-ABL and Notch cross-talk has been investigated in the
context of CD34+ cells from chronic phase CML patients and it was confirmed in
chapter three that Notch signalling was hyperactive in these cells. Notch signalling
was also upregulated in the more primitive CD34+Thy+ compartment. Most available
BCR-ABL inhibitors have been shown to be effective against CD34+ CML cells but
not against the more primitive CD34+ CD38- cell subset in chronic phase CML
192
(Copland et al.. 2006). It would therefore be important in future work to investigate
the effect of Notch inhibition on BCR-ABL activity in the context of the CD34+
CD38-/Thy+ cell subset by including an extra CD34 and CD38/Thy surface staining
step in the P-crkl assay, enabling thereby the measurement of P-crkl content in the
FACS gated CD34+ CD38-/Thy+ cell subset. Similarly, the effect of BCR-ABL
inhibition on Notch activity within the CD34+ CD38-/Thy+ cell subset could be
attempted in the future by using a BCR-ABL inhibitor that is effective against the
primitive CD34+ CD38-/Thy+ cells such as Dasatinib (Copland et al. 2006).
Whether survival and self renewal of CML stem cells is critically dependant on intact
Notch signalling remains an open question. This question could be addressed by
assessing the proliferation and apoptosis status of the cells following the treatments
with inhibitors outlined in this study. This could also be investigated in vivo in a
mouse model by generating a mouse in which Notch signalling is inactivated by either
a dominant-negative version of the RBPJ protein (DNRBPJ) or a dominant negative
version of the co-activator MAML (DNMAML) (Maillard et al. 2008). Stem cell
enriched cells from control or Notch inactive mice could be then transfected with
control retroviruses or viruses carrying the p210 BCR-ABL and transplanted into
lethally irradiated mice to test the requirement of Notch signalling in induction and
maintenance of CML in vivo.
Clearly many more functional studies are required to investigate the biological and
cellular events that result from the activation of Notch signalling in chronic phase
CML. If Notch signalling was proven to be critical for the survival or proliferation of
chronic phase CML cells, as observed in T-ALL, a more detailed model for the role of
Notch in CML progression could be established. One possibility is that in the context
of the chronic phase of CML Notch is activated and confers proliferation and cell
survival of CD34+ CML cells. Progression to the blastic phase of CML is then
associated with down-regulation of Notch (Sengupta et al. 2007). This fits very well
with the finding in this project that activation of Notch in the blastic phase CML
K562 cells resulted in inhibition of proliferation and by the recent findings that this
may induce apoptosis in K562 cells (Yin et al. 2008). Therefore, it can be
193
postulated that the outcome of Notch signalling in CML will depend on the cellular
context.
194
Fig. 6.1. Proposed model for Notch and BCR-ABL cross-talk in CML. Both BCR-
ABL and Notch signalling activate the PI3K-AKT-mTOR signalling pathway which
confers survival and proliferation signals to CML cells. Blocking BCR-ABL kinase
activity by IM is not sufficient to induce apoptosis in CML cells because they may switch
their addiction for survial signals to the PI3K signalling activated by Notch. In this model,
IM up-regulates Notch by modulating Wnt pathway components GSK3β and or
Dishevelled. IM induced activation of GSK3β or IM induced inhibition of Dishevelled
stabilises ICN in the cytoplasm which in turn activates the PI3K-AKT-mTOR signalling
by up-regulation of Hes1 which abolish the inhibitory effect of PTEN on PI3K pathway.
Hes1
PTEN
BCR ABL
PI3K
++
ICN1
AKT
mTOR
GSK3β
Cell proliferation and survival
Dishevelled
β-catenin
IM
IM
GSK3β
P
P
β-catenin accumulation
Activation
Inhibition
195
Fig.6.2. The cooperative model of activated Notch and BCR-ABL signalling in
chronic phase CML. Both Notch and BCR-ABL are activated in chronic phase CML
where the two signalling pathways may activate survival signalling pathways to inhibit
apoptosis in CD34+ CML cells. In vitro inhibition of Notch signalling by GSI results in
compensatory activation of BCR-ABL activity to keep the same level of survival signals
required for CML cell survival (A). Exposure to IM in vitro leads to compensatory
activation of Notch signalling to maintain the same level of survival signals needed by
CML cells to inhibit apoptosis (B). The net effect is maintenance of balanced levels of
survival signals that protect CD34+ CML cells from apoptosis in the chronic phase of
CML. (GSI: gamma secretase inhibitor, IM: imatinib mesylate).
BCR-ABL NOTCHBCR-ABL
NOTCH
GSI
Survival signals
P P P
Survival signals
GSI
BCR-ABL NOTCH
BCR-ABL
IMNOTCH
Survival signals
P
Survival signals
IM
A
B
References
1 Acar, M., Jafar-Nejad, H., Takeuchi, H., Rajan, A., Ibrani, D., Rana, N. A., Pan, H., Haltiwanger, R. S. and Bellen, H. J. (2008) Rumi is a CAP10 domain glycosyltransferase that modifies Notch and is required for Notch signaling. Cell 132, 247-258
2 Afar, D. E., Goga, A., McLaughlin, J., Witte, O. N. and Sawyers, C. L. (1994) Differential complementation of Bcr-Abl point mutants with c-Myc. Science 264, 424-426
3 Alcalay, M., Meani, N., Gelmetti, V., Fantozzi, A., Fagioli, M., Orleth, A., Riganelli, D., Sebastiani, C., Cappelli, E., Casciari, C., Sciurpi, M. T., Mariano, A. R., Minardi, S. P., Luzi, L., Muller, H., Di Fiore, P. P., Frosina, G. and Pelicci, P. G. (2003) Acute myeloid leukemia fusion proteins deregulate genes involved in stem cell maintenance and DNA repair. J Clin Invest 112, 1751-1761
4 Allman, D., Karnell, F. G., Punt, J. A., Bakkour, S., Xu, L., Myung, P., Koretzky, G. A., Pui, J. C., Aster, J. C. and Pear, W. S. (2001) Separation of Notch1 promoted lineage commitment and expansion/transformation in developing T cells. J Exp Med 194, 99-106
5 Allman, D., Punt, J. A., Izon, D. J., Aster, J. C. and Pear, W. S. (2002) An invitation to T and more: notch signaling in lymphopoiesis. Cell 109 Suppl, S1-11
6 Amarante-Mendes, G. P., Naekyung Kim, C., Liu, L., Huang, Y., Perkins, C. L., Green, D. R. and Bhalla, K. (1998) Bcr-Abl exerts its antiapoptotic effect against diverse apoptotic stimuli through blockage of mitochondrial release of cytochrome C and activation of caspase-3. Blood 91, 1700-1705
196
7 Arai, A., Kanda, E. and Miura, O. (2002) Rac is activated by erythropoietin or interleukin-3 and is involved in activation of the Erk signaling pathway. Oncogene 21, 2641-2651
8 Arai, F. and Suda, T. (2007) Maintenance of quiescent hematopoietic stem cells in the osteoblastic niche. Ann N Y Acad Sci 1106, 41-53
9 Armstrong, F., Brunet de la Grange, P., Gerby, B., Rouyez, M. C., Calvo, J., Fontenay, M., Boissel, N., Dombret, H., Baruchel, A., Landman-Parker, J., Romeo, P. H., Ballerini, P. and Pflumio, F. (2008) NOTCH is a key regulator of human T-cell acute leukaemia initiating cell activity. Blood
10 Artavanis-Tsakonas, S., Muskavitch, M. A. and Yedvobnick, B. (1983) Molecular cloning of Notch, a locus affecting neurogenesis in Drosophila melanogaster. Proc Natl Acad Sci U S A 80, 1977-1981
11 Artavanis-Tsakonas, S., Rand, M. D. and Lake, R. J. (1999) Notch signaling: cell fate control and signal integration in development. Science 284, 770-776
12 Aster, J. C., Pear, W. S. and Blacklow, S. C. (2008) Notch signaling in leukemia. Annu Rev Pathol 3, 587-613
13 Avigdor, A., Goichberg, P., Shivtiel, S., Dar, A., Peled, A., Samira, S., Kollet, O., Hershkoviz, R., Alon, R., Hardan, I., Ben-Hur, H., Naor, D., Nagler, A. and Lapidot, T. (2004) CD44 and hyaluronic acid cooperate with SDF-1 in the trafficking of human CD34+ stem/progenitor cells to bone marrow. Blood 103, 2981-2989
14 Barnes, D. J., Palaiologou, D., Panousopoulou, E., Schultheis, B., Yong, A. S., Wong, A., Pattacini, L., Goldman, J. M. and Melo, J. V. (2005) Bcr-Abl expression levels determine the rate of development of resistance to imatinib mesylate in chronic myeloid leukemia. Cancer Res 65, 8912-8919
15 Baron, M. (2003) An overview of the Notch signalling pathway. Semin Cell Dev Biol 14, 113-119
16 Bellavia, D., Campese, A. F., Alesse, E., Vacca, A., Felli, M. P., Balestri, A., Stoppacciaro, A., Tiveron, C., Tatangelo, L., Giovarelli, M., Gaetano, C., Ruco, L., Hoffman, E. S., Hayday, A. C., Lendahl, U., Frati, L., Gulino, A. and Screpanti, I. (2000) Constitutive activation of NF-kappaB and T-cell leukemia/lymphoma in Notch3 transgenic mice. Embo J 19, 3337-3348
17 Bellavia, D., Campese, A. F., Checquolo, S., Balestri, A., Biondi, A., Cazzaniga, G., Lendahl, U., Fehling, H. J., Hayday, A. C., Frati, L., von Boehmer, H., Gulino, A. and Screpanti, I. (2002) Combined expression of pTalpha and Notch3 in T cell leukemia identifies the requirement of preTCR for leukemogenesis. Proc Natl Acad Sci U S A 99, 3788-3793
18 Bellavia, D., Campese, A. F., Vacca, A., Gulino, A. and Screpanti, I. (2003) Notch3, another Notch in T cell development. Semin Immunol 15, 107-112
19 Bhardwaj, G., Murdoch, B., Wu, D., Baker, D. P., Williams, K. P., Chadwick, K., Ling, L. E., Karanu, F. N. and Bhatia, M. (2001) Sonic hedgehog induces the proliferation of primitive human hematopoietic cells via BMP regulation. Nat Immunol 2, 172-180
197
20 Bhatia, M., Bonnet, D., Murdoch, B., Gan, O. I. and Dick, J. E. (1998) A newly discovered class of human hematopoietic cells with SCID-repopulating activity. Nat Med 4, 1038-1045
21 Bhatia, R., Holtz, M., Niu, N., Gray, R., Snyder, D. S., Sawyers, C. L., Arber, D. A., Slovak, M. L. and Forman, S. J. (2003) Persistence of malignant hematopoietic progenitors in chronic myelogenous leukemia patients in complete cytogenetic remission following imatinib mesylate treatment. Blood 101, 4701-4707
22 Bigas, A., Martin, D. I. and Milner, L. A. (1998) Notch1 and Notch2 inhibit myeloid differentiation in response to different cytokines. Mol Cell Biol 18, 2324-2333
23 Bonde, J., Hess, D. A. and Nolta, J. A. (2004) Recent advances in hematopoietic stem cell biology. Curr Opin Hematol 11, 392-398
24 Bonnet, D. (2003) Biology of human bone marrow stem cells. Clin Exp Med 3, 140-149
25 Brady, G. and Iscove, N. N. (1993) Construction of cDNA libraries from single cells. Methods Enzymol 225, 611-623
26 Bruchova, H., Borovanova, T., Klamova, H. and Brdicka, R. (2002) Gene expression profiling in chronic myeloid leukemia patients treated with hydroxyurea. Leuk Lymphoma 43, 1289-1295
27 Bruecher-Encke, B., Griffin, J. D., Neel, B. G. and Lorenz, U. (2001) Role of the tyrosine phosphatase SHP-1 in K562 cell differentiation. Leukemia 15, 1424-1432
28 Burchert, A. (2007) Roots of imatinib resistance: a question of self-renewal? Drug Resist Updat 10, 152-161
29 Burchert, A., Wang, Y., Cai, D., von Bubnoff, N., Paschka, P., Muller-Brusselbach, S., Ottmann, O. G., Duyster, J., Hochhaus, A. and Neubauer, A. (2005) Compensatory PI3-kinase/Akt/mTor activation regulates imatinib resistance development. Leukemia 19, 1774-1782
30 Callahan, R. and Raafat, A. (2001) Notch signaling in mammary gland tumorigenesis. J Mammary Gland Biol Neoplasia 6, 23-36
31 Calvi, L. M., Adams, G. B., Weibrecht, K. W., Weber, J. M., Olson, D. P., Knight, M. C., Martin, R. P., Schipani, E., Divieti, P., Bringhurst, F. R., Milner, L. A., Kronenberg, H. M. and Scadden, D. T. (2003) Osteoblastic cells regulate the haematopoietic stem cell niche. Nature 425, 841-846
32 Cantley, L. C. (2002) The phosphoinositide 3-kinase pathway. Science 296, 1655-1657
33 Carlesso, N., Aster, J. C., Sklar, J. and Scadden, D. T. (1999) Notch1-induced delay of human hematopoietic progenitor cell differentiation is associated with altered cell cycle kinetics. Blood 93, 838-848
34 Chabannon, C., Wood, P. and Torok-Storb, B. (1992) Expression of CD7 on normal human myeloid progenitors. J Immunol 149, 2110-2113
35 Chadwick, N., Fennessy, C., Nostro, M. C., Baron, M., Brady, G. and Buckle, A. M. (2008) Notch induces cell cycle arrest and apoptosis in human erythroleukaemic TF-1 cells. Blood Cells Mol Dis 41, 270-277
36 Chadwick, N., Nostro, M. C., Baron, M., Mottram, R., Brady, G. and Buckle, A. M. (2007) Notch signaling induces apoptosis in primary human CD34+ hematopoietic progenitor cells. Stem Cells 25, 203-210
198
37 Chai, S. K., Nichols, G. L. and Rothman, P. (1997) Constitutive activation of JAKs and STATs in BCR-Abl-expressing cell lines and peripheral blood cells derived from leukemic patients. J Immunol 159, 4720-4728
38 Cheng, T., Rodrigues, N., Dombkowski, D., Stier, S. and Scadden, D. T. (2000) Stem cell repopulation efficiency but not pool size is governed by p27(kip1). Nat Med 6, 1235-1240
39 Chiaramonte, R., Basile, A., Tassi, E., Calzavara, E., Cecchinato, V., Rossi, V., Biondi, A. and Comi, P. (2005) A wide role for NOTCH1 signaling in acute leukemia. Cancer Lett 219, 113-120
40 Christ, O., Gunthert, U., Haas, R. and Zoller, M. (2001) Importance of CD44v7 isoforms for homing and seeding of hematopoietic progenitor cells. J Leukoc Biol 69, 343-352
41 Chu, S., Holtz, M., Gupta, M. and Bhatia, R. (2004) BCR/ABL kinase inhibition by imatinib mesylate enhances MAP kinase activity in chronic myelogenous leukemia CD34+ cells. Blood 103, 3167-3174
42 Clarkson, B., Strife, A., Wisniewski, D., Lambek, C. L. and Liu, C. (2003) Chronic myelogenous leukemia as a paradigm of early cancer and possible curative strategies. Leukemia 17, 1211-1262
43 Clarkson, B. D., Strife, A., Wisniewski, D., Lambek, C. and Carpino, N. (1997) New understanding of the pathogenesis of CML: a prototype of early neoplasia. Leukemia 11, 1404-1428
44 Collins, B. J., Kleeberger, W. and Ball, D. W. (2004) Notch in lung development and lung cancer. Semin Cancer Biol 14, 357-364
45 Coluccia, A. M., Vacca, A., Dunach, M., Mologni, L., Redaelli, S., Bustos, V. H., Benati, D., Pinna, L. A. and Gambacorti-Passerini, C. (2007) Bcr-Abl stabilizes beta-catenin in chronic myeloid leukemia through its tyrosine phosphorylation. Embo J 26, 1456-1466
46 Copland, M., Hamilton, A., Elrick, L. J., Baird, J. W., Allan, E. K., Jordanides, N., Barow, M., Mountford, J. C. and Holyoake, T. L. (2006) Dasatinib (BMS-354825) targets an earlier progenitor population than imatinib in primary CML but does not eliminate the quiescent fraction. Blood 107, 4532-4539
47 Copland, M., Pellicano, F., Richmond, L., Allan, E. K., Hamilton, A., Lee, F. Y., Weinmann, R. and Holyoake, T. L. (2008) BMS-214662 potently induces apoptosis of chronic myeloid leukemia stem and progenitor cells and synergizes with tyrosine kinase inhibitors. Blood 111, 2843-2853
48 Coulombel, L. (2004) Identification of hematopoietic stem/progenitor cells: strength and drawbacks of functional assays. Oncogene 23, 7210-7222
49 Craddock, C. F., Nakamoto, B., Andrews, R. G., Priestley, G. V. and Papayannopoulou, T. (1997) Antibodies to VLA4 integrin mobilize long-term repopulating cells and augment cytokine-induced mobilization in primates and mice. Blood 90, 4779-4788
50 Crowner, D., Le Gall, M., Gates, M. A. and Giniger, E. (2003) Notch steers Drosophila ISNb motor axons by regulating the Abl signaling pathway. Curr Biol 13, 967-972
51 Dando, J. S., Tavian, M., Catelain, C., Poirault, S., Bennaceur-Griscelli, A., Sainteny, F., Vainchenker, W., Peault, B. and Lauret, E. (2005)
199
Notch/Delta4 interaction in human embryonic liver CD34+ CD38- cells: positive influence on BFU-E production and LTC-IC potential maintenance. Stem Cells 23, 550-560
52 Das, I., Craig, C., Funahashi, Y., Jung, K. M., Kim, T. W., Byers, R., Weng, A. P., Kutok, J. L., Aster, J. C. and Kitajewski, J. (2004) Notch oncoproteins depend on gamma-secretase/presenilin activity for processing and function. J Biol Chem 279, 30771-30780
53 Davis, R. L. and Turner, D. L. (2001) Vertebrate hairy and Enhancer of split related proteins: transcriptional repressors regulating cellular differentiation and embryonic patterning. Oncogene 20, 8342-8357
54 De Keersmaecker, K., Lahortiga, I., Mentens, N., Folens, C., Van Neste, L., Bekaert, S., Vandenberghe, P., Odero, M. D., Marynen, P. and Cools, J. (2008a) In vitro validation of gamma-secretase inhibitors alone or in combination with other anti-cancer drugs for the treatment of T-cell acute lymphoblastic leukemia. Haematologica 93, 533-542
55 De Keersmaecker, K., Versele, M., Cools, J., Superti-Furga, G. and Hantschel, O. (2008b) Intrinsic differences between the catalytic properties of the oncogenic NUP214-ABL1 and BCR-ABL1 fusion protein kinases. Leukemia
56 Deftos, M. L. and Bevan, M. J. (2000) Notch signaling in T cell development. Curr Opin Immunol 12, 166-172
57 Deininger, M. W., Goldman, J. M. and Melo, J. V. (2000) The molecular biology of chronic myeloid leukemia. Blood 96, 3343-3356
58 Deininger, M. W. and Holyoake, T. L. (2005) Can we afford to let sleeping dogs lie? Blood 105, 1840-1841
59 Delforge, M., Boogaerts, M. A., McGlave, P. B. and Verfaillie, C. M. (1999) BCR/ABL- CD34(+)HLA-DR- progenitor cells in early chronic phase, but not in more advanced phases, of chronic myelogenous leukemia are polyclonal. Blood 93, 284-292
60 Desplat, V., Lagarde, V., Belloc, F., Chollet, C., Leguay, T., Pasquet, J. M., Praloran, V. and Mahon, F. X. (2004) Rapid detection of phosphotyrosine proteins by flow cytometric analysis in Bcr-Abl-positive cells. Cytometry A 62, 35-45
61 Dierks, C., Beigi, R., Guo, G. R., Zirlik, K., Stegert, M. R., Manley, P., Trussell, C., Schmitt-Graeff, A., Landwerlin, K., Veelken, H. and Warmuth, M. (2008) Expansion of Bcr-Abl-positive leukemic stem cells is dependent on Hedgehog pathway activation. Cancer Cell 14, 238-249
62 Drexler, H. G., MacLeod, R. A. and Uphoff, C. C. (1999) Leukemia cell lines: in vitro models for the study of Philadelphia chromosome-positive leukemia. Leuk Res 23, 207-215
63 Druker, B. J., Guilhot, F., O'Brien, S. G., Gathmann, I., Kantarjian, H., Gattermann, N., Deininger, M. W., Silver, R. T., Goldman, J. M., Stone, R. M., Cervantes, F., Hochhaus, A., Powell, B. L., Gabrilove, J. L., Rousselot, P., Reiffers, J., Cornelissen, J. J., Hughes, T., Agis, H., Fischer, T., Verhoef, G., Shepherd, J., Saglio, G., Gratwohl, A., Nielsen, J. L., Radich, J. P., Simonsson, B., Taylor, K., Baccarani, M., So, C., Letvak, L. and Larson, R. A. (2006) Five-year follow-up of patients receiving imatinib for chronic myeloid leukemia. N Engl J Med 355, 2408-2417
200
64 Druker, B. J., Tamura, S., Buchdunger, E., Ohno, S., Segal, G. M., Fanning, S., Zimmermann, J. and Lydon, N. B. (1996) Effects of a selective inhibitor of the Abl tyrosine kinase on the growth of Bcr-Abl positive cells. Nat Med 2, 561-566
65 Dube, I. D., Arlin, Z. A., Kalousek, D. K., Eaves, C. J. and Eaves, A. C. (1984) Nonclonal hemopoietic progenitor cells detected in long-term marrow cultures from a Turner syndrome mosaic with chronic myeloid leukemia. Blood 64, 1284-1287
66 Duechler, M., Shehata, M., Schwarzmeier, J. D., Hoelbl, A., Hilgarth, M. and Hubmann, R. (2005) Induction of apoptosis by proteasome inhibitors in B-CLL cells is associated with downregulation of CD23 and inactivation of Notch2. Leukemia 19, 260-267
67 Duncan, A. W., Rattis, F. M., DiMascio, L. N., Congdon, K. L., Pazianos, G., Zhao, C., Yoon, K., Cook, J. M., Willert, K., Gaiano, N. and Reya, T. (2005) Integration of Notch and Wnt signaling in hematopoietic stem cell maintenance. Nat Immunol 6, 314-322
68 Effros, R. B. and Globerson, A. (2002) Hematopoietic cells and replicative senescence. Exp Gerontol 37, 191-196
69 Eisele, Y. S., Baumann, M., Klebl, B., Nordhammer, C., Jucker, M. and Kilger, E. (2007) Gleevec increases levels of the amyloid precursor protein intracellular domain and of the amyloid-beta degrading enzyme neprilysin. Mol Biol Cell 18, 3591-3600
70 Ellisen, L. W., Bird, J., West, D. C., Soreng, A. L., Reynolds, T. C., Smith, S. D. and Sklar, J. (1991) TAN-1, the human homolog of the Drosophila notch gene, is broken by chromosomal translocations in T lymphoblastic neoplasms. Cell 66, 649-661
71 Elrick, L. J., Jorgensen, H. G., Mountford, J. C. and Holyoake, T. L. (2005) Punish the parent not the progeny. Blood 105, 1862-1866
72 Fang, B., Zheng, C., Liao, L., Han, Q., Sun, Z., Jiang, X. and Zhao, R. C. (2005) Identification of human chronic myelogenous leukemia progenitor cells with hemangioblastic characteristics. Blood 105, 2733-2740
73 Fetscher, S., Mertelsmann, R. (2002.) Haematopoietic geowth factors: therapeutic uses. In Nature Encyclopedia of Life Sciences., Nature publishing group.
74 Fleming, R. J. (1998) Structural conservation of Notch receptors and ligands. Semin Cell Dev Biol 9, 599-607
75 Foltz, D. R., Santiago, M. C., Berechid, B. E. and Nye, J. S. (2002) Glycogen synthase kinase-3beta modulates notch signaling and stability. Curr Biol 12, 1006-1011
76 Fortini, M. E. (2002) Gamma-secretase-mediated proteolysis in cell-surface-receptor signalling. Nat Rev Mol Cell Biol 3, 673-684
77 Fowlkes, B. J. and Robey, E. A. (2002) A reassessment of the effect of activated Notch1 on CD4 and CD8 T cell development. J Immunol 169, 1817-1821
78 Frassoni, F., Podesta, M., Piaggio, G., Rosti, V., Pitto, A., Benvenuto, F., Figari, O., Vassallo, F., Carella, A. M., Zikos, P., Bergamaschi, G., Fugazza, G., Sessarego, M. and Cazzola, M. (1999) Normal primitive haemopoietic progenitors are more frequent than their leukaemic
201
counterpart in newly diagnosed patients with chronic myeloid leukaemia but rapidly decline with time. Br J Haematol 104, 538-545
79 Frisch, B. J., Porter, R. L. and Calvi, L. M. (2008) Hematopoietic niche and bone meet. Curr Opin Support Palliat Care 2, 211-217
80 Fuchs, E., Tumbar, T. and Guasch, G. (2004) Socializing with the neighbors: stem cells and their niche. Cell 116, 769-778
81 Furukawa, Y., Kikuchi, J., Nakamura, M., Iwase, S., Yamada, H. and Matsuda, M. (2000) Lineage-specific regulation of cell cycle control gene expression during haematopoietic cell differentiation. Br J Haematol 110, 663-673
82 Giniger, E. (1998) A role for Abl in Notch signaling. Neuron 20, 667-68183 Girard, L., Hanna, Z., Beaulieu, N., Hoemann, C. D., Simard, C.,
Kozak, C. A. and Jolicoeur, P. (1996) Frequent provirus insertional mutagenesis of Notch1 in thymomas of MMTVD/myc transgenic mice suggests a collaboration of c-myc and Notch1 for oncogenesis. Genes Dev 10, 1930-1944
84 Goldsby, R. A. and Goldsby, R. A. K. i. (2003) Immunology. W.H. Freeman, New York ; Houndmills
85 Gordon, M. Y., Dowding, C. R., Riley, G. P., Goldman, J. M. and Greaves, M. F. (1989) Adhesive defects in chronic myeloid leukemia. Curr Top Microbiol Immunol 149, 151-155
86 Gorre, M. E., Mohammed, M., Ellwood, K., Hsu, N., Paquette, R., Rao, P. N. and Sawyers, C. L. (2001) Clinical resistance to STI-571 cancer therapy caused by BCR-ABL gene mutation or amplification. Science 293, 876-880
87 Grabher, C., von Boehmer, H. and Look, A. T. (2006) Notch 1 activation in the molecular pathogenesis of T-cell acute lymphoblastic leukaemia. Nat Rev Cancer 6, 347-359
88 Graham, S. M., Jorgensen, H. G., Allan, E., Pearson, C., Alcorn, M. J., Richmond, L. and Holyoake, T. L. (2002) Primitive, quiescent, Philadelphia-positive stem cells from patients with chronic myeloid leukemia are insensitive to STI571 in vitro. Blood 99, 319-325
89 Grand, F. H., Marley, S. B., Chase, A., Titley, I., Healy, L., Spencer, A., Reiter, A., Goldman, J. M. and Gordon, M. Y. (1997) BCR/ABL-negative progenitors are enriched in the adherent fraction of CD34+ cells circulating in the blood of chronic phase chronic myeloid leukemia patients. Leukemia 11, 1486-1492
90 Graux, C., Cools, J., Melotte, C., Quentmeier, H., Ferrando, A., Levine, R., Vermeesch, J. R., Stul, M., Dutta, B., Boeckx, N., Bosly, A., Heimann, P., Uyttebroeck, A., Mentens, N., Somers, R., MacLeod, R. A., Drexler, H. G., Look, A. T., Gilliland, D. G., Michaux, L., Vandenberghe, P., Wlodarska, I., Marynen, P. and Hagemeijer, A. (2004) Fusion of NUP214 to ABL1 on amplified episomes in T-cell acute lymphoblastic leukemia. Nat Genet 36, 1084-1089
91 Greenblatt, D. Y., Vaccaro, A. M., Jaskula-Sztul, R., Ning, L., Haymart, M., Kunnimalaiyaan, M. and Chen, H. (2007) Valproic acid activates notch-1 signaling and regulates the neuroendocrine phenotype in carcinoid cancer cells. Oncologist 12, 942-951
92 Gridley, T. (2004) Kick it up a Notch: NOTCH1 activation in T-ALL. Cancer Cell 6, 431-432
202
93 Guidos, C. J. (2002) Notch signaling in lymphocyte development. Semin Immunol 14, 395-404
94 Guo, M., Jan, L. Y. and Jan, Y. N. (1996) Control of daughter cell fates during asymmetric division: interaction of Numb and Notch. Neuron 17, 27-41
95 Hamilton, A., Elrick, L., Myssina, S., Copland, M., Jorgensen, H., Melo, J. V. and Holyoake, T. (2006) BCR-ABL activity and its response to drugs can be determined in CD34+ CML stem cells by CrkL phosphorylation status using flow cytometry. Leukemia 20, 1035-1039
96 Han, H., Tanigaki, K., Yamamoto, N., Kuroda, K., Yoshimoto, M., Nakahata, T., Ikuta, K. and Honjo, T. (2002) Inducible gene knockout of transcription factor recombination signal binding protein-J reveals its essential role in T versus B lineage decision. Int Immunol 14, 637-645
97 Han, W., Ye, Q. and Moore, M. A. S. (2000) A soluble form of human Delta-like-1 inhibits differentiation of hematopoietic progenitor cells. Blood 95, 1616-1625
98 Hao, S. X. and Ren, R. (2000) Expression of interferon consensus sequence binding protein (ICSBP) is downregulated in Bcr-Abl-induced murine chronic myelogenous leukemia-like disease, and forced coexpression of ICSBP inhibits Bcr-Abl-induced myeloproliferative disorder. Mol Cell Biol 20, 1149-1161
99 He, F., Wang, L., Hu, X. B., Yin, D. D., Zhang, P., Li, G. H., Wang, Y. C., Huang, S. Y., Liang, Y. M. and Han, H. (2008) Notch and BCR signaling synergistically promote the proliferation of Raji B-lymphoma cells. Leuk Res
100 Henning, K., Schroeder, T., Schwanbeck, R., Rieber, N., Bresnick, E. H. and Just, U. (2007) mNotch1 signaling and erythropoietin cooperate in erythroid differentiation of multipotent progenitor cells and upregulate beta-globin. Exp Hematol 35, 1321-1332
101 Holtz, M. S., Slovak, M. L., Zhang, F., Sawyers, C. L., Forman, S. J. and Bhatia, R. (2002) Imatinib mesylate (STI571) inhibits growth of primitive malignant progenitors in chronic myelogenous leukemia through reversal of abnormally increased proliferation. Blood 99, 3792-3800
102 Holyoake, T. L., Jiang, X., Jorgensen, H. G., Graham, S., Alcorn, M. J., Laird, C., Eaves, A. C. and Eaves, C. J. (2001) Primitive quiescent leukemic cells from patients with chronic myeloid leukemia spontaneously initiate factor-independent growth in vitro in association with up-regulation of expression of interleukin-3. Blood 97, 720-728
103 Honda, H., Oda, H., Suzuki, T., Takahashi, T., Witte, O. N., Ozawa, K., Ishikawa, T., Yazaki, Y. and Hirai, H. (1998) Development of acute lymphoblastic leukemia and myeloproliferative disorder in transgenic mice expressing p210bcr/abl: a novel transgenic model for human Ph1-positive leukemias. Blood 91, 2067-2075
104 Hows, J. (2005) Adult stem cell therapy beyond haemopoietic stem cell transplantation? An update. Transpl Immunol 14, 221-223
105 Hu, Y., Chen, Y., Douglas, L. and Li, S. (2008) beta-Catenin is essential for survival of leukemic stem cells insensitive to kinase inhibition in mice with BCR-ABL-induced chronic myeloid leukemia. Leukemia
203
106 Hubmann, R., Schwarzmeier, J. D., Shehata, M., Hilgarth, M., Duechler, M., Dettke, M. and Berger, R. (2002) Notch2 is involved in the overexpression of CD23 in B-cell chronic lymphocytic leukemia. Blood 99, 3742-3747
107 Huettner, C. S., Zhang, P., Van Etten, R. A. and Tenen, D. G. (2000) Reversibility of acute B-cell leukaemia induced by BCR-ABL1. Nat Genet 24, 57-60
108 Inokuchi, K. (2006) Chronic myelogenous leukemia: from molecular biology to clinical aspects and novel targeted therapies. J Nippon Med Sch 73, 178-192
109 Ishiko, E., Matsumura, I., Ezoe, S., Gale, K., Ishiko, J., Satoh, Y., Tanaka, H., Shibayama, H., Mizuki, M., Era, T., Enver, T. and Kanakura, Y. (2005) Notch Signals Inhibit the Development of Erythroid/Megakaryocytic Cells by Suppressing GATA-1 Activity through the Induction of HES1. J Biol Chem 280, 4929-4939
110 Iso, T., Kedes, L. and Hamamori, Y. (2003) HES and HERP families: multiple effectors of the Notch signaling pathway. J Cell Physiol 194, 237-255
111 Izon, D. J., Aster, J. C., He, Y., Weng, A., Karnell, F. G., Patriub, V., Xu, L., Bakkour, S., Rodriguez, C., Allman, D. and Pear, W. S. (2002) Deltex1 redirects lymphoid progenitors to the B cell lineage by antagonizing Notch1. Immunity 16, 231-243
112 Jacobsen, L. and Hughes, P. (2007) Effects of Passage Number on Cell Line Transfection. Biochemica. 3, 32
113 Jamieson, C. H., Ailles, L. E., Dylla, S. J., Muijtjens, M., Jones, C., Zehnder, J. L., Gotlib, J., Li, K., Manz, M. G., Keating, A., Sawyers, C. L. and Weissman, I. L. (2004) Granulocyte-macrophage progenitors as candidate leukemic stem cells in blast-crisis CML. N Engl J Med 351, 657-667
114 Jarriault, S., Brou, C., Logeat, F., Schroeter, E. H., Kopan, R. and Israel, A. (1995) Signalling downstream of activated mammalian Notch. Nature 377, 355-358
115 Jiang, X., Saw, K. M., Eaves, A. and Eaves, C. (2007a) Instability of BCR-ABL gene in primary and cultured chronic myeloid leukemia stem cells. J Natl Cancer Inst 99, 680-693
116 Jiang, X., Zhao, Y., Smith, C., Gasparetto, M., Turhan, A., Eaves, A. and Eaves, C. (2007b) Chronic myeloid leukemia stem cells possess multiple unique features of resistance to BCR-ABL targeted therapies. Leukemia 21, 926-935
117 Jonsson, J. I., Xiang, Z., Pettersson, M., Lardelli, M. and Nilsson, G. (2001) Distinct and regulated expression of Notch receptors in hematopoietic lineages and during myeloid differentiation. Eur J Immunol 31, 3240-3247
118 Jordan, C. T. and Guzman, M. L. (2004) Mechanisms controlling pathogenesis and survival of leukemic stem cells. Oncogene 23, 7178-7187
119 Jorgensen, H. G. and Holyoake, T. L. (2007) Characterization of cancer stem cells in chronic myeloid leukaemia. Biochem Soc Trans 35, 1347-1351
204
120 Joutel, A., Dodick, D. D., Parisi, J. E., Cecillon, M., Tournier-Lasserve, E. and Bousser, M. G. (2000) De novo mutation in the Notch3 gene causing CADASIL. Ann Neurol 47, 388-391
121 Jundt, F., Anagnostopoulos, I., Forster, R., Mathas, S., Stein, H. and Dorken, B. (2002) Activated Notch1 signaling promotes tumor cell proliferation and survival in Hodgkin and anaplastic large cell lymphoma. Blood 99, 3398-3403
122 Jundt, F., Probsting, K. S., Anagnostopoulos, I., Muehlinghaus, G., Chatterjee, M., Mathas, S., Bargou, R. C., Manz, R., Stein, H. and Dorken, B. (2004) Jagged1-induced Notch signaling drives proliferation of multiple myeloma cells. Blood 103, 3511-3515
123 Kabarowski, J. H. and Witte, O. N. (2000) Consequences of BCR-ABL expression within the hematopoietic stem cell in chronic myeloid leukemia. Stem Cells 18, 399-408
124 Kageyama, R., Ohtsuka, T. and Tomita, K. (2000) The bHLH gene Hes1 regulates differentiation of multiple cell types. Mol Cells 10, 1-7
125 Kantarjian, H. M., Talpaz, M., Giles, F., O'Brien, S. and Cortes, J. (2006) New insights into the pathophysiology of chronic myeloid leukemia and imatinib resistance. Ann Intern Med 145, 913-923
126 Karanu, F. N., Murdoch, B., Gallacher, L., Wu, D. M., Koremoto, M., Sakano, S. and Bhatia, M. (2000) The Notch Ligand Jagged-1 Represents a Novel Growth Factor of Human Hematopoietic Stem Cells. J. Exp. Med. 192, 1365-1372
127 Katoh, M. and Katoh, M. (2007) WNT signaling pathway and stem cell signaling network. Clin Cancer Res 13, 4042-4045
128 Kerkela, R., Grazette, L., Yacobi, R., Iliescu, C., Patten, R., Beahm, C., Walters, B., Shevtsov, S., Pesant, S., Clubb, F. J., Rosenzweig, A., Salomon, R. N., Van Etten, R. A., Alroy, J., Durand, J. B. and Force, T. (2006) Cardiotoxicity of the cancer therapeutic agent imatinib mesylate. Nat Med 12, 908-916
129 Kidd, S., Lockett, T. J. and Young, M. W. (1983) The Notch locus of Drosophila melanogaster. Cell 34, 421-433
130 Kim, H. K. and Siu, G. (1998) The notch pathway intermediate HES-1 silences CD4 gene expression. Mol Cell Biol 18, 7166-7175
131 Koch, U., Lacombe, T. A., Holland, D., Bowman, J. L., Cohen, B. L., Egan, S. E. and Guidos, C. J. (2001) Subversion of the T/B lineage decision in the thymus by lunatic fringe-mediated inhibition of Notch-1. Immunity 15, 225-236
132 Kogoshi, H., Sato, T., Koyama, T., Nara, N. and Tohda, S. (2007) Gamma-secretase inhibitors suppress the growth of leukemia and lymphoma cells. Oncol Rep 18, 77-80
133 Kojika, S. and Griffin, J. D. (2001) Notch receptors and hematopoiesis. Exp Hematol 29, 1041-1052
134 Kollet, O., Peled, A., Byk, T., Ben-Hur, H., Greiner, D., Shultz, L. and Lapidot, T. (2000) beta2 microglobulin-deficient (B2m(null)) NOD/SCID mice are excellent recipients for studying human stem cell function. Blood 95, 3102-3105
135 Kondo, M., Wagers, A. J., Manz, M. G., Prohaska, S. S., Scherer, D. C., Beilhack, G. F., Shizuru, J. A. and Weissman, I. L. (2003) Biology of
205
hematopoietic stem cells and progenitors: implications for clinical application. Annu Rev Immunol 21, 759-806
136 Kosugi, N., Ebihara, Y., Nakahata, T., Saisho, H., Asano, S. and Tojo, A. (2005) CD34+CD7+ leukemic progenitor cells may be involved in maintenance and clonal evolution of chronic myeloid leukemia. Clin Cancer Res 11, 505-511
137 Krause, D. S. (2002) Regulation of hematopoietic stem cell fate. Oncogene 21, 3262-3269
138 Lai, E. C. (2004) Notch signaling: control of cell communication and cell fate. Development 131, 965-973
139 Lam, L. T., Ronchini, C., Norton, J., Capobianco, A. J. and Bresnick, E. H. (2000) Suppression of erythroid but not megakaryocytic differentiation of human K562 erythroleukemic cells by notch-1. J Biol Chem 275, 19676-19684
140 Lanctot, P. M., Leclerc, P. C., Clement, M., Auger-Messier, M., Escher, E., Leduc, R. and Guillemette, G. (2005) Importance of N-glycosylation positioning for cell-surface expression, targeting, affinity and quality control of the human AT1 receptor. Biochem J 390, 367-376
141 Larsson, J. and Karlsson, S. (2005) The role of Smad signaling in hematopoiesis. Oncogene 24, 5676-5692
142 Lataillade, J. J., Clay, D., David, C., Boutin, L., Guerton, B., Drouet, M., Herodin, F. and Le Bousse-Kerdiles, M. C. (2005) Phenotypic and functional characteristics of CD34+ cells are related to their anatomical environment: is their versatility a prerequisite for their bio-availability? J Leukoc Biol
143 Li, L., Milner, L. A., Deng, Y., Iwata, M., Banta, A., Graf, L., Marcovina, S., Friedman, C., Trask, B. J., Hood, L. and Torok-Storb, B. (1998) The human homolog of rat Jagged1 expressed by marrow stroma inhibits differentiation of 32D cells through interaction with Notch1. Immunity 8, 43-55
144 Livak, K. J. and Schmittgen, T. D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402-408
145 Lundell, B. I., McCarthy, J. B., Kovach, N. L. and Verfaillie, C. M. (1997) Activation of beta1 integrins on CML progenitors reveals cooperation between beta1 integrins and CD44 in the regulation of adhesion and proliferation. Leukemia 11, 822-829
146 Maciejewski, J., Selleri, C., Anderson, S. and Young, N. S. (1995) Fas antigen expression on CD34+ human marrow cells is induced by interferon gamma and tumor necrosis factor alpha and potentiates cytokine-mediated hematopoietic suppression in vitro. Blood 85, 3183-3190
147 Maguer-Satta, V., Petzer, A. L., Eaves, A. C. and Eaves, C. J. (1996) BCR-ABL expression in different subpopulations of functionally characterized Ph+ CD34+ cells from patients with chronic myeloid leukemia. Blood 88, 1796-1804
148 Maillard, I., Adler, S. H. and Pear, W. S. (2003) Notch and the immune system. Immunity 19, 781-791
149 Maillard, I., Koch, U., Dumortier, A., Shestova, O., Xu, L., Sai, H., Pross, S. E., Aster, J. C., Bhandoola, A., Radtke, F. and Pear, W. S.
206
(2008) Canonical notch signaling is dispensable for the maintenance of adult hematopoietic stem cells. Cell Stem Cell 2, 356-366
150 Mancuso, P., Burlini, A., Pruneri, G., Goldhirsch, A., Martinelli, G. and Bertolini, F. (2001) Resting and activated endothelial cells are increased in the peripheral blood of cancer patients. Blood 97, 3658-3661
151 Marley, S. B. and Gordon, M. Y. (2005) Chronic myeloid leukaemia: stem cell derived but progenitor cell driven. Clin Sci (Lond) 109, 13-25
152 Martinez Arias, A., Zecchini, V. and Brennan, K. (2002) CSL-independent Notch signalling: a checkpoint in cell fate decisions during development? Curr Opin Genet Dev 12, 524-533
153 Matsuno, K., Diederich, R. J., Go, M. J., Blaumueller, C. M. and Artavanis-Tsakonas, S. (1995) Deltex acts as a positive regulator of Notch signaling through interactions with the Notch ankyrin repeats. Development 121, 2633-2644
154 Mayerhofer, M., Valent, P., Sperr, W. R., Griffin, J. D. and Sillaber, C. (2002) BCR/ABL induces expression of vascular endothelial growth factor and its transcriptional activator, hypoxia inducible factor-1alpha, through a pathway involving phosphoinositide 3-kinase and the mammalian target of rapamycin. Blood 100, 3767-3775
155 McGill, M. A. and McGlade, C. J. (2003) Mammalian numb proteins promote Notch1 receptor ubiquitination and degradation of the Notch1 intracellular domain. J Biol Chem 278, 23196-23203
156 Melo, J. (2001) Inviting leukemic cells to waltz with the devil. Nat Med 7, 156-157
157 Milner, L. A. and Bigas, A. (1999) Notch as a mediator of cell fate determination in hematopoiesis: evidence and speculation. Blood 93, 2431-2448
158 Milner, L. A., Bigas, A., Kopan, R., Brashem-Stein, C., Bernstein, I. D. and Martin, D. I. (1996) Inhibition of granulocytic differentiation by mNotch1. Proc Natl Acad Sci U S A 93, 13014-13019
159 Milner, L. A., Kopan, R., Martin, D. I. and Bernstein, I. D. (1994) A human homologue of the Drosophila developmental gene, Notch, is expressed in CD34+ hematopoietic precursors. Blood 83, 2057-2062
160 Miyazato, A., Ueno, S., Ohmine, K., Ueda, M., Yoshida, K., Yamashita, Y., Kaneko, T., Mori, M., Kirito, K., Toshima, M., Nakamura, Y., Saito, K., Kano, Y., Furusawa, S., Ozawa, K. and Mano, H. (2001) Identification of myelodysplastic syndrome-specific genes by DNA microarray analysis with purified hematopoietic stem cell fraction. Blood 98, 422-427
161 Mizuno, T., Yamasaki, N., Miyazaki, K., Tazaki, T., Koller, R., Oda, H., Honda, Z. I., Ochi, M., Wolff, L. and Honda, H. (2008) Overexpression/enhanced kinase activity of BCR/ABL and altered expression of Notch1 induced acute leukemia in p210BCR/ABL transgenic mice. Oncogene 27, 3465-3474
162 Mumm, J. S. and Kopan, R. (2000) Notch signaling: from the outside in. Dev Biol 228, 151-165
163 Nagar, B. (2007) c-Abl tyrosine kinase and inhibition by the cancer drug imatinib (Gleevec/STI-571). J Nutr 137, 1518S-1523S; discussion 1548S
207
164 Nam, Y., Aster, J. C. and Blacklow, S. C. (2002) Notch signaling as a therapeutic target. Curr Opin Chem Biol 6, 501-509
165 Nefedova, Y., Cheng, P., Alsina, M., Dalton, W. S. and Gabrilovich, D. I. (2004) Involvement of Notch-1 signaling in bone marrow stroma-mediated de novo drug resistance of myeloma and other malignant lymphoid cell lines. Blood 103, 3503-3510
166 Nervi, B., Link, D. C. and DiPersio, J. F. (2006) Cytokines and hematopoietic stem cell mobilization. J Cell Biochem 99, 690-705
167 Neshat, M. S., Raitano, A. B., Wang, H. G., Reed, J. C. and Sawyers, C. L. (2000) The survival function of the Bcr-Abl oncogene is mediated by Bad-dependent and -independent pathways: roles for phosphatidylinositol 3-kinase and Raf. Mol Cell Biol 20, 1179-1186
168 Nicolas, M., Wolfer, A., Raj, K., Kummer, J. A., Mill, P., van Noort, M., Hui, C. C., Clevers, H., Dotto, G. P. and Radtke, F. (2003) Notch1 functions as a tumor suppressor in mouse skin. Nat Genet 33, 416-421
169 Normann, A. P., Egeland, T., Madshus, I. H., Heim, S. and Tjonnfjord, G. E. (2003) CD7 expression by CD34+ cells in CML patients, of prognostic significance? Eur J Haematol 71, 266-275
170 Nutt, S. L., Eberhard, D., Horcher, M., Rolink, A. G. and Busslinger, M. (2001) Pax5 determines the identity of B cells from the beginning to the end of B-lymphopoiesis. Int Rev Immunol 20, 65-82
171 Oda, T., Heaney, C., Hagopian, J. R., Okuda, K., Griffin, J. D. and Druker, B. J. (1994) Crkl is the major tyrosine-phosphorylated protein in neutrophils from patients with chronic myelogenous leukemia. J Biol Chem 269, 22925-22928
172 Oertel, J., Oertel, B., Schleicher, J. and Huhn, D. (1996) Immunotyping of blasts in human bone marrow. Ann Hematol 72, 125-129
173 Ohishi, K., Katayama, N., Shiku, H., Varnum-Finney, B. and Bernstein, I. D. (2003) Notch signalling in hematopoiesis. Semin Cell Dev Biol 14, 143-150
174 Ohishi, K., Varnum-Finney, B., Flowers, D., Anasetti, C., Myerson, D. and Bernstein, I. D. (2000) Monocytes express high amounts of Notch and undergo cytokine specific apoptosis following interaction with the Notch ligand, Delta-1. Blood 95, 2847-2854
175 O'Neil, J., Calvo, J., McKenna, K., Krishnamoorthy, V., Aster, J. C., Bassing, C. H., Alt, F. W., Kelliher, M. and Look, A. T. (2006) Activating Notch1 mutations in mouse models of T-ALL. Blood 107, 781-785
176 Ostrowska, B., Sacha, T., Szostek, M., Zawada, M., Skotnicki, A., Laidler, P. (2003) The involvement of Abl and Bcr-Abl proteins in Notch signalling pathway in haematopoietic normal and CML CD34+ cells.
177 Oswald, F., Liptay, S., Adler, G. and Schmid, R. M. (1998) NF-kappaB2 is a putative target gene of activated Notch-1 via RBP-Jkappa. Mol Cell Biol 18, 2077-2088
178 Pallister, C. (1998) Blood : physiology and pathophysiology. Butterworth-Heinemann, Oxford
179 Palomero, T., Sulis, M. L., Cortina, M., Real, P. J., Barnes, K., Ciofani, M., Caparros, E., Buteau, J., Brown, K., Perkins, S. L., Bhagat, G., Agarwal, A. M., Basso, G., Castillo, M., Nagase, S., Cordon-Cardo, C., Parsons, R., Zuniga-Pflucker, J. C., Dominguez, M. and Ferrando, A.
208
A. (2007) Mutational loss of PTEN induces resistance to NOTCH1 inhibition in T-cell leukemia. Nat Med 13, 1203-1210
180 Panin, V. M. and Irvine, K. D. (1998) Modulators of Notch signaling. Semin Cell Dev Biol 9, 609-617
181 Pear, W. S., Aster, J. C., Scott, M. L., Hasserjian, R. P., Soffer, B., Sklar, J. and Baltimore, D. (1996) Exclusive development of T cell neoplasms in mice transplanted with bone marrow expressing activated Notch alleles. J Exp Med 183, 2283-2291
182 Pear, W. S. and Radtke, F. (2003) Notch signaling in lymphopoiesis. Semin Immunol 15, 69-79
183 Petzer, A. L., Eaves, C. J., Lansdorp, P. M., Ponchio, L., Barnett, M. J. and Eaves, A. C. (1996) Characterization of primitive subpopulations of normal and leukemic cells present in the blood of patients with newly diagnosed as well as established chronic myeloid leukemia. Blood 88, 2162-2171
184 Petzer, A. L. and Gunsilius, E. (2003) Hematopoietic stem cells in chronic myeloid leukemia. Arch Med Res 34, 496-506
185 Platta, C. S., Greenblatt, D. Y., Kunnimalaiyaan, M. and Chen, H. (2008) Valproic acid induces Notch1 signaling in small cell lung cancer cells. J Surg Res 148, 31-37
186 Pui, J. C., Allman, D., Xu, L., DeRocco, S., Karnell, F. G., Bakkour, S., Lee, J. Y., Kadesch, T., Hardy, R. R., Aster, J. C. and Pear, W. S. (1999) Notch1 expression in early lymphopoiesis influences B versus T lineage determination. Immunity 11, 299-308
187 Quintas-Cardama, A. and Cortes, J. (2008) Molecular biology of BCR-ABL1-positive chronic myeloid leukemia. Blood
188 Quintas-Cardama, A., Tong, W., Manshouri, T., Vega, F., Lennon, P. A., Cools, J., Gilliland, D. G., Lee, F., Cortes, J., Kantarjian, H. and Garcia-Manero, G. (2008) Activity of tyrosine kinase inhibitors against human NUP214-ABL1-positive T cell malignancies. Leukemia 22, 1117-1124
189 Radtke, F. and Raj, K. (2003) THE ROLE OF NOTCH IN TUMORIGENESIS: ONCOGENE OR TUMOUR SUPPRESSOR? Nature Reviews Cancer
Nat Rev Cancer 3, 756-767190 Radtke, F., Wilson, A. and MacDonald, H. R. (2004) Notch signaling in
T- and B-cell development. Curr Opin Immunol 16, 174-179191 Radtke, F., Wilson, A., Stark, G., Bauer, M., van Meerwijk, J.,
MacDonald, H. R. and Aguet, M. (1999) Deficient T cell fate specification in mice with an induced inactivation of Notch1. Immunity 10, 547-558
192 Rao, M. S. and Mattson, M. P. (2001) Stem cells and aging: expanding the possibilities. Mech Ageing Dev 122, 713-734
193 Reizis, B. and Leder, P. (2002) Direct induction of T lymphocyte-specific gene expression by the mammalian Notch signaling pathway. Genes Dev 16, 295-300
194 Ren, R. (2005) Mechanisms of BCR-ABL in the pathogenesis of chronic myelogenous leukaemia. Nat Rev Cancer 5, 172-183
195 Reya, T., Duncan, A. W., Ailles, L., Domen, J., Scherer, D. C., Willert, K., Hintz, L., Nusse, R. and Weissman, I. L. (2003) A role for Wnt
209
signalling in self-renewal of haematopoietic stem cells. Nature 423, 409-414
196 Rhodes, J., York, R. D., Tara, D., Tajinda, K. and Druker, B. J. (2000) CrkL functions as a nuclear adaptor and transcriptional activator in Bcr-Abl-expressing cells. Exp Hematol 28, 305-310
197 Rizo, A., Vellenga, E., de Haan, G. and Schuringa, J. J. (2006) Signaling pathways in self-renewing hematopoietic and leukemic stem cells: do all stem cells need a niche? Hum Mol Genet 15 Spec No 2, R210-219
198 Robert-Moreno, A., Espinosa, L., Sanchez, M. J., de la Pompa, J. L. and Bigas, A. (2007) The notch pathway positively regulates programmed cell death during erythroid differentiation. Leukemia 21, 1496-1503
199 Robey, E., Chang, D., Itano, A., Cado, D., Alexander, H., Lans, D., Weinmaster, G. and Salmon, P. (1996) An activated form of Notch influences the choice between CD4 and CD8 T cell lineages. Cell 87, 483-492
200 Roche-Lestienne, C., Soenen-Cornu, V., Grardel-Duflos, N., Lai, J. L., Philippe, N., Facon, T., Fenaux, P. and Preudhomme, C. (2002) Several types of mutations of the Abl gene can be found in chronic myeloid leukemia patients resistant to STI571, and they can pre-exist to the onset of treatment. Blood 100, 1014-1018
201 Sade, H., Krishna, S. and Sarin, A. (2004) The anti-apoptotic effect of Notch-1 requires p56lck-dependent, Akt/PKB-mediated signaling in T cells. J Biol Chem 279, 2937-2944
202 Saglio, G. and Cilloni, D. (2004) Abl: the prototype of oncogenic fusion proteins. Cell Mol Life Sci 61, 2897-2911
203 Saito, T., Chiba, S., Ichikawa, M., Kunisato, A., Asai, T., Shimizu, K., Yamaguchi, T., Yamamoto, G., Seo, S., Kumano, K., Nakagami-Yamaguchi, E., Hamada, Y., Aizawa, S. and Hirai, H. (2003) Notch2 is preferentially expressed in mature B cells and indispensable for marginal zone B lineage development. Immunity 18, 675-685
204 Salesse, S. and Verfaillie, C. M. (2002) Mechanisms underlying abnormal trafficking and expansion of malignant progenitors in CML: BCR/ABL-induced defects in integrin function in CML. Oncogene 21, 8605-8611
205 Satoh, Y., Matsumura, I., Tanaka, H., Ezoe, S., Sugahara, H., Mizuki, M., Shibayama, H., Ishiko, E., Ishiko, J., Nakajima, K. and Kanakura, Y. (2004) Roles for c-Myc in self-renewal of hematopoietic stem cells. J Biol Chem 279, 24986-24993
206 Sattler, M., Mohi, M. G., Pride, Y. B., Quinnan, L. R., Malouf, N. A., Podar, K., Gesbert, F., Iwasaki, H., Li, S., Van Etten, R. A., Gu, H., Griffin, J. D. and Neel, B. G. (2002) Critical role for Gab2 in transformation by BCR/ABL. Cancer Cell 1, 479-492
207 Sattler, M., Salgia, R., Okuda, K., Uemura, N., Durstin, M. A., Pisick, E., Xu, G., Li, J. L., Prasad, K. V. and Griffin, J. D. (1996) The proto-oncogene product p120CBL and the adaptor proteins CRKL and c-CRK link c-ABL, p190BCR/ABL and p210BCR/ABL to the phosphatidylinositol-3' kinase pathway. Oncogene 12, 839-846
210
208 Schroeder, T. and Just, U. (2000) Notch signalling via RBP-J promotes myeloid differentiation. Embo J 19, 2558-2568
209 Schroeder, T., Kohlhof, H., Rieber, N. and Just, U. (2003) Notch signaling induces multilineage myeloid differentiation and up-regulates PU.1 expression. J Immunol 170, 5538-5548
210 Schwartz, M. A., Schaller, M. D. and Ginsberg, M. H. (1995) Integrins: emerging paradigms of signal transduction. Annu Rev Cell Dev Biol 11, 549-599
211 Schweisguth, F. (2004) Notch signaling activity. Curr Biol 14, R129-138212 Screpanti, I., Bellavia, D., Campese, A. F., Frati, L. and Gulino, A.
(2003) Notch, a unifying target in T-cell acute lymphoblastic leukemia? Trends Mol Med 9, 30-35
213 Sengupta, A., Banerjee, D., Chandra, S., Banerji, S. K., Ghosh, R., Roy, R. and Banerjee, S. (2007) Deregulation and cross talk among Sonic hedgehog, Wnt, Hox and Notch signaling in chronic myeloid leukemia progression. Leukemia 21, 949-955
214 Shet, A. S., Jahagirdar, B. N. and Verfaillie, C. M. (2002) Chronic myelogenous leukemia: mechanisms underlying disease progression. Leukemia 16, 1402-1411
215 Shizuru, J. A., Negrin, R. S. and Weissman, I. L. (2005) Hematopoietic stem and progenitor cells: clinical and preclinical regeneration of the hematolymphoid system. Annu Rev Med 56, 509-538
216 Siissalo, S., Laitinen, L., Koljonen, M., Vellonen, K. S., Kortejarvi, H., Urtti, A., Hirvonen, J. and Kaukonen, A. M. (2007) Effect of cell differentiation and passage number on the expression of efflux proteins in wild type and vinblastine-induced Caco-2 cell lines. Eur J Pharm Biopharm 67, 548-554
217 Simpson, P. (1998) Introduction: Notch signalling and choice of cell fates in development. Semin Cell Dev Biol 9, 581-582
218 Singer, C. F., Hudelist, G., Lamm, W., Mueller, R., Handl, C., Kubista, E. and Czerwenka, K. (2006) Active (p)CrkL is overexpressed in human malignancies: potential role as a surrogate parameter for therapeutic tyrosine kinase inhibition. Oncol Rep 15, 353-359
219 Singh, N., Phillips, R. A., Iscove, N. N. and Egan, S. E. (2000) Expression of notch receptors, notch ligands, and fringe genes in hematopoiesis. Exp Hematol 28, 527-534
220 Smith, C. (2003) Hematopoietic stem cells and hematopoiesis. Cancer Control 10, 9-16
221 Smith, D. L., Burthem, J. and Whetton, A. D. (2003) Molecular pathogenesis of chronic myeloid leukaemia. Expert Rev Mol Med 5, 1-27
222 Staal, F. J. T. and Clevers, H. C. (2005) WNT SIGNALLING AND HAEMATOPOIESIS: A WNT-WNT SITUATION. Nature Reviews Immunology
Nat Rev Immunol 5, 21-30223 Steidl, U., Kronenwett, R., Martin, S. and Haas, R. (2003) Molecular
biology of hematopoietic stem cells. Vitam Horm 66, 1-28224 Stein, M. I., Zhu, J. and Emerson, S. G. (2004) Molecular pathways
regulating the self-renewal of hematopoietic stem cells. Exp Hematol 32, 1129-1136
211
225 Stier, S., Cheng, T., Dombkowski, D., Carlesso, N. and Scadden, D. T. (2002) Notch1 activation increases hematopoietic stem cell self-renewal in vivo and favors lymphoid over myeloid lineage outcome. Blood 99, 2369-2378
226 Stockhausen, M. T., Sjolund, J., Manetopoulos, C. and Axelson, H. (2005) Effects of the histone deacetylase inhibitor valproic acid on Notch signalling in human neuroblastoma cells. Br J Cancer 92, 751-759
227 Sun, X. and Artavanis-Tsakonas, S. (1997) Secreted forms of DELTA and SERRATE define antagonists of Notch signaling in Drosophila. Development 124, 3439-3448
228 Szilvassy, S. J. (2003) The biology of hematopoietic stem cells. Arch Med Res 34, 446-460
229 Takahashi, N., Miura, I., Saitoh, K. and Miura, A. B. (1998) Lineage involvement of stem cells bearing the philadelphia chromosome in chronic myeloid leukemia in the chronic phase as shown by a combination of fluorescence-activated cell sorting and fluorescence in situ hybridization. Blood 92, 4758-4763
230 Talora, C., Sgroi, D. C., Crum, C. P. and Dotto, G. P. (2002) Specific down-modulation of Notch1 signaling in cervical cancer cells is required for sustained HPV-E6/E7 expression and late steps of malignant transformation. Genes Dev 16, 2252-2263
231 Tanigaki, K., Han, H., Yamamoto, N., Tashiro, K., Ikegawa, M., Kuroda, K., Suzuki, A., Nakano, T. and Honjo, T. (2002) Notch-RBP-J signaling is involved in cell fate determination of marginal zone B cells. Nat Immunol 3, 443-450
232 Tax, F. E., Yeargers, J. J. and Thomas, J. H. (1994) Sequence of C. elegans lag-2 reveals a cell-signalling domain shared with Delta and Serrate of Drosophila. Nature 368, 150-154
233 ten Hoeve, J., Arlinghaus, R. B., Guo, J. Q., Heisterkamp, N. and Groffen, J. (1994) Tyrosine phosphorylation of CRKL in Philadelphia+ leukemia. Blood 84, 1731-1736
234 Tian, G., Ghanekar, S. V., Aharony, D., Shenvi, A. B., Jacobs, R. T., Liu, X. and Greenberg, B. D. (2003) The mechanism of gamma-secretase: multiple inhibitor binding sites for transition state analogs and small molecule inhibitors. J Biol Chem 278, 28968-28975
235 Tickenbrock, L., Hehn, S., Sargin, B., Evers, G., Ng, P. R., Choudhary, C., Berdel, W. E., Muller-Tidow, C. and Serve, H. (2008) Activation of Wnt signaling in cKit-ITD mediated transformation and imatinib sensitivity in acute myeloid leukemia. Int J Hematol 88, 174-180
236 Tohda, S., Murata-Ohsawa, M., Sakano, S. and Nara, N. (2003) Notch ligands, Delta-1 and Delta-4 suppress the self-renewal capacity and long-term growth of two myeloblastic leukemia cell lines. Int J Oncol 22, 1073-1079
237 Tsai, S., Fero, J. and Bartelmez, S. (2000) Mouse Jagged2 is differentially expressed in hematopoietic progenitors and endothelial cells and promotes the survival and proliferation of hematopoietic progenitors by direct cell-to-cell contact. Blood 96, 950-957
238 Uyttendaele, H., Marazzi, G., Wu, G., Yan, Q., Sassoon, D. and Kitajewski, J. (1996) Notch4/int-3, a mammary proto-oncogene, is an
212
endothelial cell-specific mammalian Notch gene. Development 122, 2251-2259
239 Varnum-Finney, B., Xu, L., Brashem-Stein, C., Nourigat, C., Flowers, D., Bakkour, S., Pear, W. S. and Bernstein, I. D. (2000) Pluripotent, cytokine-dependent, hematopoietic stem cells are immortalized by constitutive Notch1 signaling. Nat Med 6, 1278-1281
240 Vercauteren, S. M. and Sutherland, H. J. (2004) Constitutively active Notch4 promotes early human hematopoietic progenitor cell maintenance while inhibiting differentiation and causes lymphoid abnormalities in vivo. Blood 104, 2315-2322
241 Verfaillie, C. M., Miller, W. J., Boylan, K. and McGlave, P. B. (1992) Selection of benign primitive hematopoietic progenitors in chronic myelogenous leukemia on the basis of HLA-DR antigen expression. Blood 79, 1003-1010
242 Visnjic, D., Kalajzic, Z., Rowe, D. W., Katavic, V., Lorenzo, J. and Aguila, H. L. (2004) Hematopoiesis is severely altered in mice with an induced osteoblast deficiency. Blood 103, 3258-3264
243 Walker, L., Carlson, A., Tan-Pertel, H. T., Weinmaster, G. and Gasson, J. (2001) The notch receptor and its ligands are selectively expressed during hematopoietic development in the mouse. Stem Cells 19, 543-552
244 Walker, L., Lynch, M., Silverman, S., Fraser, J., Boulter, J., Weinmaster, G. and Gasson, J. C. (1999) The Notch/Jagged pathway inhibits proliferation of human hematopoietic progenitors in vitro. Stem Cells 17, 162-171
245 Washburn, T., Schweighoffer, E., Gridley, T., Chang, D., Fowlkes, B. J., Cado, D. and Robey, E. (1997) Notch activity influences the alphabeta versus gammadelta T cell lineage decision. Cell 88, 833-843
246 Weijzen, S., Rizzo, P., Braid, M., Vaishnav, R., Jonkheer, S. M., Zlobin, A., Osborne, B. A., Gottipati, S., Aster, J. C., Hahn, W. C., Rudolf, M., Siziopikou, K., Kast, W. M. and Miele, L. (2002) Activation of Notch-1 signaling maintains the neoplastic phenotype in human Ras-transformed cells. Nat Med 8, 979-986
247 Weijzen, S., Zlobin, A., Braid, M., Miele, L. and Kast, W. M. (2003) HPV16 E6 and E7 oncoproteins regulate Notch-1 expression and cooperate to induce transformation. J Cell Physiol 194, 356-362
248 Weng, A. P. and Aster, J. C. (2004) Multiple niches for Notch in cancer: context is everything. Curr Opin Genet Dev 14, 48-54
249 Weng, A. P., Ferrando, A. A., Lee, W., Morris, J. P. t., Silverman, L. B., Sanchez-Irizarry, C., Blacklow, S. C., Look, A. T. and Aster, J. C. (2004) Activating mutations of NOTCH1 in human T cell acute lymphoblastic leukemia. Science 306, 269-271
250 Wetzel, R., Goss, V. L., Norris, B., Popova, L., Melnick, M. and Smith, B. L. (2005) Evaluation of CML model cell lines and imatinib mesylate response: determinants of signaling profiles. J Immunol Methods 305, 59-66
251 Wickremasinghe, R. G. and Hoffbrand, A. V. (1999) Biochemical and Genetic Control of Apoptosis: Relevance to Normal Hematopoiesis and Hematological Malignancies. Blood 93, 3587-3600
213
252 Wilson, A., MacDonald, H. R. and Radtke, F. (2001) Notch 1-deficient common lymphoid precursors adopt a B cell fate in the thymus. J Exp Med 194, 1003-1012
253 Wolfer, A., Bakker, T., Wilson, A., Nicolas, M., Ioannidis, V., Littman, D. R., Lee, P. P., Wilson, C. B., Held, W., MacDonald, H. R. and Radtke, F. (2001) Inactivation of Notch 1 in immature thymocytes does not perturb CD4 or CD8T cell development. Nat Immunol 2, 235-241
254 Wolfer, A., Wilson, A., Nemir, M., MacDonald, H. R. and Radtke, F. (2002) Inactivation of Notch1 impairs VDJbeta rearrangement and allows pre-TCR-independent survival of early alpha beta Lineage Thymocytes. Immunity 16, 869-879
255 Wu, L., Sun, T., Kobayashi, K., Gao, P. and Griffin, J. D. (2002) Identification of a family of mastermind-like transcriptional coactivators for mammalian notch receptors. Mol Cell Biol 22, 7688-7700
256 Yamamoto, N., Yamamoto, S., Inagaki, F., Kawaichi, M., Fukamizu, A., Kishi, N., Matsuno, K., Nakamura, K., Weinmaster, G., Okano, H. and Nakafuku, M. (2001) Role of Deltex-1 as a transcriptional regulator downstream of the Notch receptor. J Biol Chem 276, 45031-45040
257 Ye, Q., Shieh, J. H., Morrone, G. and Moore, M. A. (2004) Expression of constitutively active Notch4 (Int-3) modulates myeloid proliferation and differentiation and promotes expansion of hematopoietic progenitors. Leukemia 18, 777-787
258 Yin, D. D., Fan, F. Y., Hu, X. B., Hou, L. H., Zhang, X. P., Liu, L., Liang, Y. M. and Han, H. (2008) Notch signaling inhibits the growth of the human chronic myeloid leukemia cell line K562. Leuk Res
259 Yu, H., Cook, T. J. and Sinko, P. J. (1997) Evidence for diminished functional expression of intestinal transporters in Caco-2 cell monolayers at high passages. Pharm Res 14, 757-762
260 Zanjani, E. D., Almeida-Porada, G., Livingston, A. G., Flake, A. W. and Ogawa, M. (1998) Human bone marrow CD34- cells engraft in vivo and undergo multilineage expression that includes giving rise to CD34+ cells. Exp Hematol 26, 353-360
261 Zhang, J., Niu, C., Ye, L., Huang, H., He, X., Tong, W. G., Ross, J., Haug, J., Johnson, T., Feng, J. Q., Harris, S., Wiedemann, L. M., Mishina, Y. and Li, L. (2003) Identification of the haematopoietic stem cell niche and control of the niche size. Nature 425, 836-841
262 Zhang, P., Yang, Y., Zweidler-McKay, P. A. and Hughes, D. P. (2008) Critical role of notch signaling in osteosarcoma invasion and metastasis. Clin Cancer Res 14, 2962-2969
263 Zhao, C., Blum, J., Chen, A., Kwon, H. Y., Jung, S. H., Cook, J. M., Lagoo, A. and Reya, T. (2007) Loss of beta-catenin impairs the renewal of normal and CML stem cells in vivo. Cancer Cell 12, 528-541
264 Zhao, S., Zoller, K., Masuko, M., Rojnuckarin, P., Yang, X. O., Parganas, E., Kaushansky, K., Ihle, J. N., Papayannopoulou, T., Willerford, D. M., Clackson, T. and Blau, C. A. (2002) JAK2, complemented by a second signal from c-kit or flt-3, triggers extensive self-renewal of primary multipotential hemopoietic cells. Embo J 21, 2159-2167
265 Zweidler-McKay, P. A., He, Y., Xu, L., Rodriguez, C. G., Karnell, F. G., Carpenter, A. C., Aster, J. C., Allman, D. and Pear, W. S. (2005) Notch
214
signaling is a potent inducer of growth arrest and apoptosis in a wide range of B-cell malignancies. Blood 106, 3898-3906
266 Zweidler-McKay, P. A. and Pear, W. S. (2004) Notch and T cell malignancy. Semin Cancer Biol 14, 329-340
215
1 2 3 4 1 2 3 4
300
180
120
300
iii
kDa kDa1 2 3 4 1 2 3 41 2 3 4 1 2 3 4
300
180
120
300
iii
kDa kDa
A-
B-
8911 8911
Isot
ype(
IgG
)
91 91
ECN1IgG1
ICN
1
Appendex1. Immunoreactivity of ECN1 vs ICN1 antibodies . A-Total HEK293 cell lysates were separated with a 8% SDS-PAGE, transferred to nitrocellulose and probed with: (i) EA1 antibody which detects extracellular Notch1 (ECN1 ) and (ii) b-tan20 which detects intracellular Notch1 (ICN1, Iowa). Lanes (1) untransfected, (2&3) full-length hN1 transfected and (4) ICN transfected cells. (1&2) 15g (3&4) 40g of cell lysates. The arrows indicate the full-length form (~300 kDa), the ECN1 (~180 kDa) and the ICN1(~120 kDa).
B- HEK293 cells were transfected with full-length N1 and stained with ECN1 and ICN1 antibodies.
Appendex1
216
![Final corrected thesis 02-11-2011shodhganga.inflibnet.ac.in/bitstream/10603/4738/16/16_references.p… · [72] Rao CNR, Thomas PJ, Kulkarni GU. Nanocrystals: Synthesis, properties](https://img.dokumen.tips/doc/110x75/5f0b4f5e7e708231d42fe256/final-corrected-thesis-02-11-72-rao-cnr-thomas-pj-kulkarni-gu-nanocrystals.jpg)
