COP9 Signalosome Interacts ATP-dependently withp97/Valosin-containing Protein (VCP) and Controls theUbiquitination Status of Proteins Bound to p97/VCP*

Received for publication, July 14, 2009, and in revised form, September 17, 2009 Published, JBC Papers in Press, October 13, 2009, DOI 10.1074/jbc.M109.037952

Sevil Cayli‡1,2, Jorg Klug‡1, Julius Chapiro‡, Suada Frohlich‡, Gabriela Krasteva§3, Lukas Orel¶,and Andreas Meinhardt‡4

From the Units of ‡Reproductive Biology and §Cardiopulmonary Neurobiology, Department of Anatomy and Cell Biology,Justus-Liebig-University, 35385 Giessen, Germany and the ¶Center for Biomolecular Medicine and Pharmacology, Medical Universityof Vienna, A-1090 Vienna, Austria

Ubiquitinated proteins can alternatively be delivered directlyto the proteasome or via p97/VCP (valosin-containing protein).Whereas the proteasome degrades ubiquitinated proteins, thehomohexameric ATPase p97/VCP seems to control the ubiq-uitination status of recruited substrates. TheCOP9 signalosome(CSN) is also involved in the ubiquitin/proteasome system(UPS) as exemplified by regulating the neddylation of ubiquitinE3 ligases. Here, we show that p97/VCP colocalizes and directlyinteracts with subunit 5 of the CSN (CSN5) in vivo and is asso-ciated with the entire CSN complex in an ATP-dependentman-ner. Furthermore, we provide evidence that the CSN and in par-ticular the isopeptidase activity of its subunitCSN5aswell as theassociated deubiquitinase USP15 are required for proper proc-essing of polyubiquitinated substrates bound to p97/VCP.Moreover, we show that in addition to NEDD8, CSN5 binds tooligoubiquitin chains in vitro. Therefore, CSN and p97/VCPcould form an ATP-dependent complex that resembles the 19 Sproteasome regulatory particle and serves as a key mediatorbetween ubiquitination and degradation pathways.

Many fundamental cellular functions such as membranefusion, gene transcription,DNAreplication, and repair are con-trolled by the covalent linkage of ubiquitin (Ub)5 to substrate

proteins (1). Different Ub modifications serve as signaling-de-pendent regulators of protein interaction networks (2). Sub-strates that are polyubiquitinated via Lys48 are recognized bythe 19 S regulatory particle of the proteasome that consists ofa lid and a base complex. Upon recognition, substrates areunfolded by the base complex and hydrolyzed within the 20 Sproteolytic chamber (3).The COP9 signalosome (CSN) plays an essential role as

mediator between signaling pathways and downstream mech-anisms controlling developmental processes. This involvesubiquitin-dependent protein degradation of key regulatorymolecules like the cell cycle inhibitor p27Kip1, the tumor sup-pressor p53, and IkB�. The CSN is a highly conserved complexfound in all higher eukaryotes (4). Like the proteasome lid, itcontains eight core subunits (CSN1–8), and for each of themexists a paralogous subunit in the proteasome lid. CSN5 (alsoknown as Jab1) and CSN6 possess a MOV34/PAD N-terminal(MPN) domain (5). The MPN domain of CSN5 harbors a met-alloprotease motif referred to as the Jab1/MPN domain-associ-atedmetallopeptidase (JAMM)motif that regulates the activityof E3 Ub-ligases by deneddylation of the cullin component (6).The chaperone p97 or valosin-containing protein (p97/VCP)

has been recognized as another key player within the ubiquitin/proteasome system (UPS). p97/VCP extracts mono- or oli-goubiquitinated substrates from complexes and presents themto the UPS. It is a member of the family of ATPases associatedwith various cellular activities (AAA�) and forms a homohex-amer. Two AAA cassettes of each monomer build two con-secutive stacked rings (D1 and D2 domain) in the hexamerunderneath a ring of flexible N-terminal domains (7). Itsstructure is reminiscent of the proteasome base complexthat contains a heterohexameric ring of the AAA� ATPasesRpt1–6. After extraction of ubiquitinated substrates fromlarger complexes with the aid of substrate-recruiting cofac-tors, the segregated proteins can suffer three different fatesdepending on the involvement of a number of substrate-processing cofactors. They can (i) be polyubiquitinated pro-moting proteasomal degradation, (ii) stably maintain theirubiquitination status, or (iii) be deubiquitinated and releasedfrom the complex (7).

* This work was supported in part by a research grant from the UniversityMedical Center Giessen and Marburg (to A. M.).

1 Both authors contributed equally to this work.2 Recipient of a faculty scholarship from the Medical Faculty, Justus-Liebig-

University, Giessen, Germany. Present address: Dept. of Histology andEmbryology, Gaziosmanpasa University, Tokat, Turkey.

3 Recipient of a postdoctoral grant from the Excellence Cluster Cardio-Pulmo-nary System of the universities of Giessen and Frankfurt and the Max-Planck-Institute for Heart and Lung Research, Bad Nauheim, Germany.

4 To whom correspondence should be addressed: Dept. of Anatomy and CellBiology, Justus-Liebig-University, Aulweg 123, 35385 Giessen, Germany.Tel.: 49-641-994-7024; Fax: 49-641-994-7029; E-mail: andreas.meinhardt@anatomie.med.uni-giessen.de.

5 The abbreviations used are: Ub, ubiquitin; AAA�, ATPase associated withvarious cellular activities; APS, ammonium persulfate. BisTris, 2-[bis(2-hy-droxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; CLSM, confocallaser scanning microscopy; CSN, COP9 signalosome; FRET, fluorescenceresonance energy transfer; GST, glutathione S-transferase; IP, immuno-precipitation; MPN domain, MOV34/PAD N-terminal domain; JAMM,Jab1/MPN domain-associated metallopeptidase; mCSN5, deneddylase-defective mutant; MIF, macrophage migration inhibitory factor; Ni-NTA,nickel-nitrilotriacetic acid; p97/VCP, p97/valosin-containing protein; ROI,region of interest; RP, regulatory particle; siRNA, small interfering RNA;

TEMED, N,N,N�,N�-tetramethylethylenediamine; UBX, ubiquitin regulatoryX; UPS, ubiquitin/proteasome system.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 284, NO. 50, pp. 34944 –34953, December 11, 2009© 2009 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in the U.S.A.

34944 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 50 • DECEMBER 11, 2009

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

While investigating the interactome of macrophage migra-tion inhibitory factor (MIF) by using stably transfected NIH3T3 cells expressingMIF that is endogenously tagged with bio-tin (8), we identified p97/VCP as a new MIF-interacting pro-tein. To clarify the role of MIF in the UPS, we at first exploredthe interaction of p97/VCP andCSN5.Wediscovered that bothcomplexes form an ATP-dependent supercomplex resemblingthe proteasome-regulatory particle that could serve as a keyUPS substrate-processing machine determining substrate fate.

EXPERIMENTAL PROCEDURES

Antibodies—The following antibodies were used: mouseanti-FLAG (M2) and mouse anti-�-actin (Sigma), mouse anti-p97/VCP (Affinity BioReagent), rabbit anti-CSN5, rabbit anti-p97/VCP, rabbit anti-ubiquitin (Santa Cruz Biotechnology),rabbit anti-CSN1 (Biomol,), mouse anti-UPS15 (Abnova), andrabbit anti-cullin 1 (Abcam). The c-Myc antibody (9E10) was agift of Martin Eilers (Wurzburg, Germany). Mouse anti-FLAGM2 agarose affinity gel was purchased from Sigma and K48-linked oligoubiquitin chains Ub(2–7) from Biomol Interna-tional, LP.Cell Culture and Transfections—HEK 293T and NIH 3T3

cells were cultured in Dulbecco’s modified Eagle’s medium,containing glutamine, 10% fetal calf serum, and antibiotics at37 °C in 5% CO2. Cells were seeded in 6-well plates at a densityof 2 � 105 cells 1 day before transfection and transiently trans-fected with 1�g of expression plasmid using FuGENE 6 (RocheApplied Science) according to the instructions of the supplier.In some experiments, only 0.3 or 0.5 �g of DNA/well was used;however, the total amount of DNA/well was kept constant at 1�g by adding empty vector DNA.Coimmunoprecipitation and Immunoblotting—Washed

cells were lysed in 500 �l of radioimmune precipitation assaybuffer containing proteinase inhibitors (50 mM Tris (pH 7.5),150 mM NaCl, 5 mM EDTA, 10 mM K2HPO4, 10% v/v glycerol,1% Igepal CA-630, 0.15% SDS, 1 mM Na3VO4, 1 mM sodiummolybdate, 20mMNaF, 0.1mMphenylmethylsulfonyl fluoride),passed through a 24-gauge needle, and centrifuged at 13,000 �g for 10 min at 4 °C. The supernatants were diluted (1:2) withimmunoprecipitation (IP) buffer (20 mM Tris (pH 8), 150 mM

NaCl, 2mMEDTA, 1% IgepalCA-630, 20mMNaF, and proteaseinhibitor mixture (Sigma)) and incubated on a rotating wheel(10 rpm) at 4 °C for 3 h to overnight with 30 �l of proteinG-Sepharose 4B Fast Flow beads (GE Healthcare) preloadedwith 1–2 �g of the cognate antibody. Beads were washed threetimes with 1 ml of ice-cold IP buffer, and immune complexeswere collected by centrifugation, resuspended in 25 �l of 3�SDS-PAGE sample buffer, and incubated for 10 min at 95 °C.The IP samples were separated on a NuPAGE 4–12% NovexBisTris gel (Invitrogen) and blotted onto nitrocellulose mem-branes (GEHealthcare). Themembranes were blockedwith 5%nonfat dry milk in Tris-buffered saline (pH 7.4) containing0.05% Tween 20 and incubated with primary antibodies deco-rated with horseradish peroxidase-conjugated secondary anti-bodies according to the instructions of the manufacturers.Bound secondary antibodies were visualized by enhancedchemiluminescence (GE Healthcare).

Cloning of a Construct for Expression of mCSN—A two-stepPCR strategy was used for cloning an expression vector forCSN5 with point mutations in the JAMM domain (H140A/H142A/S150A/D153A). In a first step (i) CSN5-fw-1 primerTAATGAATTCTGGCGGCGTCCGGGAGCGGTATG andCSN5-rev-1 CATAGCCAGGGGCGCTAGCATACCACCC-GATTG and (ii) CSN5-fw-2: CAATCGGGTGGTATGCTA-GCGCCCCTGGCTATG and CSN5-rev-2: GGCGCTCGA-GATTAAGAGATGTTAATTTGATTAAACAGTTTAT-CCTT were used for generating two overlapping CSN5 genefragments. Both fragments were separated by agarose gelelectrophoresis and eluted from the gel. In a second step,both fragments were mixed and single strands filled in withPfu polymerase by seven cycles of PCR. Then CSN5-fw-1primer and CSN5-rev-2 primer were added, and full-lengthCSN5 containing the desired point mutations (H140A/H142A) was amplified by a further 25 PCR cycles. Mutatedfull-length CSN5 fragment was separated by agarose gelelectrophoresis, eluted from the gel, digested by EcoRI andXhoI (highlighted in bold), and inserted into pcDNA3-myc(a gift from Jan Karlseder, generated by integrating a myc tag intopcDNA3 from Invitrogen). The additional mutations (S150A/D153A) were introduced into the (H140A/H142A) mutant back-ground by using the same strategy and primers CSN5-fw-2:GGCTGCTGGCTTGCTGGGATTGCTGTTAGT and CSN5-rev-2: GAGTACTAACAGCAATCCCAGCAAGCCAGC.In Vitro Binding Assays—1 �g of GST-CSN5 was immobi-

lized on glutathione-Sepharose 4B beads (GE Healthcare) andincubated withHis-tagged p97/VCP protein (0.5, 1, or 2�g) for2 h at 4 °C in binding buffer containing 25 mM Tris-HCl (pH8.0), 200mMKCl, 2mMMgCl2, 1mMATP, 1mM dithiothreitol,5% glycerol, and 1% Triton X-100. After washing, bound pro-teins were analyzed by immunoblotting.In the oligoubiquitin binding assay, glutathione-Sepharose

4B beads (GE Healthcare) were loaded with GST-CSN5 or Ni-NTA-agarose beads with p97/VCP and incubated with Lys48-linked oligoubiquitin chains Ub2–7 (Biomol International, LP)in binding buffer (50 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM

EDTA, 1%TritonX-100) for 3 h at 4 °C. The beadswerewashedthree times with binding buffer and resuspended in 3� SDSsample buffer. Bound proteins were separated by SDS-PAGE,transferred to a nitrocellulose membrane, and subjected tosequential immunoblotting using anti-ubiquitin, anti-CSN5,and anti-p97/VCP antibodies.Fluorescence Resonance Energy Transfer (FRET)—Indirect

double-labeling immunofluorescence was combined with con-focal laser scanning microscopy (CLSM) and FRET analysis toidentify associations of proteins as described previously (9).Cells were transfected with different plasmids using the sameprocedure as described above and fixed 24 h after transfectionwith 4% paraformaldehyde for 15min. Both primary antibodies(rabbit anti-CSN5 and mouse anti-p97/VCP) were appliedsimultaneously and incubated overnight at 4 °C. For control ofthe specificity of the secondary reagents (donkey anti-rabbit Ig,F(ab�)2, Cy5-conjugated, 1:400; donkey anti-mouse, Cy3-con-jugated, 1:1000, both from Dianova, Hamburg, Germany) onlythe anti-CSN5 antibody and both secondary antibodies wereapplied.

ATP-dependent Interaction of CSN and p97/VCP

DECEMBER 11, 2009 • VOLUME 284 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 34945

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

The CLSM settings (TCS-SP2 AOBS; Leica, Bensheim, Ger-many) for fluorescence detection were as follows: Cy3, 52%laser power at 543 nm, detection at 550–602 nm; Cy5, 20%laser power at 633 nm, detection at 642–705 nm. FRET wasquantified by the acceptor photobleaching method, and FRETefficiency was shown as change of fluorescence intensity asdescribed previously (9). Differences between experimentaland control group ROIs were analyzed with the Kruskal-Wallistest followed by theMann-WhitneyU test using SPSS software,version 12 (SPSSGmbHSoftware,Munich,Germany), withp�0.05 being considered as significant and p � 0.01 as highlysignificant.Gel Filtration—400 �l of HEK 293T lysate (3 mg of protein)

was separated on a Sephacryl S-200 10/30 HR column (GEHealthcare) in a buffer containing 25 mM HEPES (pH 7.5), 150mM NaCl, 1 mM EDTA, 1 mM dithiothreitol, 1 mM ATP, and10% glycerol that is used for proteasome purifications. Fractionsize was 1 ml out of which 300 �l were precipitated with ace-tone, resolved in SDS sample buffer, and examined by SDS-PAGE and immunoblotting.Discontinuous Native Gel Electrophoresis—1.4 �g of purified

CSN from human erythrocytes (10) and 6 or 1.2 �g of bacteri-ally expressed p97/VCP purified from the soluble fraction(detailed protocol available upon request) were incubated in 50mMTris-HCl (pH 7.2), 10% glycerol, 1mMATP, 2mMMgCl2 ina 22-�l volume for 2 h at room temperature. The same volumeof 2� sample buffer (50 mM Tris-HCl (pH 7.2), 10% (v/v) glyc-erol, 150 mM KCl, 0.5% (w/v) Coomassie Blue G-250) wasadded, and after 30 min of incubation at room temperaturesamples were applied to a discontinuous native agarose-poly-acrylamide composite gradient gel prepared according toNiep-mann and Zheng (11) and Suh et al. (12) as follows. 5 ml of 1%agarose (w/v) in water was boiled, equilibrated at 45 °C, andmixed with 5 ml of prewarmed (45 °C) 4% (w/v) acrylamide/bisacrylamide (37.5:1) solution in 0.75 M Tris-HCl (pH 8.8) andsupplemented with 50 �l of 10% (w/v) ammonium persulfate(APS) and 5 �l of TEMED. 3 ml of this 0.5% agarose/2% acryl-amide/bisacrylamide solution was drawn into a prewarmed(45 °C) 10-ml graduated pipette followed by 3 ml of a pre-warmed 18% (w/v) acrylamide/bisacrylamide (37.5:1) solutionin 375 mM Tris-HCl (pH 8.8) with APS and TEMED (50 �l and5 �l, respectively, for a 10-ml solution) followed by 2–3 airbubbles. The 6-ml gel solution in the pipette was used to pour aminigel carefully at room temperature. After polymerizationandmaturation for 15min at 4 °C and 1 h at room temperature,samples were loaded, and electrophoresis was performed at4 °C and 15 V/cm for 16 h using 100 mM Tris-HCl (pH 8.8) asanode buffer and 25mMTris, 192mMglycine, 0.1% SDS, 0.002%Coomassie Blue G-250 as cathode buffer. Coomassie-contain-ing cathode buffer was exchanged for cathode buffer withoutCoomassie after 5 h. Resolved proteins were transferred tonitrocellulose by wet blotting using a Trans Blot Cell (Bio-Rad)and 20mMTris, 163mM glycine, 5%methanol as transfer bufferover 1 h at 120 V and room temperature.Knock Downs—All siRNAs used here had been applied pre-

viously in several reports, which is documented by one citationper siRNA (see below). Furthermore, for CSN5 siRNAwe showthe reported functional consequences following knock down

(hyperneddylation of cullin 1, see Fig. 6C). Transfection ofsiRNAs (100 pmol) with Lipofectamine (Invitrogen) was per-formed in Opti-MEM according to the protocol of the supplierusing 4 �l of transfection reagent/100 pmol of siRNA. siRNAsfor validated negative control (AM4621), CSN1 (GAACCUU-UAACGUGGACAUtt) (13), CSN5 (GCUCAGAGUAUCGA-UGAAAtt) (14), and USP15 (GCACGUGAUUAUUCCUGU-Utt) (15) were purchased from Ambion. 6 h after transfectionthe medium was replaced with Dulbecco’s modified Eagle’smedium containing 10% serum. After 72 h cells, were harvestedin lysis buffer (50 mM Tris-Cl (pH 7.4), 150 mM NaCl, 1 mM

EGTA, 1% Nonidet P-40, 0.25% sodium deoxycholate, 1 �M

leupeptin, 1 mM phenylmethylsulfonyl fluoride). In some ex-periments, the proteasome inhibitorMG132 (Calbiochem) wasadded (50 �M) to the medium 1 h before lysis.Recombinant Proteins and in Vitro Binding Assays—Recom-

binant GST-CSN5 and His-p97/VCP were expressed in Esche-richia coli BL21(DE3). Both proteins accumulated in inclusionbodies. GST-CSN5 inclusion bodies were purified and washed(Triton X-100method) exactly as described (16) and denaturedin phosphate-buffered saline containing 6 M guanidine HCl, 10mM dithiothreitol for 1 h at room temperature. After centrifu-gation (14,000� g, 30min, 4 °C) up to 2ml of supernatant wereadded dropwise into 20ml of renaturation buffer (100mMTris-HCl (pH 8.0), 10% (w/v) glucose, 10% (v/v) glycerol, 0.25 M

L-arginine) under stirring at room temperature (17). Refoldingcontinued overnight at 4 °C. The centrifuged (14,000 � g, 30min, 4 °C) refolding solution was applied to a standard 1-mlglutathione-Sepharose column, and bound GST-CSN5 waseluted with 10 mM glutathione in 50 mM Tris-HCl (pH 8.0),snap frozen in liquid nitrogen, and stored at �80 °C. His-p97/VCP inclusion bodies were purified and washed as describedabove. Denatured protein (6 M guanidine HCl in phosphate-buffered saline) was purified by standard Ni-NTA-agarosechromatography. Bound protein was eluted with 300mM imid-azole and renatured by dialysis against phosphate-bufferedsaline containing 1 mM dithiothreitol (Fig. 1D). Alternatively,the protein was purified from the soluble fraction of the bacte-rial lysate under nondenaturing standard conditions by metalchelate affinity chromatography (see Fig. 4C). Both prepara-tions formed largely homohexamers in solution when analyzedby native gel electrophoresis. Detailed protocols are availableon request. The in vitro binding assay was carried out essen-tially as described (18).In the ubiquitin binding assay, glutathione-Sepharose 4B

beads (GE Healthcare) were loaded with GST-CSN5 and incu-bated with Lys48-oligoubiquitin chains Ub2–7 (Biomol Inter-national, LP) in binding buffer (50mMHEPES (pH 7.5), 150mM

NaCl, 5 mM EDTA, 1% Triton X-100) for 3 h at 4 °C. Washedbeads were resuspended in 3� SDS sample buffer. Bound pro-teins were separated by SDS-PAGE, transferred to a nitrocellu-lose membrane, and subjected to sequential immunoblottingusing antibodies against ubiquitin, CSN5/Jab1, and p97/VCP.

RESULTS

p97/VCP Interacts with CSN5 in Vivo and in Vitro—In aMIFinteractome screen, we identified p97/VCP as a newMIF-inter-acting protein. The interaction of MIF and p97/VCP was indi-

ATP-dependent Interaction of CSN and p97/VCP

34946 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 50 • DECEMBER 11, 2009

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

rect and found to be mediated by CSN5,6 a well establishedbinding partner of MIF (19). Overexpression of FLAG-taggedp97/VCP in NIH 3T3 cells followed by immunoprecipitationwith anti-FLAG antibody coprecipitated large quantities ofCSN5 (Fig. 1C). Likewise, His-p97/VCP specifically bound toimmobilized GST-CSN5 in vitro (Fig. 1D). Moreover, double-labeling indirect immunofluorescence experiments combinedwith acceptor bleaching FRET-CLSM analysis in NIH 3T3 cellsectopically expressing p97/VCP and CSN5 (Fig. 2) revealedclose proximity of both proteins (�10 nm) in the cytoplasm,indicating that physical interaction is possible. Importantly,endogenous CSN5�p97/VCP complexes were also coimmuno-precipitated in vivo fromNIH3T3 andHEK293T cell lysates byusing either anti-CSN5 (Fig. 1A) or anti-p97/VCP antibodies(Fig. 1B), but not by an isotype control antibody. Collectively,our data establish that p97/VCP and CSN5 do interact.Mapping the Interface between CSN5 and p97/VCP—To elu-

cidate the domain(s) involved in the interaction of both pro-teins, FLAG-tagged p97/VCP, wild type CSN5, or Myc-taggedCSN5 deletion mutants were ectopically expressed in HEK293T cells. Following immunoprecipitation with anti-FLAGantibody, the Myc epitope was detected by immunoblotting(Fig. 3A). The results show that amino acids 1–110 of CSN5 aresufficient tomediate binding to p97/VCP, whereas amino acids110–191 are not. The region 54–191 of CSN5 defines theMPNdomain (20) that can be further subdivided into an N-terminalMPN core domain and a C-terminal JAMM motif (129–175)

6 S. Cayli, S. Frohlich, T. Henke, H. Urlaub, A. Meinhardt, and J. Klug, unpublished data.

FIGURE 2. CSN5 and p97/VCP colocalize in vivo. FRET-CLSM and double-label-ing indirect immunofluorescence were used to detect a close in vivo associationof CSN5 and p97/VCP in NIH 3T3 cells ectopically expressing both proteins (9). Inacceptor bleaching experiments, the fluorescence of the donor (p97/VCP labeledwith Cy3-conjugated secondary antibody; A and B) and of the acceptor (CSN5labeled with Cy5-conjugated secondary antibody; C and D) was visualized andquantified in a defined ROI. Scale bar, 20 �m. After photobleaching of the accep-tor fluorophore (compare ROI 1 in C and D), a significant increase in donor fluo-rescence in Cy3 was detected only in the ROI that was chosen for acceptor pho-tobleaching (compare ROI 1 in A and B). ROI 2–5 are control regions outside thebleached area. 18–20 cells in each experiment (n � 76 for the experimentalgroup and n � 82 for the control group (see below) obtained from four differentexperiments) were analyzed. A positive FRET signal in the bleached ROI, calcu-lated as increase in fluorescence (�IF), was robustly detected in every experimentwith a median increase of 7.9 (E). ***, p � 0.001, Mann-Whitney U test. Boxplots:percentiles 0, 25, median, 75, 100. Open circles denote extreme values of the dataset. A false-positive FRET signal that can be caused by cross-reactivity of second-ary antibodies was excluded by performing control experiments in which bothsecondary antibodies were applied together with Cy5-labeled anti-CSN5 anti-body (acceptor) only (median �IF � 2.8). Significant FRET occurred only in thecytoplasm, indicating that p97/VCP and CSN5 must be closer than 10 nm in thiscompartment, whereas no indication of colocalization in the nucleus was found(data not shown). CSN5 is distributed evenly over the nucleus and cytoplasm,whereas p97/VCP was mainly located in the cytoplasm.

FIGURE 1. CSN5 interacts with p97/VCP in vivo and in vitro. A, lysates fromNIH 3T3 and HEK 293T cells (Input, lane 1) were used for IP with anti-CSN5antibody (lane 2) and isotype control antibody (Ctr., lane 3) and analyzed byimmunoblotting (IB). B, reciprocal IP was performed using anti-p97/VCP anti-body (lane 2). Immunoprecipitates were immunoblotted for the detection ofp97/VCP and CSN5. C, CSN5 expression was analyzed in NIH 3T3 cells trans-fected with empty vector (lane 1) or FLAG-p97/VCP (lane 2). In the superna-tant of lysed cells, FLAG-p97/VCP (lane 4) was pulled down using anti-FLAGantibody. Coprecipitated CSN5 was detected by immunoblotting. D, GST-CSN5 (1 �g) immobilized on glutathione-Sepharose 4B beads was incubatedwith increasing amounts of purified His-p97/VCP (lanes 1– 4). Binding of His-p97/VCP was detected by immunoblotting (lanes 1– 4, top panel). As control,unloaded beads were incubated with 2 �g of His-p97/VCP (lane 5). Input ofHis-p97/VCP: 0.25 �g (lane 1), 0.5 �g (lane 2), 1 �g (lane 3), and 2 �g (lanes 4and 5).

ATP-dependent Interaction of CSN and p97/VCP

DECEMBER 11, 2009 • VOLUME 284 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 34947

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

(Fig. 3A). The latter appears not to be required for binding top97/VCP. To confirm that binding is independent of a func-tional JAMM motif, a deneddylase-defective mutant (mCSN5;see also Fig. 6A) was expressed together with FLAG-p97/VCP.AsmCSN5was immunoprecipitatedwith anti-FLAG antibody,the JAMMmotif could be excluded as being required for inter-action with p97/VCP (Fig. 3B).

Tomap the binding interface on p97/VCP, a number of dele-tion constructs were expressed in HEK 293T cells (Fig. 3C).After immunoprecipitation of CSN5 neither the N domainalone, nor the individual D1 or D2 domains were coprecipi-tated. Only ND1 and D1D2 proteins were able to coprecipitateCSN5 albeit with less (ND1) or weak (D1D2) affinity comparedwith the wild type protein.

FIGURE 3. A, FLAG-p97/VCP interacts with the N-terminal domain of CSN5. Plasmids expressing FLAG-p97/VCP, Myc-CSN5 (wild type (wt) 1–334), or the deletionmutant Myc-1–191, Myc-1–110, or Myc-110 –191 (47) were cotransfected into HEK 293T cells. Expression of FLAG-p97/VCP and Myc-tagged CSN5 proteins wasdetected by immunoblotting (IB) before (Input) and after IP of FLAG-p97/VCP. The asterisk denotes IgG heavy chains. B, interaction between CSN5 and p97/VCPis independent of a functional JAMM motif. Plasmids expressing FLAG-p97/VCP and a Myc-CSN5 mutant with point mutations in the JAMM motif (see“Experimental Procedures”) were cotransfected into HEK 293T cells. Expression of FLAG-p97/VCP and Myc-tagged CSN5 mutant was detected by immuno-blotting before (Input) and after IP of Myc-CSN5 mutant (Myc-mCSN5, left panel) and FLAG-p97/VCP (right panel). C, all domains of p97/VCP contribute to theinteraction interface with CSN5/CSN. Wild type p97/VCP or truncated proteins (see schematic drawing of constructs) were expressed as FLAG-tagged fusionproteins in HEK 293T cells together with CSN5. Expression of FLAG-tagged p97/VCP proteins and Myc-tagged CSN5 was detected by immunoblotting before(Input) and after IP of CSN5. V, empty vector. The asterisk denotes an unspecific band. The input blot (left) was reprobed, whereas duplicate gels were used forFLAG and CSN5 immunoblots after IP (right).

ATP-dependent Interaction of CSN and p97/VCP

34948 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 50 • DECEMBER 11, 2009

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

p97/VCP and the CSN Form an ATP-dependent Complex—Because CSN5 exerts its activities as part of the CSN complex,we subsequently investigated whether p97/VCP is interactingwith the entire CSN. Total protein extracts from HEK 293Tcells were separated by Sephacryl S-200 gel filtration chroma-tography. Immunoblot analyses revealed that p97/VCP, CSN1,and CSN5 are all present in fraction 5 (peak) that contains pro-teins and complexes with a molecular mass of about 660 kDa(Fig. 4A). When fraction 5 was used to immunoprecipitateCSN1, a subunit known to coprecipitate CSN2, 3, 5, and 8 (21),p97/VCP coprecipitated in addition to CSN5 (Fig. 4B). Furtherdirect evidence for a high molecular weight CSN�p97/VCPcomplex resulted from biochemical studies. Bacteriallyexpressed and purified p97/VCP and CSN purified from eryth-rocytes (10) were incubated together in the presence or absenceof ATP and subsequently analyzed in native agarose-polyacryl-amide composite gels (Fig. 4C). The CSN complex migrated asa well defined 450 kDa band (Fig. 4C, lane 1) and themajority ofp97/VCP as an approximately 600-kDa complex, i.e. theexpected molecular mass of the biologically active p97/VCPhomohexamer (Fig. 4C, lane 5). Characteristically, only highconcentrations of urea were able to dissociate the highly stablehexamer into monomers (Fig. 4C, lanes 6 and 7) as describedpreviously (22). Only in the presence of ATP did the addition ofexcess p97/VCP lead to a supershift of the CSN and formationof a high molecular mass oligomeric complex considerablylarger than 660 kDa that contained CSN5 and p97/VCP (Fig.4C, lanes 2–4).CSN5 Binds to Oligoubiquitinated Chains and Substrates—

Next we wanted to test whether CSN5, apart from being aNEDD8 isopeptidase, can have other functions and potentiallyalso bind Lys48-oligoubiquitin chains. Because CSN5 is veryinsolublewhen produced in various expression systems, a strat-egy was developed to refold guanidine HCl-denatured GST-CSN5 by using the aggregation suppressor arginine and thefolding enhancer sucrose (17). RefoldedGST-CSN5was immo-bilized on glutathione-Sepharose beads and incubated withLys48-linked oligoubiquitin chains Ub(2–7) (Fig. 5A, lanes2–4). CSN5 interacted with Ub(2–7) (Fig. 5A, lane 3) similar toHis-p97/VCP that is known to bind oligoubiquitin (23) andwasused as positive control (Fig. 5A, lane 5). The low molecularweight control protein secretoglobin 2A1 (SCGB2A1) (24) didnot bind to glutathione-Sepharose-boundGST-CSN5 (data notshown), indicating that binding of oligoubiquitin chains isspecific.To examine whether binding of oligoubiquitin as for Prp8p

(25) is mediated by the JAMM motif, Myc-tagged CSN5 andtruncation mutants 1–191, 1–110, and 110–191 wereexpressed in HEK 293T cells. Lysates were immunoprecipi-tated with anti-Myc antibody and immunoblotted to detectubiquitin (Fig. 5B). The wild type protein coprecipitated a sub-stantial fraction of ubiquitinated proteins (lane 2, set to 100%),and the 1–191mutant containing the entireMPNdomain (54–191) was still able to coprecipitate a significant amount of ubiq-uitinated proteins (lane 3, 52% compared with wild type).Importantly, also the 110–191 mutant harboring the JAMMmotif (129–175) but lacking large parts of the MPN core (54–142) (20) plus the conserved glutamate 76 (26) still showed

FIGURE 4. p97/VCP interacts with the CSN complex. A, p97/VCP cofraction-ates together with CSN1 and CSN5 during Sephacryl S-200 gel chromatogra-phy. Proteins in 30% of each fraction were acetone-precipitated, separated by12.5% SDS-PAGE, and immunoblotted (IB) using the antibodies indicated onthe left. Fraction numbers are provided at the bottom, and molecular massmarkers are at the top. Input, 2% of lysate. B, the remainder of fraction 5 wasused for IP of CSN1 and detection of coprecipitated p97/VCP, CSN1, and CSN5by immunoblotting. Ctr., IP with isotype control antibody. C, purified CSN (1.4�g) and p97/VCP (6 �g; 1.2 �g in lane 4) were analyzed by immunoblotting ofnative 2–18% polyacrylamide-agarose composite gels either alone or after2-h preincubation of both complexes in the absence or presence of 1 mM ATP.4 M (lane 6) and 6 M urea (lane 7) were used to dissociate p97/VCP hexamers(p97hex). The asterisk denotes a p97/VCP homotrimer.

ATP-dependent Interaction of CSN and p97/VCP

DECEMBER 11, 2009 • VOLUME 284 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 34949

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

interaction with ubiquitinated proteins to a comparable extent(lane 5, 46% compared with wild type). In contrast, the mutant1–110 that does not contain the JAMM motif virtually lostbinding (lane 4, 5%).We conclude that in addition to conferringNEDD8 isopeptidase activity, the JAMM motif of CSN5 bindsoligoubiquitin, but cannot depolymerize it.CSN5 Regulates the Ubiquitination Status of Substrates

Bound to p97/VCP—p97/VCP binds to polyubiquitinated sub-strates either directly with its N domain or indirectly via a num-ber of cofactors. Because it controls the degree of ubiquitina-tion of bound substrates, we examined whether CSN5 canmodify this function. To replace wild type CSN5 with mCSN5,the JAMM mutant was expressed in HEK 293T cells in thepresence of the proteasome inhibitorMG132 (27). Lysateswereimmunoprecipitated with anti-p97/VCP antibody and immu-noblotted for the detection of ubiquitin (Fig. 6A). Ubiquitin-conjugated proteins bound to p97/VCPwere found to accumu-late in the mCSN5-transfected cells (Fig. 6A, lane 6, 1.3-foldmore polyubiquitinated proteins compared with vector con-trol), whereas overexpression of wild type CSN5 repeatedly ledto a slight decrease of associated polyubiquitinated proteins(Fig. 6A, lane 5, 0.7-fold less polyubiquitinated proteins com-pared with vector control). Similarly, ubiquitinated proteinsaccumulated on p97/VCP when the CSN was destabilized byefficient knock down of CSN1 or CSN5 by RNA interference(Fig. 6B, lanes 6 and 7, respectively). In conclusion, the CSN5JAMM motif and a functional CSN complex are required forthe deubiquitination of ubiquitinated substrates bound to p97/VCP. Because the CSN is also associated with the deubiquiti-nase USP15 (28), we investigated its function by knock-downexperiments. Silencing of USP15 resulted in the accumulationof ubiquitinated proteins bound to p97/VCP comparable withthe effect inCSN1 andCSN5knock downs (Fig. 6C, lane 8). Thefunctionality of the knock-down experiments was exemplarilyshown for CSN5 (Fig. 6C, upper panel). Knock down substan-tially increased the proportion of neddylated cullin 1 as thedeneddylase activity of theCSN is impaired as a consequence ofsilencing CSN1 or CSN5 gene expression. The same effect wasobserved when mCSN5 was overexpressed (Fig. 6C, lowerpanel), demonstrating that the mutant protein is indeed com-promising CSN deneddylase activity. Furthermore, IkB� accu-mulated in the CSN5 knock down (upper panel) due to hyper-neddylated cullin 1 (15).

DISCUSSION

Specific interaction of the homohexamericATPase p97/VCPwith subunit CSN5 of the COP9 signalosome and the wholeCSN complex was demonstrated by five independent lines ofevidence comprising (i) an in vivo interactome screen with bio-tin-tagged MIF, (ii) in vitro pulldown studies with overex-pressed wild type and mutant proteins, (iii) in vivo FRET anal-yses with ectopically expressed proteins, (iv) biochemicaldemonstration of an ATP-dependent CSN�p97/VCP complexin composite native gels, and (v) reciprocal coimmunoprecipi-tation of endogenous CSN5 and p97/VCP, i.e. without overex-pression in vivo.Mapping the interface betweenCSN5 andp97/VCP by overexpression of wild type and mutant proteinsrevealed that the ND1 domains of p97/VCP are sufficient for

FIGURE 5. CSN5 binds to oligoubiquitinated proteins in vitro and invivo. A, oligoubiquitin chains Ub(2–7) were incubated with GST or GST-CSN5 immobilized on glutathione-Sepharose 4B or His-p97/VCP immobi-lized on Ni-NTA-agarose. Bound proteins were resolved by SDS-PAGE andidentified by sequential immunoblotting. Protein samples of GST-CSN5and His-p97/VCP were directly loaded in lanes 4 and 6, respectively. Alllanes were on the same immunoblot; a few intervening lanes were omit-ted as indicated by vertical lines. B, HEK 293T cells transfected with emptyvector (V) or Myc-CSN5 mutants were lysed and immunoprecipitated (IP)using a monoclonal anti-Myc antibody. Myc tag and ubiquitin weredetected by immunoblotting (IB). Coprecipitated polyubiquitinated pro-teins were quantified with ImageJ (see numbers below the ubiquitinimmunoblot (IB: Ub). Vector control was set to 0%, wild type (wt) Myc-CSN5 to 100%. The asterisk denotes IgG heavy chains.

ATP-dependent Interaction of CSN and p97/VCP

34950 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 50 • DECEMBER 11, 2009

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

specific binding, but that residues in the second ATPasedomain D2 are contributing to binding affinity, whichexplains why binding of CSN5 to the ND1 protein is weakerthan to the wild type protein. Weak binding to the D1D2protein also shows that direct contacts with both ATPasecassettes are involved.A plethora of cofactors have been described to interact with

p97/VCP. Based on their domain structure they can be groupedinto proteins with UBX domain and non-UBX proteins (29) orfunctionally into substrate-recruiting and -processing cofac-tors of different pathways (7, 30). Many cofactors bind to p97/VCP in homo- or heterooligomeric form and use the N domainof p97/VCP as interaction interface (7). Examples are the tri-meric ubiquitin regulatory X (UBX)-protein p47 (31) and theubiquitin fusion degradation1 (Ufd1)-nuclear protein localiza-tion 4 (Npl4) heterodimer (32). On the other hand, the UBXdomain containing cofactor UBXD1 binds to the C terminus ofp97/VCP with its peptide N-glycanase UBA/UBX (PUB)domain (33), similar to peptide N-glycanase that binds with itsPUB domain (34) to the C-terminal 10 amino acids of p97/VCP(35).As an ATPase, p97/VCP passes through cycles of ATP bind-

ing and hydrolysis. A number of results indicate that ATPasedomain D2 is considerably more active in ATP hydrolysis thantheD1domain. Conformational changes caused byATPhydro-lysis mainly in domain D2 are subsequently transmitted tocofactors and substratemolecules (36). From at least one cofac-

tor, Werner syndrome protein, it is also known that it binds top97/VCP in an ATP-dependent fashion (37). Therefore, weconclude that conformational changes in p97/VCP originatingfrom ATP binding and/or hydrolysis are required to enableCSN binding. This also explains why in addition to the impor-tant N domain, both ATPase domains are required for efficientbinding.Most p97/VCP cofactors use a UBX domain, which folds like

ubiquitin, for binding to p97/VCP and a ubiquitin-associateddomain that binds to ubiquitin for recruiting ubiquitinated pro-teins (7, 30). Structural analysis of the p97 ND1 domains com-plexed with the p47 C-terminal domain revealed that the p47UBX domain interacts with the p97/VCP N domain via a loopthat is highly conserved in UBX domains, but is absent in ubiq-uitin (7).Other cofactors like the peptideN-glycanase useUBX-related domains such as the PUB-domain (35). Interestingly,valosin-containing protein/p47 complex-interacting proteinp135 (VCIP135), a deubiquitinase (38), was also shown to inter-act with p97/VCP (39).For CSN5, we identified a region containing an MPN

domain responsible for interaction with p97/VCP. Part ofthe MPN domain is the JAMM motif that confers deneddy-lase activity to the signalosome (6). Our results show that forbinding to p97/VCP, the C-terminal half of the MPN domain(amino acids 110–191) including the catalytic metalloproteasecenter (JAMM motif) is not sufficient. Also, four amino acidpoint mutations (CSN5 mutant) that abrogate isopeptidase

FIGURE 6. A functional CSN complex with associated USP15 deubiquitinase is required for deubiquitination of polyubiquitinated substrates bound top97/VCP. A, HEK 293T cells were transfected with empty vector, CSN5, or the JAMM mutant of CSN5 (mCSN5) and treated with the proteasome inhibitorMG132. p97/VCP was immunoprecipitated from transfected cell lysates, and precipitates were immunoblotted (IB) for ubiquitin, p97/VCP, and CSN5. �-Actinwas used as loading control. The fraction of coprecipitated polyubiquitinated proteins normalized against precipitated p97/VCP was quantified with ImageJ.Numbers below the ubiquitin immunoblots (IB: Ub) indicate the fold increase versus control, which was set to 1. B, cells were transiently transfected with control,CSN1, CSN5, and USP15 siRNAs. The intensities of protein bands detected in immunoblots were normalized for �-actin and quantified with ImageJ. CSN1 siRNAreduced CSN1 protein to 40%, CSN5 siRNA CSN5 protein to 18%, and USP15 siRNA USP15 protein to 24%. After treatment with the proteasome inhibitor MG132for 1 h, cell lysates were analyzed by immunoblotting using specific antibodies as indicated on the left. After IP of p97/VCP, ubiquitin was detected inprecipitates by immunoblotting. Asterisks denote IgG heavy chains, # indicates Myc-mCSN5. C, functional controls. Lysates of CSN5 knock-down cells wereanalyzed by immunoblotting for the presence of CSN5, cullin 1, I�Ba, CSN1, and �-actin (upper panel). Lysates of mCSN5-transfected cells were analyzed byimmunoblotting for the presence of CSN5, cullin 1, and �-actin (lower panel).

ATP-dependent Interaction of CSN and p97/VCP

DECEMBER 11, 2009 • VOLUME 284 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 34951

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

activity do not interfere with binding. Therefore, the N-termi-nal half of the MPN domain, the so-called MPN core, and/orthe N-terminal 54 residues of CSN5 are mediating binding top97/VCP.Because at least a large fraction of CSN5 is found in the sig-

nalosome (for a detailed discussion, see reference 40) andectopically expressed CSN5 variants and mutants replace thewild type CSN5 within the signalosome (27), it cannot beexcluded that signalosome subunits other than CSN5 contrib-ute to CSN-p97/VCP interaction.It is known that JAMM motifs can have diverse functions.

Whereas the JAMMmotif of CSN5 acts as a NEDD8 isopepti-dase, the motifs of RPN11 and AMSH function as ubiquitinisopeptidases (41). Contrary to these enzymatic activities, theJAMMmotif of MOV34 is unable to complex a zinc ion and isthought to have primarily a structural role (42) similar to thepre-mRNA splicing factor Prp8p, whose inactive JAMMmotifacts as a new ubiquitin binding domain (25).Experiments described by Groisman et al. (27) indicated

that in addition to its isopeptidase activity that deconjugatesNEDD8 from neddylated cullins, CSN5 could possess an iso-petidase activity that deconjugates ubiquitin. Hetfeld et al. (28)reported that CSNpurified from erythrocytes binds gold-Ub(4)particles. But it remained unclear whether binding is mediatedby themetalloprotease subunit CSN5 or the associated deubiq-uitinase USP15. Because CSN5 accumulates in insoluble formwhen expressed in different systems, we developed a strategy torenature denaturedCSN5.Using this approach, wewere able toshow specific binding of oligoubiquitin to recombinant CSN5,but we could not observe any depolymerizing activity. Thus,our data are in agreement with the results of Groisman et al.(27) and Hetfeld et al. (28) and strengthen the hypothesis thatCSN5 binds ubiquitin and could possess deconjugating activity.p97/VCP controls the degree of ubiquitination of bound sub-

strates that are either bound directly or indirectly via a plethoraof cofactors. Here, we could show that the CSN interacts withp97/VCP and regulates the amount of polyubiquitinated pro-teins bound to p97/VCP. When the CSN was inactivated byknock-down of CSN1 or CSN5, the amount of polyubiquiti-nated proteins bound to p97/VCP increased, indicating that theCSN is required for proper processing of substrate proteinsbound to p97/VCP. Because the same effect could be observedwhen a CSN5 mutant with defective JAMM motif was trans-fected, we further conclude that a functional isopeptidase activ-ity of CSN5 is required for substrate processing by p97/VCP.Increasing amounts of cullin 1-NEDD8 following CSN5 knock-down revealed that the inactivation ofCSN5was functional andshowed expected consequences. By inactivation of the CSN-associated deubiquitinase USP15 (28), we could demonstratethat USP15 is also involved in the processing of polyubiquiti-nated substrates bound to p97/VCP.Based on the newly established interaction of CSN and p97/

VCP, we propose that CSN and p97/VCP could form a largeATP-dependent oligomeric complex we name CSN regulatoryparticle in analogy to the proteasome regulatory particle (RP).The analogy is based on pairwise sequence homologies betweenall CSN and RP lid subunits on the one hand (43) and structuralhomologies between the homohexameric AAA� ATPase p97/

VCP and the AAA� ATPases Rp1–6 of the RP base that form aheterohexamer on the other hand (44). This implies that theproteasomal proteins RPN1, 2, and 10 or paralogous proteinscould be part of the CSN RP as well. Until recently, p97/VCPwas known mainly for its role in endoplasmic reticulum-asso-ciated protein degradation. Together with new results showingthat p97/VCP associates with allmammalianUBXdomain pro-teins linking it to dozens of E3 ligases and their cytoplasmicsubstrates (45), our results further suggest that not only p97/VCP itself, but the CSN RP plays a global regulatory role inprotein turnover. p97/VCP was termed a molecular “gearbox”that in conjunction with substrate-processing cofactors is reg-ulating the ubiquitination status of substrates (7). Based on ourfindings that the deneddylase activity of CSN5 and the deubiq-uitinase USP15 are involved in regulating the ubiquitinationstatus of proteins recruited to p97/VCP, we suggest that bothactivities are decisive for “switching gears.” Other deubiquiti-nases could also be involved because the CSN is associated withat least two different enzymatic deubiquitinase activities (27,28). A further level of control originates from the association ofprotein kinases CK2 and D with the CSN that potentially couldregulate the association of substrate-processing cofactors withp97/VCP through phosphorylation. Therefore, what emerges isthe picture of a molecular machine that extracts ubiquitinatedand abnormal folded proteins from larger protein complexes ormembranes and determines their fate by using the N-terminaldomain of p97/VCP and the CSN as a hub for substrate-pro-cessing cofactors and regulatory enzymes. Because the interac-tion of p97/VCP with the CSN originated from an interactomescreen for the cytokine MIF, our results also suggest that MIFmay not only be involved in regulating the deneddylase activityof CSN5 (46), but appears to control the UPS on a muchbroader scale.

Acknowledgments—We thank W. Dubiel (Charite, Berlin, Germany)for generously providing purified CSN; M. Tagaya (Tokyo University,Japan), S. Fang (University of Maryland, Baltimore, MD), J. Bernha-gen (Rheinisch-Westfalische Technische Hochschule Aachen, Ger-many), M. P. Coleman (Cambridge, U. K.), and J. Song (Sungkyunk-wan University, Korea) for plasmids; and Dr. Laurence Samelson(NCI, National Institutes of Health) for p97/VCP antibody. We arealso grateful to J. Bernhagen, G. Suske, C. Mallidis, andW. Dubiel fora critical reading of the manuscript.

REFERENCES1. Hershko, A., and Ciechanover, A. (1998) Annu. Rev. Biochem. 67,

425–4792. Haglund, K., and Dikic, I. (2005) EMBO J. 24, 3353–33593. Pickart, C.M., and Cohen, R. E. (2004)Nat. Rev.Mol. Cell Biol. 5, 177–1874. Wei, N., and Deng, X. W. (2003) Annu. Rev. Cell Dev. Biol. 19, 261–2865. Huang, X., Hetfeld, B. K., Seifert, U., Kahne, T., Kloetzel, P. M., Naumann,

M., Bech-Otschir, D., and Dubiel, W. (2005) FEBS J 272, 3909–39176. Ambroggio, X. I., Rees, D. C., and Deshaies, R. J. (2004) PLoS Biol 2, E27. Jentsch, S., and Rumpf, S. (2007) Trends Biochem. Sci 32, 6–118. Filip, A. M., Klug, J., Cayli, S., Frohlich, S., Henke, T., Lacher, P., Eickhoff,

R., Bulau, P., Linder, M., Carlsson-Skwirut, C., Leng, L., Bucala, R., Krae-mer, S., Bernhagen, J., and Meinhardt, A. (2009) J. Biol. Chem. 284,7977–7985

9. Konig, P., Krasteva, G., Tag, C., Konig, I. R., Arens, C., and Kummer, W.(2006) Lab. Invest. 86, 853–864

ATP-dependent Interaction of CSN and p97/VCP

34952 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 284 • NUMBER 50 • DECEMBER 11, 2009

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

10. Hetfeld, B. K., Bech-Otschir, D., and Dubiel, W. (2005)Methods Enzymol.398, 481–491

11. Niepmann, M., and Zheng, J. (2006) Electrophoresis 27, 3949–395112. Suh,M. H., Ye, P., Datta, A. B., Zhang,M., and Fu, J. (2005)Anal. Biochem.

343, 166–17513. Peth, A., Berndt, C., Henke, W., and Dubiel, W. (2007) BMC Biochem. 8,

2714. Kim, B. C., Lee, H. J., Park, S. H., Lee, S. R., Karpova, T. S., McNally, J. G.,

Felici, A., Lee, D. K., and Kim, S. J. (2004)Mol. Cell. Biol. 24, 2251–226215. Schweitzer, K., Bozko, P. M., Dubiel,W., and Naumann,M. (2007) EMBO

J. 26, 1532–154116. Sambrook, S., and Russell, D. W. (2001).Molecular cloning. A laboratory

manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NewYork

17. Tresaugues, L., Collinet, B., Minard, P., Henckes, G., Aufrere, R., Blon-deau, K., Liger, D., Zhou, C. Z., Janin, J., Van Tilbeurgh, H., andQuevillon-Cheruel, S. (2004) J Struct Funct Genomics 5, 195–204

18. Meyer,H.H., Shorter, J. G., Seemann, J., Pappin, D., andWarren,G. (2000)EMBO J. 19, 2181–2192

19. Kleemann, R., Hausser, A., Geiger, G., Mischke, R., Burger-Kentischer, A.,Flieger, O., Johannes, F. J., Roger, T., Calandra, T., Kapurniotu, A., Grell,M., Finkelmeier, D., Brunner, H., and Bernhagen, J. (2000) Nature 408,211–216

20. Burger-Kentischer, A., Finkelmeier, D., Thiele, M., Schmucker, J., Geiger,G., Tovar, G. E., and Bernhagen, J. (2005) FEBS Lett. 579, 1693–1701

21. Tsuge, T., Matsui, M., and Wei, N. (2001) J. Mol. Biol. 305, 1–922. Wang, Q., Song, C., and Li, C. C. (2003) Biochem. Biophys. Res. Commun.

300, 253–26023. Dai, R. M., and Li, C. C. (2001) Nat Cell Biol. 3, 740–74424. Stoeckelhuber, M., Messmer, E. M., Schmidt, C., Xiao, F., Schubert, C.,

and Klug, J. (2006) Histochem Cell Biol. 126, 103–10925. Bellare, P., Kutach, A. K., Rines, A. K., Guthrie, C., and Sontheimer, E. J.

(2006) RNA 12, 292–30226. Cope, G. A., Suh, G. S., Aravind, L., Schwarz, S. E., Zipursky, S. L., Koonin,

E. V., and Deshaies, R. J. (2002) Science 298, 608–61127. Groisman, R., Polanowska, J., Kuraoka, I., Sawada, J., Saijo,M., Drapkin, R.,

Kisselev, A. F., Tanaka, K., and Nakatani, Y. (2003) Cell 113, 357–36728. Hetfeld, B. K., Helfrich, A., Kapelari, B., Scheel, H., Hofmann, K., Guter-

man, A., Glickman, M., Schade, R., Kloetzel, P. M., and Dubiel, W. (2005)Curr. Biol. 15, 1217–1221

29. Dreveny, I., Pye, V. E., Beuron, F., Briggs, L. C., Isaacson, R. L., Matthews,S. J., McKeown, C., Yuan, X., Zhang, X., and Freemont, P. S. (2004) Bio-chem. Soc. Trans. 32, 715–720

30. Schuberth, C., and Buchberger, A. (2008)Cell Mol Life Sci 65, 2360–237131. Beuron, F., Dreveny, I., Yuan, X., Pye, V. E., McKeown, C., Briggs, L. C.,

Cliff, M. J., Kaneko, Y.,Wallis, R., Isaacson, R. L., Ladbury, J. E., Matthews,S. J., Kondo, H., Zhang, X., and Freemont, P. S. (2006) EMBO J. 25,1967–1976

32. Bruderer, R. M., Brasseur, C., and Meyer, H. H. (2004) J. Biol. Chem. 279,49609–49616

33. Kern, M., Fernandez-Saiz, V., Schafer, Z., and Buchberger, A. (2009) Bio-chem. Biophys. Res. Commun. 380, 303–307

34. Allen, M. D., Buchberger, A., and Bycroft, M. (2006) J. Biol. Chem. 281,25502–25508

35. Zhao, G., Zhou, X., Wang, L., Li, G., Schindelin, H., and Lennarz, W. J.(2007) Proc. Natl. Acad. Sci. U.S.A. 104, 8785–8790

36. Pye, V. E., Dreveny, I., Briggs, L. C., Sands, C., Beuron, F., Zhang, X., andFreemont, P. S. (2006) J Struct Biol 156, 12–28

37. Indig, F. E., Partridge, J. J., vonKobbe, C., Aladjem,M. I., Latterich,M., andBohr, V. A. (2004) J Struct Biol 146, 251–259

38. Wang, Y., Satoh, A., Warren, G., andMeyer, H. H. (2004) J. Cell Biol. 164,973–978

39. Uchiyama, K., Jokitalo, E., Kano, F., Murata, M., Zhang, X., Canas, B.,Newman, R., Rabouille, C., Pappin, D., Freemont, P., and Kondo, H. (2002)J. Cell Biol. 159, 855–866

40. Chamovitz, D. A. (2009) EMBO Rep 10, 352–35841. McCullough, J., Clague, M. J., and Urbe, S. (2004) J. Cell Biol. 166,

487–49242. Alves, B. S., Oyama, S., Jr., Gozzo, F. C., Sanches,M., Guimaraes, B. G., and

Zanchin, N. I. (2006) Biochem. Biophys. Res. Commun. 347, 608–61543. Wei, N., Serino, G., and Deng, X. W. (2008) Trends Biochem. Sci 33,

592–60044. Elsasser, S., and Finley, D. (2005) Nat Cell Biol. 7, 742–74945. Alexandru, G., Graumann, J., Smith, G. T., Kolawa, N. J., Fang, R., and

Deshaies, R. J. (2008) Cell 134, 804–81646. Nemajerova, A., Moll, U. M., Petrenko, O., and Fingerle-Rowson, G.

(2007) Cell Cycle 6, 1030–103447. Oh,W., Lee, E.W., Sung, Y.H., Yang,M. R., Ghim, J., Lee,H.W., and Song,

J. (2006) J. Biol. Chem. 281, 17457–17465

ATP-dependent Interaction of CSN and p97/VCP

DECEMBER 11, 2009 • VOLUME 284 • NUMBER 50 JOURNAL OF BIOLOGICAL CHEMISTRY 34953

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from

and Andreas MeinhardtSevil Cayli, Jörg Klug, Julius Chapiro, Suada Fröhlich, Gabriela Krasteva, Lukas Orel

p97/VCPProtein (VCP) and Controls the Ubiquitination Status of Proteins Bound to COP9 Signalosome Interacts ATP-dependently with p97/Valosin-containing

doi: 10.1074/jbc.M109.037952 originally published online October 13, 20092009, 284:34944-34953.J. Biol. Chem. 

  10.1074/jbc.M109.037952Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/284/50/34944.full.html#ref-list-1

This article cites 46 references, 13 of which can be accessed free at

by guest on February 18, 2020http://w

ww

.jbc.org/D

ownloaded from