doi:10.1006/jmbi.2000.3571 available online at http://www.idealibrary.com on J. Mol. Biol. (2000) 297, 309±319

Constructing High Complexity Synthetic Libraries ofLong ORFs Using In Vitro Selection

Glen Cho, Anthony D. Keefe, Rihe Liu, David S. Wilsonand Jack W. Szostak*

Howard Hughes MedicalInstitute, Department ofMolecular BiologyMassachusetts GeneralHospital, Boston, MA02114, USA

G.C., A.D.K., R.L., D.S.W. contriequally.

Present address: D. S. Wilson, ZyWay, Hayward, CA 94545, USA.

Abbreviations used: ORF, open rPCR, reverse transcription polymerpolar residue; N, non-polar residueglycerol phosphate synthase.

0022-2836/00/020309±11 $35.00/0

We present a method that can signi®cantly increase the complexity ofprotein libraries used for in vitro or in vivo protein selection experiments.Protein libraries are often encoded by chemically synthesized DNA, inwhich part of the open reading frame is randomized. There are, however,major obstacles associated with the chemical synthesis of long openreading frames, especially those containing random segments. Insertionsand deletions that occur during chemical synthesis cause frameshifts, andstop codons in the random region will cause premature termination.These problems can together greatly reduce the number of full-lengthsynthetic genes in the library. We describe a strategy in which smallersegments of the synthetic open reading frame are selected in vitro usingmRNA display for the absence of frameshifts and stop codons. Thesesmaller segments are then ligated together to form combinatorial librariesof long uninterrupted open reading frames. This process can increase thenumber of full-length open reading frames in libraries by up to twoorders of magnitude, resulting in protein libraries with complexities ofgreater than 1013. We have used this methodology to generate threetypes of displayed protein library: a completely random sequence library,a library of concatemerized oligopeptide cassettes with a propensity forforming amphipathic a-helical or b-strand structures, and a library basedon one of the most common enzymatic scaffolds, the a/b (TIM)barrel.

# 2000 Academic Press

Keywords: in vitro selection; mRNA display; mRNA-protein fusions;synthetic library; TIM barrel

*Corresponding author

Introduction

In vitro selection and directed evolution arepowerful tools for discovering new functionalmolecules. Rare molecules can be isolated fromlarge libraries of random and semi-randomsequences through iterative cycles of selection andampli®cation (Szostak, 1992; Wilson & Szostak,1999). Recent advances have made it possible toperform in vitro selection experiments on protein

buted to this paper

omyx, 3911 Trust

eading frame; RT-ase chain reaction; P,; IGPS, indole-3-

libraries (Roberts & Ja, 1999). Unlike nucleic acids,proteins cannot be ampli®ed directly. This problemhas been addressed by expressing protein librarieson the surface of phage or microorganisms, andeven using stalled ribosomes (Boder & Wittrup,1997; Forrer et al., 1999; Georgiou et al., 1997;Hanes & Pluckthun, 1997; Mattheakis et al., 1994;Smith & Petrenko, 1997). Recently our laboratoryhas developed a technique that links phenotypeand genotype in vitro through the covalent attach-ment of proteins to their own mRNAs (Roberts &Szostak, 1997), a process that we call mRNAdisplay. This technique allows a much largersampling of random sequences (>1013) than hasbeen previously possible.

Here, we describe a method for the design andsynthesis of large synthetic DNA libraries codingfor protein sequences suitable for use in selectionexperiments. The entire length of the DNA library

# 2000 Academic Press

310 High Complexity Synthetic Libraries of Long ORFs

is derived from degenerate DNA oligonucleotides.There are, however, a number of problems associ-ated with creating long synthetic protein librariesof high complexity. Deletions that occur due toimperfect coupling and capping ef®ciencies duringsolid phase DNA synthesis will cause frameshifts(Hecker & Rill, 1998). Another problem is that stopcodons that are encoded within the randomizedregion will cause premature termination. The pro-portion of ``correct'' or intended sequences in thelibrary will be reduced signi®cant]y if these pro-blems are not addressed. For a typical deletion rateof 0.5 % per coupling, only 22 % of a syntheticlibrary that encodes 100 amino acids will be com-pletely in frame. Stop codons within randomregions will further decrease this number depend-ing on the distribution of codons used. Forexample, only 0.8 % of sequences will not havestop codons for a library encoding 100 amino acidresidues in which each codon position has anequal mixture of each nucleotide. The use of appro-priate ratios of nucleotides in the three positions ofthe codon can reduce the occurrence of stopcodons, but this severely alters the density withwhich different regions of sequence space aresampled.

To address these problems, we have chosen thefollowing general strategy: (1) synthesize thelibrary in small cassettes; (2) perform an in vitroselection that enriches for sequences lacking stopcodons and frameshifts; (3) assemble the ®nallibrary through restriction and ligation of theselected cassettes. Essentially, we perform anin vitro selection using the mRNA display technol-ogy to enrich for sequences that code for intactopen reading frames. This method will selectivelyenrich the library in sequences that lack insertions,deletions and stop codons. We refer to this pro-cedure as ``pre-selection''.

We have used this method to create three differ-ent types of random libraries. The ®rst type oflibrary has all amino acid positions randomizedwith the exception of constant regions containingaf®nity tags at both ends of the sequence. Thesecond is a ``patterned'' library made up of seg-ments that have a propensity for forming amphi-pathic a-helices and b-strands. A third type oflibrary has been created in which random aminoacid residues are displayed in the context of aknown protein fold. Each of these libraries will beuseful in studying speci®c questions in proteinevolution.

Results

General strategy

DNA oligonucleotides corresponding to seg-ments of the designed library are synthesized andampli®ed by PCR. These templates are then ampli-®ed such that ¯anking af®nity tags (FLAG (Chiang& Roeder, 1993) and His6 (Porath et al., 1975)) are

encoded at the 50 and 30 ends. When translated,these tags correspond to the N and C termini ofthe expressed polypeptide (Figure 1). The pre-selection is then performed as follows: RNA is gen-erated from the DNA library and then modi®ed atthe 30 end to add a short DNA segment that isterminated with puromycin. Translation of theseconstructs in vitro results in the formation of acovalent bond between the RNA and the protein itencodes; this produces a protein displayed uponits mRNA (Roberts & Szostak, 1997). These mRNAdisplayed proteins are then successively puri®edon the basis of each of the af®nity tags. We foundit bene®cial to include the N-terminal puri®cationtag because we had observed internal initiationevents. The translation reaction in which themRNA displayed proteins are made will contain aheterogeneous mix of species (Figure 1). Themajority of the RNA will not display protein. Somesequences have an intact open reading frame(ORF) and contain both N and C-terminal tags.Some contain deletions and go out of frame andlack the C-terminal tag. Internally initiated tran-scripts lack the N-terminal tag. After puri®cationon Ni-NTA and anti-FLAG resins, those sequenceswith both tags and thus a contiguous ORF will beenriched. The RNA component of the displayedproteins can then be ampli®ed using reverse tran-scription and polymerase chain reaction (RT-PCR)to generate double-stranded DNA segments thatcan be cut and ligated together to form the com-plete library. Naturally, the number of uniquesequences in each segment is decreased after pre-selection, but the ligation of these pieces will regen-erate a high complexity ®nal library through thecombinatorial assembly of different cassettes.

Random library

Presumably the ®rst proteins arose from pools ofrandom sequences. The density of functional oreven folded molecules in protein sequence space isnot known. To address these issues, we con-structed a random library in which every positionhas an equal probability of encoding each aminoacid. This random library (R4) was constructedusing a novel strategy. A single cassette (R) wassynthesized that encoded 20 contiguous randomamino acids ¯anked by FLAG and His6 tags. Anucleotide distribution (Table 1) encoding anamino acid composition (Table 2) resembling thatof contemporary proteins was arrived at by usingan iterative computer program (Michael New, per-sonal communication), but similar programs areavailable on the internet, for example, at http://gaiberg.wi.mit.edu/cgi-bin/CombinatorialCodons(Wolf & Kim, 1999). This program adjusts the ninevariables that de®ne the proportions of each of thefour nucleotides at each of the three positions inthe codon in an attempt to match a desired aminoacid composition of the resultant protein library.Because the selection step removes sequences con-

Figure 1. The pre-selection. A heterogeneous mixture of mRNA display templates, some of which display protein,are present in the pre-selection translation mixture immediately before af®nity puri®cation. (a) An mRNA displaytemplate terminating in puromycin with the parts of the open reading frame coding for the two protein af®nity tagsindicated. The 50 end of this template contains the tobacco mosaic virus translation enhancer sequence (TMV) fol-lowed by the initiating methionine codon (AUG). (b) An mRNA display template displaying a full-length protein freeof frameshifts and stop codons with both protein af®nity tags present. (c) An mRNA display template that hasinitiated internally and displays the corresponding truncated protein lacking the N-terminal FLAG tag. (d) AnmRNA display template with a deletion in its open reading frame, displaying the corresponding frameshifted proteinlacking the C-terminal His6 tag. (e) The only one of the constructs described above that is enriched by the pre-selection process, the mRNA display template displaying a full-length protein free of frame shifts with both proteinaf®nity tags present, that corresponds to (b) above; this is ampli®ed using RT-PCR as indicated. (f) The double-stranded DNA cassette that results from the ampli®cation of the pre-selected mRNA display templates with thelocation of the type IIS restriction enzyme sites indicated.

High Complexity Synthetic Libraries of Long ORFs 311

taining stop codons from the library, it is notnecessary to minimize the occurrence of stopcodons by adjusting the nucleotide mix.

The random region is ¯anked by two differenttype IIS restriction sites, BbsI and BbvI. Theseenzymes cut outside of their recognition sequences(Figure 2). The position of the recognitionsequences with respect to the cut sites wasarranged so that the recognition sequences andany other auxiliary sequences such as the af®nitytags are excised. The constructs were also designedso that both enzymes created the same four nucleo-tide non-palindromic overhang. We were able to

avoid completely ®xed amino acid residues at theligation junction because the four base overhangsymmetrically spans two codons. The ®rst of thesecodons speci®es a mixture of Asp, His, Tyr, andAsn residues, and the second a mixture of Cys andTrp residues. These codons were chosen for the lig-ation junctions to increase the representation ofamino acid residues that were under-representedin the random sequence and could be importantfor chemical catalysis. Pre-selection was performed,as described below, upon these constructs anddouble-stranded DNA was generated from theselected material.

Table 1. Percentage of each nucleotide at each position of the designed codons

Library Codon position % T % C % A % G

Random 1 20 18 35 272 29 17 33 213 22 29 0 49

Patterneda-P 1 0 8 49 43

2 4.6 26 51 183 0 31 0 69

a-N 1 58 17 16 8.92 89 11 0 03 0 31 0 69

b-P 1 34 0 47 192 0 33 45 223 0 60 0 40

b-N 1 21 18 32 292 100 0 0 03 0 51 0 49

g 1 12 22 30 362 32 16 32 203 0 72 0 28

Structure-based 1 14 18 32 362 20 23 35 223 35 32 0.61 33

The values shown were determined by sequencing individual cloned cassettes, except in the case of the random library, in whichcase cassettes were sequenced in the context of the full-length library. These frequencies closely matched the intended ratios (seehttp://xanadu.mgh.harvard.edu/szostakweb/orf.html internet table for details). For the number of codons sequenced to determinethese percentages, refer to Table 2.

312 High Complexity Synthetic Libraries of Long ORFs

The random region of the R cassette encodes 20amino acid residues, and the ®nal R4 library wasassembled from four cassettes to give a randomregion 80 amino acid residues long and ¯anked by

Table 2. Percentage of each amino acid encoded by the des

Amino acidRandomlibrary

a-Cassettepolara

a-Cassettenon-polara

b-Caspola

Ala 4.1 11 0.98 6.Arg 6.8 7.6 0 4.Asn 7.5 7.7 0 14Asp 5.5 6.8 0 5.Cys 4.6 0 0 4.Gln 2.6 2.8 0 0Glu 4.0 15 0 3.Gly 5.3 7.8 0 4.His 3.8 1.3 0 0Ile 4.8 0.70 4.4 0Leu 7.4 0.37 51 0Lys 5.1 17 0 9.Met 4.5 1.6 9.9 0Phe 2.8 0 16 0Pro 2.8 2.1 1.9 0Ser 6.6 2.8 6.3 18Thr 5.4 13 1.8 17Trp 4.4 0 0 3.Tyr 5.0 0 0 9.Val 7.1 2.0 7.9 0Codonssequenced 1200 395 316 40

The values shown were determined by sequencing individual clcase cassettes were sequenced in the context of the full-length libra

a For individual cassettes, the contribution of positions at the brithe full-length libraries (random and patterned).

b For the structure-based library, only the degenerate residues w

FLAG and His6 tags. The assembly proceeded bydividing the double-stranded DNA library intotwo aliquots, one of which was cut with BbsI andthe other with BbvI. The puri®ed fragments were

igned codons

settera

b-Cassettenon-polara g-Cassettea

Patternedlibrary

Structure-based libraryb

8 0 5.8 4.3 8.72 0 6.1 3.0 5.9

0 6.9 5.2 7.94 0 8.3 8.8 7.87 0 1.7 4.4 1.8

0 2.0 0.8 1.86 0 3.2 4.1 5.24 0 7.2 3.1 8.2

0 5.1 3.8 4.116 6.9 4.1 4.128 8.1 14 6.1

0 0 2.7 5.5 5.015 2.7 4.7 2.111 2.8 4.6 1.70 3.5 1.1 4.00 6.2 5.9 9.30 4.8 6.7 5.9

1 0 0.67 6.5 1.18 0 2.8 2.5 3.5

29 12 7.5 5.8

0 320 315 2134 657

oned cassettes, except in the case of the random library, in whichry.dging restriction sites is omitted; this contribution is included for

ere considered.

Figure 2. Assembly of the full-length library from theDNA cassettes that result from the ampli®cation of thepre-selected mRNA display templates. The cassettes aredivided into two aliquots that are restricted with eitherBbvI or BbsI; subsequent ligation with T4 DNA ligasegives a new cassette in which the DNA between therestriction sites doubles in length while the ¯ankingregions remain the same. The doubling of the length ofthis region may be repeated any number of times byrepeating the restriction and ligation process.

High Complexity Synthetic Libraries of Long ORFs 313

then ligated together with T4 DNA ligase. Repeat-ing this procedure yielded the ®nal library(Figure 2). The diversity of the pre-selected cassettewas 4 � 1012 sequences. This value represents thenumber of mRNA display template cassettes thatwere recovered from the pre-selection, andassumes that each cassette is unique. This assump-tion is justi®ed because the complexity of themRNA display templates (3 � 1014) is much largerthan the number of mRNA displayed proteinsrecovered from the pre-selection (4 � 1012). Afterligating the four cassettes together, the diversity ofthe library was combinatorially increased to4 � 1014, assuming that each full-length librarymember results from the ligation of different com-binations of cassettes. After the ®nal ligation, thelibrary was ampli®ed by PCR, which increases thecopy number but does not affect the diversity orcomplexity of the library.

After pre-selection, 60 % of the ®nal librarysequences are completely free of deletions, inser-tions and stop codons (Table 3). Removing stopcodons and frameshifts increased the proportion of``desired'' molecules in the library by a factor of

approximately 50. Had the library been assembledfrom the cassettes without pre-selection, then theproportion that would have been completely freeof deletions and stop codons would have beenapproximately 1 %, with a concomitant reductionin diversity. The random library can be used togenerate mRNA display templates that display theproteins they encode when translated in vitro(Figure 3).

Patterned library

Only a small fraction of random polypeptidesequences would be expected to fold into unique,globular structures typical of natural proteins. Forthis reason, we also constructed a second library inwhich polar (P) and non-polar (N) residues werepatterned so as to form peptide stretches capableof forming amphipathic secondary structureelements. Our intention was that this patterningwould increase the fraction of library moleculescapable of forming a well-de®ned hydrophobiccore (Kamtekar et al., 1993).

The design was approached by ®rst makingthree cassettes encoding 11 amino acid residues,each displaying a particular pattern of polar andnon-polar residues. Cassette a (``a-helix'') encodessequences with the pattern NNPPNPPNNPP. Thenucleotide distributions (Table 1) of the codonswere designed so that several different amino acidresidues could be encoded at each position, whilerespecting the P/N distinction (see Table 2 andMaterials and Methods for details). A sequencewith this P/N pattern can form an a-helix in whichall the non-polar residues lie on one face(Eisenberg et al., 1984). Cassette b (``b-strand'')encodes a sequence with the patternNPNPNPNPNPP. This peptide pattern can form b-strands with all of the non-polar residues on oneside. The periodicity of polar and non-polar resi-dues in a linear sequence has been shown to besuf®cient to promote folding into a-helices and b-strands (Xiong et al., 1995). Cassette g encodes arandom amino acid sequence (Table 2), similar tothat described for the R cassette above without anydesigned P/N pattern. The goal was then to ligateeight cassettes so as to generate a library of poly-peptides with a random ordering of amphipathica-helices and b-strands, as well as some unpat-terned peptide units.

Each of these cassettes has the same constant¯anking regions, which are similar to thosedescribed for the R cassette. The same restrictionsites, BbsI and BbvI, allowed for a strategy similarto that described above. Each cassette was dividedinto two aliquots, one being restricted with BbsIand the other with BbvI. These six fragments werethen mixed together and ligated, as above, so as togive cassette-dimers of the nine possible combi-nations (aa, ab, ag, ba, bb, bg, ga, gb, and gg).These cassette-dimers were then treated exactly aswere the R cassette for making the R4 library(Figure 2). After two successive ligations, the ®nal

Table 3. Proportions of synthetic DNA cassettes with various kinds of imperfections, both before and after the pre-selection process was applied

Before pre-selection After pre-selection

LibraryWithout

frameshifts

Fraction of libraryWithout stop

codons PerfectWithout

frameshifts

Fraction of libraryWithout stop

codons Perfect

Enrichment factorin perfectfull-length

libraries

R 0.81 (16) 0.41 0.34 0.96 (96) 0.92 0.88Random (R4) 0.013 0.60 47

a 1.00 (16) 1.00 1.00b 0.92 (60) 0.59 0.54 0.96 (28) 0.93 0.90g 1.00 (15) 0.95 0.94

Patterned 0.10 0.65 6.5AB 0.32 (22) 0.69 0.16 0.92 (14) 1.00 0.71a

CD 0.79 (14) 0.64 0.51 1.00 (17) 1.00 1.00EF 0.47 (17) 0.69 0.33 0.94 (18) 1.00 0.94GH 0.49 (36) 0.62 0.30 1.00 (15) 1.00 0.54b

IJ 0.63 (11) 0.87 0.55 1.00 (16) 1.00 1.00Structure-based 0.0043 0.36 84

The values shown were determined by sequencing individual cloned cassettes, except in the case of the random library, in whichcase cassettes were sequenced in the context of the full-length library. Columns 2-4 correspond to the unselected cassettes: column 2shows the fraction of cassettes without frameshifts (deletions and insertions); column 3 shows the fraction of cassettes without stopcodons; and column 4 shows the fraction of cassettes without either frameshifts or stop codons, and the same for the full lengthDNA library members that would have resulted were they to have been assembled without the bene®t of the pre-selection process.Columns 5-7 correspond to the cassettes that were selected by the pre-selection process and are exactly analogous to columns 2-4. Inthe case of the full-length libraries, these numbers are extrapolated from the fraction of perfect cassettes within sequenced full-lengthlibrary members. Column 8 shows the factor by which the proportion of library members completely free of frameshifts and stopcodons has been multiplied by the use of the pre-selection process. This factor is equal to the factor by which the initial librarydiversity is multiplied in a selection using one of these libraries as compared to the same library constructed without the use of thismethod. The numbers in parentheses are the numbers of cassettes sequenced in the derivation of these data.

a Of the sequenced clones, 92 % were free of frameshifts (deletions or insertions) and stop codons: however, only 71 % were alsofree of three, six or nine-base deletions and these sequences were not considered perfect.

b This number is aberrantly low due to a technical error, see the experimental protocol for the structure-based library.

314 High Complexity Synthetic Libraries of Long ORFs

library consisted of eight consecutive cassettes. Thenumber of possible combinations of a, b and gunits is 6561. The actual complexity of the libraryis much higher because each cassette is itself alibrary of sequences. The number of unique full-length library sequences after the ®nal ligation was2.4 � 1014. The composition of the library withrespect to the cassettes was 44 % a, 45 % b and11 % g.

Three measures were taken to reduce the num-ber of library molecules that were either out offrame or contained in-frame stop codons. First, asmall amount of each library was puri®ed by high-resolution denaturing PAGE. After this gel puri®-cation, the deletion rate per nucleotide was only0.2 %. Second, the codons in the a and g librarieswere designed such that in-frame stop codonsoccurred at zero and 1 %, respectively. Nearly allof the sequenced a and g cassettes were completelyfree from both frameshifts and in-frame stopcodons. Third, the pre-selection technique, men-tioned above, was performed on the b cassette,since no attempt was made in this case to reducethe frequency of in-frame stop codons. The pre-selection decreased the fraction of defective cas-sette b fragments from 45 % to 10 % (Table 3). Sincethe b fragment was incorporated into the library at44 % on average, this increased the number of com-pletely in-frame molecules without stop codonsfrom 10 % to 65 %. The patterned library can beused to generate mRNA display templates that dis-

play the protein they encode when translatedin vitro (Figure 3).

Structure-based library

A third library was constructed in which ran-dom amino acid positions were placed in the con-text of a known protein fold. We chose indole-3-glycerol phosphate synthase (IGPS) (Tutino et al.,1993) from the hyperthermophilic archaeon Sulfolo-bus solfatiricus to serve as the structural model forbuilding this library. The IGPS is part of the trypto-phan biosynthesis pathway and has the canonicala/b barrel, or TIM barrel fold (Creighton &Yanofsky, 1966). It is highly stable to thermal andchaotropic denaturation (Andreotti et al., 1997).The structure has been solved to 2.0 AÊ and the pro-tein is active as a monomer (Hennig et al., 1995;Knochel et al., 1996). We have created a library inwhich 49 random residues have been inserted inplace of the eight structurally constrained loopsthat connect the b-sheets and a-helices at one endof the barrel (Figure 4). The random sequences willbe presented from eight different structuralpositions, enabling the proteins to form large cav-ities or interaction surfaces.

The complete library was assembled from ®veseparate cassettes (AB, CD, EF, GH, and IJ) thatcorrespond to different regions in the gene. Eachcassette was produced by the mutually primedextension of two oligonucleotides. The oligonucleo-

R4

Figure 3. The mRNA displayed proteins of the assembled libraries. In vitro translated samples labeled with [35S]-methionine were analyzed by SDS-PAGE (6 % or 8 %) and exposed to a phosphorimager plate. Linker refers to ashort oligo(dA) stretch that is terminated by puromycin at the 30 end. For each of the libraries, the ®rst lane showsthe translation product of the unmodi®ed mRNA template. The second lane shows the translation product of themRNA template modi®ed at the 30 end with puromycin (the mRNA display template). Lane 3 shows the elution frac-tion from an oligo(dT) puri®cation performed on the sample shown in lane 2. Lane 4 shows the same oligo(dT)-puri-®ed sample subsequently treated with RNase A.

High Complexity Synthetic Libraries of Long ORFs 315

tides have constant sequences that correspond tothe amino acids specifying the b-strands or a-helices of the scaffold and random sequences thatcorrespond to the loops. These cassettes were thenampli®ed to add the T7 promoter at the 50 end anda His6 tag at the 30 end. Each cassette was selectedfor the absence of deletions and stop codons usingthe pre-selection technique described above. Theenzyme Deep Vent polymerase (NEB) was usedfor PCR ampli®cation to reduce the frequency ofmutations introduced into the cassettes subsequentto pre-selection. The design at the C-terminal His6

tag included two out-of-frame stop codons, thatterminate translation for sequences that are not inthe correct frame. The results of the pre-selectionare summarized in Table 3. After pre-selection andsubsequent RT-PCR ampli®cation, FokI and BanIwere used in generating asymmetric ligation junc-tions. AB, GH, and IJ were cut with FokI; CD andEF were cut with both FokI and BanI to generatecomplementary sticky ends. The ligation junctionswere designed so that the overhangs will onlybe complementary between intended adjacentcassettes to generate the complete library in whichthe cassettes are arranged AB-CD-EF-GH-IJ.

The random region was designed so that theamino acid distribution would re¯ect the distri-bution normally found in the loops of a/b barrelfamily members. A structural alignment for all ofthe known enzymes with a/b barrel folds from theFSSP database was used to obtain the frequency ofthe various amino acids in the loops (Holm &

Sander, 1994). An appropriate nucleotide mixturewas calculated as described above. The probabilityof a stop codon occurring within the randomregion was initially 3.6 %, (20 out of 555 codons)per position before selection as determined bysequencing the random regions of each of the cas-settes. This would have resulted in only 16 % ofthe sequences in the ®nal library having no stopcodons. However, after pre-selection, sequencingrevealed no stop codons were encountered in therandom region (out of 657 codons sequenced).Overall, the pre-selection increased the diversityapproximately 80-fold due to the reduction inframeshifts and stop codons. For the ®nal library,36 % of the members are calculated to be comple-tely intact. If we had attempted to generate thelibrary without pre-selecting for ORFs, then theproportion of intact sequences would be 0.43 %.The ®nal library is 849 nucleotides in length andcodes for 269 amino acid residues, 49 of which arein random loops (Figure 4). The diversity of thelibrary is 1.2 � 1014 different sequences. The struc-ture-based library can be used to generate mRNAdisplay templates that display the protein theyencode when translated in vitro (Figure 3).

Discussion

We would like to compare the frequency anddistribution of functional molecules within each ofthe three different libraries. How many successfulmolecules will emerge from each library if the

Figure 4. Secondary structurerepresentation of the structure-based library. The red regionscorrespond to the loops at therandomized end of the barrel.Degenerate positions within thesequence are denoted by X.The ®rst 25 residues of the wild-type indole-3-glycerol phosphatesynthase, which correspond toa-helix 0 in the wild-type sequence,were not included in the construc-tion of the library and af®nitytags were added at the N andC termini.

316 High Complexity Synthetic Libraries of Long ORFs

same target is used for selection? Also, will therebe a difference in the range of activities of thesesuccessful molecules with respect to the libraryfrom which they were derived? If we perform aselection for speci®c binding to a small moleculetarget, then active proteins presumably will haveto specify in their sequence: (1) regions of second-ary structure, (2) a hydrophobic core, and (3) anappropriate arrangement of residues at the bindingsite. It is not known how frequently these proper-ties occur in sequence space. The patterned librarywill have a predisposition for forming secondarystructural units, and thus less additional infor-mation may be required to form a functional pro-tein than in the case of the totally random library.The a/b barrel library, which has the highest pro-portion of ®xed residues of the three libraries, willneed to additionally specify only the correct activesite or binding site residues, and thus functionalmolecules may be even more abundant comparedwith the other two libraries.

The selection for ORFs described in this studycan also be used to create other types of proteinlibraries, and for increasing the complexity oflibraries used in other types of selections such asphage display and ribosome display. For example,if the diversity in a phage display experiment islimited to 108 and only 1 % of the sequences is inthe correct frame and has no stop codons, theneffectively only 106 correct sequences will besampled. However, if a library has been pre-selected for ORFs, then the complexity can beincreased to approach the experimental limit. Itshould be noted that the pre-selection protocolitself could be performed using phage display.

Another possible application of this technique isto select ORFs from genomic libraries. Randomgenomic DNA clones could be modi®ed so as topossess tags at their 50 and 30 ends and then pre-selected for the absence of stop codons. Sequencesselected by such an approach will be enriched infragments of ORFs. These sequences could then be

used for selections or could be sequenced to give adatabase enriched in ORFs.

Materials and Methods

Construction of the random library

Exact nucleotide mixtures and all oligonucleotidesequences for the three libraries can be downloadedfrom http://xanadu.mgh.harvard.edu/szostakweb/orf.html Further information on library construction is alsopresent on this site. Oligonucleotides were ordered fromthe Keck Oligo Facility at Yale University. The randomcassette was synthesized on a DNA synthesizer usingstandard phosphoramidite chemistry. The synthesizedDNA encoded 72 random nucleotides that comprised 18consecutive random codons (XYZ) with the distributionof bases shown in Table 1. These random codons were¯anked by constant sequence that, after nested PCR,gave the whole cassette as follows: phage T7 RNA poly-merase promoter, tobacco mosaic virus translationenhancer sequence (Sleat et al., 1987), initiating methio-nine (start of ORF), FLAG tag, BbsI site, random regionBvsI site, His6 tag, ¯exible linker (MGMSGS), (TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACAATGGACTACAAAGACGACGACGATAAGAAGACTYACTGZ(XYZ)18YACTGGTCAGCGAGCTGC-CATCATCATCATCATCATATGGGAATGTCTGGATCT). The RNA was produced from the cassette with T7RNA polymerase and mRNA displayed proteins weremade as previously described (Liu et al., 2000). A 10 mltranslation yielded 6 � 1013 mRNA displayed proteins.The translation mixture was then diluted tenfold intooligo(dT)-cellulose binding buffer (1 M KCl, 100 mMTris(hydroxymethyl) amino methane, 0.25 % w/v TritonX-100 (pH 8.0)) and this mixture was incubated with2 mg/ml oligo(dT)-cellulose (Pharmacia, Piscataway, NJ)for 15 minutes at 4 �C with rotation. The oligo(dT)-cellu-lose was washed on a chromatography column (Bio-Rad,Hercules, CA) with the oligo(dT)-cellulose binding bufferand then eluted with deionized water. We did notobserve problems with insolubility of the mRNA dis-played protein fragments, either with this or the otherlibraries, presumably due to the low concentration of themRNA displayed proteins during the operations, andfrom the solubilizing effect of the nucleic acid portion.

High Complexity Synthetic Libraries of Long ORFs 317

The eluate was mixed with 2� Ni-NTA binding buffer(1� is 6 M guanidinium chloride, 0.5 M NaCl, 100 mMsodium phosphate, 10 mM Tris(hydroxymethyl)aminomethane, 10 mM 2-mercaptoethanol, 0.25 % Triton X-100(pH 8.0)) and then incubated with Ni-NTA agarose (Qia-gen, Valencia, CA) for one hour at 4 �C with rotation.The Ni-NTA agarose was then washed with Ni-NTA®rst wash buffer (8 M urea, 0.5 M NaCl, 100 mMsodium phosphate, 10 mM Tris(hydroxymethyl)aminomethane, 10 mM 2-mercaptoethanol, 0.25 % Triton X-100(pH 6.3)) and then with a gradient of increasing amountsof Ni-NTA second wash buffer (0.5 M NaCl, 10 mMTris(hydroxymethyl)amino methane, 10 mM 2-mercap-toethanol, 0.25 % Triton X-100 (pH 8.0)), and then waseluted with Ni-NTA elution buffer (0.25 M imidazole,0.5 M NaCl, 10 mM Tris(hydroxymethyl)amino methane,10 mM 2-mercaptoethanol, 0.25 % Triton X-100 (pH 8.0))for one hour at 4 �C with rotation. EDTA was added tothe eluate to give 5 mM.

The buffer was exchanged into FLAG binding buffer(150 mM NaCl, 50 mM Hepes, 0.25 % Triton X-100(pH 8.3)) on a gel ®ltration column (Pharmacia, Piscat-away, NJ), and the solution was then incubated withFLAG M2 agarose (Sigma, St Louis, MO) for one hour at4 �C with rotation. The mRNA displayed proteins werethen eluted with the same buffer containing ®ve molarequivalents of FLAG elution peptide (Sigma, St. Louis,MO) to the FLAG M2 agarose for one hour at 4 �C withrotation.

The volume of the eluate was reduced by lyophiliza-tion and the buffer was exchanged to RT buffer (50 mMTris(hydroxymethyl)amino methane, 75 mM KCl, 3 mMMgCl2 (pH 8.3)) on a gel ®ltration column (Pharmacia,Piscataway, NJ). The mRNA displayed proteins werethen reverse transcribed with Superscript II (Gibco BRL,Rockville, MD) to give a cDNA library of 4 � 1012 differ-ent members, which were then ampli®ed using PCR. Theresulting dsDNA was gel puri®ed using native PAGE in1 � TBE with an additional 50 mM NaCl and split intotwo equal parts that were restricted with either BbsI orBbvI. The resulting fragments were puri®ed using nativePAGE and the larger of the resulting fragments was col-lected and ligated together using phage T4 DNA ligaseand the product was again puri®ed using native PAGE.Repeating the restriction and ligation upon the resultingproduct yielded the ®nal library with four contiguousrandom regions, each derived from a different combi-nation of cassettes. This ®nal library was then translatedin a 10 ml reaction to give 7 � 1013 unique mRNA dis-played proteins.

Construction of the patterned library

Three different cassettes were synthesized, each ofwhich contains a random sequence region ¯anked byconstant elements similar to those described for the Rcassette, except for the absence of the FLAG tagsequence. The only differences between the a, b and gcassettes are in the random regions. Cassette a, whichencodes peptides with P/N periodicity consistent withamphipathic a-helix formation, has the following codonsequence in its random region: 12332332234, where oneencodes a mixture of Cys and Trp, two encodes a mix-ture of non-polar residues, three encodes a mixture ofpolar residues, and 4 encodes a mixture of Asn, Asp, Hisand Tyr. Therefore, the sequence of the entire cassette is:50TTCTAATACGACTCACTATAGGGACAATTACTATTTACAATTACAATGGACGAGAAGACCCACTG(29 ran-

dom nucleotides)ACTGGTCTGGCGGCTGCCACCATCACCACCATCACAGCAGCGCC. The codon seq-uence of the b cassette is: 15656565654, where 5 and 6encode mixtures of polar and non-polar amino acid resi-dues, respectively. The codon sequence of the g cassetteis: 17777777774, where 7 encodes a mixture of all 20amino acid residues. Each cassette was initially syn-thesized as a 69 nucleotide long oligonucleotide (encod-ing the random regions and some ¯anking constantsequence), and the full-length, double-stranded cassettewas then generated by PCR with primers that added theremaining sequence.

The pre-selection was performed on the b cassetteusing the same protocol as described for cassette R, withthe following exceptions: after binding the displayedpeptides to the Ni-NTA agarose, the column waswashed with Ni-NTA binding buffer and then elutedwith the same buffer with 100 mM imidazole (pH 8).The imidazole was then removed by gel ®ltration andthe Ni-NTA puri®cation was repeated a second time.The imidazole was again removed by gel ®ltration andthe RT step was performed as described above. Thenumber of displayed proteins synthesized in this proto-col was 4 � 1012 and the number of output moleculeswas 1.2 � 1011. The FLAG puri®cation was also omitted.The a and g cassettes were not pre-selected, as they hada low incidence of frameshift errors (since their relativelysmall size, 69 nucleotides, allowed for ef®cient removalof shorter products on denaturing PAGE) and stopcodons (due to codon design).

Each of the three cassettes was ampli®ed by PCR, gel-puri®ed using native PAGE, and separated into twoequal aliquots for separate restriction by either BbsI orBbvI, as described for cassette R. The six fragments werethen gel puri®ed (native PAGE), mixed together andligated. The resulting cassette-dimers were then treatedexactly as was the R cassette, such that after two moresuccessive cutting and ligation cycles, each library mol-ecule contained eight cassettes. The ratio of the cassettesin the ®nal product was a:b:g � 44:45:11. This ®nallibrary was then translated in a 10 ml reaction to give1.2 � 1014 unique mRNA displayed proteins.

Construction of the structure-based library

Each segment (AB, CD, EF, GH, and IJ) was madethrough a mutually primed extension of 1 � 1014 mol-ecules using Deep Vent polymerase (New England Bio-labs, Beverly, MA). The codons that correspond to theregions that will remain constant were optimized fortranslation in rabbit reticulocyte lysate (Wada et al.,1992). These segments were then ampli®ed with theirrespective primers with auxiliary segments such that theT7 promoter and TMV translational enhancer directlyprecedes the initiating ATG, and a His6 tag sequence isadded at the 30 end (the FLAG epitope was encoded inthe 50 extending oligonucleotide). RNA was producedfrom these libraries and translation of the modi®ed con-structs yielded approximately 1013 mRNA displayed pro-teins in 1.5 ml in vitro translation reactions for eachcassette as described above.

The pre-selection was performed as described for theR cassette of the random library with these exceptions:8 M urea was used in place of 6 M guanidinium chlorideduring the Ni-NTA agarose puri®cation. Two successiveNi-NTA puri®cations were performed by removing theimidazole by gel ®ltration as described for the patternedlibrary. After precipitation of the Ni-NTA eluate, the

318 High Complexity Synthetic Libraries of Long ORFs

mRNA displayed proteins were reverse transcribed andthe FLAG puri®cation was performed as described forthe R cassette. The ®nal yield for each cassette wasaround 10 % of the starting amount of mRNA displayedproteins giving a diversity of molecules ranging from1 � 1011 to 3 � 1012.

The cDNA from the FLAG eluate was then PCRampli®ed using Deep Vent polymerase to generate>1014 molecules. Cassettes AB, GH, and IJ were cutwith FokI (New England Biolabs, Beverly, MA); cas-settes CD and EF were cut with FokI and BanI (NewEngland Biolabs, Beverly, MA) in a double digestionto produce asymmetric ligation junctions. The frag-ments were puri®ed and ligated as described above togive a ®nal complexity of 1.2 � 1014. This ®nal librarywas then translated in a 10 ml reaction to generateapproximately 1.3 � 1013 unique mRNA displayed pro-teins before puri®cation.

One of the cassettes (GH) was anomalous in thatthe proportion of intact sequences did not seem toincrease dramatically upon selection for ORFs (Table 3).Upon careful examination, it appears that one of theprimers used to amplify library GH had an extranucleotide. This unfortunate error caused the selectionto enrich those sequences that had a one base deletionto compensate for the one base insertion in order toremain in frame. The results from sequencing showthat the deletions occur within a short window ofsequence that is ¯anked by two out-of-frame stopcodons. Fortunately, the region is separated by theFokI cleavage site so half of the deletions were cutaway and half were retained in the coding region.This had the effect of reducing the overall librarycomplexity of the structure-based library twofold.

Acknowledgments

The authors thank the members of the Szostak Labora-tory, in particular Jonathan Davis, Jack Pollard andJonathan Urbach, for helpful suggestions and PamelaSvec for assistance with cloning and sequencing. Theauthors thank Michael New of the NASA AmesResearch Center for the amino acid composition iterationcode. We acknowledge the Cancer Research Fund of theDamon Runyon-Walter Winchell Foundation, HoechstAG, the NASA Astrobiology Institute and the NIH forgrant support.

References

Andreotti, G., Cubellis, M. V., Palo, M. D., Fessas, D.,Sannia, G. & Marino, G. (1997). Stability of a ther-mophilic TIM-barrel enzyme: indole-3-glycerolphosphate synthase from the thermophilic archaeonSulfolobus solfataricus. Biochem. J. 323, 259-264.

Boder, E. T. & Wittrup, K. D. (1997). Yeast surface dis-play for screening combinatorial polypeptidelibraries. Nature Biotechnol. 15, 553-557.

Chiang, C. M. & Roeder, R. G. (1993). Expression andpuri®cation of general transcription factors byFLAG epitope-tagging and peptide elution. Pept.Res. 6, 62-64.

Creighton, T. E. & Yanofsky, C. (1966). Indole-3-glycerolphosphate synthetase of Escherichia coli, an enzymeof the tryptophan operon. J. Biol. Chem. 241, 4616-4624.

Eisenberg, D., Weiss, R. M. & Terwilliger, T. C. (1984).The hydrophobic moment detects periodicity inprotein hydrophobicity. Proc. Natl Acad. Sci. USA,81, 140-144.

Forrer, P., Jung, S. & Pluckthun, A. (1999). Beyondbinding: using phage display to select for structure,folding and enzymatic activity in proteins. Curr.Opin. Struct. Biol. 9, 514-520.

Georgiou, G., Stathopoulos, C., Daugherty, P. S., Nayak,A. R., Iverson, B. L. & Curtiss, R., III (1997). Displayof heterologous proteins on the surface of micro-organisms: from the screening of combinatoriallibraries to live recombinant vaccines. Nature Bio-technol. 15, 29-34.

Hanes, J. & Pluckthun, A. (1997). In vitro selection andevolution of functional proteins by using ribosomedisplay. Proc. Natl Acad. Sci. USA, 94, 4937-4942.

Hecker, K. H. & Rill, R. L. (1998). Error analysis ofchemically synthesized polynucleotides. Biotechni-ques, 24, 256-260.

Hennig, M., Darimont, B., Sterner, R., Kirschner, K. &Jansonius, J. N. (1995). 2.0 AÊ structure of indole-3-glycerol phosphate synthase from the hyperthermo-phile Sulfolobus solfataricus: possible determinants ofprotein stability. Structure, 3, 1295-1306.

Holm, L. & Sander, C. (1994). The FSSP database ofstructurally aligned protein fold families. Nucl.Acids Res. 22, 3600.

Kamtekar, S., Schiffer, J. M., Xiong, H., Babik, J. M. &Hecht, M. H. (1993). Protein design by binary pat-terning of polar and non-polar amino acids. Science,262, 1680-1685.

Knochel, T. R., Hennig, M., Merz, A., Darimont, B.,Kirschner, K. & Jansonius, J. N. (1996). The crystalstructure of indole-3-glycerol phosphate synthasefrom the hyperthermophilic archaeon Sulfolobus sol-fataricus in three different crystal forms: effects ofionic strength. J. Mol. Biol. 262, 502-515.

Liu, R., Barrick, J., Szostak, J. W. & Roberts, R. W.(2000). Optimized synthesis of RNA-protein fusionsfor in vitro protein selection. Methods Enzymol. 318,268-293.

Mattheakis, L. C., Bhatt, R. R. & Dower, W. J. (1994).An in vitro polysome display system for identifyingligands from very large peptide libraries. Proc. NatlAcad. Sci. USA, 91, 9022-9026.

Porath, J., Carlsson, J., Olsson, I. & Belfrage, G. (1975).Metal chelate af®nity chromatography, a newapproach to protein fractionation. Nature, 258, 598-599.

Roberts, R. W. & Ja, W. W. (1999). In vitro selection ofnucleic acids and proteins: what are we learning?Curr. Opin. Struct. Biol. 9, 521-529.

Roberts, R. W. & Szostak, J. W. (1997). RNA-peptidefusions for the in vitro selection of peptides and pro-teins. Proc. Natl Acad. Sci. USA, 94, 12297-12302.

Sleat, D. E., Gallie, D. R., Jefferson, R. A., Bevan, M. W.,Turner, P. C. & Wilson, T. M. (1987). Characteris-ation of the 50-leader sequence of tobacco mosaicvirus RNA as a general enhancer of translationin vitro. Gene, 60, 217-225.

Smith, G. P. & Petrenko, V. A. (1997). Phage display.Chem. Rev. 97, 391-410.

Szostak, J. W. (1992). In vitro genetics. Trends Biochem.Sci. 17, 89-93.

Tutino, M. L., Scarano, G., Marino, G., Sannia, G. &Cubellis, M. V. (1993). Tryptophan biosynthesisgenes trpEGC in the thermoacidophilic archaebac-

High Complexity Synthetic Libraries of Long ORFs 319

terium Sulfolobus solfataricus. J. Bacteriol. 175, 299-302.

Wada, K., Wada, Y., Ishibashi, F., Gojobori, T. &Ikemura, T. (1992). Codon usage tabulated from theGenBank genetic sequence data. Nucl. Acids Res. 20,2111-2118.

Wilson, D. S. & Szostak, J. W. (1999). In vitro selectionof functional nucleic acids. Annu. Rev. Biochem. 68,611-647.

Wolf, E. & Kim, P. S. (1999). Combinatorial Codons: acomputer program to approximate amino acidprobabilities with biased nucleotide usage. ProteinSci. 8, 680-688.

Xiong, H., Buckwalter, B. L., Shieh, H.-M. & Hecht,M. H. (1995). Periodicity of polar and non-polaramino acids is the major determinant of secondarystructure in self-assembling oligomeric peptides.Proc. Natl Acad. Sci. USA, 92, 6349-6353.

Edited by P. E. Wright

(Received 8 November 1999; received in revised form 27 January 2000; accepted 28 January 2000)