Upload
lenard-lawson
View
223
Download
0
Tags:
Embed Size (px)
Citation preview
Control of Prokaryotic (Bacterial) Genes
Gene Control Many biotech techniques make use of
existing mechanisms for controlling gene expression Gene expression = “gene activity,” the
process by which information from a gene is used to synthesize a protein
All genes are not being expressed at all times
Discussion Consider bacterial genes for metabolic
enzymes… Under what circumstances would the
prokaryote want those genes turned OFF? Why?
Under what circumstances would the prokaryote want those genes turned ON? Why?
Remember Regulating Metabolism? Feedback inhibition
product acts as an allosteric inhibitor of 1st enzyme in tryptophan pathway
but this is wasteful production of enzymes
= inhibition-
-Oh, I
remember thisfrom our
Metabolism Unit!
Different way to Regulate Metabolism Gene regulation
instead of blocking enzyme function, block transcription of genes for all enzymes in tryptophan pathway saves energy by
not wasting it on unnecessary protein synthesis
= inhibition-
--
Gene regulation in bacteria Cells vary amount of specific enzymes
by regulating gene transcription turn genes on or turn genes off
turn genes OFF exampleif bacterium has enough tryptophan then it doesn’t need to make enzymes used to build tryptophan
turn genes ON example if bacterium encounters new sugar (energy source), like lactose, then it needs to start making enzymes used to digest lactose
STOP
GO
Gene Regulation Regulatory sequence: a sequence of DNA that interacts
with regulatory proteins to control transcription of other genes
Regulatory gene: DNA encoding a regulatory protein or RNA
Bacteria group genes together Operon
genes grouped together with related functions, controlled by a single regulatory sequence example: all enzymes in a metabolic pathway
promoter = RNA polymerase binding site single promoter controls transcription of all genes in operon transcribed as one unit & a single mRNA is made
operator = DNA binding site of repressor protein structural genes = genes to be expressed
So how can these genes be turned off? Repressor protein
binds to DNA at operator site blocking RNA polymerase blocks transcription
Effector molecule Binds to repressor, changes its affinity for DNA binding site
operatorpromoter
Operon model
DNATATA
RNApolymerase
repressor
repressor = repressor protein
Operon: operator, promoter & genes they control
serve as a model for gene regulation
gene1 gene2 gene3 gene4RNA
polymerase
Repressor protein turns off gene by blocking RNA polymerase binding site.
1 2 3 4mRNA
enzyme1 enzyme2 enzyme3 enzyme4
mRNA
enzyme1 enzyme2 enzyme3 enzyme4
operatorpromoter
Trp operon
DNATATA
RNApolymerase
tryptophan
repressor repressor protein
repressortryptophan – repressor proteincomplex
Synthesis pathway modelWhen excess tryptophan is present, it binds to trp repressor protein & triggers repressor to bind to DNA
repressor without trp effector, inactive. With trp, active.
blocks (represses) transcription
gene1 gene2 gene3 gene4
conformational change in repressor protein!
1 2 3 4
repressortrpRNA
polymerase
trp
trp
trp trp
trp trp
trptrp
trp
trp
trp
Tryptophan operonWhat happens when tryptophan is present?Don’t need to make tryptophan-building enzymes
Tryptophan is allosteric regulator of repressor protein
http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio26.swf::The%20Tryptophan%20Repressor
mRNA
enzyme1 enzyme2 enzyme3 enzyme4
operatorpromoter
Lac operon
DNATATARNA
polymerase
repressor repressor protein
repressorlactose – repressor proteincomplex
lactose
lac repressor gene1 gene2 gene3 gene4
Digestive pathway model When lactose is present, binds to lac repressor protein & triggers repressor to release DNA
repressor without lac effector, active. With lac, inactive.
induces transcription
RNApolymerase
1 2 3 4
lac lac
laclac
lac
lac
lac
conformational change in repressor protein!
lac
lac
http://highered.mcgraw-hill.com/sites/dl/free/0072835125/126997/animation27.html
Lactose operon(notice, the lacI gene for the repressor protein precedes the promoter, handy!)
But wait!What if there’s lactose AND glucose present?Glucose is a much better energy source… do
we still want to bother breaking down lactose?
Lactose operonLac promoter has TWO binding sites
One for RNA polymeraseLac repressor protein can bind to operator and inhibit that
One for CAP, catabolite activating protein, before the promoter. RNA polymerase doesn’t bind well to this gene without CAP there.
Lactose operon As glucose concentration increases in a cell, the
concentration of cAMP, or cyclic AMP, decreases (+glucose=-cAMP)
When cAMP binds to CAP, it has the correct conformation to bind to DNA So, when glucose is low, the cAMP-CAP complex is
bound to DNA, and RNA polymerase can attach When glucose is high, cAMP doesn’t bind to CAP,
CAP doesn’t bind to DNA, and neither does RNA polymerase
Lactose operon
In order for the structural genes to be transcribed, the cAMP-CAP complex must be bound to the CAP binding site, AND the repressor protein must not be bound to the operator
http://www.youtube.com/watch?v=2sMFswbOgKk
Operon Regulation Operons can be regulated by positive or negative
means… Positive control: Regulatory proteins bind to DNA and
stimulate expression. Negative control: Regulatory proteins bind to DNA to
inhibit expression.
…and can be inducible or repressible. Inducible: “Off by default.” The effector (inducer) interacts
with regulatory proteins or DNA and turns expression on. Repressible: “On by default.” The effector (repressor)
interacts with regulatory proteins or DNA turns expression off.
Discussion The lac operon is termed negative
inducible. Why?
The trp operon is termed negative repressible. Why?
Discussion Example: In a positive repressible operon,
activator proteins are normally bound to the DNA and actually provide a binding site for RNA Polymerase. It’s therefore positive: the controlling protein stimulates expression.
An inhibitor can bind to the activator protein, change its conformation, and prevent it from binding to RNA polymerase. It’s therefore repressible: it’s normally on, and the molecule turned gene expression off.
That’s positive repressible. How might a positive inducible operon work?
Operon function Repressible operon
usually functions in anabolic pathways synthesizing end products
when end product is present in excess,cell allocates resources to other uses
Inducible operon usually functions in catabolic pathways,
digesting nutrients to simpler molecules
produce enzymes only when nutrient is available cell avoids making proteins that have nothing to do, cell allocates
resources to other uses
And some genes are continuously expressed (always turned on).
e.g. the genes that code for ribosomal complexes
Discussion Before we leave operons behind (for the
moment), look at their big picture. Knowing what attaches where is not the most important part, it’s only a prerequisite to this: WHY does the trp operon function as it does?
How is it advantageous? What is its adaptive significance?
WHY does the lac operon function as it does? How is it advantageous? What is its adaptive significance?
Control of Eukaryotic Genes
Eukaryotic Control The control of gene expression in
eukaryotes is complex! Involves regulatory genes, regulatory
proteins, transcription factors, and more!
Can occur at any step in the pathway from gene to functional protein:
1. packing/unpacking DNA
2. transcription
3. mRNA processing
4. mRNA transport
5. translation
6. protein processing
7. protein degradation
How do you fit all that DNA into nucleus?
DNA coiling & folding double helix nucleosomes chromatin fiber looped domains chromosome
from DNA double helix to condensed chromosome
1. DNA packing
Nucleosomes “Beads on a string”
1st level of DNA packing histone proteins
8 protein molecules positively charged amino acids bind tightly to negatively charged DNA
DNA packing movie
8 histone molecules
DNA packing as gene control Degree of packing of DNA regulates transcription
tightly wrapped around histones no transcription genes turned off
heterochromatindarker DNA (H) = tightly packed
euchromatinlighter DNA (E) = loosely packed
H E
Histone acetylation Acetylation of histones unwinds DNA
loosely wrapped around histones enables transcription genes turned on
attachment of acetyl groups (–COCH3) to histones conformational change in histone proteins transcription factors have easier access to genes
2. Transcription initiation transcription factors = proteins that bind to
DNA to regulate transcription Some are activators, increase expression Others are repressors, decrease expression
Actual rate of expression Depends on combination
of transcription factors
2. Transcription initiation Example control regions on DNA
Promoter sequence nearby control sequence on DNA binding of RNA polymerase & transcription
factors “base” rate of transcription
Enhancer sequence distant control
sequences on DNA binding of activator
proteins “enhanced” rate (high level)
of transcription
Transcription complex
Enhancer
ActivatorActivator
Activator
Coactivator
RNA polymerase II
A
B F E
HTFIID
Core promoterand initiation complex
Activator Proteins• regulatory proteins bind to DNA at
distant enhancer sites• increase the rate of transcription
Coding region
T A T A
Enhancer Sitesregulatory sites on DNA distant from gene
Initiation Complex at Promoter Site binding site of RNA polymerase
Discussion That’s how an activator binds to a
promoter or enhancer to increase expression… How could it work that I could attach a
repressor or “silencer” protein to those same sequences to decrease expression?
http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120080/bio28.swf::Transcription%20Complex%20and%20Enhancers
3. Post-transcriptional control Alternative RNA splicing
variable processing of exons creates a family of proteins
RNA interference Small interfering RNAs (siRNA)
short segments of RNA (21-28 bases) bind to mRNA create sections of double-stranded mRNA “death” tag for mRNA
triggers degradation of mRNA
cause gene “silencing” post-transcriptional control turns off gene = no protein produced
NEW!
siRNA
Action of siRNA
siRNA
double-stranded miRNA + siRNA
mRNA degradedfunctionally turns gene off
Hot…Hotnew topicin biology
mRNA for translation
breakdownenzyme(RISC)
dicerenzyme
5. Control of translation Block initiation of translation stage
regulatory proteins attach to 5' end of mRNA prevent attachment of ribosomal subunits &
initiator tRNA block translation of mRNA to protein
6-7. Protein processing & degradation Protein processing
folding, cleaving, adding sugar groups, targeting for transport
Protein degradation
initiation of transcription
1
mRNA splicing
2
mRNA protection3
initiation of translation
6
mRNAprocessing
5
Of turning genotypic diversity into even greater phenotypic diversity!
7 protein processing & degradation
4
4
Many methods
Discussion Work together with someone else, get a
blank piece of paper, and: Summarize the most important take-
home message or messages about control of gene expression... using only pictures and no text. (They don’t have to be pictures of DNA/RNA/etc itself!)
AP Biology 2007-2008
Biotechnology
AP Biology
A Brave New World
AP Biology
TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACT
human genome3.2 billion bases
AP Biology
Biotechnology today Genetic Engineering
manipulation of DNA if you are going to engineer DNA &
genes & organisms, then you need a set of tools to work with
this unit is a survey of those tools…
Our tool kit…
AP Biology
Bacteria Bacteria review
one-celled prokaryotes reproduce by mitosis
binary fission rapid growth
generation every ~20 minutes 108 (100 million) colony overnight!
dominant form of life on Earth incredibly diverse
AP Biology
Bacterial genome Single circular chromosome
haploid naked DNA
no histone proteins ~4 million base pairs
~4300 genes 1/1000 DNA in eukaryote
How have theselittle guys gotten to
be so diverse??
AP Biology
Genetic Diversity Living things, eukaryotes and prokaryotes,
have a variety of ways of mixing up genetic information “horizontally” Transduction: Viral transmission of genetic
material Transposition: Movement of DNA segments
within and between DNA molecules And prokaryotes have unique methods
Conjugation: Cell-to-cell transfer of genetic material And…
AP Biology
Transformation Bacteria are opportunists
pick up naked foreign DNA wherever it may be hanging out have surface transport proteins that are
specialized for the uptake of naked DNA import bits of chromosomes from
other bacteria incorporate the DNA bits into their
own chromosome express new genes transformation form of recombination
mix heat-killed pathogenic & non-pathogenicbacteria
mice die
AP Biology
Plasmids Small supplemental circles of DNA
5000 - 20,000 base pairs self-replicating
carry extra genes 2-30 genes genes for antibiotic resistance
can be exchanged between bacteria Conjugation: “bacterial sex” rapid evolution
can be imported from environment transformation
AP Biology
How can plasmids help us? A way to get genes into bacteria easily
insert new gene into plasmid = vector insert plasmid into bacteria bacteria now expresses new gene
bacteria make new protein
+
transformedbacteriagene from
other organism
plasmid
cut DNA
recombinantplasmid
vector
glue DNA
AP Biology
Biotechnology Plasmids used to insert new genes into bacteria
gene we want
cut DNA
cut plasmid DNA
insert “gene we want” into plasmid...
“glue” together
ligase
like what?…insulin…HGH…lactase
recombinant plasmid
AP Biology
How do we cut DNA? Restriction enzymes
restriction endonucleases
evolved in bacteria to cut up foreign DNA “restrict” the action of the attacking organism protection against viruses
& other bacteriabacteria protect their own DNA by methylation &
by not using the base sequences recognized by the enzymes in their own DNA
AP Biology
How do restriction enzymes work? Take a normal piece of paper. Tear/cut it into 3 long segments (tear from top to
bottom) On each segment, write a random stream of DNA
bases and their complementary base pairs.
When you’re done, help me lay them all out end to end and tape them together so we have a nice long chromosome to demonstrate this with!
AP Biology
What do you notice about these phrases?
radarracecarMadam I’m AdamAble was I ere I saw Elbaa man, a plan, a canal, PanamaWas it a bar or a bat I saw?go hang a salami I’m a lasagna hog
palindromes
AP Biology
Restriction enzymes Action of enzyme
cut DNA at specific sequences restriction site
symmetrical “palindrome” produces protruding ends
sticky ends will bind to any complementary DNA
Many different enzymes named after organism they are found in
EcoRI (GAATTC, E. coli), HindIII (AAGCTT, Hemophilus influenzae), BamHI (GGATCC, Bacillus amyloli)…
Madam I’m Adam
CTGAATTCCGGACTTAAGGC
CTG|AATTCCGGACTTAA|GGC
AP Biology
Restriction enzymes Cut DNA at specific sites
leave “sticky ends”
GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA
GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA
restriction enzyme cut site
restriction enzyme cut site
AP Biology
Sticky ends Cut other DNA with same enzymes
leave “sticky ends” on both can glue DNA together at “sticky ends”
GTAACG AATTCACGCTTCATTGCTTAA GTGCGAA
gene you want
GGACCTG AATTCCGGATACCTGGACTTAA GGCCTAT
chromosome want to add
gene to
GGACCTG AATTCACGCTTCCTGGACTTAA GTGCGAA
combinedDNA
AP Biology
Sticky ends help glue genes together
TTGTAACGAATTCTACGAATGGTTACATCGCCGAATTCACGCTTAACATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGTGCGAA
gene you want cut sitescut sites
AATGGTTACTTGTAACG AATTCTACGATCGCCGATTCAACGCTTTTACCAATGAACATTGCTTAA GATGCTAGCGGCTAAGTTGCGAA
chromosome want to add gene tocut sites
AATTCTACGAATGGTTACATCGCCG GATGCTTACCAATGTAGCGGCTTAA isolated gene
sticky ends
chromosome with new gene addedTAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
sticky ends stick together
DNA ligase joins the strands Recombinant DNA molecule
http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120078/bio37.swf::Restriction%20Endonucleases
AP Biology
Demo Suppose we add this sequence:
…o a solution containing these enzymes (whose restriction sites are): EcoRI (5’ G|AATTC 3’) HindIII (5’ A|AGCTT 3’) BamHI (5’ G|GATCC 3’)
How many pieces of DNA would I have?
5’ ATCGGTTAAGCTTGGGCAACGGATCCGAGATCATCGT 3’
AP Biology
Why mix genes together?
TAACGAATTCTACGAATGGTTACATCGCCGAATTCTACGATC
CATTGCTTAAGATGCTTACCAATGTAGCGGCTTAAGATGCTAGC
Gene produces same protein in different organism or different individual
aa aaaa aa aa aa aa aa aa aa
“new” protein from organism ex: human insulin from bacteria
human insulin gene in bacteria
bacteria human insulin
How can bacteria read human DNA?
AP Biology
The code is universal Since all living
organisms… use the same DNA use the same code
book read their genes
the same way
AP Biology
Copy (& Read) DNA Transformation
insert recombinant plasmid into bacteria
grow recombinant bacteria in agar cultures bacteria make lots of copies of plasmid “cloning” the plasmid
production of many copies of inserted gene!
production of “new” protein transformed phenotype
DNA RNA protein trait
AP Biology
Grow bacteria…make more
growbacteria
harvest (purify)protein
transformedbacteria
plasmid
gene fromother organism
+
recombinantplasmid
vector
http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter14/animation_quiz_2.html
AP Biology
Discussion But suppose I want to move a gene
from a bacterium into a multicellular eukaryote… I can inject a plasmid directly, but that’s
tedious and not highly effective Think back to the last unit… how could
VIRUSES be used to accomplish this purpose?
AP Biology
Uses of genetic engineering Genetically modified organisms (GMO)
enabling plants to produce new proteins Protect crops from insects: BT corn
corn produces a bacterial toxin that kills corn borer (caterpillar pest of corn)
Extend growing season: fishberries strawberries with an anti-freezing gene from
flounder
Improve quality of food: golden rice rice producing vitamin A
improves nutritional value
AP Biology
Green with envy??Jelly fish “GFP”
Transformed vertebrates
AP Biology
Cut, Paste, Copy, Find… Word processing metaphor…
cut restriction enzymes
paste ligase
copy plasmids
bacterial transformation is there an easier way??
find ????