Immunology Today, vol. 8, No. 1, 1987

Control of messenger RNA stability Gene expression can be controlled at many levels. Changes in the rate of transcription of a gene, the rate of nuclear processing of the transcript (capping, termina- tion, polyadenylation and splicing) and the rate of trans- port of the processed transc,ipt from the nucleus to the cytoplasm can contribute to changes in the levels of a particular mRNA. Once the message has reached the cytoplasm, the rate of production of the protein that it encodes can also be regulated. The message may be sequestered away from the ribosomes so that it is not translated. The efficiency with which it is translated can vary, and finally, the rate at which the message is degraded can be controlled. In recent years, most effort in molecular biology has focused on the sequences that control transcription, splicing and polyadenylation, and considerable progress has been made in identifying these sequences. The control of mRN.A stability has received less attention, but Shaw and Kamen 1 have begun to identify sequences which appear to confer instability upon an mRNA molecule under certain physiological circumstances.

The starting point for this work 'was the observation by Shaw and Kamen 1 and Caput eta/ . 2 that AT-rich se- uences were common in the 3' non-coding regions of mRNA encoding certain lymphokines, cytokines and oncogenes. In particular, the AT-rich regions were more highly conserved than the coding regions between

Department of Molecular Biology, Immunex Corporation, Seattle, Washington 98101, USA

David Cosman mouse and human granulocyte-macrophage colony stimulating factor (GM-CSF) (Ref. 1) and mouse and human tumor necrosis factor (TNF) (Ref. 2). Shaw and Kamen then found that GM-CSF mRNA in a lectin- stimulated human T-cell line was very unstable (t,,~ <30 min) and hypothesized that the instability might be due to the AT-rich sequence. They tested this hypothesis directly by synthesizing the 51 base pair (bp) AT-rich sequence and inserting it into the 3' non-coding region of a gene known to give rise to a very stable transcript, namely rabbit 13-globin. As a control, they synthesized another sequence of the same length, in which they interspersed 14 G and C residues, and inserted this olJgonucleotide into the same site in the rabbit 13-globin gene. The two constructs (globin-AT and globin-GC) with the globin genes in appropriate expression vectors, were transfected into several cell lines to assay the steady state levels and stabilities of the transcripts. In transient assays, measuring RNA 30 h after transfection, and in stably transformed cell lines, the steady state level of globin-AT RNA was only about 3% of globin-GC RNA (or wild l.ype globin RNA). The authors then went on to show that th!s difference was not due to different rates of transcription but rather to decreased stability of the globin-AT RNA. The addition of the AT rich sequence had rendered the normally stable globin mRNA as unstable as natural GM-CSF mRNA (t,,~ <30 min), whereas the

Table 1. AT-rich sequences found in the 3' non-coding regions of some genes encoding cytokines or proto-oncogenes

Gene Ref. AT-rich sequence

Hu GM-CSF 5 Mu GM-CSF 6 Hu G-CSF 7 Mu IL-3 8 Rat IL-3 9 Hu IL-2 10 Mu IL-2 11 Bo IL-2 12 Hu IL-1{3 13 Hu IL-I~ 14 Mu IL-I~ 15 Rab IL-lc~ 16 Hu BSF-1 17 Mu BSF-1 18 Hu TNF 19 Mu TNF 20 Hu LT 19 Hu IFNq, 21 Mu IFN--y 22 Bo IFN-,,/ 23 Hu c-fos 24 Hu c-myc 25 Hu c-sis 26 Mu c-myb 27

TAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTAA TTTATTTATATATTTATATTTTTTAAATATTATTTATTTATTTATTTATTT TATTTATCTCTCTATTTAATATTTATG CTATTT'AA TA~TTTATGTAT~TGTATTTATTTATTTATT TA--TTTATGTATTTATGTATTTATTTA I]TATTA TATTTATTTAAATATTTAAATTTTATATTTATT TATTTATTTAAATATTTAACTTTAATTTATTTTT TATTTATTTAAATATTTAAAATTTATATTTATTTTTT TATTTATTTATTTATTTGTTTGTTTGTTTTGATTTCATTG GTCTAATTTATTCAAA TTATTTTTTAATTATTATTTATATATGTATTTATAAATATATTTAAGATAATTATAATAT TTATTTTTAAGTTATTTTATATATGTATTTATAAATATATTTATGATAATTATATTATTTAT ATTATTTATATGTATGTATTTATAAAGTATTTAAGATAATAATTATTATATTTATA TATTTTAATTTATG A GTTTTTG ATAG CTTTATTTTTTAA G TATTTATATATTTATAA AATTTTTAATG GTTTTATTTTTAATATTTATATATTTATAATT TTATTTATTATTTATTTATTATT rATTTATTTA TTATTATTTATTATTTATTTATTATTTATTTATTT AAAAAAATTAAATTATTTATTTAT TATTTATTAATATTTAACATTATTTATAT TATTTATTAATATTTAAAACTATTTATAT TATTTATTAATATTTAATATTTTACATTATTTATAT TTTTTAATTTArTTATTAAGATG GATTCTCAGATATTTATATTTTTATTTTATTTTTTT TAATTTTTTTTATTTAAGTACATTTTG CTITTTAAAGTTGATTTTTTTCTATTGTTTTTA TTTCCTTTTATTTTTTAAATGTAAAATTTATTTATATTTCGTATTTAAA ATTTTTTAAAAAAAATAAAATGATTTATTTGTATTTTA

16

GM-CSF (granulocyte-macrophage colony-stimulating factor), G-CSF (granulocyte colony stimulating factor), IL (interleukin), BSF (B-cell stimulating factor), TNF (tumor necrosis factor), LT (lymphotoxin), IFN (interferon), Hu (human), Mu (mouse), Bo (bovine), Rab (rabbit). The consensus sequence ATTTA is indicated.

l ( ~ 1987 . [ I~ev,( ,r ~ [ l ( , [ l ( { , PH[~h!,h[,I., [~ V . A ~1~,|( , ( i , l f l t 0167 , 1919 /87 /$02 O0

Immunology Today, vol. 8, No. I, 1987

control GC-containing oligonucleotide had not altered the stability of the globin mRNA.

Although GM-CSF mRNA in lectin-stimulated T cells is unstable, Shaw and Kamen found that in the same T cells, stimulated instead with the pl~orbol ester TPA, the GM-CSF mRNA was more stable. This suggested that the RNA degradation pathway could be modulated by a system involving protein kinase C, the main target of phorbol esters. Further insight into the control of RNA stability mediated by the AT-rich sequence came from the authors' demonstration that the protein synthesis inhibitor, cycloheximide, could stabilize the globin-AT mRNA. This suggests that either the mRNA must be actively translated to be degraded, or that degradation of the mRNA is under control of an unstable protein whose synthesis is inhibited by cycloheximide.

How general is this phenomenon of control of mRNA stability by AT-rich sequences? Shaw and Kamen 1 and Caput et al. 2 have listed some of the mRNAs containing the sequence motifs ATFIA or TTATr-I-AT. Some of these, together with others, are listed in Table 1. Caput et al. have pointed out that this type of sequence motif occurs many more times than would be expected oy chance, and it is striking that most of the genes containing it are cytokine genes or proto-oncogenes which have in com- mon the fact that they are transiently expressed in response to different biological stimu!i. Direct evidence for function of these sequences in stability of mRNA has only been demonstrated for GM-CSF; however, good indirect evidence exists for their function in control of expression of the proto-oncogene, c-fos. Firstly, deletion of a 67 bp region from the 3' non-coding region of c-los that contains the AT-rich consensus sequences converts the normally non-transforming gene into a transforming gene 3. It remains to be proven that this effect is due to an increase in c-fos mRNA stability. Secondly, when a wild type c-fos gene is transfected into 3T3 cells, a low U I I I U M I I I . U l I I I l & l ~ l l " ~ l 1.1 I . / I U U U ~ I ~ U . I U I I U V : I I I ~ ~.ll~'l g i l l . . . 1 L l l l l U I O -

tion of the cells the c-fos mRNA is transiently induced. When 3' sequences from c-fos are removed, the basal level of c-fos mRNA is higher, and the mRNA produced after serum stimulation is more stable 4. Although the precise sequences mediating this effect have not been mapped, the same AT-rich motif seems a likely candi- date.

Undoubtedly these findings of Shaw and Kamen 1 will provoke much study of the functions of the AT-rich regions in some of the genes listed in Table 1. It should be possible to define a minimal consensus sequence that retains the ability to destabilize an mRNA, to determine whether the mRNA suffers an endonucleolytic cut within the AT-rich region or is degraded in some other manner, aqd perhaps to demonstrate a sequence-specific RNA b~nding protein that may or may not itself be a ribonuc- lease. It will be important to understand the relative contributions of changes in transcription versus changes in mRNA stability in mediating the transient induction of these cytokines and products of proto-oncogenes.

References 1 Shaw, G. and Kamen, R. (1986) Ce1146, 659 2 Caput, D, Beutler, B., Hartog, K. etal. (1986) Proc. Natl Acad. 5ci. USA 83, 1670 3 Meijlink, F., Curran, T., Miller, A.D etal. (1985) Proc. Natl Acad. Sci. USA 82, 4987

4 Treisman, R. (1985) Ce1142, 889 5 Wong, G.G., Witek, J.S. Temple, P.A. eta/. (1985)Science 228, 810 6 Gough, NM., Gough, J., Metcalf, D. etal. (1984)Nature (London) 309, 763 7 Nagata, S., Tsuchinya, M., Asano, S. etal. (1986)Nature (London) 319, 415 8 Miyatake, S., Yokota, T., Lee, F. eta/. (1985) Proc. NatlAcad. Sci. USA 82, 316 g Cohen, D.R., Hapel, A.J. and Young, I.G. (1986) Nucleic Acids Res. 14, 3641 10 Tanigushi, T., Matsui, H., Fujita, T. etal. (1983)Nature (London) 302,305 11 Kashima, N., Nishi-Takaoka, C., Fujita, T. eta/. (1985)Nature (London) 312,402 12 Cerretti, D.P., McKereghan, K., Larsen, A. eta/. (1986)Proc. Natl Acad. Sci. USA 83, 3223 13 Auron, P.E., Webb, AC., Rosenwasser, LJ. eta/. (1984) Proc. Natl Acad. Sci. USA 81,7907 14 March, C.J., Mosley, B., Larsen, A. et al. (1985)Nature (London) 215, 641 15 Lomedico, P.T., Gubler, V., Hellman, C.P. etal. (1984) Nature (London) 312,458 16 Furutani, Y., Notake, M., Yamayoshi, M. etal. (1985) Nudeic Acids Res. 13, 5869 11 Yokota, T., Otsuka, T., Mossman, T. etal. (1986)Proc. Natl Acad. Sci. USA 83, 5894 18 Lee, F., Yokota, T., Otsuka, T. etal. (1986) Proc. NatlAcad. Sci. USA 83, 2061 19 Nedwin, G.E., Naylor, S.L., Sakaguchi, A.Y. etal. (1985) Nucleic Acids Res. 13, 6361 20 Fransei I, L., Muller, R., Marmenout, A. eta/. (1985)Nucleic Acids Res. 13,4417 21 Gray, P.W., Leung, D.W., Pennica, D. etal. (1982)Nature (London) 295, 503 22 Gray, P.W. and Goeddel, D.V. (1983) Proc. NatlAcad. Sci. USA 80, 5842 23 Cerretti, D.P., McKereghan, K., Larsen, A. etal. (198~,) J. ImmunoL 136, 4561 24 van Straaten, F., Muller, R., Curran, T. etal. (1983) Proc. Natl Acad. Sci. USA 80, 3183 25 Battey, J., Moulding, C., Taub, R. eta/. (1983) Ceii34, 779 26 Ratner, L., Josephs, S.F., Jarett, R. etal. (1985) Nucleic Acids Res. 13, 5007 27 Gonda, T.J., Gough, N.M., Dunn, A.R. etal. (1985) EMBOJ. 4, 2003

Reprints We can supply reprints of any article

appearing in Immunology Today at very reasonable rates.

Please apply for details to Production Manager,

Elsevier Publications Cambridge, 68 Hills Road, Cambridge CB2 1LA, UK.

(Minimum order 100)