Upload
others
View
0
Download
0
Embed Size (px)
Citation preview
Fiorucci et al. - 1
JPET/2003/063651
Cooperation between Aspirin-triggered lipoxin and nitric oxide (NO) mediates anti-adhesive properties of NCX-4016 (NO-aspirin) on
neutrophil-endothelial cell adherence
Stefano Fiorucci1, Eleonora Distrutti1, Andrea Mencarelli1, Giovanni Rizzo1, Anna Rita Di Lorenzo1, Monia Baldoni1, Piero del Soldato2, Antonio Morelli1 and John L. Wallace3
1Clinica di Gastroenterologia ed Epatologia, Dipartimento di Medicina Clinica e Sperimentale; Università degli Studi di Perugia, Perugia, Italy.
2Nicox SA, Sophia Antipolis, France; 3 Mucosal Inflammation Research Group, Faculty of Medicine, University of Calgary, Calgary, Alberta, T2N N1 Canada,
JPET Fast Forward. Published on February 4, 2004 as DOI:10.1124/jpet.103.063651
Copyright 2004 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 2
Running title NO and ATL modulate anti-adhesive effect of NCX-4016
Address correspondence to Stefano Fiorucci, M.D. Clinica di Gastroenterologia ed Endoscopia Digestiva Policlinico Monteluce 06100 Perugia Italy FAX 011-39-075-5783687 Email address: [email protected] Number of text pages 27 Number of tables 0 Number of Figures 7 Number of references 41 Number of words in the Abstract 248 Number of words in the Introduction 550 Number of words in the Discussion 1073 Abbreviations ATL, Aspirin-triggered lipoxin or 15-epi-LXA4; COX-1 and COX-2, cyclooxygenase-1 and 2; HUVEC, human umbilical vein endothelial cells; LXA4, lipoxin A4; PMN, polymorphonuclear neutrophils; Recommended section Inflammation and immunopharmacology
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 3
NCX-4016 is nitric oxide (NO)-releasing derivative of aspirin that inhibits cyclo-oxygenase (COX) activity and releases NO. Acetylation of COX-2 by aspirin activates a transcellular biosynthetic pathway that switches eicosanoid biosynthesis from prostaglandin E2 to 15-epi-lipoxin (LX)A4 or Aspirin-Triggered Lipoxin (ATL). Here we demonstrate that exposure of neutrophil (PMN)/ human umbilical vein endothelial cell (HUVEC) co-cultures to aspirin and NCX-4016 triggers ATL formation and inhibits cell-to-cell adhesion induced by endotoxin (LPS) and interleukin (IL)-1β by 70-90%. However, while selective and non selective COX-2 inhibitors (celecoxib, rofecoxib and naproxen) or Boc-1, a LXA4 receptor antagonist, reduced the anti-adhesive properties of aspirin by ≈70%, anti-adhesive effects of NCX-4016 were only marginally affected (≈30%) by COX inhibitors and Boc-1, implying that COX-independent mechanisms mediates the anti-adhesive properties of NCX-4016. Indeed, NCX-4016 causes a long-lasting (up to 12 h) release of NO and cGMP accumulation in HUVEC. Scavenging NO with 10 mM haemoglobin, in the presence of celecoxib, reduced the anti-adhesive properties of NCX-4016 by ≈80%. Confirming a role for NO, the NO-donor DETA-NO also inhibited PMN/HUVEC adhesion by ≈80%. NCX-4016, but not aspirin, decreased DNA binding of NF-κB on gel shift analysis and HUVEC’s over-expression of CD54 and CD62E induced by LPS/IL-1β. Reduction of binding of the two NF-κB subunits, p50-p50 and p50-p65, was reversed by dithiothreitol, implying S-nitrosylation as mechanism of inhibition. In summary, our results support the notion that ATL and NO are formed at the PMN/HUVEC interface following exposure to NCX-4016 and mediate the anti-adhesive properties of this compound. Key words Aspirin-triggered lipoxin, cycloxygenase-2, Nitric oxide, nuclear factor (NF)-κB, CD54, CD62E
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 4
Adhesive interactions between leukocytes and endothelial cells and transmigration
through the endothelium junctions represent early events in physiological (e.g.
innate immune response) as well as pathological responses, such as
ischemia/reperfusion injury, atherosclerosis, transplant rejection and various
inflammatory disorders (Cotran and Mayadas-Norton, 1998). Adhesion of
polymorphonuclear leukocyte (PMN) to the endothelium increases vascular
permeability and favours cell transmigration into surrounding tissues (Carlos and
Harlan, 1994; Gimbrone et al., 1995). Cyclo-oxygenase (COX)-derived lipid
mediators regulate many aspects of adhesive interactions in vascular
inflammation and represent a major target for the therapeutic actions of
aspirin and non-steroidal anti-inflammatory drugs (NSAIDs) (Alpin et al., 1998;
FitGerald and Patrono, 2001; Patrono, 1994; Pillinger et al., 1998). In contrast to
NSAIDs, aspirin not only inhibits prostaglandin (PG) generation but can also
trigger lipoxin (LX) production (Claria and Serhan,1995). Thus, COX-2
acetylation by aspirin modifies its activity to generate 15R-hydroxyeicosatetraenoic
acid (15R-HETE), which can be oxygenated to produce 15(R) -epi-Lipoxin (LX)A4,
also termed aspirin-triggered LX or ATL (Claria and Serhan, 1995; Serhan, 2002;
Serhan and Oliw, 2001). Similarly to LXA4, ATL, exerts potent anti-inflammatory
actions acting as a braking signal to limit PMN chemotaxis and transmigration
across endothelial cell layers (Schottelius et al., 2002; Serhan, 2002; Serhan and
Oliw, 2001).
Nitric oxide (NO), synthesized from L-arginine by a family of constitutive
and inducible NO synthases, is a small, diffusible, highly reactive molecule that
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 5
serves a variety of functions in the cardiovascular system and accounts for most of
the endothelium-dependent vasodilation (Ignarro, 1990). In addition to controlling
vascular tone, NO also regulates adhesive interactions at the endothelium
surface (Ignarro, 1990). Thus, exposure of endothelial cells to NO inhibits E-
selectin, intercellular adhesion molecule (ICAM)-1 and vascular cell adhesion
molecule-1 (VCAM-1) expression (De Caterina et al., 1995; Khan et al., 1996;
Kubes et al., 1994; Spiecker et al., 1997), limits the release of secretable
cytokines, IL-6 and IL-8 (Persoons et al., 1996), and prevents nuclear
translocation of nuclear factor (NF)-κB (De Caterina et al., 1995, Dela Torre et al.,
1997), suggesting that similar to LXA4 and ATL, NO might act as a braking
signal in regulating vascular inflammation.
NCX-4016 (2-(acetyloxy)benzoic acid 3-(nitrooxymethyl)phenyl ester) is
the prototype of a new class of anti-platelet and anti-inflammatory drugs obtained
by coupling a NO-releasing moiety to acetylsalicylic acid (Fiorucci and Del
Soldato, 2003; Fiorucci et al., 2000a; Fiorucci et al., 2002b; Fiorucci et al.,
2003; Wallace et al., Wallace et al., 2002). NCX-4016 inhibits COX-1 and COX-2
activity (Fiorucci and Del Soldato, 2003; Fiorucci et al., 2002a; Wallace et al.,
1999; Wallace et al., 2002) and triggers ATL formation in vivo (Fiorucci et al.,
2003). Previous studies in rodents have shown that NCX-4016 is more effective
than aspirin in preventing myocardial infarction and restenosis after carotid
angioplasty (Wallace et al., 2002). In contrast to aspirin, but similarly to NO
donors, NCX-4016 modulates the expression of tissue factor on monocytes
(Fiorucci et al., 2002a) as well as cytokine secretion from activated macrophages
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 6
(Fiorucci et al., 2000), thereby suggesting that both the aspirin and the NO
moiety contribute to its pharmacological activity.
The present study was designed to investigate whether NCX-4016
modulates endothelial cell/PMN interaction and identify molecular intermediates
of this effect. Since NO modulates NF-κB activity, we have examined whether
NCX-4016 has the ability to interfere with the binding of this transcription factor to
DNA in activated endothelial cells.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 7
Methods
Materials. Aspirin, 1,4-dithio-D,L-threitol (DTT) lipopolysaccharide (LPS;
Escherichia coli 0111:B4 serotype), Nϖ-nitro-L-arginine methyl ester (L-NAME) and
Boc1 (N-t-butoxycarbonyl-methionine-leucine-phenylalanine) were from Sigma
Chemical (St. Louis, MO). Celecoxib was synthesized as previously described
(Fiorucci et al., 2003a). Rofecoxib (Nicoll-Griffith et., 2000) was synthesized by
Dr. Stefan Laufer (Department fur Pharmazie-Zentrum fur Pharmaforschung,
University of Tubingen, Germany) (Fiorucci et al., 2003a). Culture media and fetal
bovine serum were from GIBCO (Milan, Italy). Mouse anti-human monoclonal
antibodies anti-CD62E and anti-CD54 were from Immmunotech (Marseille,
France). Interleukin 1β from R&D Systems (Minneapolis, MN). DETA-NO, (z)-
1-[2-(2-aminoethyl)-N-(2-ammonioethyl)amino] diazen-1-ium-1,2 diolate and 1H-
[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one (ODQ), were from Alexis (Milan, Italy).
HUVEC. Primary cultures of human umbilical endothelial cells (HUVEC) were
from Istituto Zooprofilattico of Brescia (Brescia, Italy). HUVEC were grown in
endothelial basal medium supplemented with bovine brain extract (12 µg/ml),
human epithelial growth factor (10 ng/ml), hydrocortisone (1 µg/ml), penicillin (100
units/ml), streptomycin (100 µg/ml), and gentamycin (5 µg/ml), at 37°C in a
humidified atmosphere containing 5% and 2% fetal bovine serum. Cells were used
between passages 2 to 5 as described previously (Fiorucci et al., 2003a).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 8
PMN Isolations. Fresh peripheral blood was isolated from healthy donors who
had refrained from taking anti-inflammatory drugs or other medications for at
least 2 weeks. Neutrophils (PMN) were isolated using standard dextran
sedimentation and gradient separation on Histopaque-1077 (Sigma Chemical Co.
St Louis, MO) as described previously. This procedure yields a PMN population
that is 95-98% viable (trypan blue exclusion) and 98% pure (acetic acid-crystal
violet staining).
PMN-HUVEC Co-Cultures. HUVECs were seeded on gelatin-coated, 24-well
plates for 48 hours. Confluency was confirmed by microscopical inspection before
each experiment. Confluent cells were then incubated for 24 h in the presence of
10 ng/ml IL-1β and 10 ng/ml LPS (Claria and Serhan, 1996). For eicosanoid
generation experiments, 2.105 HUVEC were pre-incubated with 100 µM aspirin
or NCX-4016 for 5 hours and then for 30 minutes with 5 µM A23187 and 20 µM
arachidonic acid (AA) and then coincubated with 2.106 PMN for further 30 min
(Claria and Serhan, 1996). To inhibit COX-2 activity, 100 µM celecoxib, 10 µM
rofecoxib and 100 µM naproxen were added directly to HUVEC, and cells pre-
incubated for 20 minutes before addition of PMN. In experiments were Boc-1,
was used, this agent was added directly to PMN/HUVEC co-cultures (Fiorucci et
al., 2003a; Perretti et al., 2001).
PMN-HUVEC Adhesion Assay. Freshly isolated PMN were washed twice with
labelling medium (RPMI 1640 plus 1% FBS) and then incubated for 1 h (37°C; 5%
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 9
CO2) with 51CrO4 (sodium salt; DuPont NEN, Boston, MA; 3-5 µCi/5 × 107 cells).
The labelled leukocytes were washed four times with labelling medium and then
resuspended in fresh labelling medium. For static adhesion assays, 50 µl of
labelled neutrophil suspension (1 × 107 cells) were added to each well of
endothelial cells (10:1 ratio of leukocytes to endothelial cells) and incubated for
30 minutes at 37°C on an orbital shaker at 90 rpm in the presence of aspirin or
NCX-4016. At the end of the incubation period, the medium from each well was
aspirated and saved for radioactive counting. The monolayer was gently washed
three times with cold PBS to remove loosely adherent or unattached neutrophils;
collected washes were combined with medium and counted, yielding a measure of
nonadherent leukocytes. After the final wash, monolayers were lysed for 1 h with
1 M NaOH; counting of the lysate [in counts/min (cpm)] yielded a measure of
adherent leukocytes. Adhesion was quantified as follows: %PMN
adherence = lysate (cpm)/[supernatant (cpm) + wash (cpm) + lysate (cpm)].
CD54 (ICAM-1) and CD62E (E-selectin) Expression. Surface expression of
adhesion molecules was quantified by flow cytometry. To investigate the
expression of CD54 and CD62E, activated HUVEC (18 hr in culture with
LPS/IL-1β) were incubated for 5 h aspirin or NCX-4016 with or without Hb, while
celecoxib was added 30 min cell harvesting by extensive wash and culture
trypsinization (Fiorucci et al., 2003a). HUVEC were identified by size (forward
and side scatter). After staining with specific antibodies, cells were washed twice
and incubated with FITC-conjugated sheep anti-mouse F(ab')2 secondary Ab
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 10
(1:400 dilution; Sigma Chemical Co.) for 45 min at 4°C. Stained cells were washed
once and fixed in 1% (v/v) formaldehyde in PBS. Flow cytometry was performed
on a Epics XL instrument (Coulter-Beckman, Milan, Italy). After gating out small
sized (i.e. noncellular) debris, 50,000 events were collected for each analysis. The
levels of CD54 and CD62E for each experiment were normalized against the
value of the isotype-matched control antibody (background).
15-epi-LXA4 (ATL) and PGE2 Assay. ATL concentrations were measured
using a commercially available assay (Neogen Corporation, Lansing MI)
following manufacturer’s instructions. The antibody used in this assay specifically
recognizes 15(R)-epi-LXA4, and has been characterized previously by us and
others (Chiang et al., 1998; Fiorucci et al., 2002b). The PGE2 assay of cell
supernatants was carried out in duplicate using a commercially available ELISA kit
(Cayman Chemical Co, Milan, Italy).
NO generation and Nitrite/nitrate Assay. NO formation was measured using a
2 mm NO-sensitive electrode connected to the ISO-NO Mark II meter (World
Precision Instruments, Inc. Sarasota, FL). The NO electrode was calibrated by
addition of known concentrations of NaNO2 under reducing conditions (Kl/H2SO4).
The nitrite/nitrate concentrations in cell supernatants was measured using a
commercially available EIA kit (Cayman Chemical, Co.)
Preparation of Nuclear Extracts. After stimulation with LPS, cells were washed
three times with ice-cold PBS, harvested, and resuspended in 0.5 ml of buffer A
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 11
(20 mM HEPES pH 7.4, 10 mM KCl, 1.5 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 1
mM PMSF) and protease inhibitors: 5 µg/ml aprotinin, 5 µg/ml pepstatin A, 5 µg/ml
leupeptin or 1x Protease inhibitor cocktail (Roche, Milan, Italy). After 10 min
incubation on ice, 23 µl of 10% Nonidet P-40 was added and vigorously mixed for
15 s. Nuclei were separated from cytosol by centrifugation at 13,000 x g for 10 s.
The cytosolic proteins contained in the supernatant fraction were separated from
membrane by centrifugation 10’ at 13,000 x g (Haglund and Rothblum, 1987). The
pellet containing a nuclear proteins fraction has resuspended in 50 µl of buffer B
(20 mM HEPES pH 7.4, 1.5 mM MgCl2, 0.42 M NaCl, 1 mM EDTA, 1 mM DTT, 1
mM PMSF, 10% glicerol) and 1x Protease inhibitor cocktail (Roche). After 30 min
at 4°C, lysates were separated by centrifugation (13,000 x g, 30 s), and
supernatant containing nuclear proteins were transferred to new vials. The protein
concentration was measured using a protein dye reagent (Bio-Rad, Richmond,
CA) with BSA as standard, and samples used directly or stored at -80°C.
Electrophoretic Mobility Shift Analysis (EMSA). Probes used for EMSAs were
radiolabeled by [γ-32P]ATP end labeling with T4 polynucleotide kinase. Briefly, 10
pM of double strand oligonucleotide CAGTTGAGGGGACTTTCCCAGGC was end
labeled with [γ-32P]ATP for 60 min at room temperature before the kinase was
inactivated at 95 °C for 5 min. The labeled probe was purified from unincorporated
nucleotides by using a QuickSpin column (G-25, Gibco) following the
manufacturer's instructions. The specific activities of 32P-labeled oligoprobe were
measured by beta counter. For EMSAs, 6-10 µg of nuclear extracts were
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 12
incubated in a total volume of 20-25 µl of binding buffer (50 mM NaCl, 10 mM Tris
pH 7.4, 0.5 mM EDTA, 1 mM PMSF, 1 µg of poly(dI-dC), and 5% glycerol) for 20
min at room temperature with 50,000 cpm (50 fmoli) of labeled probe. For
competition assays, 20X excess of unlabeled oligonucleotides were pre-incubated
for 15 min prior to the addition of the radiolabeled probe. For antibody-mediated
supershift assays, extracts were pre-incubated with 5 µl of NF-kB subunit anti-p50
(Santa Cruz Biotechnology, Santa Cruz, CA) at room temperature for 10 min
before the addition of the radiolabeled probe. The reactions were loaded on a 6%
polyacrylamide non denaturing gel in 0.5× Tris-borate-EDTA, electrophoresed for 2
h at 170 V before drying (1 h at 80 °C) and exposed to autoradiographic film.
Statistical Analysis. All data are presented as the mean ± SEM. Comparisons
of groups of data were performed using a one-way analysis of variance (ANOVA)
followed by the Tukey post-hoc test. An associated probability (P value) of less
than 5% was considered significant.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 13
Results
As illustrated in Figure 1a, exposure of LPS/IL-1β-primed HUVEC
to aspirin and NCX-4016 for 5 h resulted in a concentration-dependent inhibition
of PMN/HUVEC adhesion. At the dose 100 µM, aspirin and NCX-4016 reduced
adhesive interactions by 70-90% (n=8; P<0.001 versus LPS/IL-1β). To dissect
mediators involved in the inhibitory effect of aspirin and NCX-4016, HUVEC were
incubated with celecoxib and rofecoxib, two selective COX-2 inhibitors, or
naproxen, a non selective COX-2 inhibitor, and PMN adhesion assessed. As
shown in Figure 1b, 100 µM celecoxib, 10 µM rofecoxib and 100 µM naproxen
each caused a 60-70% reversion of antiadhesive properties of aspirin (n=8;
P<0.001 versus aspirin). In contrast, celecoxib, rofecoxib and naproxen,
caused 20-30% inhibition of the anti-adhesive activity of NCX-4016 (Figure 1b;
n=8; P<0.05 versus NCX-4016), suggesting that COX-independent mechanisms
are also involved in the anti-adhesive properties of this drug.
Exposure of HUVEC to LPS/IL-1β for 24 h induced COX-2 expression
as assessed by RT-PCR (Figure 2a) and significantly enhanced generation of
PGE2 in comparison with untreated cells (n=8; P<0.001). Aspirin and NCX-
4016 (100 µM reduced PGE2 concentrations by ≈80% and triggered the
formation of ATL (Figure 2b and c; n=8; P<0.01 versus LPS/IL-1β alone).
Treatment of the PMN/ HUVEC co-culture with 100 µM celecoxib, 10 µM
rofecoxib or 100 µM naproxen abrogated ATL generation induced by aspirin
and NCX-4016 (n=8, P<0.01 versus aspirin and NCX-4016 alone) and further
inhibited PGE2 synthesis (n=8, P<0.01 versus aspirin and NCX-4016 alone).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 14
The role of ATL in mediating anti-adhesive effects of NCX-4016 and apsirin was
further investigated using Boc-1, a LXA4 receptor antagonist (Fiorucci et al.,
2002b; Fiorucci et al., 2003a; Perretti et al., 2001). Thus, as shown in Figure 2d,
exposure of PMN/HUVEC co-cultures to Boc-1 reduced anti-adhesive effect of
aspirin by ≈ 60% (n=8, P<0.01 versus aspirin alone), while was only partiallt
effective in modulating anti-adhesive properties of NCX-4016 (n=8, P<0.05 versus
NCX-4016 alone).
As shown in Figure 3a-c, culturing HUVEC with LPS/IL-1β, increased
NO2/NO3 release in cell supernatants, a measure of NO formation, as well as
intracellular cGMP concentrations (n=8; P<0.01 versus basal). While 5 h
incubation with 100 µM aspirin had no effect on the rate of NO formation, addition
of 100 µM NCX-4016 significantly enhanced NO2/NO3 generation (Figure 3a and
b; n=8; P<0.01 versus LPS/IL-β). This finding was further confirmed by assessing
NO formation with a NO-sensitive electrode. Thus, as shown in Figure 3c,
exposure to 100 µM NCX-4016 resulted in a long-lasting (up to 12 h) release of
NO (n=8; P<0.01 versus LPS/IL-β).
Figure 4a demonstrates that exposure to L-NAME, a non-selective NOS
inhibitor, and to a lesser extent to ODQ, a guanylyl-cyclase inhibitor, enhanced
adhesion of PMN to LPS/IL-1β-primed HUVEC, suggesting that endogenous NO
provides an anti-adhesive background in this experimental setting (n=8; P<0.01
versus LPS/IL-1β). While inhibition of endogenous NO with L-NAME slightly,
≈20%, reduced anti-adhesive effects of aspirin (n=8, P>0.05 versus aspirin alone),
ODQ was not effective (n=8, P>0.05 versus aspirin alone). L-NAME and ODQ
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 15
also failed to reverse inhibition of PMN/HUVEC adhesion caused by NCX-4016
(n=8, P>0.05 versus NCX-4016 alone), indicating that cGMP is not involved. In
contrast, Figure 4b, hemoglobin, 10 mM, a NO scavenger, significantly,
≈50%, attenuated the anti-adhesive properties of NCX-4016, but not of aspirin, and
when added in combination with celecoxib, or Boc-1 (Figure 4c), it reversed the
anti-adhesive properties of NCX-4016 by ≈70% (n=8, P<0.01 versus NCX-4016
alone). Confirming a role for NO, DETA-NO, 100 µM, also reversed in a Hb-
dependent manner PMN/HUVEC adhesion triggered by LPS/IL-1β (Figure 4d;
n=6;P<0.01 versus LPS/IL-1β).
Exposure of HUVEC to LPS/IL-1β significantly up-regulated the
expression of CD54 and CD62E (Figure 5a; n=8; P<0.01 versus control cells). This
effect was curtailed by 100 µM NCX-4016 (n=8, P<0.01 versus LPS/IL-1β). In
contrast to NCX-4016, aspirin was effective in reducing CD54 expression, but not
CD62E (n=8; P<0.05 versus LPS/IL-1β). Data shown in Figure 5b and c,
demonstrated that celecoxib abrogates the effect of aspirin on CD54 expression
(n=8; P<0.05 versus aspirin). Once again, scavenging NO with 10 mM
hemoglobin, in the presence of celecoxib, reversed the effect of NCX-4016 on
LPS/IL-β-induced CD54 and CD62E expression by 70-80% (n=8, P<0.05 versus
NCX-4016). As shown in Figure 6a, NCX-4016, but not aspirin, reduced CD54
and CD62E mRNA up-regulation induced by LPS/IL-1β, suggesting that
modulation of CD54 and CD62E expression was, at least partially, due to the
inhibition of gene transcription.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 16
Since the involvement of NF-κB in regulating the expression of CD54 and
CD62E is well established (Roebuck, and Finnegan, 1999), we then examined
whether aspirin and NCX-4016 modulates NF-κB activation induce by LPS/IL-
1β. As shown in figure 6b, treatment of HUVEC with LPS/IL-1β alone induced the
specific NF-κB DNA binding activity of the p50-p50 homodimer and the p50-p65
heterodimer. This effect was inhibited by treating HUVEC with 100 µM NCX-
4016, while aspirin at this concentration was ineffective. We have then examined
whether the NCX-4016-induced suppression of the NF-κB binding activity cells
could be reversed by the thiol-reducing agent dithiothreitol (DTT), and, as shown
in Figure 6c, we found that incubation of the NCX-4016-treated nuclear extract with
10 mM DTT gave ≈70% recovery of DNA binding activity of the p50-p50
homodimer under the experimental conditions used (n=4; P<0.01 versus NCX-
4016 alone). In contrast, DTT has no effect on aspirin-treated cells (Figure 6c).
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 17
Discussion
ATL, a tetraene-containing eicosanoid, structurally related to LXA4, is
emerging as an endogenous braking signal for neutrophil function. Similarly to
glucocorticoids and NSAIDs it exerts potent anti-inflammatory activity with
significantly less, if any, side effects (Schottelius et al., 2002). ATLs exert
inhibitory effects on several inflammatory mechanisms, including cytokine and
chemokine generation (Gronert et al., 1998; Serrhan 2002; Serhan and Oliw,
2001), leukocyte responses to cytokines or to microbial stimulation (Gewirtz et
al., 1998; Takano et al., 1997), neutrophil and eosinophil migration, and cell
surface expression of adhesion molecules P selectin and LFA-1 (Filep et al.
1999). ATL is generated by PMN and endothelial cells in response to aspirin,
particularly after these cells have been exposed to IL-1β, TNF-α or endotoxin
(Claria & Serhan 1995; Serhan 2002, Serhan and Oliw, 2001). In this pro-
inflammatory setting, aspirin acethylates while aspirin acetylates both COX-1
and COX-2 (Patrono 1994), and COX-1 acetylation results in irreversible
inhibition, acetylation of COX-2 leads to an enzyme that performs an incomplete
reaction transforming arachidonic acid into 15R-HETE (Figure 7), which is
released and transformed via transcellular routes to form ATL by leukocytes in
close proximity (Clarià and Serhan 1995; Serhan 2002; Serhan and Oliw, 2001).
In the present study we have demonstrated that, similar to aspirin, NCX-4016
inhibits cell-to-cell adhesion and triggers the formation of ATL from human
PMN/HUVEC co-cultures. Thus, despite the fact that NCX-4016 carries an ester
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 18
substitution at its carboxylic acidic moiety, this molecule maintains the ability to
acetylate COX-2.
We have previously shown that selective COX-2 inhibitors, celecoxib
and rofecoxib, abrogate ATL synthesis (Fiorucci et al., 2003) and reverse
anti-adhesive effects of aspirin. We now demonstrated that not only celecoxib
and rofecoxib, but also naproxen, a non-selective COX-2 inhibitor, block ATL
formation confirming that selective and non-selective NSAIDs are equally
effective in inhibiting the acetylated and the non-acetylated form of COX-2
(Mancini et al., 1997). In parallel with inhibition of ATL formation, selective and
non-selective COX-2 inhibitors reduced by 60-70% the anti-adhesive activity of
aspirin, establishing a mechanistic link between ATL formation and anti-
adhesive properties of aspirin. Consistent with this view, Boc-1, a selective
LXA4 receptor antagonist (Perretti et al.,2001), also markedly attenuated the
anti-adhesive effects of aspirin.
In contrast to aspirin, COX-2 inhibition and ATL antagonism failed to
inhibit the adhesive properties of NCX-4016, suggesting that inhibition of that
COX-independent, NO-mediated, mechanisms are operational in cells exposed to
this drug. Indeed, the findings that exposure of HUVEC to NCX-4016 results in
NO formation and that anti-adhesive properties of NCX-4016 were significantly
reduced by hemoglobin, support this view (Fiorucci and Del Soldato, 2003;
Wallace et al., 2002). Anti-adhesive properties of NCX-4016 were insensitive to
L-NAME and ODQ suggesting that endogenously formed NO and cGMP were
not involved. In contrast, L-NAME partially reduced the anti-adhesive properties
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 19
of aspirin, supporting the notion that NO is released by activated endothelial cells
providing an anti-adhesive background to limit cell-to-cell adhesion. NCX-4016
contains two active moieties, i.e. an aspirin-like and an NO-releasing moiety, that
contribute to its activity (reviewed in Wallace et al., 2002) However, the
finding that Hb, reverses anti-adhesive properties of NCX-4016, while celecoxib
did not, indicates that most of the anti-adhesive effects it exerts are mediated by
its NO-releasing moiety. Although, our data support the notion that NCX-4016
causes COX-2 acetylation (as measured by ATL formation), in vitro data
indicate that the kinetic of acetylation differs from that of aspirin suggesting
that NCX-4016 requires an extensive metabolism to generate free acetyl
salicylic acid (Del Soldato, unpublished).
Similarly to NO, NCX-4016 reduces the expression of adhesion
molecules on endothelial cells (De Caterina et al., 1995; Khan et al., 1996; Kubes
et al., 1994; Spiecker et al., 1997; Zampoli et al., 2000), and downregulates the
expression of CD54 and CD62E on activated HUVEC. This effect was only
partially reversed by celecoxib, but fully inhibited by the combination of a coxib with
hemoglobin, suggesting an NO-mediated pathway. The mechanisms through
which NO regulates adhesion molecule expression has not been completely
elucidated. Experimental evidence suggest that NO may inhibit the expression of
adhesion molecules through its interaction with NF-κB (De Caterina et al., 1995;
DeLatorre et al., 1997). NF-κB is a transcription factor involved in inflammation
that regulates synthesis of cytokines, cytokine receptors, and adhesion molecules
(Barnes and Karin, 1997). NF-κB transcription is sensitive to oxidative and
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 20
nitrosative stress (Stamler et al., 1992). An oxidizing cytoplasmic environment is
typically associated with NF-κB activation, yet oxidation or nitrosation of the NF-κB
heterodimer (p50-p65) prevents DNA binding (Stamler et al., 1992; Marshall et al.,
2000). Matthews et al. have found that S-nitrosylation of the redox-sensitive
NF-κB p50 C62 residue is associated with inhibition of p50 homodimer and p50-
p65 heterodimer binding to their consensus DNA target sequence, resulting in a 4-
fold decrease in the equilibrium binding constant. We have now provided
evidence that, similar to NO, NCX-4016 inhibits NF-κB activity. At 100 µM, a
concentration that can be reached in vivo after a therapeutic dose of this
compound (Fiorucci et al., 2003b), NCX-4016 reduce p50-p65 and p50-p50
binding to DNA, suggesting that modulation of CD54 and CD62E expression could
be, at least in part, mediated by NF-κB inhibition. Inhibition of p50-p50 DNA
binding is due to S-nitrosylation, as demonstrated by the fact that removing NO by
incubation of nuclear extract with the thiol reducing agent DTT abrogates the
inhibitory effect of NCX-4016 (Fiorucci et al., 2000). Aspirin has previously been
shown to inhibit NF-κB binding to DNA (Kopp and Ghosh, 1994; Pillinger et al.,
1998) at millimor concentrations (5-10 mM). Thus the observation that NCX-
4016 inhibits NF-κB binding at micromolar concentrations adds to the concept
that NO and/or NO cooperating with ATL mediates the effect of NCX-4016 on the
transcription factor.
The expression of adhesion molecules after cytokine stimulation is
time dependent, requiring 2-4 h for CD62E and 6-8 h for ICAM-1 (De Caterina
et al., 1995). Thus, one might expect that prolonged NO release is necessary
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 21
for an effective inhibition of gene transcription for such molecules. Indeed, we
demonstrated that exposure to NCX-4016 results in a prolonged release of
NO, which generates a lost-lasting “clamp” of NO at the endothelial cell
interface.
In conclusion, this study demonstrates that NCX-4016 acetylates COX-2
and switches prostanoid metabolism from PGE2 to ATL. NCX-4016 inhibits
nuclear binding of NF-κ B and suppresses CD54 and CD62E expression on
activated HUVEC. We propose that the ability of NCX-4016 to limit endothelial
activation is due to COX-dependent and -independent, NO-mediated,
mechanisms.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 22
References
Alpin AE, Howe S, Alahari SK & Juliano RL (1998) Signal transduction and signal modulation by cell adhesion receptors: The role of integrins, cadherins, immunoglobulin-cell adhesion molecules, and selectins. Pharmacol Rev 50: 197-263 Barnes P., and Karin, M. (1997) NF-κB: a pivotal transcription factor in chronic inflammatory disease. N. Engl. J. Med. 336:1066-1071 Carlos T, & Harlan J. (1994) Leukocyte-endothelial adhesion molecules. Blood. 84:2068-2101. Chiang, N., T. Takano, C. B. Clish, N. A. Petasis, H.-H. Tai, & C. N. Serhan. (1998). Aspirin-triggered 15-epi-lipoxin A4 (ATL) generation by human leukocytes and murine peritonitis exudates: development of a specific 15-epi-LXA4 ELISA. J. Pharmacol. Exp. Ther. 287: 779-790 Clària, J., & C. N. Serhan. (1995). Aspirin triggers previously unrecognized bioactive eicosanoids by human endothelial cell-leukocyte interactions. Proc. Natl. Acad. Sci. USA 92: 9475-9479. Cotran,R.S. and Mayadas-Norton,T. (1998) Endothelial adhesion molecules in health and disease. Pathol. Biol. (Paris), 46, 164–170. De Caterina R, Libby P, Peng H-B, Thannickal VJ, Rajavashisth TB, Gimbrone MA, Jr, Shin WS and Liao JK (1995) Nitric oxide decreases cytokine-induced endothelial activation. J Clin Invest 96: 60-68 DelaTorre A, Schroeder RA and Kuo PC (1997) Alteration of NF-kappa B p50 DNA binding kinetics by S-nitrosylation. Biochem Biophys Res Commun 238: 703-706 Filep JG, Zouki C, Petasis NA, Hachicha M, & Serhan CN. (1999). Anti-inflammatory actions of lipoxin A4 stable analogs are demonstrable in human whole blood: modulation of leukocyte adhesion molecules and inhibition of neutrophil-endothelial interactions. Blood 94: 4132-4142 Fiorucci S, and Del Soldato P. (2003) NO-aspirin: mechanism of action and gastrointestinal safety. Dig Liver Dis. 35 Suppl 2:S9-19. Fiorucci S, Distrutti E, Mencarelli A, Morelli A, Laufor SA, Cirino G, and Wallace JL. (2003a) Evidence that 5-lipoxygenase and acetylated cyclooxygenase 2-derived
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 23
eicosanoids regulate leukocyte-endothelial adherence in response to aspirin. Br J Pharmacol. 139:1351-9. Fiorucci S, Mencarelli A, Meneguzzi A, Lechi A, Morelli A, del Soldato P, Minuz P. (2002a) NCX-4016 (NO-aspirin) inhibits lipopolysaccharide-induced tissue factor expression in vivo: role of nitric oxide. Circulation 106:3120-5. Fiorucci, S., Mendes De Lima, O., Mencarelli, A., Palazzetti, B., Distrutti, E., Mcknight, W., Dicay, M., Ma, L., Romano, M., Morelli, A., & Wallace, J.L. (2002b) COX-2 derived Lipoxin A4 increases gastric resistance to aspirin-induced damage. Gastroenterology 123:1598-1606. Fiorucci,S., Santucci, L., Cirino, G., Mencarelli, A., Familiari, L., Soldato, P.D., Morelli, A. (2000). IL-1 beta converting enzyme is a target for nitric oxide-releasing aspirin: new insights in the antiinflammatory mechanism of nitric oxide-releasing nonsteroidal antiinflammatory drugs. J Immunol. 165:5245-54 Fiorucci S, Santucci L, Wallace JL, Sardina M, Romano M, del Soldato P, and Morelli A. (2003b). Interaction of a selective cyclooxygenase-2 inhibitor with aspirin and NO-releasing aspirin in the human gastric mucosa. Proc Natl Acad Sci U S A. 100:10937-41. Fitzgerald Ga, & Patrono C. (2001). The coxibs, selective inhibitors of cyclooxygenase-2. N Engl J Med. 345:433-42. Gimbrone MA, Jr. (1995). Vascular endothelium in health and disease, in Molecular Cardiovascolar Medicine (Habers E ed) pp 49-61, Scientific American Medicine, New York. Gronert K, Martinsson-Niskanen T, Ravasi S, Chiang N, Serhan CN. (2001). Selectivity of recombinant human leukotriene D4, leukotriene B4, and lipoxin A4 receptors with aspirin-triggered 15-epi-LXA4 and regulation of vascular and inflammatory responses. Am J Pathol 158:3-9. Haglund RE, Rothblum LI. (1987). Isolation, fractionation and reconstitution of a nuclear extract capable of transcribing ribosomal DNA. Mol Cell Biochem. 73:11-20
Ignarro L. (1990). Biosynthesis and metabolism of endothelium-derived nitric oxide. Annu Rev Pharmacol Toxicol 30: 535-560
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 24
Khan BV, Harrison DG, Olbrych MT, Alexander RW and Medford RM. (1996). Nitric oxide regulates vascular cell adhesion molecule-1 gene expression and redox-sensitive transcriptional events in human vascular endothelial cells. Proc Natl Acad Sci USA 93: 9114-9119
Kopp E,and Ghosh S. (1994). Inhibition of NF- B by sodium salicylate and aspirin. Science 265:956-959 Kubes, P., I. Kurose, D. N. Granger. (1994). NO donors prevent integrin-induced leukocyte adhesion but not P-selectin-dependent rolling in postischemic venules. Am. J. Physiol. 267:H931 Lecomte, M., Laneuville, O., Ji, C., Dewitt, D. L., & Smith W.L. (1994). Acetylation of human prostaglandin endoperoxide synthase-2 (cyclooxygenase-2) by aspirin. J. Biol. Chem. 269: 13207-13215. Mancini, J.A., Vickers, P.J., O'neill, G.P., Boily, C., Falgueyret, J.P., & Riendeau, D. (1997). Altered sensitivity of aspirin-acetylated prostaglandin G/H synthase-2 to inhibition by nonsteroidal anti-inflammatory drugs. Mol Pharmacol. 51: 52-60. Matthews JR, Nicholson J, Jaffray E, Kelly SM, Price NC, Hay RT. (1995). Conformational changes induced by DNA binding of NF-kappa B. Nucleic Acids Res. 23:3393-402. Nicoll-Griffith DA, Yergey JA, Trimble LA, Silva JM, Li C, Chauret N, Gauthier, JY, Grimm E, Leger S, Roy P, Therien M, Wang Z, Prasit P, Zamboni R, Young RN, Brideau C, Chan CC, Mancini J, Riendeau D. (2000). Synthesis, characterization, and activity of metabolites derived from the cyclooxygenase-2 inhibitor rofecoxib (MK-0966, Vioxx). Bioorg Med Chem Lett 10:2683-6 Patrono, C. (1994). Aspirin as an antiplatelet drug. N Engl J Med 330:1287-94.
Persoons JH, Schornagel K, Tilders FF, De Vente J, Berkenbosch F, Kraal G. (1996). Alveolar macrophages autoregulate IL-1 and IL-6 production by endogenous nitric oxide. Am J Respir Cell Mol Biol. 14:272- Perretti M, Getting Sj, Solito E, Murphy Pm, & Gao Jl. (2001). Involvement of the receptor for formylated peptides in the in vivo anti-migratory actions of annexin 1 and its mimetics. Am J Pathol 158:1969–1973. Pillinger MH, Capodici C, Rosenthal P, Kheterpal N, Hanft S, Philips MR & Weissmann G. (1998). Modes of action of aspirin-like drugs: Salicylates inhibit erk activation and integrin-dependent neutrophil adhesion. Proc Natl Acad Sci USA 95:14540–14545.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 25
Roebuck,K.A. and Finnegan,A. (1999). Regulation of intercellular adhesion molecule-1 (CD54) gene expression. J. Leukoc. Biol., 66, 876–888 Schottelius AJ, Giesen C, Asadullah K, Fierro IM, Colgan SP, Bauman J, Guilford W, Perez HD, Parkinson JF. (2002) An aspirin-triggered lipoxin A4 stable analog displays a unique topical anti-inflammatory profile. J Immunol. 169: 7063-70.
Serhan C. (2002). Lipoxins and aspirin-triggered 15-epi-lipoxin biosynthesis: an update and role on anti-inflammation and pro-resolution. Prostaglandins and Other Lipid Mediators 68-69: 433-455.
Serhan, C.N., & Oliw, E. Unorthodox routes to prostanoid formation: new twists in cyclooxygenase-initiated pathways. (2001). J. Clin. Invest. 107:1481-1489 Spiecker M, Peng HB and Liao JK (1997). Inhibition of endothelial vascular cell adhesion molecule-1 expression by nitric oxide involves the induction and nuclear translocation of IkappaBalpha. J Biol Chem 272: 30969-30974 Stamler JS, Simon DI, Osborne JA, Mullins ME, Jaraki O, Michel T, Singel DJ and Loscalzo J. (1992). S-Nitrosylation of proteins with nitric oxide: Synthesis and characterization of biologically active compounds. Proc Natl Acad Sci USA 89: 444-448 Takano, T., S. Fiore, J. F. Maddox, H. R. Brady, N. A. Petasis, & C. N. Serhan. (1997). Aspirin-triggered 15-epi-lipoxin A4 (LXA4) and LXA4 stable analogues are potent inhibitors of acute inflammation: evidence for anti-inflammatory receptors. J. Exp. Med. 185: 1693-704. Zampolli, A., G. Basta, G. Lazzerini, M. Feelisch, R. De Caterina. (2000). Inhibition of endothelial cell activation by nitric oxide donors. J. Pharmacol. Exp. Ther. 295:818 Wallace JL, Ignarro LJ, Fiorucci S. (2002). Potential cardioprotective actions of no-releasing aspirin. Nat Rev Drug Discov. 1:375-82 Wallace JL, Muscara MN, McKnight W, Dicay M, Del Soldato P, Cirino G. (1999). In vivo anti-thrombotic effects of NCX-4016: a nitric oxide-releasing aspirin derivative. Thromb Res. 93: 43-50.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 26
Figure legends
Figure 1. Panel a. Structure of NCX-4016. Panel b. NCX-4016 and aspirin
causes a concentration-dependent inhibition of cell-to-cell adhesion in
PMN/HUVEC co-cultures stimulated with 10 µg/ml LPS and 10 ng/ml IL-1β for 24
hr. Data are mean ± SE of 6 experiments. * P<0.001 versus LPS/IL-1β alone.
Panel c. COX-2-derived eicosanoids are required for anti-adhesive effects of
aspirin but not for the anti-adhesive properties of NCX-4016. Exposure of
PMN/HUVEC co-cultures to 100 µM celecoxib and naproxen or 10 µM rofecoxib,
abrogates anti-adhesive activities of NCX-4016 and aspirin. Data are mean ± SE
of 6 experiments. * P<0.001 versus control; ** P<0.0001 versus LPS/IL-1β alone.
Figure 2. COX-2 inhibition blocks ATL formation in PMN/HUVEC co-cultures.
Panel a. RT-PCR analysis of COX-1 and COX-2 expression in HUVEC
exposed to LPS and IL-1β. Symbols are: “bp” base pairs; Lane 1, positive
control (i.e. COX-1 or COX-2 positive cDNA); Lane 2, negative control (water);
Lane 3, control HUVEC; and Lane 4, HUVEC treated with 10 µg/ml LPS and 10
ng/ml IL-1β for 24 hr. The RT-PCR shown is representative of three others
showing the same pattern.
Panel b. Aspirin and NCX-4016 inhibits PGE2 generation in HUVEC/PMN co-
cultures. Data are mean ± 8 experiments. * P<0.01 versus cells incubated with
medium alone;** P<0.01 versus cells incubated with LPS/IL-1β.ψ P<0.01 versus
cells incubated with aspirin (ASA) or NCX-4016.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 27
Panel c. Aspirin (ASA) and NCX-4016 trigger ATL formation in HUVEC/PMN co-
cultures. Data are mean ± 8 experiments. * P<0.01 versus cells incubated with
medium alone or LPS/IL-1β;** P<0.01 versus cells incubated with aspirin or NCX-
4016.
Panel d. Boc-1 a selective LXA4 receptor antagonist reverses the anti-adhesive
activities of aspirin (ASA) but not of NCX-4016. Data are mean ± SE of 8
experiments. *P<0.001 versus control. ** P<0.01 versus LPS/IL-1β. ψ P<0.01
versus aspirin (ASA) and NCX-4016.
Figure 3 . Exposure of HUVEC to NCX-4016 (100 µM) results in NO formation
(panel a) and increased intracellular concentrations of cGMP (panel b). Data are
mean ± SE of 8 experiments. *P<0.01 versus control. **P<0.05 versus LPS/IL-1β.
Panel c. Time course of NO formation in HUVEC exposed to 100 µM NCX-4016.
Data are mean ± SE of 8 experiments. . *P<0.01 versus baseline. **P<0.01 versus
LPS/IL-1β.
Figure 4. Panel a. L-NAME and ODQ fail to reverse inhibition of PMN/HUVEC
adhesion induced by aspirin (ASA) and NCX-4016. Data are mean ± SE of 8
experiments. *P<0.01 versus medium. **P<0.05 versus LPS/IL-1β.ψ P<0.051
versus LPS/IL-1β.
Panel b. NO scavenging with Hb (10 mM) in the presence of celecoxib (100 µM)
reverses the anti-adhesive effect of NCX-4016. Data are mean ± SE of 8
experiments. *P<0.01 versus medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05
versus aspirin (ASA) and NCX-4016.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 28
Panel c. NO scavenging with Hb (10 mM) in the presence of Boc-1 reverses the
anti-adhesive effect of NCX-4016. Data are mean ± SE of 8 experiments. *P<0.01
versus medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05 versus NCX-4016 ;
and ψψ P<0.05 versus NCX-4016 plus Boc-1.
Panel d. DETA-NO, causes a Hb-sensitive, inhibition of PMN/HUVEC adhesion
induced by LPS/IL-1β. HUVEC were incubated for 3 h with 100 µM DETA-NO
before addition of PMN. Data are mean ± SE of 5 experiments. *P<0.01 versus
medium alone. **P<0.01 versus LPS/IL-1β.ψ P<0.05 versus DETA-NO.
Figure 5. Panel a. NCX-4016 down-regulates the expression of CD54 and
CD62E on LPS/IL-1β stimulated HUVEC. Activated HUVEC were incubated for 5h
aspirin or NCX-4016 with or without Hb, while celecoxib was added 30 min before
assessment of CD54 and CD62E expression by flow cytometry. Data are mean ±
SE of 8 experiments. *P<0.01 versus medium. **P<0.01 versus LPS/IL-1β.
Panel b and c. Celecoxib and the NO scavenger Hb abrogate the effect of NCX-
4016 on CD54 and CD62E induction caused by LPS/IL-1β. Data are mean ± SE of
8 experiments. *P<0.01 versus medium. **P<0.01 versus LPS/IL-1β. ψ P<0.05
versus aspirin (ASA) and NCX-4016
Figure 6. Panel a. NCX-4016 abrogates induction of CD54 and CD62E mRNA in
HUVEC monolayer exposed to LPS/IL-1β. Symbols are: “bp” base pairs; Lane 1,
positive control (i.e. CD54 and CD62E positive cDNAs); Lane 2, negative control
(water); Lane 3, HUVEC treated with 10 µg/ml LPS and 10 ng/ml IL-1β for 24 hr.;
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. - 29
Lane 4, HUVEC treated with aspirin 100 µM; Lane 5, HUVEC treated with NCX-
4016 100 µM. The RT-PCR shown is representative of three others showing the
same pattern.
Panel b. NCX-4016 inhibits NF-κB binding to DNA. NF-κB DNA binding activity
was assayed in nuclear lysates of HUVEC after 6 h of treatment with LPS/IL-1β
alone or with aspirin (ASA) or NCX-4016 100 µM by EMSA (see Materials and
Methods). Treatment with LPS/IL-1β alone induces the specific NF-κB (p50-p50;
p50-65) DNA binding activity. This induction was partially reduced by aspirin
(ASA) but is almost completely abrogated with NCX-4016. Cells treated with
medium alone were used as control. The specificity of binding was examined by
competition with the addition of unlabeled/cold oligonucleotides, in 20X excess.
The EMSA shown is representative of three others showing the same pattern.
Lanes are: 1, LPS alone; 2, LPS plus ASA ; 3, LPS + NCX-4016; 4 control, 20 x
unlabelled/cold oligonucleotiode; 5, LPS plus anti-p50 mAb.
Panel c. DTT reverses inhibition of p50-p50 binding caused by NCX-4016. Data
are mean ± SE of 4 experiments. *P<0.01 versus medium. **P<0.01 versus
LPS/IL-1β. ψ P<0.05 versus NCX-4016.
Figure 7. Biosynthetic pathways involved in ATL formation.
This article has not been copyedited and formatted. The final version may differ from this version.JPET Fast Forward. Published on February 4, 2004 as DOI: 10.1124/jpet.103.063651
at ASPE
T Journals on February 1, 2021
jpet.aspetjournals.orgD
ownloaded from
Fiorucci et al. Figure 1
0
2000
4000
6000
8000
10000 *
****
HU
VE
C/P
MN
adh
esio
n(c
pm
)
Medium LPS/IL-1β
Alone ASA NCX4016
0
5000
10000
15000
* **
**
**
Agent aloneCelecoxibRofecoxib
Medium LPS/IL-1β
Alone ASA NCX4016
ψ ψ
ψ ψ
Naproxen
ψ
ψ
*
PM
N/
HU
VE
C a
dhes
ion
(cpm
)
O
O
O
OONO2
a
b c
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
Fiorucci et al. Figure 2
COX-2
COX-1
β-actin
Bp 1 2 3 4
0
100
200
300
400
500
600
700
800
*
**
*
Agent alone
Celecoxib
**
Medium LPS/IL-1 β
Alone ASA NCX4016
Rofecoxib
Naproxen
* *
ψ ψPG
E2
conc
entr
atio
n (p
g/m
l)
0
100
200
300
400
500
600
700
800
900
Medium LPS/IL-1 β
Alone ASA NCX4016
**
****
15R
-epi
-LX
A4
(pg/
mg)
0
2500
5000
7500
10000Agent alone Boc-1
* *
****
ψ
ψ
Medium LPS/IL-1β
Alone ASA NCX-4016
PM
N/H
UV
EC
adh
eren
ce(c
pm)
a
b
c
d
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
Fiorucci et al. Figure 3
0
4
8
12
16
20 **
NO
2/N
O3
(µM
105 H
UV
EC
)
* *
0
100
200
300
400
500
**
*
Medium LPS/IL-1β
Alone ASA NCX-4016cG
MP
con
cent
rati
on(f
M 1
06 cel
ls)
0 2 4 6 8 10 120
100
200
300
400
500
600
700
800
NCX-4016 IL-1β/LPS ASA
Time (hr)
**
*
Intr
acel
lula
r N
O(a
rbit
rary
un
it)
a
b
c
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
Fiorucci et al. Figure 4
0
5000
10000
Agent alone
Celecoxib
Celecoxib + Hb
Hb
**
**
Medium LPS/IL-1β
Alone ASA NCX-4016
**
ψ
****
ψψ
ψ
**
PM
N/H
UV
EC
adh
esio
n(c
mp)
0
5000
10000
15000 Agent alone L-NAME
Medium LPS/IL-1β
Alone ASA NCX-4016
*
**
ψψ
ψ
ODQ
ψ ψ
*
ψ
PM
N/ H
UV
EC
adh
esio
n(c
pm)
a b
0
2500
5000
7500
10000
PM
N/
HU
VE
C a
dhes
ion
(cpm
)
Medium LPS/IL-1β
Alone DETA-NO DETA-NO + Hb
*
**
ψ
d
0
2500
5000
7500
10000
Medium + + + + +LPS/IL-1β - + + + +NCX4016 - - + + +Boc-1 - - - + +Hb - - - - +
*
**
ψ
ψψ
PM
N/
HU
VE
C a
dhes
ion
(cpm
)
c
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
0
25
50
75
CD54 CD62E
*
**
0
10
20
30
40
50*
** ** **
Medium LPS/IL-1β
Alone ASA NCX-4016
CD
54
expr
essi
on(%
of p
ositi
ve H
UV
EC
) CD
62E expression
(% of positive H
UV
EC
)
0 10 20 30 40 50 60 70 80
CD54
CD62E
Control
LPS/IL-1β
Aspirin
Aspirin + celcoxib
Aspirin + Hb
Aspirin + celcoxib + Hb
ψ
ψ
**
**
**
0 10 20 30 40 50 60 70 80
Control
LPS/IL-1β
NCX-4016
NCX-4016 + celcoxib
NCX-4016 + Hb
NCX-4016 + celcoxib + Hb
CD54/CD62E expression(% of positive HUVEC)
**
****
ψψ
ψψ
ψψ
a
b
c
Fiorucci et al. Figure 5
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
Bp 1 2 3 4 5
Fiorucci et al. Figure 6
p50/p65
p50/p50
ba
0
250
500
750
1000
Alone DTT 20 mM
Medium LPS/IL-1β
Alone ASA NCX-4016
**
**
ψ
P50
/p50
bin
ding
(OD
)
c
CD54
CD62
β-actin
1 2 3 4 5
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from
COOH
11 15
13
Arachidonic Acid
Cyclooxygenase
ASPIRIN or NCX-4016
PGH Synthase 15-R oxygenation
X
Prostaglandins
Aspirin-Triggered Lipoxin15-epi-LXA415-epi-LXA4
COX-1COX-1 COX-2COX-2
MembraneLipid Storage
Lipoxygenases
Lipoxins,Leukotrienes
1513
SH HR
1513
SH HR
Lipoxygenases
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
JPET
Fast Forward. Published on February 4, 2004 as D
OI: 10.1124/jpet.103.063651
at ASPET Journals on February 1, 2021 jpet.aspetjournals.org Downloaded from