COMSATS University Islamabad Pakistan

i

Process Optimization for Up-regulation of

Strigolactones and Their Role in Abiotic Stresses

By

Wajeeha Saeed

CIIT/FA13-PBM-007/ISB

PhD Thesis

in

Biochemistry and Molecular Biology

COMSATS University Islamabad

Pakistan

Spring, 2019

Style Definition: TOC 3: Line spacing: 1.5 lines, Tab

stops: 0.92", Left + 5.93", Right,Leader: …

ii



Strigolactones and Their Role in Abiotic Stresses

A Thesis Presented to


In partial fulfillment

of the requirement for the degree of

PhD (Biochemistry and Molecular Biology)

By

Wajeeha Saeed


Spring, 2019

iii


Strigolactones and Their Role in Abiotic

Stresses

_________________________________________

A Post Graduate Thesis submitted to the Department of Biosciences as partial

fulfillment of the requirement for the award of the Degree of PhD in Biochemistry

and Molecular Biology.

Name Registration Number

Wajeeha Saeed CIIT/FA13-PBM-007/ISB

Supervisor

Dr. Zahid Ali

Assistant Professor

Department of Biosciences

COMSATS University Islamabad (CUI)

Islamabad, Campus.

Formatted: Left, Indent: Left: 0"

iv

Certificate of Approval

This is to certify that the research work presented in this thesis, entitled “Process

Optimization for Up-regulation of Strigolactones and Their Role in Abiotic Stresses” was

conducted by Ms. Wajeeha Saeed (CIIT/FA13-PBM-007/ISB), PhD Scholar under the

supervision of Dr. Zahid Ali. No part of this thesis has been submitted anywhere else for

any other degree. This thesis is submitted to the Department of Biosciences, COMSATS

University Islamabad (CUI) in partial fulfillment of the requirements for the degree of

Doctor of Philosophy in the field of Biochemistry and Molecular Biology.

Student Name: Wajeeha Saeed Signature: __________

Examination Committee:

Signature: ___________

External Examiner 1

Prof. Dr. Shaheen Asad

National Institute of Biotechnology

and Genetic Engineering, Faisalabad.


External Examiner 2

Prof. Dr. M. Inam-ul-Haq

Chairman, Department of Plant

Pathology,

PMAS-Arid Agriculture University

Murree Road, Rawalpindi


Dr. Zahid Ali

Supervisor

Department of Biosciences

COMSATS University Islamabad, Islamabad Campus


Prof. Dr. Mahmood Akhtar Kayani

HoD, Department of Biosciences

COMSATS University Islamabad, Islamabad Campus


Prof. Dr. Habib Bokhari

Chairman, Department of Biosciences



Prof. Dr. Arshad Saleem Bhatti

Dean Faculty of Science,


v

Author’s Declaration

I Wajeeha Saeed, CIIT/FA13-PBM-007/ISB, hereby state that my PhD thesis titled

“Process Optimization for Up-regulation of Strigolactones and Their Role in Abiotic

Stresses” is my own work and has not been submitted previously by me for taking any

degree from this University i.e. COMSATS University Islamabad (CUI) or anywhere else

in the country/world.

At any time if my statement is found to be incorrect even after my Graduation the university

has the right to withdraw my PhD degree.

Date: __________ Signature: _______________

Wajeeha Saeed


vi

Plagiarism Undertaking

I solemnly declare that research work presented in the thesis titled “Process Optimization

for Up-regulation of Strigolactones and Their Role in Abiotic Stresses” is solely my

research work with no significant contribution from any other person. Small

contribution/help wherever taken has been duly acknowledged and that complete thesis has

been written by me.

I understand the zero-tolerance policy of the HEC and COMSATS University Islamabad

towards plagiarism. Therefore, I as an Author of the above titled thesis declare that no

portion of my thesis has been plagiarized and any material used as a reference is properly

referred/cited.

I. undertake that if I am found guilty of any formal plagiarism in the above titled thesis

even after award of PhD degree, the University reserves the rights to withdraw/revoke my

PhD degree and that HEC and the University has the right to publish my name on the

HEC/University website on which names of students are placed who submitted plagiarized

thesis.

Date: __________ Student Signature: _______________

Wajeeha Saeed


vii

Certificate

It is certified that Wajeeha Saeed, CIIT/FA13-PBM-007/ISB has carried out all the work

related to this thesis under my supervision at the department of Biosciences, COMSATS

University Islamabad and the work fulfill the requirements for award of PhD degree.

Date: __________

Supervisor:

__________

Dr. Zahid Ali

Assistant Professor, Department of Biosciences

Head of Department:

_____________________________

Prof. Dr. Mahmood Akhtar Kayani

HoD, Department of Biosciences

viii

DEDICATION

This dissertation is dedicated to:

My beloved parents:

Mr. Saeed Ahmad & Mrs.Sajida Saeed, thank you for your guidance,

unfathomable love, efforts and prayers.

I also dedicate this work to my Husband Mr. Naveid Abbas Imani for his

love, care and support throughout my Ph.D. studies.

ix

ACKNOWLEDGEMENTS

In the name of ALLAH (S.W.T), the Most Beneficent, the Most Merciful and Gracious,

the one who is the source of all knowledge and entitled to the divine attributes, bestowed

upon me the wisdom and capability to achieve this work. Whose guidance and

uncountable blessing have given me strength during my hard times, to fulfill my project

whole heartedly. Then, I offer my humble praise and immense gratitude to Prophet

Muhammad (P.B.U.H) The perfect amongst those born on earth, who is the universal

guidance and role model for humanity and love his followers for their remembrance.

The dissertation marks the end of a long and eventful journey wouldn’t be possible without

the contribution of many people who have accompanied and supported me throughout my

PhD journey.

Foremost, I would like to express my earnest gratitude to my supervisor Dr. Zahid Ali

from department of Biosciences,Assistant professor COMSATS University Islamabad. I

have been extremely lucky to have him as my tremendous mentor by encouraging my

research and allowing me to grow as a research scientist. His feedback and advice have

been instrumental in shaping this manuscript. He has been there providing his earnest

support, unwavering guidance, scholastic supervision, collegiality, and mentorship in my

quest for knowledge. He has not only motivated me to pursue my research and explore

the vast avenues of possible vistas in experimental work, but also uplifted my abilities

with his inspirational discussion. I would also like to extend my recognition to Dr. Saadia

Naseem Assistant professor COMSATS University Islamabad & my co-supervisor from

department of Biosciences, COMSATS University Islamabad for her insightful

discussion, constructive comments and meticulous guidance throughout the experimental

and thesis work and publications.

I would also like to extend warm thanks and appreciation for Prof. Dr. Francesca

Cardinale and her team at Department of Agricultural, Forest and Food Sciences

University of Turin, Italy during my IRSIP fellowship and for providing me opportunity

to avail WWS-2 Young scientist award of scholarship at University of Turin. Her

x

immaculate direction as well as professional encouragement kept me going with absolute

zeal and zest. I would also like to thank Post Doc lab fellows Dr. Ivan Visentin and Dr.

Chiara Pagliarani for their help in experimental work at DISAFA.

Special thanks to German Collection of Microorganisms and Cell Cultures (DSMZ)

Germany for providing dicistronic binary vector construct and Max Perutz Labs, Vienna

Bio center for GFP reporter construct. I am extremely obliged for the research

collaboration with Prof. Dr. Cristina Prandi and Prof. Dr. Pilar Cubas, Department of

chemistry, university of Turin, Italy and Plant Molecular Genetics Department National

Centre of Biotechnology (CNB-CSIC), Spain. They generously provided and synthesized

all the synthetic molecules and transgenic Arabidopsis seeds.

I owe a deep sense of gratitude to my supervisory committee member Dr. Muhammad

Muddassar, Assistant professor COMSATS University Islamabad for his guidance in

bioinformatics and docking simulations. I am also grateful to Prof. Dr. Mahmood

Akhtar Kayani HoD, Department of Biosciences COMSATS University Islamabad and

all the administration of campus for providing best possible environment for research. Not

forgotten, my appreciation to my Lab fellows specially Saira Karimi, Anam Saleem,

Sobia Anwar and Saba Saleem for their assistance in completion of research work, and

moral support. I am grateful to them all for countless hours spent discussing fruitful ideas

in the lab as well as over cups of tea at the campus cafe.

Most importantly, none of this would have been possible without my pillars of strength

my father Saeed Ahmad and my husband Navied Imani. Both of them never stopped

believing my abilities. I am forever in their debt. It is to them all; along with my

affectionate mother Sajida Saeed to whom I dedicate this dissertation. Thank you all for

giving me strength to reach for stars and chase my dreams. I am generously thankful to

my beloved sister Khuzaima Saeed for her moral support and companionship during my

PhD experience. Moreover, I would be unable to persue my carrier as PhD doctorate

without my uncle Dr. Abdur Rashid (Late), previous Head of Electrical Engineering

Department COMSATS Abbottaad made to ensure that I had an excellent education. This

dissertation is dedicated to first doctorate of our family.

xi

Finally yet importantly, I would like to take this opportunity to acknowledge Higher

Education Commission (HEC), Pakistan for financial support through HEC Indigenous

Scholarship (PIN no 2BM2-161) and IRSIP award at University of Turin Italy.

In the end, I would like to thank my institute COMSATS University for making my PhD

possible. I will be leaving the university with a heavy heart. May COMSATS progress by

leaps and bounds in each and every field of Science and Technology, Ameen

Wajeeha Saeed


xii

ABSTRACT

Process Optimization for Up-regulation of Strigolactones and

Their Role in Abiotic Stresses

Strigolactones (SLs) are novel plant hormones, which contribute significantly to improve

overall plant architecture, performance, and tolerance in response to environmental

stresses. Expansion of novel technologies that can assist in characterization of the

molecular mechanisms regulating plant hormone synthesis, signalling, and action are

facilitating the modification of hormone biosynthetic pathways for the production of

transgenic crop plants with enhanced abiotic stress tolerance. The present research project

deals in exploration of the SLs role against abiotic stresses in plants. The expression of

Carotenoid cleavage oxygenase (CCD7) from Lotus japonicas in tomato (as a model plant)

was carried out for the amelioration of drought stress tolerance. To achieve seamless

transfer of traits into cultivated varieties of tomato, optimization of highly reproducible and

efficient protocol for in vitro regeneration and efficient Agrobacterium mediated

transformation applicable to several varieties of Solanum lycopersicum L. [cv. Riogrande,

cv. Romagrande, local hybrid 17905 and model cv. M82] was done. First, conventional

indirect organogenesis was developed for all four varieties used in this study followed by

somatic embryogenesis (SE) and Agrobacterium mediated transformation. One-week-old

tomato seedlings were used as a source of cotyledon and hypocotyl segments, which served

as explants. The explants were subsequently cultured on Murashige and Skoog (MS)

medium supplemented with different combination and concentrations of plant growth

regulators (PGRs). Substantial trends in regeneration and propagation were observed

among the varieties and treatments. The two commercial cvs. Rio grande and Roma

showed preferential response to callus induction when cultured for 2 weeks on growth

media CIMT9 (0.5 mg/L NAA, 1 mg/L BAP) and CIMT12 (2 mg/L IAA, 2 mg/L NAA, 2

xiii

mg/L BAP, 4 mg/L KIN). cv. Riogrande, being the most responsive commercial variety,

was selected for in vitro morphogenesis via somatic embryogenesis (SE). During SE,

young cotyledons and hypocotyls explants were tested on media with different ranges of

pH (3 – 7) supplemented with 0.5 and 2 mg/L NAA. SE was induced from both explants

at pH 4.0 in dark conditions and numerous rhizoids (approximately~38) were produced

from each explant. Further incubation of each rhizoid under light conditions, led to the

formation of a novel structure - rhizoid tubers (RTBs) on MS media supplemented with 5

mg/L TDZ/BAP at pH 4.0. It has been observed that only lower pH-induced rhizoids and

RTBs regenerated into multiple individual shoots on media at normal pH (5.8). The RTBs

led to a complete plantlets regeneration in 45 days compared to the conventional invitro

morphogenesis (60 days). The time for in vitro regeneration form individual RTBs was

found to be more proficient as compared to previously reported methods. For genetic

transformation, Agrobacterium tumefaciense strains EHA105 and GV3101 harboring

pGreenII0029-35S-TL-GFP-CCD7, pGreenII0029-35S-TL-GFP-D14 and

pGreenII0029MAS-CCD7-CP148-LUC with Kanamycinkanamycin selection marker

were used. Vector functionality was confirmed via transient histochemical GUS staining

and GFP imaging. Various parameters were optimized for short time transformation of cv.

Riogrande including explant type/age/orientation, optical density of bacterium, infection

and co-cultivation time, preculture treatment of explant and bacteriostatic antibiotic. 40–-

45% transformation efficiency was achieved with 2–-5 days precultured one-week old

cotyledons transformed with Agrobacterium culture (OD 0.4–-0.6) for 15 min followed by

48 hr of co cultivation in the presence of 200 µM Acetosyringoneacetosyringone. The

strigolactone (SL) up regulated shoots were successfully confirmed with PCR

amplification of 1900 bp CCD7, 817 bp D14, 405 bp GFP and 800 bp of LUC genes in

subsequently transformed T0 and T1 plants. The acclimatized plants were subjected to

drought stress survival assay, leaf water loss index and relative water content,

subsequently; morphological as well as physiochemical analysis showed that CCD7 over

expressing T0 and T1 (OE0 &OE1) lines were more resistant to extreme water deficit with

a survival rate of 80% as compared to WT plants. Ectopic expression of CCD7 regulated

above ground architecture of plants by reducing number of primary and secondary braching

in transgenic lines in comparisonas compared to wild type plants. Furthermore, CCD7 over

xiv

lines showed enhanced reactive oxygen species (ROS) scavenging system with high

antioxidant enzyme system of peroxidases (including SOD, POD, APX and CAT) stable

elevated total chlorophyll content and lower lipid peroxidation levels (MDA) levels during

21 days drought stress challenge. Moreover, the antioxidant properties due to phenols and

flavonoid content also showed more than 50 % increase under well-irrigated conditions.

The results showed overexpression of CCD7 SL precursor gene in cv. Riogande confers

tolerance against abiotic stresses particularly in extreme water deprivation, which was due

to organ level dynamics of SL in ABA dependent manner. Hormonal cross talk between

SL–-ABA and structure and activity relationship were further studied by development of

synthetic SL analogues and mimics and their structural activity relationship (SAR) was

quantified in transgenic Arabidopsis where AtD14 was fused to firefly luciferase. A D14

luminescence quenching based assay in parallel to germination-inducing bioassay on

parasitic weed were developed for series of D-Lactams analogues of SL. The result

obtained showed that the assay is quantitative, robust and less laborious for quantification

and SAR studies of natural as well as synthetic SLs, plant hormones with shared lineage,

SL mimics, and florescent molecules having bulky functional groups. Stability,

germination and receptor binding results conveyed that various compounds tested were

active only at higher concentration when compared with GR24 as a reference. The results

of D14 degradation assay were extrapolated by in silico docking which showed favorable

binding pose and activity of D-Lactams and ABA co crystallized with synthetic rac-GR24,

once again to ratify bioisosteric approach of SL perception and signaling. Finally, the

presented work indicated that SLs are involved in spatial and temporal regulation of ABA

mediated abiotic stress management in tomato and Arabidopsis model systems. The natural

and synthetic SLs are stereo specifically required by land plants to orchestrate hormonal

cross talk and stress resilience. LjCCD7 gene, when upregulated in tomato not only altered

the architecture of transgenic plants, but also enhanced their adaptability to drought stress

and enhanced water use efficiency.

xv

TABLE OF CONTENTS

1. Introduction ..........................................................................................................2

Drought stress and improved water use efficiency: A retrospective ..................2

Strigolactones (SLs): multidimensional plant hormones ...................................4

Structure and functionality relationships (SAR) ...................................... 65

SLs biosynthesis and perception ............................................................ 109

SLs signal transduction by α/β-hydrolase proteins ............................... 1110

SLs function in response to stress ............................................................... 1514

SL-ABA regulation during Abiotic stresses ......................................... 1615

Tomato as model organism ........................................................................ 1918

Tomato cultivation in Pakistan ................................................................... 2019

Tomato varieties grown in Pakistan ............................................................ 2120

Challenges faced by tomato production ...................................................... 2221

Biotic factors ...................................................................................... 2221

Abiotic factors .................................................................................... 2221

Genetic engineering for improved stress tolerance ...................................... 2322

Factors effecting tomato transformation ..................................................... 2625

2. Material and Methods .................................................................................... 3433

Experimental procedures ............................................................................ 3433

Plant material ...................................................................................... 3433

Sterilization and germination of seeds ................................................. 3433

xvi

Cell culture experiments ............................................................................. 3736

Effect of plant growth regulators (PGRs) on callus induction via direct

organogenesis ................................................................................................... 3736

Effect of medium pH and auxins on induction of somatic embryogenesis

(SE) 3938

Effect of cytokinins on immature somatic embryos ............................. 3938

Microscopic studies of RTBs .............................................................. 4039

Shooting response of novel structures RTBs and regenerating calli ..... 4039

Rooting medium and establishment of in vitro seedling in soil ............ 4140

Cloning of strigolactone (SL) biosynthetic genes........................................ 4241

Primer designing ................................................................................. 4241

Isolation of SLs biosynthetic pathways genes ...................................... 4241

Purification and sequencing of targeted gene fragments ...................... 4746

Plant expression vector construction ................................................... 4847

Cloning strategy of LjCCD7 ....................................................................... 4948

Double digestion of vector and insert .................................................. 5150

Gel purification of digested fragment and setting up Ligations ............ 5150

Chemically competent E. coli cells preparation ................................... 5453

Heat shock transformation of competent cells ..................................... 5554

Screening of colonies by colony PCR.................................................. 5554

Plasmid Isolation by alkaline lysis....................................................... 5655

PCR confirmation ............................................................................... 5756

Agrobacterium tumefaciens competent cells ........................................ 5756

Freeze thaw transformation of Agrobacterium competent cells ............ 5856

Glycerol stocks preparation ................................................................. 5857

Transient expression analysis by agroinfiltration ........................................ 5958

xvii

GUS histochemical staining ................................................................ 6059

Stable transformation of Solanum lycopersicum cv. Riogrande .................. 6160

Ex-Plants preparation .......................................................................... 6160

Agrobacterium mediated infection ...................................................... 6160

Co-cultivation and selection ................................................................ 6261

Regeneration of transformed explants ................................................. 6261

Ex-vitro acclimatization and transfer of rooted plants .......................... 6362

β-glucuronidase (GUS) activity ........................................................... 6362

Molecular analysis of transformed shoots ............................................ 6462

Morphological phenotyping of transgenic plants ........................................ 6563

Biochemical test for antioxidant enzyme potential under drought stress ..... 6564

Dehydration response assay ................................................................ 6564

Relative water content (RWC) ............................................................ 6564

Leaf water loss index .......................................................................... 6664

Enzyme extraction .............................................................................. 6665

Nitroblue tetrazolium SOD assay ........................................................ 6665

Guaiacol peroxidase (POD) activity .................................................... 6766

Catalase (CAT) activity....................................................................... 6866

Malondialdehyde (MDA) content analysis .......................................... 6867

Ascorbate peroxidase activity (APX) .................................................. 6967

Chlorophyll content analysis ............................................................... 6968

Total Phenols, Flavonoid and antioxidant estimation of transgenic tomato

plants………………………………………………………………………………

Statistical Analysis ..................................................................................... 7270

Development of Smart molecular tools STRItools (STRIgolactone tools)

xviii

Synthesis of SL analogues ................................................................... 7270

Stability analysis ................................................................................. 7574

Germination assay ............................................................................... 7574

Luminometer in planta assays ............................................................. 7675

Docking analysis ................................................................................. 8079

Analysis of ABA dynamics using in planta luminescence based assay.... 8179

Luminescence based assays ................................................................. 8179

Gene expression by quantitative reverse-transcription PCR (qRT-PCR)

cDNA synthesis .................................................................................. 8281

Quantification of gene expression ....................................................... 8281

In silico docking ..................................................................................... 8483

3. Results ............................................................................................................. 8685

Tomato cell culture .................................................................................... 8685

Seed germination and contamination control ....................................... 8685

In vitro callus formation is genotype-dependent .................................. 9089

Effect of media pH & NAA concentrations on in vitro morphogenesis 9291

Secondary embryogenesis and novel structures “Rhizoid tubers” (RTB)

formation ........................................................................................................ 10099

Shoot organogenesis from RTBs and calli ....................................... 103102

Histological Analysis of RTBs ........................................................ 111110

Cloning of putative SL biosynthetic genes and transformation of S. lycopersicum

cv. Riogrande ................................................................................................... 115114

Vector construction and functionality test ....................................... 117116

Vector functionality in tomato by transient infiltration .................... 125124

Stable transformation of S. lycopersicum cv. Riogrande ......................... 129128

Effect of age and orientation of explants ......................................... 129128

Formatted: Line spacing: 1.5 lines

xix

Effect of pre-culture on regeneration of transformed shoots ............ 129128

Infection and co cultivation duration ............................................... 130129

Antibiotic sensitivity test ................................................................. 134133

Regeneration of putatively transformed explants and shooting ........ 135134

Ex-vitro acclimatization of transformed plantlets ............................ 136135

Molecular characterization of transformed shoots................................... 138137

Morphological assessment of T0 & T1 plants ........................................... 140139

Physiological indices associated to dehydration resistance of transgenic tomato

plants 142141

Estimation of antioxidant enzyme potential, MDA and chlorophyll content

analysis of drought stressed transgenic lines. ................................................ 147146

Development of STRI Tools: SL analogues and in planta quantitative assay to

study SL binding mode ..................................................................................... 156155

Synthesis of new molecules ............................................................ 156155

Stability of newly synthesized compounds ...................................... 157156

Germination activity of new SL- Analogues .................................... 159157

Luminometer based D14 degradation assay ..................................... 160159

Docking of D-Lactams .................................................................... 171170

Luminometer assay based dynamic of other phytohormones .................. 174173

Docking simulation of ABA in At-D14 ........................................... 179178

4. Discussion ................................................................................................... 184183

Tomato cell culture, somatic embryogenesis and Agrobacterium mediated

transformation studies ...................................................................................... 187185

Overexpression of LjCCD7 gene enhances drought stress tolerance in tomato by

ROS scavenging mechanism ............................................................................ 201199



xx

Structure and activity relationships (SARs) in natural and synthetic analogues

decoded via quantitative in planta assay and docking simulations .................... 208205

5. References ................................................................................................... 221218

APPENDIX- I ..................................................................................................... 261256

APPENDIX- II ................................................................................................... 264259

APPENDIX- III .................................................................................................. 267262

APPENDIX- IV .................................................................................................. 268263

APPENDIX- V.................................................................................................... 270264

APPENDIX- VI .................................................................................................. 271265

xxi

LIST OF FIGURES

Figure 1.1 Chemical structure of strigolactones (SLs) and related compounds…………87

Figure 1.2 Signalling and perception pathway of strigolactones (Saeed et al.,

Figure 1.3 Overview of Agrobacterium mediated transformation in

Figure 1.4 Schematic overview of in vitro regeneration in

Figure 2.1 Restriction map of SLCCD7 coding

Figure 2.2 Restriction map 1 of LjCCD7 coding

Figure 2.3 Restriction map 2 of LjCCD7 coding

Figure 2.4 Restriction map SLD14 coding

Figure 2.5 T-DNA cassette of dicistronic vector (Ali et al.,

Figure 2.6 LjCCD7 harboring T-DNA

Figure 2.7 T-DNA cassette of reporter gene construct

Figure 2.8 T-DNA cassette of GFP fusion with

Figure 2.9 T-DNA cassette of GFP fusion with

Figure 2.10 Agro infiltration of tomato leaves and fruit for transient gene

Figure 2.11 Modification of GR24 to D-

Figure 2.12 D-Lactams analogues and mimics synthesized in this

Figure 2.13 Multimode Luminometer based quantitative in planta assay for quantification

of SL and SL related

Figure 2.14 Mode of SL-D14 interaction and real time monitoring of SL related activity

……………………………………………………………………………...79

Figure 2.15 qRT-PCR reaction conditions used in the

xxii

Figure 3.1 Germination of Solanum lycopersicum L. cvs. Riogrande, Roma, M82 and

hybrid (17905) on full and ½ strength MS medium without

Figure 3.2 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82

and hybrid (17905) on optimized

Figure 3.3 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82

and hybrid (17905) on optimized

Figure 3.4 Effect of increasing concentration of NAA at pH 4.0 on S.E from cotyledon

and hypocotyl of S. lycopersicum cv.

Figure 3.5 The effect of medium pH (4.0) on rhizoids production from cotyledon and

hypocotyl explants of S. lycopersicum cv.

Figure 3.6 Effect of pH 4.0 + 2 mg/L NAA vs pH 3, 5, 6 & 7…………………………9998

Figure 3.7 Effect of NAA*pH level on RTBs

Figure 3.8 Origination of RTBs from rhizoids at pH 4.0.

Figure 3.9 Induction of RTBs from rhizoids on MS media supplemented with TDZ/BAP

(5 mg/L) at pH 4.0.

Figure 3.10 Stages of whole plantlet development via in vitro shooting from excised

RTBs………………………………………………………………………105

Figure 3.11 Steps of complete in vitro regeneration in S. lycopersicum cv. Riogrande.

110109

Figure 3.12 Light microscopic sections of rhizoid tubers (RTBs) stained with safranin

stain on tuber induction medium supplemented with 5 mg/L TDZ at pH 4.0

from cotyledon explants of S. lycopersicum cv. Riogrande. 112111

xxiii

Figure 3.13 Histology of somatic embryos developed via direct somatic embryogenesis

from cotyledons explants of S. lycopersicum cv.

Figure 3.14 Histology of rhizoid cluster containing RTBs, globular and torpedo shaped

embryos…………………………….……………………………………..114

Figure 3.15 Cross talk between SLs and abscisic acid (ABA) biosynthesis for the

adaptability of plants in response to challenging

Figure 3.16 Total RNA quality and quantity from leaves and roots of

Figure 3.17 Vector map of pGEX-LjCCD7 (Liu et al.,

Figure 3.18 Amplified LjCCD7 fragment of 1899 bp and restriction map created with

XbaI-HindIII digestion.

Figure 3.19 PCR amplified LJCCD7 and SLD14

Figure 3.20 TA cloning of LjCCD7 & SLD14 in pGEMT

Figure 3.21 Blue white screening of TA clones in E.

Figure 3.22 Colony PCR results showing desired gene from white positive clones

containing TA cloned gene of

Figure 3.23 Restriction enzyme digestion of vector and

Figure 3.24 Sub cloning of LjCCD7 in dicistronic vector in

Figure 3.25 Sub-cloning of LjCCD7 fused with N terminal of GFP in

Figure 3.26 Sub-cloning of SLD14 fused with N terminal of GFP in

Figure 3.27 Analysis of reporter gene expression in detached leaves and fruits of S.

lycopersicum cv.

Figure 3.28 Effect of pre-culture treatment on transformation

Figure 3.29 Effect of bacterial density on transformation

xxiv

Figure 3.30 Effect of pre culture treatment Vs fresh cotyledons after co-cultivation of S.

lycopersicum cv.

Figure 3.31 Regeneration of Agrobacterium infected transformed cotyledon

explants………………………………………………………………...137

Figure 3.32 Acclimatization of CCD7 transformed regenerated plants and development of

flowers and fruits in S. lycopersicum cv.

Figure 3.33 PCR confirmation of LUC, GFP and CCD7 genes in putative transformed

lines…………………………….…………………………………………139

Figure 3.34 Phenotypic evaluation of transgenic CCD7 lines in comparison to WT

Riogrande at reproductive

Figure 3.35 Drought tolerance response of LJCCD7 overexpressing Riogrande

plants………………………………………………………………………143

Figure 3.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing

Riogrande

Figure 3.37 SOD content analysis of leaves and stem of CCD7 overexpressing lines

against

Figure 3.38 POD content analysis of leaves and stem of CCD7 overexpressing Riogrande

lines against

Figure 3.39 Effect of drought stress on H2O2 scavenging acticity due to CAT and APX in

leaves and stem of CCD7 overexpressing Riogrande lines against

Figure 3.40 Malondialdehyde (MDA) levels in the transgenic OE1 tomato after 21 days

of drought stress

xxv

Figure 3.41 Leaf chlorophyll content analysis of CCD7 overexpressing Riogrande

tomato……………………………………………………………………..154

Figure 3.42 Synthesis module of GR24-D-

Figure 3.43 Germination-inducing activity of D-Lactams on Phelipanche aegyptiaca

seeds…………………………….………………………………………...160

Figure 3.44 Dose response assay with (+)-GR24 & EGO10 normalized to acetone

control…………………………….………………………………………162

Figure 3.45 Luciferase assay with D-Lactam based SL analogues

Figure 3.46 A-B Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in comparison

with at 1 μM (+)-

Figure 3.47 Highest concentrationn (100 μM) of D-Lactam analogues in comaprison to

(+)-

Figure 3.48 Luciferase competition test between rac-9 and (+)-

Figure 3.49 (A-B) Luciferase D14 degradation activity over 15 hr treatment against 1µM

(+)-

Figure 3.50 Luciferase D14 degradation assay with SL mimics across a range of

concentrations (0.01–100 μM)

Figure 3.51 Docking model of rac-3 and rac-4 in the binding site of rice

Figure 3.52 Docking model of rac-9 in the binding site of rice

Figure 3.53 SL cross talk with various phytohormones during abiotic stresses (Saeed et

al., 2017)

Figure 3.54 Luminometer based D14 degradation assay with phytohormones at T=3

hr…………………………….……………………………………………176

xxvi

Figure 3.55 Luminometer based D14 degradation assay with phytohormones over 15

hr…………………………….……………………………………………177

Figure 3.56 Transcript accumulation of genes involved SL & ABA metabolism following

ABA

Figure 3.57 Transcript accumulation of genes involved SL & ABA metabolism following

100 µM ABA

Figure 3.58 Plausible binding mode of (+)-GR24 (cyan-a) in AtD14 (green) binding

pocket……………………………………………………………………..180

Figure 3.59 Plausible binding mode of S-(+)-ABA (yellow-b) in AtD14 (green) binding

pocket…………………………….……………………………………….181

Figure 3.60 Superimposed pose of (+)-GR24 (cyan) & S-(+)-ABA (yellow) in AtD14

(green) binding

Figure 4.1 Organ level dynamics of strigolactones during abiotic stresses encountered by

plants…………………………….………………………………………...186

Figure 4.2 Morphological assessment of T0 Transgenic plants of cv.

Figure 4.3 Morphological features of T1 transgenic plants Vs WT

Figure 4.4 Morphological assessmet of T1 transgenic

Figure 4.5 SLs quantification based on LUC degradation activity of tomato root exudates

normalized to mock and acetone control………………………………… Luc

activity of tomato root exudates normalized to mock and acetone

xxvii

LIST OF TABLES

Table 1.1 An overview of in vitro regeneration events and tranformation done in

tomato……………………. .................................................................... 2928

Table 2.1 Treatments used for seed disinfection ....................................................... 3534

Table 2.2 Optimized media formulations for in vitro morphogenesis and transformation

of S. lycopersicum cultivar(s)… ............................................................. 3635

Table 2.3 List of callus induction media used in the study ........................................ 3837

Table 2.4 List of primers used in the study ............................................................... 4443

Table 2.5 High capacity cDNA synthesis from total RNA ........................................ 4544

Table 2.6 PCR reaction conditions and master mix ................................................... 4544

Table 2.7 Reaction mix for NcoI- NotI double digestion ........................................... 5352

Table 2.8 Reaction mix for XbaI-HindIII double digestion ....................................... 5352

Table 2.9 Reaction mix for XmaI-NotI double digestion ........................................... 5352

Table 2.10 Rapid ligation mix for PCR products for TA cloning .............................. 5352

Table 2.11 Ligation reaction of vector and gene of interest ....................................... 5453

Table 3.1 Effect of Clorox (NaOCl) concentration on sterilization of seeds of Solanum

lycopersicum L cvs. Riogrande, Roma, M82 and hybrid (17905) on full and

½MS medium without sucrose ............................................................... 8886

Table 3.2 The effect of various combinations of PGRs on callogenesis in Solanum

lycopersicum cultivars irrespective of explant type. ................................ 9189

Table 3.3 The Effect of Various Concentrations of NAA and pH values on rhizoid

induction in S. lycopersicum cv. Riogrande. ........................................... 9694

Table 3.4 Effect of TDZ/BAP concentration on rhizoid tubers (RTBs) induction at low

pH in S. lycopersicum cv. Riogrande (no distinction of explant type). .. 10199

xxviii

Table 3.5 Effect of pH values on development of rhizoid tubers (RTBs) irrespective of

explant type in S. lycopersicum cv. Riogrande supplemented with 5 mg/L of

TDZ ..................................................................................................... 10199

Table 3.6 Effects of culture media and explant type on shoot regeneration in four S.

lycopersicum cultivars. ....................................................................... 107105

Table 3.7 Effect of auxins on rooting of in vitro regenerating shoots of four S.

lycopersicum cultivars after 8-10 weeks of incubation. ....................... 109107

Table 3.8 Effect of optical density on transient expression of T-DNA .................. 126124

Table 3.9 Effect of acetosyringoneAcetosyringone concentration on transient expression

of vector T-DNA ................................................................................ 127125

Table 3.10 Agrobacterium mediated stable transformation parameters optimized for S.

lycopersicum cv. Riogrande ............................................................... 131129

Table 3.11 Antibiotic sensitivity screening for selection media optimized for S.

lycopersicum cv. Riogrande ............................................................... 134132

Table 3.12 Regeneration efficiency of putatively transformed kanamycin resistant shoots

of S. lycopersicum cv. Riogrande ....................................................... 135133

Table 3.13 Physiochemical characteristics of T1 transgenic plants ........................ 155153

Table 3.14 Chemical stability of lactams, named as described in Fig. 2.11, in 30% MeOH

or 1:1 acetonitrile (ACN): water at 21 °C and pH 6.7. ........................ 158156

xxix

LIST OF ABBREVIATIONS

NaOH Sodium hydroxide

µg Micogram

µL Microliter

2, 4-D Dichlorophenoxyacetic acid

ABA Abscisic acid

ABA Abscisic acid

AM Arbuscular mycorrhiza

AM fungi Arbuscular mycorrhizal fungi

ANOVA Analysis of variance

Amp Ampicillin

APX Ascorbate Peroxidase

AtD14 Arabidopsis α/β-fold hydrolase DWARF 14

BAP Benzyl aminopurine

BRs Brassinosteroids

bp Base pairs

CAT Catalase

CCD Carotenoid cleavage dioxygenases

CIM Callus Induction Media

D14 α/β-fold hydrolase DWARF 14

DAS Days after stress

DMSO Dimethyl Sulfoxide

DNA Deoxyribo nucleic acid

DPPH 2,2-diphenyl-1-picrylhydrazyl

ent Enantiomer

epi Epimer

FAO Food and Agriculture Organization

xxx

FC reagent Folin-Cioceltau reagent

GA3 Gibberellic Acid

GAE Gallic acid equivalent

Gent Gentamycin

GFP Green Fluorescent Protein

GUS β Glucuronidase

hr Hour

IAA Indole acetic acid

Kan Kanamycinkanamycin

Kb kilo basepairs

KIN Kinetin

LUC Luciferase

MDA Malondialdehyde

mg Milligram

mg/L milligram per liter

mL Millilitre

NAA Naphthalene acetic acid

NaOCl Sodium hypochlorite

NCED 9‐cisepoxycarotenoid dioxygenase

OD Optical Density

PCR Polymerase Chain Reaction

PGRs Plant growth regulators

pH -log H+

POD Peroxidase

QE Quercetin

rac Racemic mixture

Rif rRifampicin

RIM Root Induction Media

ROS Reactive oxygen species

xxxi

RT-PCR Reverse Transcriptase PCR

RWC Relative water content

SA Salicylic Acid

S.E Standard error of mean

SAR Structure and Activity Relationship

SE Somatic embryogenesis

SIM Shoot Induction Media

SL Strigolactone

SLs Strigolactones

SOD Superoxide dismutase

T-DNA Transfer DNA

TDZ N-Phenyl-N'-1, 2, 3-thiadiazol-5-ylurea

Tet Tetracycline

WT Wild type

X-Gluc 5-Bromo-4-Chloro-3-indoyl-β-D-glucuronide

ZEA Zeatin

Introduction Chapter 1

1

Chapter 1

Introduction


2

1. Introduction

Drought stress and improved water use efficiency: A retrospective

Plants are particularly sensitive to water deficit and they require abundant irrigation water

for their vegetative and reproductive growth, flower and fruit development. Drought stress

poses severe threats to normal physiology of plants due to its unpredictable nature and

dependency on external factors such as level of precipitation and its distribution,

hydrodynamics of soil and climate changes (Shinozaki and Yamaguchi-Shinozaki, 2006).

Unpredictable climate changes and their geographical distribution are making drought

stress an acute problem for domestic cultivation of various important crops like tomato

with negative impacts on plant growth, water absorption and photosynthesis rate, transport

of water and soluble solutes for fruit development, their productivity and quality (Mitchell

et al., 1991; Nahar and Gretzmacher, 2011). Water deficit is escalating day by day due to

global warming, with more abrupt changes in evapotranspiration of crops leading to

physiochemical and molecular changes in adaptability and tolerance of plants (Fischlin et

al., 2007). Plants have evolved adaptation and tolerance to water paucity at molecular and

cellular levels by expression of various defence mechanism, accumulation of proteins,

osmolytes, hormones and invoking alterations in cellular metabolism involved in stress

tolerance. Therefore differential changes in regulation of stress responsive pathways, genes

and proteins are observed with substantial cross-linking of signalling networks, which may

improve resistance to multiple abiotic stresses. Manipulation of the key genes and proteins


3

and convergence of gene regulatory pathways may aid in the process of counteracting

multiple stresses. Hence, tolerance to certain unfavourable homeostasis caused by water

deficit may be presumed as plasticity in metabolic functions that allows plant to depict

avoidance, tolerance or recovery from drought (Ahuja et al., 2010; Ku et al., 2018). This

defence mechanism defined by limiting the damage due to abiotic stress is termed as

tolerance of plant. Adaptation or tolerance of plant to various stresses is a complicated

phenomenon characterized by activation of multitude of gene regulatory pathways. The

comprehension of dynamics and advancements in multifarious gene interplay can be

investigated further to unleash the adaptive mechanism of plants under different abiotic

stresses (da Silva and Costa de Oliveira, 2014; Mittler, 2006). Elucidation of molecular

control and underlying physiology of plant under stress is pivotal for understanding how

plants can survive under unwanted conditions which may provide basis for engineering

more resistant crops by using molecular tools to introduce specific stress related genes

(Osakabe et al., 2011; Wang et al., 2003; Wei et al., 2017). Drought inducesd physiological

and morphological imprints to minimize the negative impacts of water deficit. These

alterations include reduction in biomass, shortening of life cycle, changes in root structure,

proliferation & depth, reduced leaf size, area & number to minimize water use, reduction

in transpiration, increase in stomatal resistance, increase in root/shoot biomass ratio, short

stature, accumulation of soluble solutes (sugars, proline, amino acids, sugars) for

maintenance of water potential and enhanced production of antioxidant defence enzymes

to withstand oxidative damage. These drought avoidance and tolerance traits are

adaptations governed by differential expression of genes, transcription factors and most

importantly phytohormones to maintain water budget and reduce injury of plants under

stress. This native plasticity in plants in turn depends on stress severity, duration and

susceptibility of plants (Ahuja et al., 2010; Fujita et al., 2011; Shinozaki and Yamaguchi-

Shinozaki, 2006; Umezawa et al., 2006).

Dynamic approaches to combat abiotic stresses specifically water deficit include

phytohormones engineering besides conventional breeding program to transfer abiotic

stress resistant genes. Phytohormones are endogenous growth mediators produced in small

quantities and are responsible for plant protective functions by acclimatization to single or

combination of abiotic stresses. These signalling molecules involve organ level dynamics


4

to change the physiological and molecular state of plant by and exerting their effect often

from their site of production (Khan et al., 2012; Ku et al., 2018). Last decade opened new

possible outcomes of phytohormones engineering by manipulation of their biosynthesis

and catabolism to enhance stress tolerance, growth regulation, source/sink transitions and

differential plasticity of plants under unfavourable environment. These phytohormones

include abscisic acid (ABA), auxins (IAA), gibberellins (GAs), cytokinins (CKs), salicylic

acid (SA), brassinosteroids (BRs), jasmonates (JAs) and strigolactones (SLs) –, a new class

of signalling mediators (Saeed et al., 2017; Sreenivasulu et al., 2012).

Strigolactones (SLs): multidimensional plant hormones

Among various plant hormones, SLs are contemporary hormones discovered recently with

myriad of new revenues and remarkable breakthroughs in phytohormones research. With

SLs discovery, researchers got a clue to look for regulation of plant development and their

meticulous adaptation to environmental constraints. These research endeavours also

opened new chapters of hormone cross talk responsible for overall response in plants

(Saeed et al., 2017). It has been established that SLs are responsible for diverse

physiological activities coherently in plant development besides shoot branching. They

regulate plant growth and architecture by facilitating phosphate availability from the soil

by AM fungi colonization and root hair elongation for inorganic phosphate acquisition

from the soil (Brewer et al., 2013). These signalling molecules produced by the plants in a

very low concentrations (µM and pM) have been detected in root exudates of wide variety

of both dicots and monocot plants. These compounds particularly unstable in aqueous

environment with manifold functional aspects as well as physiological roles are produced

in different plants in diverse forms under certain conditions (Xie et al., 2010). The SLs

have been detected in the root exudates of a wide range of monocot and dicotyledonous

plant species. Different plant species and even various varieties of one crop species produce

diverse SLs and/or mixtures of these signalling compounds with roots being main site of

synthesis. However, production of SLs in lower part and its translocation from roots to

shoot for inhibition of shoot branching has also been reported. Several other groups also

supported the transportation of root derived SLs (Abe et al., 2014; Kohlen et al., 2013).


5

The manifestation of physiological role of this new hormone was reported using

branching/increased tillering mutants, including both SL-biosynthesis and SL-signalling

mutations of different species. These mutants are more axillary growth (max) in

Arabidopsis (Stirnberg et al., 2002; Booker et al. 2004), ramosus (rms) in pea (Sorefan et

al., 2003), dwarf (d ) & high tillering dwarf (htd ) in rice (Arite et al., 2007) and decreased

apical dominance (dad ) in petunia (Simons et al., 2007). Level of SLs in root exudates of

these mutants depicted by grafting experiments were remarkably low as compare to WT

due to defective biosynthesis and transport of signal from roots to shoot. Since SLs are

produced in roots, for their execution of branch inhibition they need to be transported shoot

ward through vasculature (Dun et al., 2009; Mouchel and Leyser, 2007). It has been well

established that SLs are responsible for diverse physiological activities coherently in plant

development besides shoot branching. They regulate plant growth and architecture by

facilitating phosphate availability from the soil by AM fungi colonization and root hair

elongation for inorganic phosphate acquisition from the soil (Agusti et al., 2012; Brewer

et al., 2013; Rasmussen et al., 2012). Studies conducted on SL deficient and SL insensitive

mutants showed denser lateral roots and shorter primary roots in comparison to their wild

counterparts (Brewer et al., 2015; Gomez-Roldan et al., 2008; López-Ráez et al., 2008;

Rasmussen et al., 2013). Additional roles of SLs in plant physiology includes interaction

with plant growth hormone for regulation of secondary growth and increase in stem

thickness through interaction with auxins (Agusti et al., 2012), inhibition of adventitious

root formation in Pea, Arabidopsis and tomato (Kohlen et al., 2013; Rasmussen et al.,

2012), positive regulation of internode length , promotion of leaf senescence, seed

germination, seedling and root development (Kapulnik et al., 2011; Ruyter-Spira et al.,

2011; Zhang et al., 2013). Moreover, several studies have demonstrated positive role of

SLs in seed germination and early seedling development in Arabidopsis (Tsuchiya et al.,

2010).

Additionally synthetic active analogue of SLs, GR24 has been shown to promote

nodulation in Alfalfa and many other rhizobial plants (De Cuyper et al., 2015; Foo et al.,

2014; Soto et al., 2010). Finally, strigolactones have been proposed to play a direct or

indirect role in plant defence in different fungal pathosystems (Dor et al., 2011; Torres-

Vera et al., 2014). With increasing interest in biological and physiological role of SLs in


6

plant development and regulation, additional functions are likely to be identified in future

as more research groups probe SLs mediated signalling pathways.

Structure and functionality relationships (SAR)

So far 18-20 natural SLs have been characterized and they share similar chemical

architecture (Al-Babili and Bouwmeester, 2015). Structurally, they are tricyclic lactones

referred as ABC rings linked to methylbutenolide via an enol ether bridge to an invariable

α, β-unsaturated furanone moiety named D ring. The bioactiphore resides within the region

that connects the D-ring to the core; chemical diversity is given by the stereochemistry of

the B-C ring junction, the size of the A ring, and the substitution patterns of the A and B

rings (Al-Babili and Bouwmeester, 2015). A and B rings vary in their structure due to

presence of one or two methyl groups while C and D-rings mostly remain constant except

their stereoisomers have been reported on enol ether bridge which is believed to mediate

biological activity of SLs (Rani et al., 2008; Xie et al., 2010). Signaling and perception

mechanism of strigolactones and their bioactivity depends on stereochemistry of CD rings.

SLs contain several stereocenters and often exist as mixture of stereoisomers. Among

various stereoisomers of natural SLs, activity differs remarkably. The absolute stereo

chemical configuration system according to IUPAC system (International Pure and

Applied Chemistry) designated R or S system indicating chirality. The SL intermediate

carlactone is converted to two distinct classes of molecules define by 5DS/ (+)-strigol and

(−)-orobanchol from which all the SLs are derived (Xie et al., 2013). The structure shown

in Figure 1.1 showed that in general, A ring with oxygen function may occur at different

position and BC junction at C-2 could be accounted for stereo specificity.


7

Figure 1.1 Chemical structure of strigolactones (SLs) and related compounds


8

Two naturally occurring SLs are produced from SL intermediate carlactone namely strigol and orobanchol, with the

characteristic ABC-ring to D-ring structure. Both stereomers have different in hydroxyl groups at the C5 and C4 positions

and the differing stereochemistry at the B-ring to C-ring junctions. The stereochemistry at C2′ is the same in both strigol

and orobanchol marked by red arrow. Adapted from (Lombardi et al., 2017)

The two precursors of SLs are actually opposite to each other on B-C ring stereochemistry

and termed as diastereomers 2′R D-ring configuration as shown in Figure 1.1. Thus, SL

nomenclature has been defined by using ent for enantiomer i.e. mirror image and epi for

epimer i.e. opposite stereochemistry at one carbon with referenced to their parent scaffold.

This notion pertains to either (+)-strigol where by 5-deoxystrigol (5DS) is considered as

reference compound and for (−)-orobanchol, 4-deoxyorobanchol (4DO; ent-2′-epi-5DS) is

an appropriate reference compound (Xie et al., 2013; Zwanenburg and Pospíšil, 2013). The

classification of naturally occurring SLs aided in detection and stereo chemical assignment

of synthetic SL analogues, derivatives and mimics. For example, synthetic SL

representative GR24 is widely used in research as racemic mixture containing two

enantiomers with 5DS configuration. The stereo specificity of SLs and SL like compounds

has important role in activity and regulation of prime biological functions such as parasitic

weed germination, promotion of hyphal branching factors in arbuscular mycorrhizal (AM)

fungi, branch inhibition, rice tillering as well as activation of downstream signaling effector

protein. Various biological functions are regulated by stereo specificity of natural and

synthetic SLs. Strigol like compounds (sorgolactone, GR24, 5-deoxystrigol, sorgomol etc)

have been found to stimulate greater activity in Striga hermonthica seed germination as

compared to their enantiomers, while germination in Striga gesnerioides is inhibited by

same compounds and promoted by orobanchol type compounds (Nomura et al., 2013).

Based on choice of structure and activity diversity and complex organic process to

synthesize sizeable quantities of synthetic SLs, series of active analogues have been

http://www.plantphysiol.org/content/165/3/1221#def-8


9

prepared (Artuso et al., 2015; Lombardi et al., 2017). It has been verified now via bioassay

and detailed SAR studies that the presence of enol ether and the ABC scaffold is required

for nucleophilic attack on CD junction through Michael addition on enol ethers present in

SLs, thus an easy leaving group as well as butenolide D ring is released, subsequently

mediating SL perception (Prandi et al., 2014; Zwanenburg and Mwakaboko, 2011;

Zwanenburg et al., 2009). In order to understand the response nuances observed not only

at genus level but also contrasting stereo-specificity displayed within species, detailed

insights are required to comprehend the mechanism involved in perception of SLs. For this

purpose series of synthetic analogues with modification of ABCD ring system have been

used (Bhattacharya et al., 2009; Jamil et al., 2018; Nefkens et al., 1997; Sanchez et al.,

2018; Zwanenburg and Mwakaboko, 2011; Zwanenburg et al., 2009). Also due to scarce

quantity of SLs produced as root exudates in picomolar amount/plant, the functional

structures are difficult to maintain, dampened by minimal synthesis rate. For same reason

natural SLs cannot be used for bioactivity assays when large amount of product is required

to actually generate a response while, organic synthesis has cost constrictions as well. All

the mentioned hitches in potential use of natural SLs prompted for chemical synthesis of

SL like synthetic compounds with structural requirements only required to maintain the

biological activity. These analogues not only serve as smart tool to decipher SARs but also

broadens choice of available modifications in structure according to practical applications.

Elucidation of their activity and structure relationships will further engender missing leads

in the perception and binding of natural and synthetic SLs in receptor bioactiphore (Artuso

et al., 2015; Lace and Prandi, 2016; Lombardi et al., 2017).

SLs biosynthesis and perception

Determination of SLs biosynthetic origin was carried out in a study where plants treated

with inhibitors of carotenoid biosynthesis lead to lower level of SLs in root exudates,

suggesting a biosynthetic link of SLs with carotenoids (Matusova et al., 2005). Following

this discovery, carotenoid cleavage dioxygenases based hypothetical SLs biosynthetic

pathway was proposed with β-carotene as a prime substrate of the reaction. Later on

Gomez-Roldan et al., (2008) and Umehara et al., (2008) independently discovered

carotenoid cleavage dioxygenases (CCDs) required for SLs biosynthesis. Both discoveries

unravel the detection of novel signalling molecule in plants responsible for inhibition of


10

shoot branching/tillering in plants. Wide collection of branching mutants such as: more

axillary growth (max) mutants of Arabidopsis, dwarf (d) or high tillering dwarf (htd) of

Oryza sativa, ramosus (rms) of Pisum sativum and decreased apical dominance (dad) of

Petunia, particularly led to the detection of SL biosynthesis and signaling pathways (Arite

et al., 2007; Booker et al., 2005; Snowden et al., 2005; Waters et al., 2012).

Plastid localized carotenoid cleavage enzymes specifically cleaves double bonds in

carotenoid molecules to form carbonyl compounds called apocarotenoids (Auldridge et al.,

2006). Two SL biosynthesis related genes CCD7 and CCD8 have been characterized in

different plants like D17/HTD1, D10 in rice; RMS5/RMS1 in Pea, DAD3/DAD1 in Petunia

and MAX3/MAX4 in Arabidopsis respectively (Morris et al. 2001; Sorefan et al. 2003;

Booker et al. 2004; Arite et al. 2007). D27 an iron binding plastid localized enzyme works

upstream of CCD7 and CCD8 being all-trans to 9-cis-β-carotene isomerase enzyme, it is

responsible to catalyze the isomerization of trans-β-carotene into 9-cis-β-carotene. The

later acts as substrate for CCD7 enzyme activity to cleave cis configured carotenoids into

9-cis-β-apo-10′-carotenal (Alder et al., 2012). CCD8 then acts on the product of first

enzymatic cleavage to form a compound Carlactone (CL), which is an intermediate

compound in SL pathway and act as precursor molecule for more specific SLs as shown in

Figure 1.1.

The genes acting downstream to CL are mainly responsible for signal perception and

regulation. These Genes include More Axillary Growth 1 (MAX1) in Arabidopsis which

encode a cytochrome P450 CYP711A1 gene and is responsible for the conversion of

carlactone into functional SL like 5-deoxystrigol (Alder et al., 2012; Booker et al., 2004;

Stirnberg et al., 2002). MAX1 putatively converts CL into functional SL by rearrangements

and modifications (hydroxylation, oxidation), converting CL to carlactonic acid (CLA) and

methyl carlectonoate (MeCLA). Further investigation of MAX1 genes and its orthologues

in Arabidopsis and Rice revealed that this gene is expressed in all vascular tissues and

functions only in late steps of SLs synthesis and responsible for structural diversity of SLs

(Booker et al., 2005; Umehara et al., 2010). More recently, another gene was reported to

be involved in branching phenotype and act downstream of MAX1. This gene Lateral

Branching Oxidoreductase (LBO) in Arabidopsis encode oxidoreductase-like enzyme of

the 2-oxoglutarate and Fe (II)-dependent dioxygenase superfamily. It has been suggested


11

that in Arabidopsis LBO has similarity to MAX3 in expression pattern. Downstream of

MAX1, LBO enzyme acts on products of MAX1 like MeCLA or CLA and convert it into

SL like compound responsible for branching phenotype (Brewer et al., 2016).

SLs signal transduction by α/β-hydrolase proteins

Components of SLs signal transduction and perception consist of F-box leucine rich protein

MAX2/RMS4/D3, α/β-fold hydrolase DWARF 14 (D14, DAD2) which act as receptor and

repressor proteins in rice (DWARF53 D53, SLENDER RICE1 SLR1) and Arabidopsis

(BRI1-EMS-SUPPRESSOR1 BES1). D3 and MAX2 are leucine rich F-box proteins

involved in regulation of shoot branching and SLs responses. Both protein have been

shown to be part of SKP1-CUL1-F-box-protein (SCF)-type ubiquitin ligase complex and

performs ubiquitination and subsequent proteosomal degradation of target protein,

repressor/negative regulators (Stirnberg et al., 2007; J. Zhao et al., 2014). Putative

orthologues of D14 have been identified in rice (D14), Arabidopsis (ATD14), Petunia

(DAD2), Barley (HvD14) and Black cottonwood (PtD14) by using SL signaling mutants

(Arite et al., 2009; Hamiaux et al., 2012; Marzec, 2016; Waters et al., 2012; Zheng et al.,

2016). All of these receptors are members of α/β-fold hydrolase family, capable of SL

binding and hydrolysis in vitro. D14 mediated perception of SL depends on catalytic triad

(Ser,His,Asp) for binding and hydrolysis of SLs (Hamiaux et al., 2012). It has been

proposed that MAX2/D3 act as recognition subunit in SKP1-CUL1-F-box-protein (SCF)

while D14 mainly via its hydrophobic ligand binding pocket and particularly Ser147/Ser97

residues (nucleophilic) in the triad, attacks the D ring (carbonyl of butenolide) separate it

from ABC part (Scaffidi et al., 2012; Zhao et al., 2013a). The nucleophilic attack on D ring

of SL brings some conformational changes in ligand binding cavity and triggers specific

protein-protein interactions. D14-SLs complex is subsequently recognized by SKP1-CUL1

containing MAX2/D3 and further target proteins are selected for degradation by

polyubiquitination in SL dependent manner. The likely targets of degradation include rice

protein D53, SLR1 (Jiang et al., 2013; Nakamura et al., 2013; Zhao et al., 2013) and BES1

in Arabidopsis (Wang et al., 2013). As a result of this degradation both the receptor

(D14/MAX2) and the Ligand (SLs) are hydrolysed (Chevalier et al., 2014).


12

Figure 1.21.2 Signalling and perception pathway of strigolactones (Saeed et al., 2017)

The catalytic triad serving as ligand binding moiety in receptor D14 act as ligand binding moiety and attacks

the enol ether bridge of synthetic or natural SL. Upon binding D ring, bound SL receptor complex undergoes

conformational changes to make co receptor moiety the F-box/MAX2 to bind with the D14-Ligand complex.

Such interaction promotes further binding between MAX2 and its target(s), leading to ubiquitination and

degradation of the latter by the proteasome machinery and downstream signalling pathways.


13

The D14 induced hydrolysis of Rac-GR24 and co-crystallization of D14 receptor-GR24

complex resulted in D14 bound hydrolysis intermediates. X-ray structural data coupled

with computational modelling and hydrogen-deuterium exchange mass spectrometry

revealed that, D14 prioritize the binding of SL in ligand binding pocket and then binds with

D3/MAX2 in SL dependent manner particularly on the surface residue of D14 (Zhao et al.,

2015). This interaction is followed by systemic destabilization and hydrolysis of receptor,

hormone and the effector protein which is required for SL perception as shown in Figure

1.2.

It is; however, noteworthy that D14/DAD2 are highly specific for SL perception and

depends on stereo-specificity of SL molecules. Enantiomers of biologically active SLs bind

differently with D14 receptor depending on their orientation and induce conformational

changes that platforms D3/MAX2 interaction (Flematti et al., 2016). The paralogues of D14

in Arabidopsis KARRIKIN INSENSITIVE 2 (KAI2) structurally very similar to former is

involved in signalling and perception of Karrikins (KARs). Unlike SLs, KARs are smoke

derived butenolide compounds that promote seed germination and development of young

seedling. Nevertheless, both D14 and KAI2 have similar mechanism of binding the ligand

and degradation of effector proteins (Kagiyama et al., 2013). Both signalling pathways

putatively converge at D3/MAX2 and proteosomal degradation of repressor proteins

depending of type of stimulus and physiological response (Challis et al., 2013; Nelson et

al., 2011; Waters et al., 2012). However, there is still an ambiguity how MAX2

discriminates between different signalling pathways to generate multitude responses.

Nonetheless D53 orthologue in Arabidopsis SMAX1 promote KAI2 dependent signalling

in young seedlings and is required for KAI2-dependent signalling in seeds and seedlings

but does not apparently play a role in the control of shoot growth (Li et al., 2015). The

hitches in the current understanding SL signal perception and transduction and receptor-

ligand dynamics are being decoded now with the help of synthetic analogues. One of the

major potentials of synthetic SL analogues and mimics is to obtain structure and activity

information according to targeted functions like parasitic weed germination, AM fungi

promotion, downstream SL functions in comparison to GR24 as reference compound. To

aid the screening and synthesis of effective analogues, computational tools were developed


14

for in silico analysis. Still a lot of work has to be done in designing, testing and application

of SL analogues and screening their virtual efficacy in planta.

More aspects about SLs biosynthesis, perception, and signalling as well as structure-

function relationships have been nicely addressed and updated in several recent reviews

(Al-Babili and Bouwmeester, 2015; Janssen and Snowden, 2012; Ruyter-Spira et al., 2013;

Zwanenburg and Pospíšil, 2013).

SLs function in response to stress

Plants in field conditions are exposed to multiple stresses at the same time, one or more

stress combines leading to stress protective plant response. SLs have emerged to be

substantial players of plant stress physiology like nutrient starvation (Bonneau et al., 2013;

Marzec et al., 2013; Yoneyama et al., 2012), drought and high salinity (Bu et al., 2014; Ha

et al., 2014; Liu et al., 2013; Saeed et al., 2017; Visentin et al., 2016), light stress

(Gonzalez-Perez et al., 2011; Jia et al., 2014).

ABA, sometime referred as stress responsive growth regulator, due to its role in stomatal

closure act as long range signal triggered by abiotic stresses like drought, desiccation,

salinity, pathogen and wounding (Davies et al., 2002; Zeevaart and Creelman, 1988).

During dehydration, ABA accumulation is the prime response in plants for stress response

and ultimately stromal closure. However, de novo synthesis of ABA in leaves and roots is

also reported (Boursiac et al., 2013). These sudden changes in ABA level peculiarly act as

messenger to change the architecture of plants at root and shoot level (Davies et al., 2002;

Verslues and Zhu, 2005; Wilkinson and Davies, 2002). At molecular level changes in ABA

biosynthesis induce expression of many genes directly or indirectly by upregulation

/downregulation of transcription factors (Chandler and Robertson, 1994). Although ABA

is the most studied stress-responsive hormone, the role of SLs in regulation of ABA

mediated stress resilience emerging. Crosstalk between the different plant hormones results

in synergetic or antagonist interactions that play crucial roles in response of plants to

abiotic stress (Arc et al., 2013; Fahad et al., 2015; Fujita et al., 2011; Wani et al., 2016).

SLs focused research has entered into new phase of attempts to reveal the molecular level

interaction with ABA in monitoring stress resilience in plants, which is comparatively new

and of utmost importance. The shared carotenoid precursors and catalysing enzymes of

Field Code Changed


15

SLs and ABA shed light on many unseen molecular crosslinks between the two hormones

(section results Figure. 3.15). However, the biosynthetic and developmental interactions

suggest the underlying role of ABA on production or regulation of SLs and ABA (Saeed

et al., 2017). It is tempting to speculate that both hormones interact with each other at the

biosynthetic level, and that induction of ABA biosynthesis influences SLs formation and

vice versa. However, recent work done to reveal such endogenous interaction at

biosynthetic level have been sought in different prospects.

SL-ABA regulation during Abiotic stresses

In the first report of SL-ABA regulation and/or interaction ABA synthesis was blocked by

the specific NCEDs inhibitors (Abamine SG), the synthesis of 3 major SLs in tomato were

also observed to be dampened when compared to WT. Along with the reduction of SLs,

there was slight reduction of ABA in roots of treated plants (López-Ráez et al., 2010).

Interestingly, to investigate that low level of SL also affects ABA in the same way, plants

treated with inhibitor of SLs biosynthetic genes didn’t show any effect on ABA in roots.

The role of ABA in SL biosynthesis is apparently dependent on ABA level in roots, which

acts a signal to activate organ specific response. However, so far only few experimental

endeavours have been taken to unravel such interaction that too with partial contradictions.

Until now, the mechanism of how ABA affects SL or vice versa is still to some extent

ambiguous. Later Arabidopsis SL biosynthetic and signalling max mutants were subjected

to drought and salinity stress to investigate the involvement of SLs in abiotic stress

resilience. Both SL deficient and response mutants showed stress sensitive phenotype at

different developmental stages (Ha et al., 2014). If SLs contribute to drought resistance

one would expect their levels to increase under stress. This may be true in shoots, where

although metabolites remain under the detection threshold, the transcript of biosynthetic

genes are more concentrated in dehydrated than unstressed wild-type tissues, both in

Arabidopsis and tomato. However, surprisingly, the opposite is true for the main site of SL

production under normal conditions, i.e., the roots. There, both the transcript of genes

involved in SL biosynthesis and exudation, and the metabolites themselves in tissues and

exudates, were markedly decreased by drought or salinity in non-mycorrhized tomato

(Ruiz-Lozano et al., 2016; Visentin et al., 2016) and by osmotic stress in Lotus (Liu et al.,

2015). In the latter set of experiments, even the increase of SL exudation triggered by P


16

starvation alone was reversed to a sharp decrease under combined osmotic/low-P stress,

indicating that in the case of multiple stresses, response to one can override the other. The

role of SL in circumventing abiotic stresses was further proved by exogenous application

of SL, where SL deficient mutants were rescued from abiotic stress but SL signalling

mutants were not. Further, exogenous ABA applied on SL depleted plants, to check if, SL

compromised plants under stress could be rescued with ABA as they did with exogenous

SL. Interestingly all SL mutants were insensitive to various concentrations of ABA as

compared to WT plants at germinating and seedling developmental stages. It was unclear

if SLs exerts their role in drought and salinity due to ABA or later regulate SLs when stress

is perceived. It could be presumed that both phytohormones target some shared protein and

/or genes which are drought/salinity inducible. In fact, ABA importer genes were found to

be downregulated in SL signalling mutants under normal as well as drought conditions

pointing towards failed or reduced stomatal closure even after application of ABA. Finally,

both MAX3 and MAX2 reduced expression under dehydration in SL signalling mutant

when compared with WT provides additional clue for regulatory role of SL in stress

tolerance. In addition, both genes were shown to be upregulated by stress and/or ABA

treatment. This also evinces that changes in SL synthesis is not only dependent on nutrient

limitation but also on endogenous ABA, which plays regulatory role in SL signalling at

post transcriptional level rather than correlation at enzyme levels (López-Ráez and

Bouwmeester, 2008).

Sensitivity of max2 i.e. SL signalling mutant in Arabidopsis against abiotic stresses as

reported by Ha et al., (2014) was somewhat confirmed by Bu et al., (2014) with shared

conclusion on hypersensitivity of SL signalling mutants to dehydration and elevated

transpiration rate due to reduced stomatal closure as compared to WT.

severalSeveral evidences to support interaction of both hormones at various level have

been mentioned and taken together role of SLs in ABA dependent and/or independent

stress resilience cannot be over-looked and further insights may reveal missing clues to the

puzzle. Positive role of SLs in osmotic stress and organ specific SL mediated stress

response was demonstrated in Lotus japonicas. Osmotic stress and nutrient starvation

together repressed ABA level in SL depleted shoots of Lotus as compared to WT, while in

root this effect was found missing. Since P starvation alone can alter SL but not ABA


17

levels, but when both stresses P starvation and osmotic stress were combined a potent

interaction between two hormones was reported in SL deficient Lotus plants (Liu et al.,

2015). The mutants were found to be more prone to dehydration due to more loss of water

and altered stomatal conductance. In fact, ccd7 plants remained hyposensitive to exogenous

application of ABA (low concentration 5-20uM) just like Ha et al., (2014). This certainly

shows that endogenous SL have important positive role in stress modulation in ABA

dependent and/or independent manner at shoot level. If SLs do have role in improvement

of plants status when exposed to abiotic stress, then it could be possible that abiotic stress

other than P starvation can limit SL exudation as well. These organ specific dynamics were

interesting to speculate that roots and shoots perceive SL-ABA interactions in different

manner under stress condition.

As mentioned previously ABA mediated organ specific dynamics during dehydration are

main source of depletion or accumulation of ABA in roots and/or shoots (Manzi et al.,

2015). Likewise, SLs are reported to display shoot specific accumulation during osmotic

stress and decipher different root/shoot related dynamics under stress and normal

conditions. Both hormones travel towards shoot, during the drought stress SL level

decreases in roots which triggers localized ABA synthesis in roots as a chemical signal for

stress for above ground parts. However, SL depleted shoots during abiotic/drought stress

experience decrease in the level of ABA in shoots while in roots there is no such effect.

Thus drought hypersensitivity and ABA hyposensitivity shown by SL depleted plants

(Tomato, Lotus, Arabidopsis) is a persuasive proof that during the stress, ABA needs SLs

at shoot level to exert its effects (Saeed et al., 2017)

In tomato WT/SL- hetero grafts of SL depleted root stocks and WT scions, which mimics

partly the mild stressed state depicted low stomatal conductance under normal conditions.

This observation confirmed the previous hypothesis that SL decrease in roots (that occurs

normally under stress) and slow increase in ABA, platforms a pseudo stress state in shoots

which becomes more sensitive to ABA and consequently low stomatal conductance occurs

(Visentin et al., 2016). This acclimation to drought/osmotic stress in shoots require SLs.

Seemingly as reported before (Lotus and Arabidopsis) and unlikely in tomato ccd8, whole

plant SL depletion (self-grafted SL-/SL-) increases the ABA level in roots and shoot

making SL depleted shoots, hyposensitive to exogenous ABA and hypersensitive to


18

drought stress. Interestingly, to this model of SL mediated negative regulation of ABA in

stress response, the shutdown of SL in roots has been proposed as mobile signal which is

proposed to travel towards shoots by unknown players/regulators of stress adaptive

response. This could still keep SL-ABA façade under vital new discoveries to find missing

links.

In conclusion, so far role of SLs/ABA crossroads reflect the explosion of interest and

considerable progress that has recently been made in the dynamic field of plant biology,

with a particular focus on better understanding hormonal cross-talk in plant development

and stress responses. The growing interest in involvement of SLs as new players in abiotic

stress tolerance is escalating because of wide focus on possibility of phytohormones

engineering. Our growing knowledge of SLs definitely require deep insights into SL-ABA

dilemma before it could be used for improvement of crops under natural stress conditions.

These interactions are key regulators of plant adaptation to diverse range of stress levels

conferred by the plant and are mostly sought to understand how SLs biosynthesis and

regulation is linked to other factors for SL-regulated developmental processes. It is

tempting to speculate that overexpression of SL biosynthetic genes could create a quasi-

stress condition and organ level dynamics of both SL-ABA hormones can improve stress

tolerance or at least stress avoidance.

Tomato as model organism

Tomato being short-lived perennial dicot are cultivated mainly for their fruits, which are

considered savoury for their flavour. Plants are 1–-3m long, herbaceous, may grow as vines

or bushy and sprawling depending on their determinate or indeterminate nature. In addition

to high nutritious value, it also serves as a great tool for advancements in plant

biotechnological research. Tomato is a great model system for both basic and applied

research due to number of useful features it possesses. The relatively short life cycle,

smaller genome (950 Mbp), high self- fertility or inbreeding rate and homozygosity, ability

of asexual reproduction and heterografting, controlled pollination, ability to develop

haploids, availability of transformation system and diverse germplasm has made tomato

ideal model system for improvement of other dicotyledonous plants (Ling et al., 1994).

Interest in tomato as model plant in recent years has considerably increased due to


19

availability of tomato genome sequence (Tomato Genome Consortium, 2012) and due to

its inherit adaptability to fluctuating growing conditions. The dwarf cultivar Micro-Tom

was created by crossing Florida Basket and Ohio 4013–-3 predominantly for ornamental

purpose is considered as emerging model system bearing all the above mentioned unique

characteristics (Kobayashi et al., 2014; Matsukura et al., 2008). After whole genome

sequencing of tomato “Heinz 1706” by an international collaboration (Tomato Genome

Consortium 2012), the reference genome sequence has been made available to compare the

DNA polymorphism and phenotypic differences across various cultivars of S.

lycopersicum. Several dedicated studies have been initiated after the availability of

reference genome sequence and mapping data regarding comparative transcriptomics and

expression analysis of genes associated with environmental stress response in wild as well

as cultivated tomato varieties for improvement of desirable traits (Aflitos et al., 2014;

Koenig et al., 2013; Lin et al., 2014). Tomato has been used as genetic model for fruit

crops for sequence and expression analysis, gene cloning as well as QTL mapping (Frary

et al., 2000; Zamir, 2001) due to its phylogenetically distant nature from routinely used

model plant organism like Arabidopsis, pea, rice, maize or poplar.

Tomato cultivation in Pakistan

Since, tomato is a subtropical crop hence annual production decline due to environmental

constrains such as temperature fluctuation, drought or excessive rains, compromised soil

conditions and pest/insect infestation (Hamza and Chupeau, 1993; Plastira and Perdikaris,

1997). According to food and agriculture organization (FAO) statistics Pakistan is ranked

34th among tomato producers globally. It is the second most cultivated crop and the

production has steadily increased from 268,800 tons in year 2000-01 to 561,900 tons during

2008-09. 599,588 tons of tomatoes has been produced from 62,930 hectares of land under

cultivation in 2014 (FAOSTAT, 2015). However, the annual production of tomato is less

than other countries in Asia. Nonetheless, favourable summer environment and ambient

temperature, yield losses due to pathogen invasion and devastating monsoon during the

year 2014–-2015, Pakistan has imported tomato from the neighbouring countries of worth

PKR 9.5 million [Ministry of National Food Security & Research Pakistan]. Tomato is

grown throughout the year in some parts of the country part of the country; however, being


20

subtropical crop most of the commercial varieties are sensitive to different environmental

stresses, including salinity, drought, and excessive moisture etc. Hence, the supplies are

substantially reduced during intense heat and rains of summer and monsoon months from

June to August. In the hot-wet season, production shifts from lowlands to the relatively

cooler and dryer highlands. Because high land production areas are limited, tomato supply

dwindles in the wet season resulting in drastic price increases. Another period of stress is

the onset of frost during December and January when production is depressed. There is

limited genetic variation for abiotic stress tolerance within the cultivated species. Tomato

crop is also very susceptible to viruses (TMV, TYLCV) and mosaic diseases, especially

when the crop is transplanted early during the months of August-September (Khokhar,

2013). Activity of virus vector especially whitefly is very high at that time of the year.

Nematode problem is also becoming another serious problem. . Prevalence of high

temperatures in Punjab limits the production period in summers. Furthermore, variations

in biotype of insects and resistance development in plants against phytopathogens has been

a great threat to tomato production (Chaudhry et al., 2010; Shakoor et al., 2010).

Tomato varieties grown in Pakistan

Most commercial varieties grown widely in Pakistan have been imported from other

countries like USA and Europe. Total of 326 genotypes including determinate and

indeterminate varieties are cultivated with some exclusive preference due to

yield/productivity. Important varieties include determinate Nagia, Pakit, Naqeeb,

Riogrande, Roma, Napoli, Northern delight, while indeterminate include Baluchistan

cherry, Orange roma, New cherry, Nepal, Beef steak. Various hybrids have been developed

so far by crossing varieties with most desirable traits like fruit quality, shelf life, and

resistance to abiotic and biotic factors. Two new lines of hybrid tomatoes have been

established with desirable traits (yield/pathogen resistance) Sundar Hybrid (suitable for

high tunnels) and Ahmar Hybrid (low tunnels) by vegetable research institute Faisalabad

and being tested at multiple locations (Najeebullah, 2014).


21

Challenges faced by tomato production

Biotic factors

Notwithstanding the importance of tomato as most cultivated vegetable crop, the

production is facing myriad of pitfalls due to environmental challenges like pest and

pathogen invasions. Tomato hosts >200 species of a wide variety of pests and pathogens

that can cause significant economic losses. These pests, often carrier of viral diseases are

significantly undermining the tomato chain due to pre and post-harvest yield losses

(Shakoor et al., 2010). Frequently, these pests and pathogens have to be controlled by using

chemical compounds like fungicides or pesticides. These methods may not be fully

effective, raise production costs and require compliance with chemical-use laws. They also

cause concern regarding potential risk for the growers, the consumers and for the

environment. The biotic factors includes viruses causing leaf curl and leaf mosaic, fungi

responsible for wilt and powdery mildew, bacterial scab caused by Xanthomonas

campestris and nematodes are responsible for devastating diseases leading to yield losses/

Arce up to 40% (Arshad et al., 2014; Oerke, 2006).

Abiotic factors

Abiotic stresses have far more indiscriminating impact on tomato production and causing

number of impediments to yield and cultivation of tomatoes. Most of commercial verities

are sensitive to environmental constraints in the form of abiotic stresses including salinity,

drought, humidity, nutrient starvation, temperature extremes, poor soil and water logging

conditions, oxidative shock, exposure to free radicals, UV irradiation, abnormal light and

unpredictable rainfall. Unlike abiotic stresses, resistance to abiotic stresses is a complex

process; many factors circumvent each other and often pose combined stress to plants.

Being perishable commodity post-harvest handling and losses, phenotypic disorders

(cracking, scalding, sun burning), temperature fluctuations also affect the market value of

tomato. Abiotic stresses lead to reduction in average production of tomato by 50%

worldwide (Lobell et al., 2011; W. Wang et al., 2003). Due to current scenario of drastic

climate changes abiotic stress like increased temperature and decrease precipitation can

enhance fecundity of certain pest and pathogen increasing the chances of host range


22

expansion and certain biotype resistance to plant defense mechanism, thereby

combinatorial stressors cause devastating loss to tomato food chain (Kissoudis et al., 2016).

Tomato is highly sensitive to abiotic stresses like salinity, drought, oxidative burst,

extreme temperatures. Salinity and drought are two major constraints that limit the average

yield of tomato worldwide. Tomato grown in open field are often affected by high soil

salinity conditions. In early stages of life cycle it is responsible for inhibition of seed

germination while in later stages increased osmotic stress can cause stunted growth, tissue

necrosis, leaf rolling, and malfunctioned photosynthesis (Mittler, 2006). Drought and

salinity are often manifested together in tomato cultivation combinedly termed as osmotic

stress are accounted for physiological, molecular and biochemical changes in overall

homeostasis and ionic balance of plants. Similarly oxidative stress is often caused by

extreme water deficit due to high temperature and salinity leading to deleterious effects on

cellular proteins (Serrano et al., 2012). Furthermore, combinatorial stress factors are found

to exacerbate the competitive weed growth thus worsening the water use efficiency of

tomato plants (Fontanelli et al., 2013; Ziska et al., 2010).

Genetic engineering for improved stress tolerance

Conventional breeding for desirable traits and genetic engineering are two prime methods

for incorporation of important traits in crops. However later, is a robust tool for

introduction of single as well as complex pathways to regulate the temporal and spatial

expression of genes (Ali et al., 2010). Currently numeral technologies are available for

genetic improvement with transgenes encoding transcription factors, enzymes, membrane

proteins and biosynthetic pathways. Common methods for genetic transformation involve

direct and indirect gene transfer. Direct methods of gene transfer include microinjection

through direct injection into plant cell, direct DNA delivery into the plant by micro

projectile gene transfer through biolistic and high-speed laser beam are widely used. While

less efficient methods include vacuum infiltration, ultrasound waves (Birch, 1997;

Crossway et al., 1986; Klein et al., 1987). Indirect gene transfer technology is mainly based

on biological methods (Rao et al., 2009). Although direct gene transfer methods are more

popular among plant biotechnologist for introduction of genes due to simple and

straightforward procedure; however, they are expensive and often lead to low


23

transformation efficiency. Agrobacterium tumefaciens and Agrobacterium rhizogenes are

mainly used soil borne bacteria for indirect gene transfer responsible for causing crown

gall disease by transfection of tumor inducing plasmids in host plant (Hooykaas, 2010).

This characteristic has been utilized for binary vector system, where plasmids are disarmed

and gene of interest is placed between T- DNA borders of Ti plasmid. Necessary oncogenic

and virulence gene are placed in a second vector. Upon transfer both plasmid homologous

recombination occurs and the T- DNA region with gene of interest is transferred to host

plant as a mode of transfection (Brothaerts et al., 2005; Gelvin, 2010; Lee and Gelvin,

2008). The Agrobacterium based binary vector system can be used for stable as well as

transient expression of genes. Thus, WT tumor inducing genes are removed and replaced

with the desired gene and propagated via advance expression vector system (Horsch et al.,

1985) with known selectable marker gene systems such as those encoding for

Kanamycinkanamycin resistance (Cheng et al., 1994). Agrobacterium mediated

transformation is by far most widely used method for stable integration of gene into

transcriptionally active region of chromosomal DNA (Aldemita and Hodges, 1996). This

method has been successfully used and reported for transformation of several

dicotyledonous plants such as cotton, potato, tomato and soybean (Ma et al., 2015;

Wimmer, 2003). Overview of transformation procedure is shown in Figure 1.3.


24

Figure 1.3 Overview of Agrobacterium mediated transformation in plants


25

Factors effecting tomato transformation

Although reports of tomato micropropagation and transformation are widespread since first

report (McCormick et al., 1986), different explant sources have been utilized for

organogenesis, still the process of in vitro regeneration is slow. The overview of successful

tomato ceall culture and transformation events has been summarized in Table 1.1.

In tomato the gene transfer via Agrobacterium is exceedingly genotype dependent

(Compton and Veilleux, 1991; Liza et al.,2013; Moghaieb et al., 1999; Rakha et al., 2011).

Most often the morphogenesis and totipotency of tomato has been reported to be lower

than other members of Solanaceae (Anne Frary and Earle, 1996; Trujillo-Moya et al.,

2014). In vitro morphogenesis response of various tomato cultivars relay on number of

factors such as genotype, type/size/age of explant, media formulations and growth room

conditions (humidity, temperature, photoperiod) due to which tomato transformation is not

reliable nor straightforward (Bhatia et al., 2005). Many established protocols for

transformation are laborious, time consuming and cumbersome involving preculture on

feeder layers of tobacco and/or petunia and that is also exceedingly genotype dependent

(Hamza and Chupeau, 1993; Plastira and Perdikaris, 1997). Thus establishment of

reproducible protocols for in vitro morphogenesis via direct organogenesis and somatic

embryogenesis can uplift the advancements for production of stress tolerant improved

varieties, disease free plants, germplasm conservation and rapid multiplication of in vitro

grown plants (Arshad et al., 2014; Devi et al., 2008).

Tissue culture techniques are now widely used for improvement of field crops, forest, and

horticulture and plantation crops for increased agricultural and forestry production. Today

tissue culture technology is utilized mainly for large-scale production of elite planting

material with desirable characteristics. This technology has now been used commercially

and has remarkable contribution in the high-quality production of planting material

(Horsch et al., 1985). Using in vitro regeneration potential of tomato many genes,

transcription factors and enzymatic pathways have been successfully engineered in tomato

for abiotic stress tolerance specially drought (Arshad et al., 2014; Ijaz et al., 2017; Zhang

et al., 2011; Zhang and Blumwald, 2001). Nevertheless, tThe bottleneck of tomato


26

transformation is lack of universal protocol applicable to all verities irrespective of cell

culture intractability.

For successful transformation, various factors that affect overall transformation efficiency

needed to be optimized. These factors are detrimental cause of low transformation rated in

many crop plants include nutrient media, genotype, age and type of explant, plant growth

regulators (PGRs), culture conditions and pH (Wu et al., 2006). In vitro regeneration in

different genotypes and cultivars of tomato has been reported from leaf (Behki and Lesley,

1980), cotyledons (Costa et al., 2000; Hamza and Chupeau, 1993), hypocotyls (Chen et

al.,1999), meristems (Mirghis et al., 1995), inflorescence (Compton and Veilleux, 1991),

anthers (Zamir et al.,1980), suspension cells (Nover et al.,1982). Studies have shown that

explant characteristics are highly effective for the success and commercial viability of

tissue culture systems (Akin-Idowu et al., 2009; Bhau and Wakhlu, 2001).

Explants of different age have differing level of endogenous phytohormones, which shape

their response towards outer environment, and overall morphogenesis is also influenced.

Similarly the concentration of PGRs and various combinations were also found cultivar

dependent (Jehan and Hassanein, 2013; Kurtz S.M. Lineberger R.D. and Kurtz, S.M.

Lineberger, 1983; Plastira and Perdikaris, 1997), Therefore, development of callus cultures

and their subsequent morphogenesis with right PGRs is a prerequisite for cell cultures.

Different PGRs mainly auxins (Naphthaleneacetic acid NAA, Indole-3-acetic acid IAA,

Dichlorophenoxyacetic acid 2,4–-D) and cytokinins (Kinetin KIN, Zeatin ZEA,

Benzylaminopurine BAP) alone and their ratio may lead to variable regeneration response

(Bhatia et al., 2004, 2005). The right concentration and combination of PGRs determine

the mode of de differentiation. For example, in tomato cell culture regeneration can be

induced by callus induction or somatic embryogenesis. The fate of de differentiation and

subsequent regeneration depends on type of exogenous impulse in cell culture (PGRs and

pH). Conventional callus mediated organogenesis and embryogenesis, both are widely

used for in vitro regeneration in tomato (Dubois et al., 1990). However, latter has been

demonstrated as a process consisting of callusing and redetermination of cells and genotype

independent regeneration in plants. An outline of in vitro regeneration has been shown in

Figure 1.4.


27

Figure 1.4 Schematic overview of in vitro regeneration in tomato


28

Table 1.1 An overview of in vitro regeneration events and tranformation done in tomato

Cultivar

Name

Ex-plant type Age of Ex-

Plant

PGR

used

Response Reference

Avinash,

PusaRuby

and Pant

Bahr

Hypocotyls and

leaf discs

2-3 weeks IAA,

BAP,

GA3,

Kinetin

Callus leading

to regeneration

with IAA 0.5

mg/L + Kinetin

1.5 mg/L + GA3

0.5 mg/L

(Afroz et al.,

2009)

Not

specified

Leaf, stem,

cotyledons

15 days old IAA,

BAP, Kn

Direct

organogenesis,

Massive

Shooting and

Rooting

(Sheeja et al.,

2004)

Money

maker

Leaf disc

Hypocotyl

----------- NAA,

IAA,

BAP,

IBA, Kin

and

Zeatin

Callogenesis

(Chaudhry et al.,

2010)

Dhanashri Cotyledonary

leaves and

hypocotyls

15-days old IAA,

BAP,

IBA

Direct

organogenesis,

shoot formation,

and rooting

(Wayase and

Shitole, 2014)

Roma Meristem (root,

leaf, Node,

internode

------------- 2.4-D,

BAP,

NAA,

Kin

callogenesis

(Ishfaq et al.,

2012)

Roma, cv.

Riogrande

Grande,

Money

maker,

Nagina and

Festo

Hypocotyls, leaf

disc and shoot tip

17-18 zeatin

(ZEA)

and

(IAA)

Direct

organogenesis

(Nyla Jabeen,

Zubeda Chaudhry

And Mirza, 2003)

Money

maker

Cotyledon 7–10 IBA, IAA Direct

organogenesis

(Saker et al.,

2011)(Saker et

al., 2011)


29

Daniela 144,

Brillante

179, Annan

3017, Galina

3019 and

Bernadine

5656

Cotyledon,

hypocotyls

7-10 IAA,

Zeatin,

BA, 2,4D

Optimal

regeneration

(Velcheva et al.,

2005)

Micro-Tom Cotyledon 4-5 IAA, IBA Callogenesis

and regeneration

(Qiu et al., 2007)

Hezuo 908 Cotyledon,

hypocotyls

10 IAA,

BAP

Direct

Organogenesis

(Sun et al., 2015)

cv.

Riogrande

Grande

Cotyledon 10 Zeatin,

IAA

Regeneration (Arshad et al.,

2014)

CastleRock Cotyledon,

hypocotyl

7 IAA,

ABA, BA

and

Zeatin

Callogenesis

and

organogenesis

(Abu-El-Heba et

al., 2008)

Micro-tom Cotyledon ----- Zeatin,

NAA

0.05mg/L

rooting

1.5mg/L

shooting

(Guo et al., 2012)

Rhubarb Cotyledons ----- IAA,

6BA

Direct

organogenesis

2.0 mg/L 6-BA

+ 0.2 mg/L IAA

0.5mg/L IAA

for rooting

(Juan et al., 2015)

Pusa ruby Cotyledon discs

and hypocotyl

30 BAP,

NAA

Regeneration/

organogenesis

(H D Sherkar and

A M Chavan,

2014)

Super Strain

B and Rio

Grande

Cotyledons,

hypocotyls

7-10 Zeatin,

IAA

direct

organogenesis

(Hanafy Ahmed

A. H, 2015)

UC82B Cotyledons 8 Zeatin,

IAA

Organogenesis (Cortina and Culi,

2004)

Micro-Tom Leaf 4 weeks BAP,

IAA and

Zeatin

Callogenesis

and

organogenesis

(Cruz-Mendívil

et al., 2011)


30

Rio, Roma,

Money

maker

Leaf discs,

hypocotyls

----- BAP,

IAA,

Zeatin,

IBA

Organogenesis/

Shoot induction

(Shah et al.,

2016)

Zheza

No.905

Cotyledon, stem 4-5 NAA,

BA

callogenesis (Ma et al., 2015)

------ Leaf 2 months Kinetin,

2,4-D

Callogenesis (López et al.,

2015)

Roma, Rio

Grande

money

maker

Hypocotyl, leaf

discs

------ IAA,

BAP,

NAA,

GA3, 2Ip

and

Kinetin

Direct

organogenesis

and callogenesis

(Chaudhry et al.,

2007)

IPA 5 Anther ------ NAA,

BAP and

2,4-D

Callogenesis (Brasileiro et al.,

1999)

.


31

Research aims

The objectives of Ph.D. thesis are

1. Deciphering the role of SLs in stress physiology, isolation and Cloning of CCD7 gene into

dicistronic vector system (Ali et al., 2010) driven by a constitutive promoter.

2. Screening the promising cultivar(s) of Solanum lycopersicum L by cell culture and vector

functionality in tomato through transient leaf infiltration assay followed by stable

Agrobacterium mediated transformation.

3. Molecular characterization of developed transgenic plants and comparative physiological

parameter studies under abiotic stress (dehydration).

4. Designing and synthesis of SL analogues and in planta SL quantification assay in

genetically encoded Arabidopsis model system.

o Array of SL related analogues and mimics will be tested via biological assays in parasitic

weed, receptor binding luminescence assay and validated through computational tools

o In planta quantitative assay to study SL-ABA and stress responses in Arabidopsis as a

model.

Materials and Methods Chapter 2

32

Chapter 2

Materials and Methods


33

2. Material and Methods

Experimental procedures

Plant material

The research was carried out at Plant Biotechnology & Molecular Pharming (PBMP) Lab,

COMSATS University Islamabad, Pakistan during 2014-2019. The seeds of three local

tomato cultivars cv. Riogrande, cv. Romagrande, Hybrid -17905 were obtained from

Institute of Agri-Biotechnology & Genetic Resources (IABGR) NARC, Islamabad. One

model cv. M82 was obtained form (DISAFA-Italy) were used for cell culture optimization.

Seeds of transgenic Arabidopsis pD14::D14::LUC were obtained from NCB Madrid Spain.

Seeds storage was maintained at 4oC in dark to break dormancy of the seeds and optimal

seed vigor.

Sterilization and germination of seeds

For seed sterilization, the seeds of all four varieties were first rinsed with autoclaved double

distilled water followed by immersion in 70% ethanol for 1-2 min and transferred to

different combinations of disinfectants [(NaOCl), (v/v1%-20%)], 6% NaOCl with 2 drops

of tween 20 and house hold bleach (8%) [Table 2.1]. Following sterilizationsterilization, ,

the seeds were washed five times with deionized autoclaved water and blotted dry on

sterilized filter paper. 150 seeds for each treatment were utilized in three replicates. Seed

were aseptically placed on MS growth media plus vitamins [Phytotechlabs, Product No.

M519] (Murashige and Skoog, 1962). Both full strength and half strength MS media with

varying concentration of sucrose (0%, 1%, 2% and 3%) were evaluated for their effects on

in vitro germination rate of tomato seeds. Two different gelling agents were individually

tested to solidify the culture medium: 8.0 g/L micropropagation grade plant agar

(Phytotechlabs Product ID. A296) and 4.0 g/L Phytagel (both gelling agents and

concentrations were optimized during preliminary experiments). All basal media consisted

of 4.15 g/L MS salts plus vitamins with 8.0 g/L plant agar and 20 g/L sucrose as otherwise

stated (Table 2.2). The pH of medium was adjusted to 5.8 before autoclaving. Seeds were

kept for 48 hr in dark and subsequently maintained at 23oC2, with 30–-50% humidity and

16/8 hr Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights in


34

growth room. Germination index was calculated from age of 8 days for newly emerged

seedling until 80% germination was achieved.

Table 2.1 Treatments used for seed disinfection

Disinfection

treatment

NaOCl

(% v/v)

House Hold

bleach (% v/v) Tween 20

T1 1 - -

T2 2 - -

T3 3 - -

T4 5 - -

T5 6 - -

T6 6 - 2 drops

T7 10 - -

T8 15 - -

T9 20 - -

T10 - 8 -

T11 2% or 50% v/v -


35

Table 2.2 Optimized media formulations for in vitro morphogenesis and transformation of

S. lycopersicum cultivar(s)

Optimized medium used for regeneration and transformation of tomato

Culture medium Additional Components

Germination medium (GM) 3.17 g/L MS salts, 8 g/L plant Agar and pH 5.8

Callus induction medium

(CIM)

4.15 g/ L, 20 g/L sucrose, 8 g/L plant Agar ,2 mg/L

NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L KIN pH

5.8. OR

4.15 g/ L, 20 g/L sucrose, 4 g/L Phytagel, 2 mg/L

NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L ZEA and

pH 5.8 (cv. M82)

Shoot induction Medium

(SIM)

4.15 g/ L MS salts, 20 g/L sucrose, 8 g/L plant Agar

,3 mg/L BAP and 0.1 mg/L IAA pH 5.8

Root induction Medium (RIM) 4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar

and 0.5 mg/L NAA or 1 mg/L IBA pH 5.8

Rhizoids induction medium

(RhIM)

4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,

0.5 or 2 mg/L NAA and pH 4.0

Tubers induction Medium

(TIM)


5 mg/L BAP or 5 mg/L TDZ and pH 4.0

Pre-Culture Medium (PCM) 4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,

1 mg/L NAA, 1 mg/L BAP and pH 5.8

Co-Cultivation Medium

(CCM)


2 mg/L NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L

KIN and 200 μM acetosyringone Acetosyringone

and pH 5.8

Selection Medium (SM) 4.15 g/L MS salts, 20 g/L sucrose, 2 mg/L IAA, 2

mg/L BAP, 4 mg/L KIN, 300 mg/L Cefotaxime

cefotaxime or 300 mg/L Augmentinaugmentin, and

600 mg/L Ticarcillin ticarcillin pH 5.8

Infiltration Medium (IFM) 4.15 g/L MS salts, 20 g/L sucrose, 2 mg/L NAA and

200 μM acetosyringoneAcetosyringone

Inoculation Medium (IM) 4.15 g/L MS salts, 20 g/L sucrose and 200 μM

acetosyringoneAcetosyringone


36

Cell culture experiments

Effect of plant growth regulators (PGRs) on callus induction via

direct organogenesis

Tomato seedlings, one-week post emergence were deemed suitable explants for this study.

Well-developed cotyledons of about 2 cm in size were selected and thereafter excised. The

distal and proximal ends of the cotyledons were aseptically cut with a sterile blade and

approximately 1 cm explants were prepared. Depending on the seedling vigor and

genotype, seedlings were allowed to grow for 3 weeks time until they have fully expanded

cotyledons. Just below cotyledonary node an acropetal cut was made to excise hypocotyls

measuring 1 cm. Explants were horizontally placed on culture vessels with their adaxial

side (cotyledons) in contact with callus induction medium (CIM). 17 different MS basal

media formulations with varying concentrations of PGRs like Naphthalene acetic acid

(NAA), 6-Benzylaminopurine (BAP), Indole-3-acetic acid (IAA), Kinetin (KIN), Zeatin

(ZEA), 2,4–-Dichlorophenoxy acetic acid (2,4–-D) and Gibberellic acid (GA3) were used

independently and in combinations enlisted in Table 2.3. The stock solutions were prepared

as 1mg/mL (1000ppm) for ease of comparison. However, to compare the molecule-

molecule diffrences among same class of growth regulators, equivalent µM concentration

of each hormone is also calculated (Appendix II). Different cytokinins were used in

increasing concentration while keeping a fixed or low concentration of auxins. NAA

(alone), BAP + NAA, BAP + IAA, combination of two cytokinins (BAP, ZEA, KIN) and

auxins analogues (NAA, IAA, 2, 4–-D) were tested. Callus induction frequency on all

hormonal combinations was recorded after 4 weeks of treatment and calculated with the

equation:

Percentage of callus induction (%) = No of callus forming explants ×100


37

Table 2.3 List of callus induction media used in the study

Treatment (Callus

induction Medium) CIM

Contents

CIMT0 (MS basal medium) 4.15 g/L MS salts+ vitamins +2% Sucrose +0.8% plant

agar pH 5.8

CIMT1 0.2 mg/L NAA (MS basal medium)

CIMT2 0.5 mg/L NAA (MS basal medium)

CIMT3 1 mg/L NAA (MS basal medium)

CIMT4 2 mg/L NAA (MS basal medium)

CIMT5 0.2 mg/L NAA+1 mg/L BAP (MS basal medium)





CIMT10 1 mg/L NAA+1 mg/L BAP (MS basal medium)

CIMT11 1/0.5 mg/L IAA+1 mg/L BAP (MS basal medium)

CIMT12 2 mg/L IAA+2 mg/L NAA+2 mg/L BAP+4 mg/L

KIN (MS basal medium)

CIMT13 2 mg/L IAA+2 mg/L NAA+2 mg/L BAP+4 mg/L

ZEA (MS basal medium)

CIMT14 0.5 mg/L IAA+2/0.5 mg/L NAA+2 mg/L 2,4-D+0.2

mg/L ZEA (MS basal medium)

CIMT15 0.5 mg/L BAP+0.5 mg/L NAA+2 mg/L GA3 (MS

basal medium)

CIMT16 2 mg/L 2,4-D+0.5 mg/L BAP (MS basal medium)


38

Effect of medium pH and auxins on induction of somatic

embryogenesis (SE)

The explants (both cotyledons and hypocotyls) of all four cultivars harvested at one-week

stage were utilized for induction of direct and indirect SE. The two auxins analogues were

used in increasing concentration NAA (at 0.5, 1, 1.5, 2 and 4 mg/L) and 2, 4–-D (at 2, 3

and 5 mg/L) during preliminary experiments against fixed medium pH value. Another

simultaneous experiment was setup to see the effect of different pH range to investigate if

optimal concentration of auxins induce SE at pH level other than 4.0. Medium pH range

(3.0, 4.0, 5.0, 5.8, 6.0 & 7.0) with fixed concentration of two auxin analogues NAA and 2,

4-D were formulated to investigate the embryogenesis. The explants were incubated in

dark on rhizoid induction media (RhIM) i.e. initiation of SE was enforced by using

particular auxins and dark influx on range of media pH. Each treatment was carried out in

triplicate by using (100 mm x 15 mm) sterile plastic plates. Number of rhizoids formed per

explant against pH range were investigated and images were captured by Nikon D5200.

Effect of cytokinins on immature somatic embryos

The low medium pH along with auxins cultivated in dark marked the induction of primary

somatic embryogenesis by forming numerous threads like structures rhizoid. The rhizoid

clusters thus formed after two weeks of culture were sub-cultured independently on rhizoid

tubers induction medium (TIM) supplemented with cytokinins TDZ (N-Phenyl-N'-1,2,3-

thiadiazol-5-ylurea) at 0, 5, 10, 15, 20 mg/L at pH 4.0. After preliminary screening effect

of cytokinins dose, pH range and illumination were tested. Effect of equal concentration of

cytokinins analogue BAP 5 mg/L in comparison with TDZ was also tested at pH 4.0.

Unlike rhizoids, which were induced in dark, rhizoid tubers (RTBs) formation was initiated

in 16/8 hr Light/Dark photoperiod. The various stages of development in RTBs were

captured with Nikon digital camera D5200.


39

Microscopic studies of RTBs

The club shaped RTBs formed via SE after 4 weeks of culture on TIM were used to study

embryogenic background of novel structures. The embryonic cell masses on surface of

RTBs at different developmental stages and their ontogenic development were studied

microscopically. The culture plates incubated for 2 weeks on low pH (4.0) were transferred

to light conditions for another two weeks. The mature RTBs thus formed were fixed in a

fixing solution FAA (Formalin: acetic acid: 70% Alcohol, 1:1:8 v/ v/v) for 24 hr. The

samples were then dehydrated sequentially in graded alcohol series of 30%, 50%, 75%,

85%, 95% and 100% and subsequently embedded in paraffin. The paraffin embedded

samples were stored at 4oC until further use. A paraffin compatible rotary Microtome

(Amos scientific AEM 480) was used to cut into 12 mm thick transverse sections of the

samples. With the help of brush, sections were laid on filter paper with one drop of 0.1%

formaldehyde to allow stretching of sections. The conditioned sections were then placed

on glass slide and stained with 1% safranin stain (Sigma). The stained sections were then

treated with xylene to remove the wax and observed under an automatic scanning system

(Zeiss AS3000B with Renishaw serial# 7p5015 automated imaging UK) and

stereomicroscope (Olympus technologies DP 12 Japan BX41TF). The images were

captured at different magnifications (25–100X) by following method described by Yang et

al., (2012)

Shooting response of novel structures RTBs and regenerating calli

RTBs developed after 4 week of culture on optimized medium (TIM) were routinely sub-

cultured on the same medium for initiation of secondary somatic embryogenesis.

Increasing concentration of TDZ was used on maturation of pro embryos while sequential

incubation on TDZ and BAP (5 mg/mL) was followed for shoot organogenesis. The

processes of shoot organogenesis was initiated following the development of RTBs in two

ways viz: in vivo and in vitro shooting. For in vivo shooting RTBs cluster with many

primary and secondary embryos were allowed to mature on same induction medium at pH

4 for spontaneous shooting. Secondly, in vitro grown RTBs were excised from main cluster

of rhizoids and somatic embryos and cultivated sequentially on fixed concentration of TDZ

for 5 days followed by subculture on BAP supplemented medium. Thus individual RTBs


40

germinated to multiple shoot and root. Alongside effect of pH and increasing TDZ

concentration on shooting response was also investigated. The experiment was setup with

excised RTBs with increasing concentration of TDZ (0, 5, 10, 15, 20 mg/L) keeping pH

value fixed (4.0) to evaluate effect of low pH on shooting response. In another set of

experiment, keeping the TDZ level fixed to 5 mg/L pH 4.0 and 5.8 was compared for

optimal shoot forming ability of RTBs.

Regenerating calli were routinely sub-cultured after one week on optimized CIM to

increase the embryonic cell mass. The calli grown for four weeks on standardized medium

(Table 2.3/2.4) were measured in size and weight. The embryogenic callus measuring >3.5

mm in dimensions and weighing more than 0.3 g were selected for multiplication stage. To

optimize the direct and indirect shoot regeneration, individual explants growing calli were

inoculated on shoot induction medium (Treatment SIMT1–SIMT6). After standardization

of most suitable PGRs combination for shoot multiplication different combination

multiplication medium were also evaluated. The effects of BAP (2, 3, 5 mg/L) with and

without auxins (IAA, NAA) were investigated to determine the average shooting frequency

and maximum number of regenerated shoots from callus. For the standard shoot induction,

MS salts with vitamins 4.15 g/L, 2% sucrose, 0.8% agar and pH 5.8 was used with 16 h of

light incubation at 23˚C±2˚C. The percentage organogenesis and number of shoots per

explant were recorded after four weeks of culture. After standardizing optimizing the most

suitable growth regulator combination, different plant growth media were also evaluated

and compared to perceive the best suitable media for regeneration and multiplication.

Rooting medium and establishment of in vitro seedling in soil

Most of RTBs formed via SE from rhizoids germinated to shoots and roots on tuber

induction medium (TIM). To induce root, 1₋3 cm long shoots sprouting from individual

calli (4 weeks) and tip of cotyledonary embryo on RTBs (2 weeks), were excised and

cultivated on root induction medium (RIM) in 5.39 × 0.7 inch culture vessels with IBA

(0.1, 0.2, 0.5, 1 mg/L), NAA (0.5, 1 mg/L) and IAA (0.1, 0.2 mg/L) as rooting hormone.

The germinated somatic embryos with well-defined shoot tips on TIM were transferred to

pH 5.8 where, they formed adventitious shoots and roots simultaneously. After 45 days,

plantlets (5₋6 leaf stage) roots were removed from vessels and washed to remove agar.


41

Plantlets were transplanted to transparent plastic pots (W × D × H: 4 × 3 ×7 inches; 22

oz) containing 750 g of autoclaved potting mix (organic compost: vermiculite; 1:1 w/w)

and covered with a polyethylene plastic bag (W × D × H; 8 × 4 × 12 inches, 1 MIL) with

3 holes to sustain humidity level. Plantlets were allowed to grow for 6 weeks under 23±2˚C,

30–50% humidity and a 16/8 h Light/Dark photoperiod. Each plantlet was given 1 mL of

half strength MS with vitamins twice in a week. Moreover, on daily basis, they were

exposed to an open-air environment for hardening before being fully transferred to a glass

house. Well-developed plantlets were transferred to a 900 g of substrate composed of soil:

peat: organic compost 1:1:1 (w/w/w) in plastic pots (W × D × H, 4.72×3.9×5.9 inches).

Cloning of strigolactone (SL) biosynthetic genes

Primer designing

Primers used in the study are enlisted in Table 2.4, used for the isolation, cloning and real

time quantitative PCR of targeted biosynthetic gene(s) designed by using Snapgene

software (GSL Biotech LLC) and synthesized by Sigma and Macrogen Korea. Primer

specificity was confirmed by Snapgene insilico PCR analysis and Sigma OligoEvaluator™

- Sequence Analysis tool. Each primer was dissolved in nuclease free water to make stock

solution of 100 μM stored at -20°C until further use. The stock solutions were diluted to

working concentration of 10 μM with final concentration of 1pmol/μL (1 μM).

Isolation of SLs biosynthetic pathways genes

Based on our preliminary studies done (Saeed et al., 2017) prime biosynthetic gene

carotenoid cleavage dioxygenases 7 (CCD7) and receptor protein of SL signaling

machinery α/β-fold hydrolase named (At) D14/DAD2/RMS3 was selected. The coding

sequence of Solanum lycopersicum CCD7 (GeneID: D100313501) and strigolactone

esterase D14 (GeneID: 101258450) were retrieved from NCBI nucleotide repository. Both

genes were isolated from Solanum lycopersicum cv. M82 in the first step by extraction of

total RNA from roots of tomato. Total RNA was extracted by using Spectrum™ Plant Total

RNA Kit (catalog# STRN250) according to manufacturer’s instruction. RNA integrity and

quantity were confirmed by gel electrophoresis and NanoDrop ND-2000. To minimize the

risk of genomic DNA contamination, RNA samples were treated with RNase-free DNase

I (NEB 2U µL−1 catalog# M0303S). For first-strand cDNA synthesis, 5 µg of DNase I


42

treated total RNA was taken in the reaction mixture using the High Capacity cDNA

Reverse Transcription kit (Catalog number: 4368814 Applied Biosystems) following the

suppliers manual as shown in Table 2.5. The 5’- and 3’- RACE CCD7 was performed with

primers listed in Table 2.4 to amplify the extreme 5’ end of cDNA pool using a SMART

RACE cDNA amplification kit according to the manufacturer’s instructions (Clontech Cat.

No. 634858).. Alongside model legume Lotus japonicus orthologue of CCD7 (LjCCD7)

previously cloned as fusion product GST–LjCCD7 into pGEX-5X-3 vector (Liu et al.,

2013) was used for amplification of LjCCD7 (Gene ID: GU441766) by using gene specific

primers. The PCR based amplification and cloning steps were performed according to

conditions in Table 2.6. The gene specific PCR products were confirmed with restriction

mapping and re-amplified with cloning primers for addition of restriction endonuclease

enzyme sites.


43

Table 2.4 List of primers used in the study

Primer Name Primer sequence

CCD7_F

CCD7_R

ATGGATCTTCAATTTGTATCACT

TTATTGTCCAAGTTTAACCATG

LjCCD7_F

LjCCD7_R

ATGCAAGCCAAACTTGTTCACAACA

TCAATTAGGTGCCCAGAAACCATGAA

Oligo

d(T)-Ancho

r Primer

GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTT

TV

RACE cDNA

synthesis

3'cDNA:AAGCAGTGGTATCAACGCAGAGTACGCGGG

5'cDNA: T25V N–3' (N = A, C, G, or T; V = A, G, or C)

RACE-PCR

GSP1 AATGCAGGCCAAAGCTTGCCATAATAT

GSP2 TTGTAGATTGGCTAGGCTAGAGTTGGTAG

UPM

CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT

XbaILJCCD7_F

HindIIILJCCD7_R

AATCTAGATGCAAGCCAAACTTGTTCA

AAGCTTCAATTAGGTGCCCAGAAACCAT

P1_Xma1

P2_Not1

TCTCTCCCGGGAATGCAAGCCAAACTT

AAGCGGCCGCAAGAATTAGGTGCCCAGAAACCA

SLd14_F

SLd14_R

ATGGTGATATTGGATTTATTAAGAAATATG

CTAAGAAGTTAAGATTCTATGAATTACATC

NcoI D14F

NotI D14R

AACCATGGTGATATTGGATTTATTAAGA

AAGCGGCCGCAAGAAGTTAAGATTCTATGAAT

GFP- F

GFP- R

GTAAACGGCCACAAGTTCA

GTTCACCTTGATGCCGTTCTT

LUC-F

LUC-R

GATTACCAGGGATTTCAGTCGAT

TGTTACTTGACTGGCGACGTA

ATCCD8-F

ATCCD8-R

GTTACCGTGAATTCTCCGA

CAAATTTCCCGATCGTCTCT

ATCCD7-F:

ATCCD7-R

AATAGGTTCCATAGCGGCT

ATCGGTAAGAACAAGCGGAA

UBQ10-F

UBQ10-

GAAGTTCAATGTTTCGTTTCATGT

GGATTATACAAGGCCCCAAAA

AtNCED3

(AT3G14440)

AATCATACTCAGCCGCCATTATCGT

TTCATTCACCGGAGCAAAATTTCCG

Formatted: Font: Not Bold

Formatted: Font: Not Bold


44

Table 2.5 High capacity cDNA synthesis from total RNA

Table 2.6 PCR reaction conditions and master mix

Reaction Volume 100 µL RT-PCR Cycle

10X RT buffer 10 µL 25oC 10min,1X

100 mM dNTPs mix 4 µL 37oC 120min 1X

MultiScribe Reverse Transcriptase (50U/μL) 5 µL 85 oC 5min, 1X

50 µM OligodT primer mix 10 µL 4oC ∞

RNase Out 1.25 µL

5µg total RNA [DNase-1 treated] (vf=50

µL)

50 µL

PCR Water (DEPC) 19.75

µL

Reaction Volume 25 µL PCR Steps PCR Cycle

10X reaction

buffer

2.5 µL Initial

denaturation

95oC 5 min, 1X

10 mM dNTPs

mix

1.5 µL Denaturation 95oC 4 0sec, 35X

50 mM MgCl2 2 µL Annealing 58-62oC 4 0sec, 35X

10 µM Forward

primer P1

1 µL Extension 72oC 2 min, 35X

10 µM Reverse

primer P2

1 µL Final extension 72oC 10 min, 1X

Taq Polymerase

(5U/μL)

0.25 µL Storage 4oC ∞

Template DNA

100 pg-1µg

3 µL

PCR Water

(DEPC)

13.75 µL


45

Figure 2.12.1 Restriction map of SLCCD7 coding sequence

Figure 2.22.2 Restriction map 1 of LjCCD7 coding sequence


46

Figure 2.32.3 Restriction map 2 of LjCCD7 coding sequence

Figure 2.42.4 Restriction map SLD14 coding sequence

Purification and sequencing of targeted gene fragments

For all cloning steps the gene specific PCR products were first were separated via 1.2% gel

electrophoresis to confirm the fragment size and subsequently cleaned by using QIAquick

PCR purification kit as follows. Five volumes of Buffer PB were added to one volume of

the PCR sample and mixed by pipetting. QIAquick spin column was placed in 2 mL

collection tube provide with the kit and the sample was added to the center of the column

to bind the DNA. The column was closed and centrifuges at 17000 g for 1 min. The flow

through was discarded and column was replaced in the same collection tube. For washing

750 µL of buffer PE was added to the QIAquick column and centrifuged for 1 min. The

flow through was discarded again and column was placed back in the collection tube. The


47

empty column with collection tube was centrifuged for additional 2 min to remove the

residual ethanol from buffer PE. The collection tube was discarded and QIAquick column

was placed in a clean 1.5 mL microcentrifuge tube. 50 µL of elution buffer was added to

the center of the column and incubated at room temperature for 2 min. The column was

centrifuged again to elute DNA. The purification steps were followed for all the amplified

products used in the cloning procedure. The purified PCR products were cloned into TA

cloning vector pGEM-T to generate pGEM-T_LjCCD7, pGEM-T_SLD14 by using T4

DNA Ligase (Promega). The ligation reactions were set up using Promega TA cloning kit

according to manufacture instruction. Five µL of overnight ligation mixture was used to

transform JM109 competent cells provided with the kit by heat shock transformation

(section 2.4.4). Transformed cells were plated on LB-ampicillin X-Gal/IPTG agar plates.

Transformed colonies were selected based on blue white screening method and confirmed

by colony PCR with gene specific primers (Table 2.4). Screened positive colonies were

grown in 2 mL of LB liquid media with 50 µg/ mL ampicillin at 37oC with constant shaking

at 120 rpm. Cell were harvested by centrifugation and plasmids were purified using a

PerfectPrep™ Spin Mini Kit (5PRIME). The sequence of the inserted fragment in pGEM-

T vectors were verified by DNA sequencing (BMR genomics Italy) and the sequencing

results were analysed by Chromas lite software version 2.1

(https://technelysium.com.au/wp/).

Plant expression vector construction

Two types of pGreen binary vector based expression system were used in the study

(Hellens et al., 2000). First one was dicistronic gene expression vector system

pGII0229MASGUS/LUC (Ali et al., 2010) based on basic pGII0229 cassette having first

cistron β-glucuronidase (GUS) under the control of P-MAS and second cistron luciferase

reporter gene (LUC) under the control of tobacco mosaic virus (tmv) IRES element

generously provided by DSMZ-Braunschweig Germany by courtesy of Dr. Zahid Ali. . For

GFP fusion constructs assembly, pGreenII0029-35S-TL-GFP provided generously by Dr.

Alois Schweighofer (MAX F. PERUTZ LABORATORIES; Vienna Biocenter )by

courtesy of Prof. Francesca Cardinale) was utilized that harbors TL-TEV translational

leader sequence from tobacco etch virus. For cloning purpose, all vector modifications and

https://technelysium.com.au/wp/


48

designing were carried out by using Snapgene molecular cloning software and confirmed

via Vector NTI Advance 11.0 (Invitrogen™ USA).

Cloning strategy of LjCCD7

For the construction of LjCCD7 vector,All the cloning steps were carried out at Department

of Agriculture, Forest and Food Sciences (DISAFA), UNITO Italy. In the first approach,

GUS gene was removed by double digestion cut out 1840 bp segment through XbaI-

HindIII and replaced with 1866 bp of LJCCD7. For GFP C/N terminal fusion constructs

the stop codons were removed via cloning primers from targeted genes. LJCCD7 was

cloned at multiple cloning site via XmaI- NotI cutout and N terminal of sGFP (S65T) was

fused with C terminal of target genes. Insertion of D14 was followed in a similar way by

NcoI- NotI double digestion. The vector cassettes used in pGreen binary vector system are

shown below.

Figure 2.52.5 T-DNA cassette of dicistronic vector (Ali et al., 2010)


49

Figure 2.62.6 LjCCD7 harboring T-DNA cassette

Figure 2.72.7 T-DNA cassette of reporter gene construct (GFP)

Figure 2.82.8 T-DNA cassette of GFP fusion with LjCCD7


50

Figure 2.92.9 T-DNA cassette of GFP fusion with SLD14

Double digestion of vector and insert

To proceed with sub-cloning of insert i.e. desired fragment with compatible restriction

enzyme (RE), both vector back bone and purified PCR product were subjected to restriction

enzyme digestion. The compatible XbaI-HindIII (Fermentas), XmaI- NotI and NcoI- NotI

(Fermentas), set of enzymes were used in double digestion at 37°C for one hr (Tables 2.7,

2.8, 2.9). Post double digestion the reaction was inactivated at 65°C for 10 min and vector

backbone was treated by 1 µL shrimp alkaline phosphatase (Fermentas) before heat

inactivation for additional 10 min at 37°C to remove the 5’ OH group and subsequent the

recircularization of vector backbone. Due to presence of HindIII restriction enzyme site

inside coding region of LjCCD7, full and partial digestion was carried out. Full digestion

produced partial fragment that contained truncated version of gene. XbaI-HindIII double

digestion was carried out in 100 µL reaction and incubated for 10, 20, 30 and 45 min at

37°C.

Gel purification of digested fragment and setting up Ligations

Following RE digestion, the fragments were separated by agarose gel electrophoresis.

Entire reaction mixture was loaded in 1.2% low melting agarose (LE Agarose Invitrogen).

The electrophoresed products of vector and gene of interest with desired size were excised

with sharp scalpel after visualization under UV light. The gel slices were weighed and


51

5PRIME GelExtract Mini Kit was used to purify DNA fragments directly from agarose gel

slice by following manufacture instruction. Three volumes of buffer PS was added to 1

volume (by weight) of gel slice. The gel was melted completely by incubation at 50°C with

continuous inversion after every 2 min for complete solubilisation. 500 µL of buffer BL to

CB2 PCRExtract mini column placed in 2 mL collection tubes. This step equilibrated the

column. Column was centrifuged for 1 min and flow through was discarded. The column

was placed back in collection tube. To bind the DNA fragment, the gel sample was added

to the center of column (800 µL at a time). The sample was centrifuged and flow through

was discarded. This step was repeated until the entire sample has been processed. The

bound DNA was washed with 700 µL of WB1 and centrifuged to discard the flow through.

2nd washing of the column was done by addition of WB2. The column was centrifuged

after flow through was discarded for additional 2 min to remove the traces of ethanol from

WB2. To elute the DNA fragments 50 µL of EB was added in the center of column

incubated at room temperature for 2 min. The column was centrifuged to get purified

product. DNA fragments purified and free from left overs of RE digestion were then

quantified by NanoDrop ND-2000. The ligations of desired vector back bone and insert

was carried out by 1:1, 1:3 and 1:5 vector to insert ratio as given in the Table 2.10 & 2.12.

Overnight ligations were carried out at 4°C; alternatively, 1 hr incubation at room

temperature was also done. At the end of incubation, the reaction was stopped by heat

inactivation at 70 °C for 10 min. 2-5 µL of ligation mix was used for transformation of

high efficiency competent cells.


52

Table 2.7 Reaction mix for NcoI- NotI double digestion

Reagents (Vf=50 µL) Standard reaction

10X Buffer O 5 µL

DNA (Insert or Vector 1µg) 2-5 µL

NcoI 4 µL (40 units 4₋fold excess)

NotI 1 µL (10 units)

DEPC water 38 µL

Table 2.8 Reaction mix for XbaI-HindIII double digestion


10X Tango Buffer 5 µL

DNA (Insert or Vector 1 µg) 2-5 µL

XbaI 0.5 µL (5 units)

HindIII 1 µL (10 units 2₋fold excess)

DEPC water 41.5 µL

Table 2.9 Reaction mix for XmaI-NotI double digestion


10X Cfr91/XmaI Buffer 5 µL

DNA (Insert or Vector 1 µg) 2-5 µL

XmaI 1 µL (10 units)

NotI 2 µL (20 units 2₋fold excess)

DEPC water 40 µL

Table 2.10 Rapid ligation mix for PCR products for TA cloning


53


2X rapid ligation buffer 5 µL

pGEM-T Vector (50 ng) 1 µL

Purified PCR product 2 µL

T4 DNA Ligase 3U/ µL 1 µL

Deionized water 1 µL

Table 2.11 Ligation reaction of vector and gene of interest

Chemically competent E. coli cells preparation

For chemically competent E. coli cells preparation DHα5/TOP10/JM109 stored as 50%

glycerol stocks kept at -20°C were streaked on freshly prepared LB agar plate without

antibiotics and incubated overnight at 37°C. Individual isolated colonies were picked and

grown in LB broth medium overnight at 120 rpm until OD600~1. This starter culture was

used as inoculum in fresh medium with 1:50 ratio and grown at 120 rpm in 37°C shaker.

The bacterial density was measured as OD600 every hour until OD600~0.2. At this point

when bacteria have entered exponential growth phase, OD600 was monitored every 15 min.

When the OD600 reached 0.35-0.4, the cells were transferred for ice incubation for 30 min

with occasional swirling to ensure uniform cooling of culture. All the steps were done at 4

°C using refrigerated centrifuge (Sigma). The tubes and all the solutions were also pre

chilled. 45 mL chilled culture was centrifuged at 4400 rpm for 10 minutes to harvest the

cells. The supernatant was decanted and pellet was resuspended (by pipetting up and down

avoiding any jerk to cells) in 24 mL of cold 100 mM MgCl2. Cells were harvested again by

centrifugation for 10 min. The supernatant was again discarded, and pellet was re-dissolved

in 12 mL cold 100 mM CaCl2, all the tubes were combined at this stage and centrifuged

Reagents (Vf=10 µL) Standard

reaction

1:1, V: I

Standard

reaction

1:3, V: I

10X rapid ligation buffer 1 µL 1 µL

Purified Vector (80-90 ng/ µL) 1 µL 1 µL

Purified RE fragments 80-100

ng/ µL

1 µL 3 µL

T4 DNA Ligase 3u/µL 1 µL 1 µL

Deionized water 6 µL 4 µL


54

again for 10 min at 4400 rpm. After discarding the supernatant carefully without disturbing

the pellet, for 3rd time pellet was re-dissolved in 6 mL of 100 mM CaCl2 by gentle pipetting

while keeping the falcon tubes on ice. Tubes were again centrifuged to harvest the cells.

The supernatant was decanted and pellet was then carefully dissolved in cold 2 mL of ice

cold 80 mM CaCl2 & 20% glycerol. The final OD600 of the suspended cells was measured

up to ~ 200-250. The prepared cells were immediately dispensed into sterile chilled 1.5 mL

microfuge tubes and snap freeze by pouring liquid nitrogen on the tubes. The cells were

kept frozen in -80°C freezer for later use.

Heat shock transformation of competent cells

The multiplication of plasmids and ligations were done by transformation of chemically

competent cells. The frozen cells were gently allowed to thaw completely on ice. The

plasmid DNA or ligation reaction was briefly spinned prior to transformation. 2 µL of

plasmid DNA or 5 µL overnight ligation was gently mixed into 50 µL of competent cells.

The tubes were gently tapped twice with finger and incubated on ice for 20 min. Following

ice incubation, the reaction tubes were subjected to heat shock in water bath at 42oC for

45-50 seconds. The cells were restored back on ice for 2 min. 900 µL room temperature

SOC/LB medium (Appendix- I) was added to the tubes to minimize the damage due to heat

shock. The cells were allowed to grow for 90-100 min with continuous shaking at 180 rpm

at 37oC. Then these transformed cells were plated on agar plates containing selection

antibiotic kanamycin and incubated overnight at 37oC. Individual colonies of successfully

transformed cells were obtained by plating 50 and 100 µL of transformed cells on LB agar

plates containing 50 µg/ mL antibiotics like Kanamycinkanamycin or Ampicillin

ampicillin depending on type of plasmid/ ligation and overnight incubation at 37oC. Single

isolated colonies were picked for colony PCR confirmation and plasmid extraction was

followed for PCR positive colonies.

Screening of colonies by colony PCR

The well isolated colonies from heat shock transformation were picked with the help of

sterile tooth pick and suspended in sterile millipore water. This suspension was used as

template for colony PCR with target gene primers. Alternatively PCR reaction was set up

in a total volume of 10 µL reaction volume containing 1 µL of 10X PCR buffer


55

(Biotechrabbit GmbH), 1.2 µL 50 mM MgCl2 (Biotechrabbit GmbH), 0.25 µL 10 mM

dNTPs (Sigma), 0.8 µL of 10 mM primer pair, 0.12 µL of 5 unit/ µL Taq polymerase

(Biotechrabbit GmbH) and sterile millipore water. The colonies were picked individually

and inoculated directly to PCR tubes with sterile toothpicks. The tooth picks were removed

after 5-10 min from the PCR tubes. PCR amplification was done in the Bio-Rad T100 PCR

thermal cycler with following conditions. DNA was initially denatured at 94˚C for 5 min

followed by 30 cycles of denaturation at 94°C for 1 min, primer annealing at 59.1°C for 40

sec and primer extension at 72°C for 2 min. The final extension was done at 72°C for 10

min. PCR products were kept at 4°C. Amplified products were separated by electrophoresis

using 1.2% (v/w) agarose gel, stained with ethidium bromide and visualized under UV

illumination. The 100 kb & 1 kb DNA ladder (5PRIME & Viogene) were used as a

molecular weight marker to confirm the size of amplified products. The colonies showing

product size of ~ 2 kb & 800 bp were deemed suitable for further confirmation.

Plasmid Isolation by alkaline lysis

Plasmid isolation was performed by using 5PRIME PerfectPrep Spin Mini Kit and alkaline

lysis by Sambrook and Russell, (2006) with some modifications. Individual colonies of

bacteria screened by colony PCR were picked and grown in 10 mL of LB medium

supplemented with kanamycinKanamycin at 37oC in shaking incubator at 150 rpm. The

cells were harvested by centrifugation at 13000 rpm for 10 min and the supernatant was

decanted. The pellet was suspended in 200 µL of solution I (25 mM Tris- Hcl, pH 8.0, 10

mM EDTA, 50 mM Glucose and Lysozyme 2 mg/ mL or 100 µg/mL Rnase A) with

vigorous vortexing, and incubated for 5 min on ice. 400 µL of freshly prepared solution II

was added (0.2 N NaOH, 1% SDS), and mixed by inverting the tubes 2-3 times and

incubated at room temperature for 5 min. 300 µL solution III (3M potassium Acetate, pH

4.8) was added, mixed by inverting the tubes and incubated on ice for 20 min. The tubes

were centrifuged at 13,000 rpm for 10 min at 4oC. The supernatant was carefully collected

in new collection tubes. The supernatant containing plasmid was extracted twice with 500

µL chloroform. Then DNA was precipitated by adding two volumes of isopropanol. The

pellet obtained after this step was washed with 70% ethanol and dried for 1 hr at room

temperature. The pellet was dissolved in 20 µL of Tris EDTA (TE) buffer containing

RNaseA (10 mg/mL) [Fermentas]. Plasmid DNA were separated by electrophoresis using


56

1% (v/w) agarose gel prepared in 1X TBE buffer stained with and visualized under UV

imaging system. The plasmid were confirmed based on size and further analysed for

restriction enzyme digestion and PCR confirmation.

PCR confirmation

Plasmid obtained were confirmed by PCR amplification with forward and reverse primers

for GUS, and LUC and GFP genes as described in (Table 2.4).

Agrobacterium tumefaciens competent cells

The Agrobacterium strain EHA105 & GV3101pMP90 were first transformed with a helper

vector pSOUP containing a tetracycline resistance gene, giving rise to EHA105::pSOUP

and GV3101::pMP90::pSOUP. Both strains were inoculated from glycerol stocks at -20°C

on YEP agar medium (yeast extract 10 g/L, bacto peptone 10 g/L, NaCl 5 g/L ,15g/L at pH

7.0) with antibiotics (EHA105/Tet 25 mg/L, GV3101/Rif 50 mg/L+ Gent 20mg/L) at 28

°C for 48 hr. Well defined colonies were inoculated in 5 mL of YEP liquid medium with

antibiotics. Next day, tubes were initially observed visually for bacterial growth by

comparing it to control (YEP medium only). The OD600 nm of the overnight culture was

set to 1 on the Nano volume spectrophotometer. 50% glycerol stocks were made from

overnight grown culture and stored at -20°C.

The thermo competent cells of Agrobacterium strains EHA105 and GV3101 were prepared

using methodology described by (Sambrook and Russell, 2001) with some modifications.

Overnight bacterial culture in YEP liquid media with antibiotics having OD600 0.8-1 was

diluted 1:50 in fresh YEP medium and grown with vigorous shaking of 200 rpm at 28 °C

until OD600 reaches to 0.3. After this point the growth was measured every 10 min. The

culture with OD 0.4-0.6 was used to make thermo competent cells. All steps were followed

at 4 °C using refrigerated centrifuge. The culture was transferred to chilled 50 mL falcon

tubes and kept on ice for 10 min. 45 mL of culture was centrifuged at 3000 rpm for 10 min;

supernatant was discarded by draining and inverting the tubes. Pellet obtained was

dissolved in 10 mL of pre-chilled 20 mM CaCl2 and centrifuged again at 3000 rpm for 10

min. The supernatant was again discarded and pellet was dissolved in 2 mL 20 mM CaCl2

and centrifuged. The supernatant was finally decanted and pellet was carefully suspended

in 1 mL of 20 mM CaCl2. The cells were aliquoted into chilled tubes and snap frozeneeze

in liquid nitrogen.


57

Freeze thaw transformation of Agrobacterium competent cells

Transformation of Agrobacterium competent cells was done by freeze thaw method

reported by (Jiménez-Antaño et al., 2018; Weigel and Glazebrook, 2006). Frozen cells

were thawed on ice and in case of freshly prepared cells, 100 µL aliquot of cells were taken

directly in sterile 1.5 mL Eppendorf and 5 µL of plasmid DNA was added. The tubes were

tapped twice and incubated on ice for 5 min. The tubes were then sequentially submerged

in liquid nitrogen for 5 min and then at 37C for 5 min. The tubes were again returned to

ice for 5 min. 800 µL of SOC medium (Appendix I) stored at room temperature was added

to the tubes to release the heat shock. Tubes were then incubated at 28 °C at 200 rpm for

3-4 hr. 50 µL of the culture was spread on YEP agar plates with Rif 50 mg/L + Kan 50

mg/L (GV3101) and Kan 50 mg/L (EHA105). The plates were incubated at 28 °C for 48

hr and well defined isolated Kanamycinkanamycin resistant colonies were selected by

performing colony PCR described in section 2.8.4.6. Slight modification was made when

performing colony PCR of Agrobacterium strains. The colonies were grown overnight in

selective medium with constant shaking at 200 rpm. Next day 200 of overnight grown

culture was centrifuged for 5 min. The pellet was washed and suspended in 500 µL sterile

nuclease free water. The suspension was boiled in water bath at 95 °C for 5 min to release

the DNA. The tubes were then spinned to settle down the debris and 5ul of supernatant was

used as template in 10 µL reaction with gene specific primers for confirmation. PCR

positive colonies were selected and grown in antibiotics containing media for further

transformation procedure.

Glycerol stocks preparation

For storage of E. coli & Agrobacterium cells containing propagating plasmid of interest,

positive colonies that were confirmed by PCR were inoculated in 5 mL of LB or YEP liquid

medium in a shaking incubator for 3 hours. When cells have entered in an exponential

growth phase, this starter culture was used to inoculate fresh media with antibiotics

according to plasmid characteristics. The bacteria were allowed to grow overnight for 12-

16 hr until OD600 reaches to 0.8-1 or 1-1.2 for E. coli & Agrobacterium respectively. These

bacteria were used to make glycerol stocks. 86 % autoclaved glycerol was used to make

stocks. 500 µL of bacterial growth was added to 500 µL of 86% glycerol. The cryogenic

tubes were vortexed vigorously to evenly mix the suspension and stored at - 20 °C for 2


58

month and - 80 °C for six months. Alternatively, for one-time usage loop full bacterial

suspension was streaked on LB agar slants in 2 mL Eppendorf tubes (NEST) and stored

for future use.

Transient expression analysis by agroinfiltration

KanamycinKanamycin resistant transfected colonies were streaked on LB plates

containing Kanamycinkanamycin/rRifampicin (50 mg/L) and incubated at 28°C for 48 hr.

Freshly appeared individual colonies were inoculated in 20 mL YEP (yeast extract 10 g/L,

bacto peptone 10 g/L, NaCl 5 g/L at pH 7.0) containing appropriate antibiotics at 28°C at

200 rpm to an OD600~1. Bacterial culture was centrifuged at 4400 rpm and pellet was

resuspended in 1 mL of inoculation medium (IM) (Table 2.2) with 100-400 µM

Acetosyringone acetosyringone (AS). The OD600 for transient inoculation was set to 0.3-

0.6 and for stable transformation, 0.6-1 was used. The IM was left for 4 hr at room

temperature to settle down the cell debris. Before inoculation to facilitate the infiltration of

Agrobacterium strains, different concentration of NAA (1-2 mg/L) was added in

supernatant of inoculation medium i.e. infiltration medium (IFM) to aid in infiltration of

Agrobacterium strains. 0.9% saline was also used as control infiltration medium to achieve

best results and process optimization. 2 mL of the liquid above cell debris was taken for

leaf and fruit infiltration. Agro-infiltration was performed by modification of method by

Schöb et al., (1997). Bacterial suspension was applied with the help of syringe 1- mL

syringe with a 0.5-×16-mm needle, against the lower side of leaf lamina using upper young

leaves. Infusion was done by applying pressure on opposite side of leaf parenchyma until

half of the leaf gets infiltrated (Schöb et al., 1997). Fresh mature and immature fruits were

also infused with needle through stylar apex, 1-2 mL of IFM1 was infiltrated. Completely

infiltrated leaf samples which showed slight change of color were selected for further

analysis. Infiltrated samples were harvested for 24, 48 and 72 hr post inoculation and fixed

in ice cold pure acetone for one hr. The samples were subjected to GUS histochemical

staining and reporter gene confirmation via RT-PCR.


59

Figure 2.102.10 Agro infiltration of tomato leaves and fruit for transient gene expression

(A-C) Infiltration of tomato Riogrande leaves (B) Infiltration of immature fruits of Riogrande

GUS histochemical staining

Leaf and fruits were subjected to histochemical β-glucuronidase gene (GUS) staining by

modification of method by Jefferson et al., (1987). The leaves and fruits were cut into 2

cm long disc (slices in case of fruits) and immersed in XGluc staining solution (200 µL of

2mg/mL XGluc, 200 µL 0.5 M EDTA, 10% Triton X100, 2 mL of 200 mM PO4 buffer,

7.4 mL distilled H2O) and incubated overnight in dark at 37°C. Samples were washed

several times with absolute ethanol following day to remove the chlorophyll content from

leaves. Visualization of GUS expression was done as indigo blue stain while GFP reporter

(S65T-GFP) expression was observed under UV light and hand-held halogen spot lamp.


60

Stable transformation of Solanum lycopersicum cv. Riogrande

Ex-Plants preparation

Stable transformation of tomato was done mainly in Plant Biotechnology & Molecular

Pharming (PBMP) Lab, Department of Biosceinces COMSATS University Islamabad,

Pakistan. Newly emerged seedlings of cv. Riogrande were deemed suitable for

transformation after initial screening of regeneration potential out of four cultivars. Initially

cotyledons and hypocotyls were compared for transformation efficiency. 7-8 days old

cotyledons (1-2 cm) were cut through mid-vein region and trimmed from both sides. The

explants were wounded with sterile needle to enhance the infection and transfer of

Agrobacterium. The cut ends and wounding site also initiate callus induction in explants.

Effect of age, type of explant, orientation along with wounding were investigated. Explants

were first placed with their adaxial and abaxial sides in contact with pre-culture medium

(PCM, Table 2.2) for 2, 5 and 7 days prior to agro-infection at 23 2°C with 30–50%

humidity and 16/8 hr Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white

fluorescent lights in a growth room.

Agrobacterium mediated infection

Agrobacterium strains GV3101 & EHA105 harboring plasmid constructs (MAS::

LJCCD7::CP148LUC, 35S:: TL::LJCCD7GFP & 35S:: TL::SLD14GFP) were streaked

from glycerol stocks on YEP agar plates with Rif 50 mg/L + Kan 50 mg/L (GV3101) and

Kan 50 mg/L (EHA105) incubated at 28 °C for 48 hr. On day 3 individual colonies were

picked and inoculated in 5 mL of YEP liquid medium for 3 hr in a shaking incubator. This

starter culture was used as inoculum for overnight growth with antibiotics in 50 mL of

fresh medium with constant shaking at 150 rpm at 28 °C. Appropriate blank controls were

also set up to compare the growth of cultures. On day 4th the cultures were checked for

their OD600~1-1.2 on nanodrop. The Agrobacterium culture were centrifuged at 4400 rpm

and pellet was resuspended in 1 mL of inoculation medium (IM) [Table 1] with 200 µM

acetosyringoneAcetosyringone (AS). The OD600 of the suspension was set to 0.2, 0.4, 0.5,

0.6, 0.8 and 1 by addition of MS liquid medium. Freshly prepared hypocotyl and cotyledon

explant along with precultured explants were used in the infection process. Explants were

immersed in Agrobacterium suspension medium with gentle shaking at 28°C for 10-15 min

followed by rinsing with sterile MS liquid twice to remove the excess of bacteria. Explants


61

were blotted dry from all sides to removes excess liquid. The effect of bacterial density,

preculture treatment and age of explant were investigated that influences transformation

efficiency.

Co-cultivation and selection

Thereafter, explants were co-cultivated with their abaxial side (preliminary screening)

down in dark at 19-24°C on co-cultivation medium CCM1 (Table 2.2) for 2-3 days. The

temperature at which successful co-cultivation occurs, concentration of

co-cultivation duration (24, 48 and 72 hr) were critical factors that influence the success of

transformation. Variable temperature & acetosyringone Acetosyringone (0 μM, 100 μM,

range was used for optimal transformation efficiency. Following co-cultivation subsequent

washing of explants was done by using sterile water containing combination of antibiotics

300 mg/L cefotaxime (phytotech) and 300 mg/L carbenicillin (sigma) in combination or

300-600 mg/L timentin (Phytotech) to suppress excess Agrobacterium growth on selection

medium. The cleaned explants were blotted dry from all sides on sterile filter paper sheets.

Later they were placed on selection medium (SM) [Table 2.2]. Alongside control, explants

without infection were also plated as negative control. 7 explants were plated on sterile

petri plates wrapped with parafilm and placed in dark at 23 2°C with 30–50% humidity

for callus induction. After 15 days, callus induction was initiated on the cut ends on

selection plates from viable explants that were sub-cultured to selection media containing

Kanamycinkanamycin 50 mg/L. Once callus induction was initiated plates and other

culture vessels were transferred under 16 hours photoperiod to theat a temperature of

25±20C under 16 hr photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights.

To increase the size of regenerating calli, sub culturinge was repeated every week.

Regeneration of transformed explants

Healthy proliferating calli were transferred to shoot induction medium (SIM). The

optimized concentration of PGRs used in cell culture experiments were utilized containing

BAP at 3 mg/L alone or in combination with IAA/NAA. After 2 weeks of cultivation on

SIM containing Kanamycinkanamycin, individual shoots were excised and place on root

induction medium (RIM) for extensive root formation. Transformation efficiency was

calculated in relation to various factors tested during the experiment.


62

Transformation efficiency % = No of Kan resistant regenerated shoots ×100

No of explants inoculated

Ex-vitro acclimatization and transfer of rooted plants

Regenerated explants were grown on RIM (Table 2.2) for four weeks until they were 3–-5

cm in length, plants with fully grown roots were removed from the medium and washed

with tap water gently to remove the extra medium. The plants were then transferred to

sterile soil and vermiculite mixture (1:1) in plastic pots and covered with clear plastic bag

with holes to sustain humidity level. Potted plants were kept in growth chamber for

hardening of plants at 24 ± 2 °C under white fluorescent light having 16/8 hr Light/Dark

photoperiod (70 μmolm-2s-1). Each day plants were kept in day light for 2-3 hr and then

transferred back to growth room. Plants were irrigated with MS salt w/vitamins for two

weeks and with distilled water for next two weeks until plants get hydrated in the soil. One

and half month hardened plants were then transferred to green house with normal day light

conditions for flowering and fruiting.

β-glucuronidase (GUS) activity

To confirm the transient and stable integration of T-DNA carrying gene of interest

histochemical GUS staining & GFP based imaging was done on callus and true leaves from

regenerating shoots. For the dicistronic binary vector carrying LjCCD7, GUS gene was

replaced during cloning process. Hence, positively transformed cells of callus/leaves were

GUS negative. While in case of GFP, UV light and hand held GFP lamp was used for leaves.

For transient expression analysis, explants were dipped in staining solution immediately

after co-cultivation by the method explained above (section 2.8.4.13). Stable expression was

confirmed via dipping 4 weeks old calli/leaves in staining solution and examined under

stereomicroscope for visible blue stain.

Molecular analysis of transformed shoots

Molecular confirmation of transformation events was carried in two ways. First by total

genomic DNA isolation of putatively transformed Kanamycinkanamycin resistant shoots

and WT plants, according to CTAB (cetyl dimethyl ethyl ammonium bromide). Doyle and


63

Doyle (1987) method was followed for DNA extraction. 0.5₋1.0 g leaf tissues were

harvested using forceps and scissors. Liquid nitrogen was poured immediately pestle and

mortar immerse the plant tissue. Samples were crushed to fine dust in liquid nitrogen. 800

µL of CTAB (2.0 % CTAB (w/v), 100 mM Tris HCl (pH 8.0), 1.4 M NaCl, 3.0 % PVP

(Polyvinyl pyrolidone), 20 mM EDTA, 0.2 % w/v mercaptoethanol solution was added.

Samples were placed in water bath at 65 °C for an hour with continuous shaking. Equal

amount chloroform and iso-amyl alcohol mixture (24:1) was added. The samples were

vortexed followed by centrifugation at 13000 rpm for 20 min. Supernatant was taken in

separate tubes and 500 µL ice cold isopropanol was added. Contents were mixed by

inversion, centrifuged at 13000 rpm for 10 min. Pellet was re-suspeneded in 70% ethanol,

and centrifuged at 3500 rpm for 2 min. Supernatant was discarded again and the tubes were

allowed to air dry. Pellet was re-suspended in 50 µL TE buffer containing RNase A. 2 µL

of RNase enzyme (Fermentas) was added to the DNA sample and incubated for 1 hour at

37°C to degrade RNA contamination. The quality and integrity of DNA was done by gel

electrophoresis stained by ethidium bromide and visualized under UV light.

Subsequently, RNA isolation was done from infected tomato explants and callus after 48

hr of co-cultivation using Invitrogen purelink RNA kit. 5 µg of total RNA was utilized for

cDNA synthesis using Revert Aid first strand cDNA synthesis kit. Both DNA and cDNAs

were subjected to PCR confirmation for presence of GFP, LUC & LJCCD7 genes.

Respective positive controls were also used with specific set of primers (Table 2.4). About

500 ng-1 µg of DNA/cDNA and 50-100 ng plasmid controls were utilized in a reaction

mixture 25 µL as explained in section 2.8.2 (Table 2.3 &2.4). The amplified fragments

were separated via 1.2% gel electrophoresis stained by ethidium bromide and visualized

under UV light.

Morphological phenotyping of transgenic plants

TransgenicT0 (OE0) Lines were selfed to produce (OE1) T1 and (OE2) T2 and their

morphological attributes were compared to wild type (WT) plants of same age.

Fruit/flower size, shape and color were observed. Overall plant architecture i.e. height,

stem diameter and numbero of secondary branches of transgenic plants were measured.

Meter rular was used to measure the height of plants in cm, while stem diameter and fruit

Formatted: Heading 2, Left, Indent: Left: 0", Adjust

space between Latin and Asian text, Adjust space

between Asian text and numbers


64

size were measured with the help of vernier caliper. Leaf morphology was compared by

variation in shape and serration. Leaf allometric expansion was measured as leaf area in

cm2. LA of distal leaflets were measured with the help of ImageJ software version 1.52a

(https://imagej.nih.gov/ij/)

Biochemical test for antioxidant enzyme potential under drought

stress

Dehydration response assay

In order to determine the potential abiotic stress resistance particularly water deficit , we

tested 3 months old CCD7 expressing (OE1) T1 lines of tomato for drought tolerance were

tested by exposing soil grown WT and transgenic plants to 21 days water challenge and

survival rate determination. The irrigation of plants was withheld for 14 days and

phenotypic changes were monitored. The leaves and stem cuttings were randomly selected

as sample for later biochemical analysis of both control and OE1 lines. Extreme water

deficit treatment was given to access the survival rate of transgenic and control plants for

21 days after which irrigation was resumed and plants were monitored for phenotypic

(height, stem diameter, leaf morphology, fruit size) as well as biochemical determinants of

drought stress.

Relative water content (RWC)

Follwing full vegetative growth of the transgenic line T0 (OE0) and T1 (OE1) plants grown

in plastic pots containing sterile soil, peat and vermiculite mixture (1:1:1) in plastic pots, 3

terminal full expanded leaves were harvested from stressed and non-stressed transgenic

and cotrol tomato plants. RWC was measured by taking fresh weight of detached leaves

(FW). The leaves were then soaked in distilled water filled deep petri dish for 48 h at 4 °C

and weighed again to get turgid weight (TW). Subsequently leaves were dried in dry heat

oven at 60 °C for 48 h for measurement of dry weight (DW). The RWC was calculated by

the equation followed by Kaya and Higgs (2003) as follows.

RWC % = ((FW–-DW)/ (TW–-DW)) × 100

Formatted: Font: (Default) Times New Roman, 12 pt

Formatted: Font: (Default) Times New Roman

https://imagej.nih.gov/ij/


65

Leaf water loss index

Transgenic and control tomato plants after 7 days dehydration treatment and non treatment

control were selected and terminal leaves were sampled randomly. Initial fresh weight of

the leaves were measured. Detached leaves were placed in closed petridish in growth

chamber under controlled environment at 23 2°C with 30–50% humidity and 70 µE m−2

s−1 incubated Post dehydration treatmet for 23 2°C with 30–50% humidity and 16/8 hr

Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights in a

growth room. Water loss was measured as percent decrease of initial fresh weight over 6

hr time at an interval of 30 min in subsequent readings (Raineri et al., 2015).

Enzyme extraction

For enzyme extraction 100 mg of leaf and stem cuttings from transgenic and WT plants

were harvested randomly and instantly frozen in liquid nitrogen. The frozen sample were

grounded to fine powder in pre chilled pastel and mortar in liquid nitrogen. 1.5 mL of

phosphate (100 mM, pH 7.2), containing 0.5% triton X-100 was added to the sample

powder followed by merceration. The homogenate was centrifuged at 15,000×g for 15 min

at 4°C. The supernatant was collected as enzyme extract and stored at -20°C for further

antioxidant enzyme analysis.

Nitroblue tetrazolium SOD assay

Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined by method followed by

(Beauchamp and Fridovich, 1971) with some modifications. This method is based on the

measurement of the inhibition of photochemical reduction of nitro blue tetrazolium (NBT)

chloride dye. The reduction of NBT is followed by measure of absorbance increase

spectrophotometrically at 570 nm. The reaction mixture (3 mL) contained 75 µM NBT, 13

µM L-methionine, 0.1 mM EDTA, 0.05 M sodium carbonate and 500 µL of prepared

enzyme extract. 13 µM riboflavin was added in the last to start the reaction by irradiation

of samples under fluorescent lamps for 15 min at 25°C. The sample tubes were prepared

in duplets and marked as sample (light) and sample (dark). Appropriate blank controls were

also set up by addition of 500 µL of extraction buffer only and marked as blank (dark). The

absorbance of light sample and dark sample were measured at 560 nm by using dual beam

Analytik Jena Specord 50Plus Spectrophotometer 190(UV/Vis)-1100 nm, based on


66

Lambert–Beer’s law. Following Spectrophotometric analysis, the SOD activity was

calculated in units of SOD activity defined as the amount of enzyme required to inhibit

reduction of NBT by 50% by using formula given below.

% inhibition of NBT reduction by SOD = control A560- (A560sample (light) - A560sample

(dark)/ control A560x 100 =X% inhibition

SOD units per g fresh weight of sample = (SOD units)/ (fresh weight of sample in grams)

Guaiacol peroxidase (POD) activity

Peroxidase activity (POX, EC 1.11.1.7) was measured as increase in absorbance at 470 nm

due to oxidation of guaiacol to tetraguaiacol by modification of method followed by Lim

et al., (2016). Guaiacol was utilized as substrate for the estimation of peroxidase activity.

The rate at which guaiacol dehydrogenation product is formed due to oxidation is taken a

measure of the POD activity and can be assayed spectrophotometrically at 470 nm (Sofo

et al., 2015). The reaction mixture (3 mL) contains 2.5 mL of 50 mM phosphate buffer pH

5.0, 300 µL of 40 mM H2O2 and 100 µL of enzyme extract. The reaction was started by

addition of 100 µL 20 mM guaiacol to the reaction mixture. Changes in absorbance were

determined for 3 min at intervals of 20 seconds at 470 nm. The POD activity was measured

by using the extinction coefficient of tetraguaiacol product (26.6 mM-1cm-1) in the formula

as

Enzyme activity (m Mol UA/g FW) = change in A470/time taken (min) x 1/extinction

coefficient of enzyme x total reaction volume / volume of enzyme extract taken x total

volume of enzyme extract / Fresh wt of tissue (g)

Catalase (CAT) activity

CAT (EC. 1.11.1.6) activity was determined by rate of decomposition of H2O2 to give H2O

and O2. The decomposition rate was assayed spectrophotometrically by rate of

disappearance of H2O2 per unit time at 240 nm by modification of method followed by Ijaz

et al., (2017) for tomato. The reaction mixture (2 mL) consisted of 50 mM phosphate buffer

(pH 7.0), 10 mM H2O2 and 0.1 mL enzyme extract. The activity of CAT enzyme was


67

defined as unit change in absorbance by 0.1. Specific activity of enzyme was calculated as

milimoles by using H2O2 extinction coefficient of 39.4 mM-1cm-1 in the formula has given

below.

Enzyme activity (m Mol UA/g FW) = change in A240/ time taken (min) x 1/extinction

coefficient of enzyme x total reaction volume/ volume of enzyme extract taken x total

volume of enzyme extract/ Fresh wt of tissue (g).

Malondialdehyde (MDA) content analysis

The oxidative burst following stress encounter and lipid peroxidation level of water

stressed transgenic leaves and stem as compared to control plants was done by measuring

malondialdehyde (MDA) levels quantified by thiobarbituric acid (TBA) reaction modified

from (Sun et al., 2010). Measurement of MDA level which are by products of lipid

peroxidation activity due to oxidative stress are used extensively as an indicator of

oxidative burst. Approximately 0.1 g of leaf and stem was homogenized in 5 mL of 5%

trichloroaceticacid (TCA) with the help of liquid nitrogen. The homogenate was

centrifuged 10,000×g for 15 min at 25 °C. The supernatant was collected in separate tube

and equal amount of 0.5% thiobarbituric acid (TBA) was added to the supernatant. The

mixture was boiled at 95 °C for 25 min. The reaction was again centrifuged at 7500 ×g for

5 min. The clarified solution was this collected to measure absorbance at 532 nm and 600

nm. Absorbance at 600 nm was taken to subtract any nonspecific turbidity to calculate level

of MDA using extinction coefficient of 155 mM−1 cm in the formula given below.

Enzyme activity (m Mol UA/g FW) = OD 532-OD600 x 1/extinction coefficient of enzyme

x total reaction volume/ volume of enzyme extract taken x total volume of enzyme extract/

Fresh wt of tissue (g)

Ascorbate peroxidase activity (APX)

APX activity (EC 1.1.11.1) determines the H2O2 detoxification system in plants as a part

of ascorbate-glutathione cycle, in which APX serves as a key enzyme where ascorbic acid

act as specific electron donor for the reduction of H2O2. APX activity was measured by

following method of according to the method followed by Nakano and Asada (1981). The

reaction mixture consisted of 0.1 ml of enzyme extract, 50 mM potassium phosphate (pH


68

7.0), 0.2 mM EDTA, 0.5 mM ascorbic acid, 2% H2O2 in a total reaction of 2 mLl. The

oxidation of ascorbic acid per min was measured as decrease in absorbance at 290 nm.

Specific activity of enzyme was calculated as milimoles using extinction coefficient of

2.8 mM-1 APX. One unit of ascorbate oxidized was measured as 1 mmol ml-1cm-1 mg-

1 protein oxidized per min.

Chlorophyll content analysis

Transgenic and control plants grown in soil with drought stress treatment and without

treatment were collected randomly. 100 mg of sample was ground to fine powder in liquid

nitrogen and homogenized in 2 mL of dimethyl sulphoxide (DMSO). The chlorophyll

pigment was determined spectrophotometrically by modification of method used by

(Wellburn, 1994). The homogenate was incubated at 65° C for 30 min in a water bath. 3

mL of fresh DMSO is added to the tube and again incubated for 10 min at 60°C.

Supernatant was collected in separate tube and volume was marked upto 10 mL with

DMSO. The absorbance of chlorophyll extract was measured at 645 and 663 nm against

DMSO blank. Total chlorophyll content (a & b) was calculated by equations followed by

(Arnon, 1949) as shown below.

. ChlA (g l-1) = 0.0127 A663 – 0.00269 A645

ChlB (g l-1) = 0.0029 A663 – 0.00468 A645

Total Chl (g l-1) = 0.0202 A663 + 0.00802 A645

Total Phenols, Flavonoid and antioxidant estimation of transgenic

tomato plants

Phenolic content estimation

For The phenolic content estimation of tomato fruit and leaf extracts, Folin–Ciocalteu (F–

C) reagent assay was performed according to Ainsworth and Elizabeth (2007). Methanolic

extracts of fresh ripened fruit was prepared by merceration of 250 mg in liquid nitrogen.

The powder sample was dissolved in 5 mLl of pure methanol (Sigma). The sample was

subsequently centrifuged at 12000 rmp for 10 min at room temperature. The supernatant

was collected in separate tube and stored at -20°C until further use. The reaction mixture

is prepared by addition of 1 mLl of crude enzyme extract in 5 mLl of distilled water. 200



69

µL of sample was mixed with 200 µL of F-C reagent (Sigma) and incubated at room

temperature for 5 min. 2 mL of 5% (w/v) Na2CO3 solution was added to the reaction tube

and total volume was marked to 5 mL with double distilled water. The reaction was

incubated for 30 min at room temperature. Phenolic content was measured at 765 nm from

calibration curve of gallic acid prepared at various concentration. Total phenolic content

was determined as mg of gallic acid equivalents GAE/g FW. The calibration curve was

prepared by mixing 1 mL of 12.5, 25, 50,100, 150 and 200 μg/mL of Gallic acid solution

with 5 mL of F-C reagent and 4.0 mL of 5% Na2CO3. The reactions were incubated at

room temperature for 30 min. The absorbance was measured at 765 nm. The calibration

curve was plotted as function of concentration of gallic acid.

The total phenolic content was calculated with the help of the graph of calibration curve

(Appendix IV) by using the formula given as

Total phenolic content in mg/g =

Fresh weight of smaple (g)

Flavonoid content

Aluminium chloride technique was used for estimation of total flavonoid content

determined by following method of Chen et al., (2014). 100 mg of mercerated tissue was

dissolved in 2 mL of absolute methanol. The sample was filtered and stored at 20°C until

further use. The reaction mixture of 1 mL contained 100 µL of enzyme extract mixed with

430 µL of 5% NaNO2. Tubes were incubated for 5 min at room temperature. Subsequently

30 µL of 10% AlCl3 and 440 µL of 1M NaOH was added and the reaction was incubated

again at room temperature for 30 min. The absorbance was read at 496 nm, using standard

curve of quercetin (Appendix V). The results were measured as mg of quercetin equivalents

(QE) per g fresh weight of the sample.

Total Flavonoid content in mg/g =

Volume of

extract in mL Concentration of Gallic acid

established from the calibration curve

curve in mg/ml

×

Concentration of quercetin Gallic acid

established from the calibration curve

in mg/ml

× Volume of

extract in mL

Fresh weight of smaple (g)

Concentration of Gallic acid

established from the calibration

curve in mg/ml



70

DPPH radical scavenging assay

2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity is based on reduction

of DPPH- Methanol solution assay due to presence of H+ donating activity of antioxidants.

The antiradical activity was estimated according to Nickavar et al., (2006). 0.1 mM

solution of DPPH was prepared in absolute methanol. 0.1 mL of methanolic extracts were

mixed vigorously with 1 ml of DPPH solution. The samples were incubated in dark for 30

min at room temperature and absorbance was measured at 517 nm against ascorbic acid as

refrence. The percent radical scavenging activity was calculated as follows. DPPH stock

solution was taken as control.

DPPH Scavenging % = [(A517 of control reaction- A517 of extract / A517 of control reaction)]

×100

The EC50 value, concentration of sample giving 50% reduction of initial DPPH

concentration was regarded as EC50 of sample and ascorbic acid (reference). The values

were obtained from the graphical plot of linear regression of average % antioxidant against

concentration (μg/mLl).

Statistical Analysis

All the experiments were repeated three times with 30 explants per treatment. Significance

of differences between results was estimated by one-way analysis of variance (ANOVA)

using generalized linear model. The percentage data was arcsine transformed (arcsine

[squareroot(X)]) and square root (for count) before analysis. The results were back

transformed and presented as mean± standard error. Variation among treatment means

were compared by Tukey’s procedure at P ≤ 0.05 & means were separated by Student’s t-

test (P < 0.05) using SPSS v. 23.0 (IBM, USA. Significant differences between means

are denoted by different lower-case letters or asterisks.

Development of Smart molecular tools STRItools

(STRIgolactone tools)

Synthesis of SL analogues

To elucidate the molecular events taking place in the ligand binding receptor D14, and

identification of new SL analogues that may behave as agonists or antagonists various


71

exclusive tools were developed and implemented. The reactivity of naturally occurring SLs

containing the active D-ring i.e. the site of nucleophilic attack for binding inside the ligand

binding pocket of receptor D14 was selectively modified by replacing butenolide D-ring

of natural SLs into a lactam functional group. The synthesis of analogues and mimics along

with their stability analysis as well as docking simulations were was perfomedcarried out

at Department of Chemistry, University of Turin Italy.

Based on D-lactam system series of SL analogues were prepared by ring closing metathesis

on suitable substituted amides under optimized conditions (Figure 2.11). We also prepared

the molecules ‘SL mimics’ which lacks normal ABC scaffold of SLs but retained D-ring

connected to an additional group by means of an ether or ester functionality were prepared

as well. Another SL mimic “CL” where D ring is conjugated to an easy leaving group was

also synthesizedprepared and BODIPY (BOron DIPYrromethens) fluorophore with

Sulfonamide functional group as “CL-BP”. These molecules were observed to mimic SL

activity and due to simple structure, they can prove to be potential candidates for

applications in agriculture (Fukui et al., 2011). To investigate the binding mode of GR24-

based lactams and SL mimics within the receptor, docking simulations were performed

within the ligand binding pocket of D14 (PDB code 5DJ5). In the next step a novel in

planta based quantitative assay was developed to access the biological activity of new

analogues. Synthetic procedures, characterization, and absolute configuration assignments

were performed according to previous work Lombardi et al., (2017). Ring closing

Metathesis (RCM) was utilized for synthesis of GR24-based D-lactams. The synthesis of

analogues and mimics was carried out at Department of Chemistry, University of Turin

Italy. We synthesized four compounds of the family of GR24 based four compounds , two

with the same configuration as Strigol and two as Orobanchol were synthesized. Either

tert-butyloxycarbonyl (N Boc) NH protected (rac 1-4) compounds were prepared. Boc

group protection is considered stable towards most nucleophilic attack. EGO10 are indolyl

SL analogues, alsocorrespondingly synthesized as NH and N Boc derivative [rac 5-6]

(Prandi et al., 2011). The last family of compounds are known as SL-mimics, also in this

case as NH and N Boc derivative [rac 7 and 8] was prepared (Fukui et al., 2011). All the

compounds were obtained and used as racemic mixture. Compound rac 9 lacks the enol

ether bridge and it is expected to be inactive (Figure 2.12)


72

Figure 2.112.11 Modification of GR24 to D-Lactams


73

Figure 2.122.12 D-Lactams analogues and mimics synthesized in this study

rac-1 and rac-2 are the N-Boc-protected GR24 D-lactam diastereoisomers. rac-3 and rac-4 are the NH

GR24 D-lactam diastereoisomers. rac-5 and rac-6 are NH and N-Boc D-lactam EGO10 derivatives,

respectively. rac-7 and rac-8 are mimic D-lactams for NH and N-Boc, respectively. rac-9 is an EGO10 derivative lacking the enol ether bridge. SL mimic CL where D ring is conjugated to an easy leaving

group, devoid of ABC rings. SL mimic CL-BP conjugated with fluorescent functional group BODIPY.

SL mimics


74

Stability analysis

Different naturally occurring and synthetic analogues of SLs depict variable reactivity, a

characteristic feature of SL. Thus, differences in activity of different analogues and mimics

may be accounted for their instability in aqueous environment. Aqueous solutions of the

compounds to be tested (200 μg mL–1) were incubated at 25°C in HPLC vials. The

compounds were first dissolved in methanol (30%) or acetonitrile (50%) and then diluted

to the final concentrations with water. The time-course of degradation was monitored by

HPLC using an Agilent Technologies HPLC chromatograph 1200 Series equipped with a

photo-diode array (PDA) detector, a binary-gradient high-pressure pump, and an automatic

sampler. The column used was a LiChroCART® 125- LiChrospher® 100 RP-18 (5 μm,

Merck Millipore) maintained at 25 °C. The solvents were (A) water + 0.1% formic acid

and (B) acetonitrile, and the flow rate was 0.8 mL min–1. The initial mobile phase, 95% A

/ 5% B, was held for 3 min and then ramped linearly to 100% B at 23 min and held for 5

min before resetting to the original conditions. The sample injection volume was 10 μL.

PDA detection was by absorbance in the 200–600 nm wavelength range. Peak detection

was at the optimum wavelength (254 nm) and peak areas were used for quantification.

Initial and subsequent measurements of peak area attributable to the tested compound were

used to fit exponential half-life curves and to calculate first-order rate constants. Stability

data allowed for calculation of the time in hours for half of the tested compound to be

hydrolysed (t1/2).

Germination assay

To monitor the biological activity of newly synthesized SL-D-lactams, their ability to

promote seed germination was investigated on seeds of P. aegyptiaca and compared to rac-

GR24, strigol, ST23b, EGO10, and EDOT as the reference standard. Seeds of Phelipanche

aegyptiaca were kindly provided by Department of Department of Chemistry, University

of Turin Italy. The biological assay on D-Lactams were carried out at Department of

Agriculture, Forest and Food Sciences (DISAFA), UNITO Italy.

chemistry, UNITO.IT. The seeds were stored in glass vials in the dark at room temperature

until their use in germination tests. For the preparation of test solutions, the compound to

be tested was weighed out very accurately, dissolved in acetone at 10–2 M and then diluted


75

with sterile distilled water to the desired concentrations. All solutions were prepared just

before use. Seeds were surface-sterilized and preconditioned as described by Bhattacharya

et al., (2009). Briefly, after exposure for 5 min to 50% (v/v) aqueous solutions of

commercial bleach (2% hypochlorite) seeds were rinsed with sterile distilled water. For

preconditioning, seeds were placed on glass fiber filter discs using a sterile toothpick

(approximately 50 seeds per disc); the glass fibre discs were placed on two filter paper

discs, wetted with sterile distilled water, and incubated at 25 °C in the dark for 6 d. The

preconditioned seeds were then allowed to dry completely in a laminar flow cabinet, after

which they were treated with each compound at five different concentrations: 10–5 M, 10–

6 M, 10–7 M, 10–8 M, and 10–9 M. Their germination rate was evaluated under a

stereomicroscope 7 d after the beginning of the treatment. For each concentration, at least

250 seeds were scored; synthetic SL rac-GR24 was included as a positive control across

the same range of concentrations, while a solution of 0.001% acetone in sterile distilled

water was included as a negative control. Seeds were scored as germinated if the radicle

protruded through the seed coat 1 week after treatment. Germination values were

normalized to those of rac-GR24 at 10–7 M.

Luminometer in planta assays

Seeds of transgenic Arabidopsis pD14::D14::LUC were obtained from NCB Madrid Spain.

A binary D14p::D14::LUC vector was obtained by LR-recombination (Invitrogen) of a

pDONOR207 carrying the D14 promoter fused to the D14 CDS (Chevalier et al., 2014).

Transgenic Arabidopsis seeds were surface sterilized with 8% house hold bleach (sodium

hypochlorite) for five min and rinsed 5 times with sterile distilled water. Sterile seeds were

plated on MS salts without sucrose solidified with 4% Phytagel and kept at 4°C in dark for

3 days for stratification. Seeds were then transferred to growth room at 25°C 16 h light/8 h

dark photoperiod for 7 days. SL analogues and mimics (Figure 2.12 ) were accurately

weighed and dissolved in acetone at 10–2 M. Five different concentrations (10–4 M, 10–5

M, 10–6 M, 10–7 M, 10–8 M) were prepared by 1:10 serial dilutions in liquid MS medium,

together with blank controls containing corresponding water and acetone volumes in the

medium. D-Luciferin (potassium salt Sigma) stock was prepared at 25 mg/mL in DMSO,

aliquoted and stored at –80 °C until use; all other solutions were prepared just before the

assay. Multiwell plates were prepared with 170 µL of standard MS liquid. 7 days old,


76

Arabidopsis seedlings were placed in each well with the help of tweezer their cotyledons

facing upward as shown in Figure 2.13. 15 µL (0.125 mg/mL, diluted 1:200 in MS from

stock=1.875 µg) of luciferin was added to each well. Plate was covered with transparent

sticker and two holes were made without disturbing the seedling. Measurements were

started in multimode reader (LB942 Tristar2 S, Berthold Technologies) and allowed to

stabilize for 2-3 hours in light before addition of any treatment. 15 µL treatment (different

SLs dissolved in standard MS solution) per well is added and measurement continued for

next 24 hours. Appropriate blank controls were added as well. Each treatment was applied

to a minimum of 16 wells (seedlings), each of which was measured individually over time.

The basic principle and plan of Luminometer assay is shown in Figure 2.14. The percentage

efficacy of each compound molecule was calculated 6 h after treatment as a function of the

decrease in D14::LUC-emitted luminescence with respect to (+)-GR24 1 µM (i.e.

GR245DS), assuming that the latter, minus the drift of the corresponding blank control, had

100% efficacy. Before testing any analogues the assay was calibrated by testing already

known synthetic SL analogues (+)-GR24 (i.e. GR245DS) racemic mixture and both of its

enantiomers, GR24 d1A, GR24 d1B & (±)-EGO10 were tested at variable concentration

range (Prandi et al., 2011). The half maximal-effective concentration (EC50) for (+)-GR24

was calculated by linear regression fitting of the data (n=5, with at least three individual

seedlings and values being pooled for each replicate) at the different concentrations, minus

the values for acetone-treated samples (negative controls) and normalized in relation to

(+)-GR24 0.01 μM, which was set to 0%. Confidence intervals at 95% were used to express

errors of the means.


77

Figure 2.132.13 Multimode Luminometer based quantitative in planta assay for

of SL and SL related compounds

(A-B) Multiwell plate setup. (C) Multimode Luminometer


78

When the mobile SL enter a cell, they are bound by D14, an α/β-hydrolase-fold protein. This binding induces a conformational switch in D14 for interactions with the F-box protein D3/MAX2–SCF–E2 complex, which tags

targets such as D53 by polyubiquitination. This tagging directs degradation of target genes via ubiquitin–

proteasome pathway in SL depenedent manner. A negative feedback loop is also triggered, in which D14 is

directed for degradation, and hence luciferase activity decreases in reporter plants.

pD14::D14::LUC

SL

Figure 2.142.14 Mode of SL-D14 interaction and real time monitoring of SL related activity


79

Docking analysis

Final analysis on activity of SL based D- Lactams analogues and subsequent binding inside

protein binding pocket of D14 receptor was done by in silico studies. Ligand scout platform

was used for docking of compounds. For comparison purpose, we performed molecular

docking was performed into rice D14 (PDB: 5DJ5) using Glide from the Schroedinger

Suite. The structure of rice D14 co-crystallized with GR24 [PDB code 5dj5] was selected

as template given its high similarity to the ligands under study and the high conservation

of the binding-site residues (Zhao et al., 2015). For each compound, 25 diverse poses were

generated and analyzed. A radius of 10 Å was used to define the pocket extension.

Automatic default parameters were set for the Genetic Algorithm. Shape constraints were

imposed using as template the structure of GR24 co- crystallized within the target.

ChemScore was used as the scoring function. All calculations were performed on a Dell

Precision workstation, having two Intel Xeon processors, twelve core 1TB 7.2K 6GBPS

SAS Hard Drive, NVidia GTX 980 graphic card, and a Linux operating system centos 7,

kernel version 3.10.0-514.10.2.el7.x86_64. Molecular interaction fields were calculated

using FLAP [Fingerprints for Ligands and Proteins], using the DRY probe to describe

potential hydrophobic interactions, and the sp2 carbonyl oxygen O and the amide N1

probes for hydrogen-bond donor and acceptor regions, respectively (Baroni et al., 2007;

Grossert et al., 2015).

Analysis of ABA dynamics using in planta luminescence

based assay

Once the D14 based quantitative assay to quantify SL dynamics in genetically encoded

model was done with fruitful proof of concept, same system was investigated for

quantitative insights to check the activity of different hormones and root exudates of tomato

that share same signaling mechanism or particularly SLs related activity.

Luminescence based assays

D14-LUC quenching based assays were performed as descried in section 2.8.4 using

Arabidopsis based reporter line containing D14 receptor under indigenous promoter

(Chevalier et al., 2014). Seed were grown as described above. Phytohormones (ABA, IAA,

KIN, and GA3) were dissolved in acetone to a final concentration of 10-2 M. Five different


80

concentration 10-4 M, 10-5 M, 10-6 M, 10–7 M, 10–8 M were prepared in MS liquid. Tomato

root exudates were obtained in purified form in HPLC vials of 2.4 mg. The purified

exudates were dissolved in acetone to final concentration of 10-2M from which five

different concentrations were made by serial dilution in MS liquid. Similar dilution of Rac-

GR24 and blank MS control containing approximate proportion of water and acetone

equivalent to treatments was also prepared. D-Luciferin (potassium salt) 25X stocks were

prepared in DMSO and 8 µL aliquots were stored at -80°C. All the treatments were

prepared just before starting assay. Multiwell plates were prepared with 170ul of standard

MS liquid. 7 days old Arabidopsis seedlings were placed in each well with the help of

tweezer their cotyledons facing upward. 15 µL (1 X) of luciferin was added to each well.

Plate was covered with transparent sticker and two holes were made without disturbing the

seedling. Measurements were started in multimode reader (Berthole technologies) and

allowed to stabilize for 2-3 hours. 15 µL treatment (Hormones dissolved in standard MS

solution) per well is added and measurement continued for next 24 hours. Appropriate

blank controls were added as well. Percent efficacy of each molecule (normalized to

appropriate controls) at T=3 hr after treatment was calculated assuming GR24 1 µM at 3

hr being 100% efficient (D14 receptor-SL complex). The proportional efficacy of each

molecule was calculated as a function of decrease in signal with respect to (100% signal)

GR24 1 µM. Residual fluorescence of all molecule were calculated for time span of 15 hr

with equivalent acetone control as well as MS control.

Gene expression by quantitative reverse-transcription PCR

(qRT-PCR)

Following luminometer assays ABA treated Arabidopsis seedlings were pooled out at 0 hr,

3 hr, 6 hr and 15 hr time from the 96 well plate. Another experiment was separately set up

on petri plate, 7 days old seedlings were incubated on MS medium containing 10 µM, 10

µM, 50 µM and 100 µM of ABA for 48 hr. Total RNA was extracted by using Spectrum™

Plant Total RNA Kit (catalog# STRN250) according to manufacturer’s instruction. RNA

integrity and quantity were confirmed by gel electrophoresis and NanoDrop ND-2000.

RNA samples displaying ratio of A260/A280 ranging from 1.9-2.2 was selected further for

RNA quality inspection and cDNA synthesis. To minimize the risk of genomic DNA


81

contamination, RNA samples were treated with RNase-free DNase I (NEB 2U

µL−1 catalog# M0303S). RNA integrity was again confirmed by gel electrophoresis. 1 %

agarose gel was used to separate RNA, where good quality samples were selected for

cDNA synthesis based on intact 28S and 18S ribosomal RNA having band intensities of

2:1 (Figure 3.16).

cDNA synthesis

For first-strand cDNA synthesized 5 µg of DNase I treated total RNA was used using the

High Capacity cDNA Reverse Transcription kit (Applied Biosystems) following the

suppliers manual as shown in Table 2.5. cDNA integrity and primer specificity was

confirmed by PCR and agarose gel electrophoresis. Freshly prepared cDNA was stored at

-80°C and later used for qPCR reactions.

Quantification of gene expression

qRT-PCR reactions were set up in triplicate for 10 µL volume using SYBR Green method

(Power SYBR® Green PCR Master Mix, Applied Biosystems) on StepOnePlusTM Real

time detection system (Applied Biosystems, USA). The sequence for two biosynthetic

genes for SL, namely the Carotenoid Cleavage Dioxygenases (CCD) 7 and, 9‐

cisepoxycarotenoid dioxygenase (NCED) 3 were retrieved from NCBI nucleotide

repository. Primers (Table 2.4) for specific gene targets were designed by using Snapgene

software (GSL Biotech LLC). The RT–qPCR was conducted following treatment of

seedling. A single sample contained atleast two pooled seedlings. Reaction was normalized

for each tragetted gene using house keeping gene ubiquitin (UBI) as internal control. SYBR

Green method (Power SYBR® Green PCR Master Mix, Applied Biosystems) was used and

threshold cycles (CT) numbers were obtained. Quantification of fold change in expression

of gene transcripts (2-ΔΔCT method) with reference to ubiquitin (UBI) as endogenous

standard. Each reaction of 10 µL final volume contained 5 µL of 2X SYBR Green mix, 0.5

µM of each primer and 1 µL of template cDNA (1/5 dilution).


82

Figure 2.152.15 qRT-PCR reaction conditions used in the study

Relative gene expression was calaculated for targeted genes by following 2-ΔΔCT method

as described by Livak method (Livak and Schmittgen, 2001). Average CT values for target

genes and reference housekeeping gene ubiquitin was obtained from data file of qPCR

reaction. The CT values were used for relative expression of each targeted gene by the

formula as follows.

Sample ΔCT = Target gene CT - UBI

ΔΔCT = Treated ΔCT– Untreated control ΔCT

Fold Change = 2-ΔΔCT

Relative gene expression = Fold change of target gene of treated samples/Fold change of

gene of control

While sample CT is threshold value, the point when fluorescence increases significantly

above the background fluorescence of target genes and reference gene (Ubiquitin).

In silico docking

The receptor protein AtD14 PDB ID: 4IH4 (Arabidopsis DWARF14 orthologue) for

molecular docking studies was retrieved from protein data bank (www.rcsb.org). The

http://www.rcsb.org/


83

receptor AtD14 was prepared by adding side chains and missing residues by Prime

modelling tool. The ligand preparation was carried out by using ligprep tool embedded in

Maestro interface of Schrodinger software (www.schrodinger.com). We performed

dockingDocking simulations were performed for of naturally occurring S-(+)-ABA in

AtD14 having rmsd < 0.85 Å. A radius of 10 Å was used to define the pocket extension.

The docking pose was generated by superimposition of only one active enantiomer of

(+)-GR24 within in the pocket superimposed S-(+)-ABA.

http://www.schrodinger.com/

Results Chapter 3

84

Chapter 3

Results

Results Chapter 3

85

3. Results

This study was conducted in three phases. First of all, in vitro regeneration response of four

tomato cultivar(s) of Solanum lycopersicum via organogenesis through callus induction

and direct somatic embryogenesis (SE) was optimized. Various factors, which effect in

vitro morphogenesis response, were investigated for all experimental cultivars. Most

responsive variety was selected for Agrobacterium mediated transformation. Biosynthetic

genes in SLs pathway, carotenoid cleavage dioxygenases 7 (CCD7) and the receptor D14

were cloned in pGreen binary vector system for plant transformation. The putative

transgenics were then characterized. We then developed smartSmart tools were developed

to access the activity of SL and ligand-receptor dynamics by fluorescence-based bioassay

for quantification of natural and synthetic SLs. Various analogues and mimics were

synthesized and tested via bioassays in order to investigate Structure–activity relationship

(SAR). Later the assay was used to study the putative interaction of D14 receptor with

other phytohormones especially ABA in the context of cross talk between two prime

hormones involved in abiotic stress management i.e. SL–-ABA cross talk. Some of these

unexplored interactions were highlighted during preliminary studies done with extensive

literature available on SL dynamics in plants like tomato, rice and Arabidopsis.

Tomato cell culture

Seed germination and contamination control

Genetic variation exists within Solanum species for rapid seed germination and seedling

vigour and most commercial cultivars of tomato are sensitive to stress conditions during

early stages of seedling growth (Foolad et al., 2007). In this study, the effects of different

concentrations of commercial sodium hypochlorite with and without the surfactant tween

20 and household bleach on seed germination were evaluated and their efficiency to control

contamination was assessed for all four types of seeds of Solanum lycopersicum L. (see

Table 3.1). The addition of a 2% sucrose solution to the basal medium was tested during

the germination process; it was observed that seed germination was unaffected by the

inclusion or exclusion of sucrose during first week. Contamination free seed germination

without sucrose inclusion in germination media was achieved in these experiments (Table

3.1). Although sucrose is an important component for healthy tomato cell cultures, it was

Results Chapter 3

86

found that an absence of sucrose does not affect the rate of germination and seedling

emergence (Table 3.2). An increase in concentration of NaOCl beyond 10%, v/v was found

to negatively affect the seed germination and vigor. Tomato seeds of all varieties sterilized

with > 10% sodium hypochlorite exhibited complete loss of germination activity

irrespective of media composition. Lowest germination was observed at 15 and 20% v/v

NaOCl. While treatment with 6% sodium hypochlorite and 8% house hold bleach for 15

min and gentle agitation, followed by 2 days incubation in dark was found optimal for seed

germination on half strength and full-strength medium leading to ~90% seed germination.

Lower level of sodium hypochlorite (1–-2.5%) was found to induce early germination;

however, 50% of the cultured seeds were infected with fungal contamination. The use of

tween 20 in combination with NaOCl was found suboptimal. Tween 20, a non-ionic

surfactant was used as a wetting agent as it helps to penetrate aqueous NaOCl. When the

6% NaOCl solution was used alone, the germination index was lower. However, Tween

20 in combination with 6% NaOCl proved to be effective in controlling the contamination

of tomato cell cultures. The four type of seeds tested in this study showed slightly more but

not significantly different germination activity on half strength MS media as compared to

full strength (Figure 3.1). Seeds of cv. Riogrande and Roma showed 90–-80% germination

index on both media (P<0.05); however, Hybrid-17905 and cv. M82 were significantly

slower in germination response (Table 3.1).

It was observed that seed vigour depends on genotype as well as self-pollination

background. Light and dark incubation for 48 hr on medium vessels was found to induce

quick germination response. The growth in both conditions was good but germination rate

was 95% in dark and about 75–-80% in light. The seeds in dark conditions started

germinating in 3–-4 days while seeds in light germinated in 5-6 days suggesting that

stratification of seeds in dark period breaks the dormancy of seeds. Another factor that

affect germination rate assessed was the storage of seed. Seeds stored on room temperature

were found dormant and they start germination after 15 days and the germination rate was

also low. On the other hand, seeds stored in cold temperature germinated quickly after

stratification.

Results Chapter 3

87

Table 3.1 Effect of Clorox (NaOCl) concentration on sterilization of seeds of Solanum

lycopersicum L cvs. Riogrande, Roma, M82 and hybrid (17905) on full and ½MS medium

without sucrose

NaOCl (%

v/v)

House

Hold

bleach

(% v/v)

Tween 20

Treatment

duration

(min)

%Germination : %Contamination

Remarks

Rio Roma Hybrid M82

1 - - 15 60: 90 63:80 69:89 66:78 Contamination

2 - - 15 65:50 67:60 56:61 45:62.5 >50

contamination

3 - - 15 87:20 85:22 60:25 35:25 >50

contamination

5 - - 15 92:8 89:13 72:15 30:20 Optimal

germination

6 - - 15 95:5 93:7 82:12 30:5 maximum

germination

6 - 2 drops 15 85:20 76:20 66:25 25:2 Sub optimal

germination

10 - - 10 20:0 15:0 18:0 10:0 <20%

germination

15 - - 10 2:0 3:0 - - No germination

20 - - 10 0 0 - - No germination

- 8 - 15 72:20 74:23 60:15 10:25 Delayed

germination

Results Chapter 3

88

Figure 3.13.1 Germination of Solanum lycopersicum L. cvs. Riogrande, Roma, M82

hybrid (17905) on full and ½ strength MS medium without sucrose

(A) Germination on ½ strength MS media (B) Germination on full strength MS media

Results Chapter 3

89

In vitro callus formation is genotype-dependent

Various PGRs monitor in vitro morphogenesis response by modulating different

physiological processes in plants. In this study, different combinations of PGRs were tested

for callus induction and regeneration. The two types of explants (cotyledons and

hypocotyls) from one-week-old seedlings used for callus induction showed variable

responses to callus induction media treatments [CIM T0-T16] (Table 3.3). It was observed

that the effect of explant type was of little influence as compared to genotype and treatment

during the experiments. Maximum development of calli was achieved from young

cotyledons of the cv. Riogrande, having an efficiency of 82.08% from CIMT9, 85% from

CIMT12. CIMT9 was found to be the most suitable treatment leading to soft, fleshy green

callus from both cotyledons and hypocotyls, which quickly regenerates. cv. Roma showed

callus formation on CIMT12 and CIMT9 at 83.9% and 75 % respectively (Table 3.3).

However, the other two types i.e. hybrid (17905) and cv. M82 were comparatively less

responsive at above-mentioned hormonal treatments and thus took longer time. In

comparison, model cultivar M82 only exhibited callus induction activity with a

combination of treatments (CIMT9 & CIMT13/ CIMT14). Both CIMT9 and CIMT13 alone

were found ineffective in callus formation. In order from most effective to least, different

CI treatments viz; CIMT0–CIMT16 for efficient callus induction were as follows

CIMT12>CIMT9>CIMT10>CIMT13>CIMT11>CIMT15>CIMT14.

Results Chapter 3

90

Table 3.2 The effect of various combinations of PGRs on callogenesis in Solanum

lycopersicum cultivars irrespective of explant type.

Treatment (Callus induction Medium)

CIM

Rio Grande Roma Hybrid M82

CIMT0 =4.15g/L MS salts+

vitamins +2%Suc+0.8% plant agar

pH 5.8

0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h

CIMT1= 0.2 mg/L NAA (MS basal

medium)

0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h

CIMT2= 0.5 mg/L NAA (MS basal

medium)

0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h

CIMT3= 1 mg/L NAA (MS basal medium) 0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h

CIMT4= 2 mg/L NAA (MS basal medium) 1.91±0.15g 0.63±0.10h 0.01±0.97j 0.001±0h

CIMT5= 0.2 mg/L NAA+1 mg/L BAP (MS

basal medium)

13.7±0.04ef 17.83±0.042f

8.43±0.11h 0.001±0h

CIMT6=0.2 mg/L NAA+2 mg/L BAP (MS

basal medium)

10.26±0.03e

f

13.56±0.03f 10.06±0.21h 0.001±0h


basal medium)

2.72±0.20g 2.47±0.13g 1.26±0.1i 0.001±0h


basal medium)

1.5874±0.1g 2±0.1g 1±0i 0.0013±0h

CIMT9= 0.5 mg/L NAA+1 mg/L BAP (MS

basal medium)

82.8±0.01ab 75.15±0.16

ab

45.64±0.12

ab

30.27±0.17

c

CIMT10=1 mg/L NAA+1 mg/L BAP (MS

basal medium)

35.33±0.04d 65.40±0.06c 26.43±0.07e 4.30±0.17fg

CIMT11=1/0.5 mg/L IAA+1 mg/L BAP

(MS basal medium)

33.96±0.17d 28.84±0.8e 31.34±0.11d 25.45±0.09d

CIMT12=2 mg/L IAA+2 mg/L NAA+2

mg/L BAP+4 mg/L KIN (MS basal medium)

85.23±0.13a 83.93±0.11 a 63.65±0.07a 9.86±0.51e

CIMT13=2 mg/L IAA+2 mg/L NAA+2

mg/L BAP+4 mg/L ZEA (MS basal

medium)

46.26±0.03c 24.67±0.12e 17.5±0.21f 64.8±0.87s

CIMT14=0.5 mg/L IAA+2/0.5 mg/L

NAA+2 mg/L 2,4-D+0.2 mg/L ZEA (MS

basal medium)

27.05

±0.33d

20.32±0.27e 15.32±1.2fg 53 ±0.67b

CIMT15=0.5 mg/L BAP+0.5 mg/L NAA+2 mg/L GA3 (MS basal medium)

33.35±0.23d 35.33±0.06

d 40.90±0.36b

c 6.88±0.19fg

CIMT16=2 mg/L 2,4-D+0.5 mg/L BAP

(MS basal medium)

14.22±0.134e

5.31±0.23g 2.0±0.16i 4.71±0.26fg

Data represent the mean ± standard error S.E (n = 51) of three replications. Means followed by the same

letter within column are not significantly different as determined by a pairwise comparison using Tukey’s

test at p<0.05.

Results Chapter 3

91

Embryogenic calli derived from cotyledonary explants depicted a high shoot regeneration

potential in Rio and Roma while other two cultivars only developed pale white compact

callus (Figure 3.1). A hypocotyl-derived callus had many embryoids in Riogrande;

however, callus induction was slower, and calli were less totipotent as compared to those

from cotyledons (Figures 3.1 & 3.2). The callus induced from Riogrande was of massive

size as compared to other cultivars reaching upto 1 g measuring 7.2 mm. The response to

callogenesis was found highly dependent on genotype and was notably affected by the

reproductive background mode (self-pollination) of the cultivars. T0 was used as control

treatment with no plant growth hormones or regulators to compare the other treatments

having different PGRs. No callus formation was observed in plants with T0 suggesting that

combination of different auxins and cytokinins is necessary for callus induction in any of

plant part. Callus obtained from various treatments were sub-cultured every week on fresh

medium on shoot and root induction medium for the regeneration.

Effect of media pH & NAA concentrations on in vitro morphogenesis

Organogenesis via direct or in direct somatic embryogenesis (SE) in tomato through

complex signaling network leads to elicitation of regulation in gene expression that

influence totipotency in cell culture. Such regulations occur as a response to exogenous

PGRs or some stress stimuli such as low pH, osmotic shock or high temperature. We used

Low medium pH along with two auxins analogues NAA and 2,4-D at concentrations 0.5

mg/L and/or 2 mg/L were utilized to initiate SE in Riogrande cotyledons and hypocotyl

explants. In first set of experiment done with increasing concentration of NAA at pH 4.0

showed that at NAA concentration >2 mg/L favors callogenesis and minimum rhizoid

formation was observed (Table 3.3 & Figure 3.4). The initiation of direst SE occurred

without any remarkable callus formation from the edges of both explants after 2–-3 days

of incubation on rhizoid induction medium (RhIM) as thin rhizoid like structures different

from adventitious or true root structure measuring up to 1cm in length (Figure 3.5). Without

PGRs or dark conditions, no rhizoids were observed. The second set of experiment was

done with fixed concentration of NAA i.e. 2 mg/L but varying pH level (3.0–-7.0). The

results showed that out of pH ranging from 3.0–-7.0, only pH 4.0 supplemented with NAA

at 2 mg/L resulted in initiation of SE from one-week-old tomato cotyledons and hypocotyls

irrespective of explant type (Figure 3.6). In general 2,4-D is considered as most effective

Results Chapter 3

92

hormone for induction of primary and secondary somatic embryos in many plants species

(Sofiari et al., 1997). Different concentrations of both auxins analogues with all pH levels

tested in triplicate revealed that 2, 4–-D was not as effective as NAA [0.5 and 2 mg/L]

(Table 3.3). In fact, explants sub-cultured on a medium supplemented with 2, 4-D failed to

produce rhizoids. SE could be induced by use of combinations of auxins and/or cytokinins

that influence endogenous levels of auxins and polar auxins transport. However, this

process is largely species dependent. Both cotyledons and hypocotyl explants displayed

significant growth of rhizoids; however, the former took less time for initiation (Figure

3.5). After 3 weeks of inoculation, the average number of rhizoids induced from cotyledons

at pH 4.0 were 23.6±3.56 in a medium supplemented with 0.5 mg/L and 2 mg/L NAA.

Testing various levels of pH against range of concentrations of NAA (0.5 mg/L4.0 mg/L)

clearly showed that only at certain threshold concertation of NAA at pH 4.0 can effectively

induce SE. The sequence of effective media pH to exhibit a substantial number of rhizoids

and RTBs from both explants was 4.0 > 5.0 > 6.0 > 7.0 supplemented with NAA 0.5 or 2

mg/L (Table 3.3).

Results Chapter 3

93

Figure 3.23.2 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82

and hybrid (17905) on optimized media

(A) Greenish soft calli induced from cotyledons of Rio. (B) Off white with green portions calli induced from

cotyledons of Roma. (C) Off white calli with green spots induced from cotyledons of hybrid 17905. (D) Pale

white calli induced from cotyledons of M82. Scale bars (A, B, C, D) 150 mm.

Results Chapter 3

94

Figure 3.33.3 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma,

and hybrid (17905) on optimized media

(A) White calli with green patches induced from hypocotyls of Rio. (B) Off white with green portions calli

induced from hypocotyls of Roma. (C) White calli induced from cotyledons of hybrid 17905. (D) Brownish

calli induced from hypocotyls of M82. Scale bars (A, B, C, D) 150 mm.

Results Chapter 3

95

Table 3.3 The EEffect of vVarious cConcentrations of NAA and pH values on rhizoid

in S. lycopersicum cv. Riogrande.

Data represent the mean ± standard error S.E (n = 40) of four replications. Means followed by the same letter

within column are not significantly different as determined by a pairwise comparison using Tukey’s test at p<0.05. (Saeed et al., 2019)

NAA

(mg/L)

pH

level

Mean No. of

rhizoids/

explant ± S.E

2,4-D

(mg/L)

pH

level

Mean No. of

rhizoids/

explant ±

S.E

NAA

(mg/L)

pH

level

Mean No. of

rhizoids/

explant ± S.E

0 4 00.00±0.00d 0 4 0.00±0.00 2 3 00.00±0.00d

0.5 4 23.6±3.56a 0.5 4 0.00±0.00 2 4 23.0±2.79a

1 4 15.21±2.34

ab

1 4 0.00±0.00 2 5 16.31±2.11ab

1.5 4 8.23±1.59bc 1.5 4 0.00±0.00 2 6 14.72±2.22c

2 4 21.69±3.4a 2 4 0.00±0.00 2 7 11.03±1.39c

3 4

11.31±1.74b 3 4 0.00±0.00 -- -- --

4 4 9.80±1.43bc 4 4 0.00±0.00 -- -- --

Results Chapter 3

96

Figure 3.43.4 Effect of increasing concentration of NAA at pH 4.0 on S.E from cotyledon

and hypocotyl of S. lycopersicum cv. Riogrande.

(A)Explants cultured on pH 4.0 + 0.5 mg/L NAA. (B) Explants cultured on pH 4.0 + 1 mg/L NAA (C-D)

Explants cultured on pH 4.0 + 2 mg/L NAA. (E) Explants cultured pH 4.0 + 3 mg/L NAA. (F) Explants

cultured on pH 4.0 + 4 mg/L NAA. Scale bars (A-F, 200 mm).

Results Chapter 3

97

Figure 3.53.5 The Eeffect of medium pH (4.0) on rhizoids production from cotyledon and

hypocotyl explants of S. lycopersicum cv. Riogrande.

(A-A2) Rhizoids induced on cotyledon explants after one-week incubation. (B-B2) Rhizoids induced on

hypocotyl explants after one-week incubation. (C) Primary and secondary somatic embryogenesis with many

proembryos after 2 weeks of incubation. Scale bars (A, A2, B, B2) 5 mm. Scale bars (C), 50 mm. (Saeed et al., 2019)

Results Chapter 3

98

Figure 3.63.6 Effect of pH 4.0 + 2 mg/L NAA vs pH 3, 5, 6 & 7

(A-C) Explants cultured on pH 4.0 + 2 mg/L NAA. (C) Enlarged view under box showing hair like rhizoid

extensions from explant edges. (D) Explants cultured on pH 3.0 + 2 mg/L NAA. (E) Explants cultured pH

5.0 + 2 mg/L NAA in dark conditions. (F) Explants cultured pH 6.0 + 2 mg/L NAA. (G) Explants cultured

pH 7.0 + 2 mg/L NAA in dark conditions. Scale bars (A, D, E, F, and G) 150 mm. Scale bar (B) 200 mm. Scale bar (C) 20 mm.

Results Chapter 3

99

Figure 3.73.7 Effect of NAA*pH level on RTBs formation

Data represent the mean ± standard error S.E calculated from 90 explants per treatment in 3 replicates. Error

bars represent S.E for three independent experiments. Significant differences are shown by asterisks ** P<

0.01 calculated by Student’s t test.

Secondary embryogenesis and novel structures “Rhizoid tubers”

(RTB) formation

The initiation phase of SE due to auxins and low pH media was followed by onset of

secondary embryogenesis. Thus, individual rhizoids, upon transfer to a medium containing

5 mg/L TDZ or BAP in light conditions, produced secondary embryogenesis and novel

structures – rhizoid tubers (RTBs) with many somatic embryoids. Rhizoids were allowed

to mature at pH 4.0 on same medium started callogenesis in light while, cluster of rhizoids

with many proembryos was shifted to MS media supplemented with 5, 10, 15 or 20 mg/L

TDZ and 5 mg BAP for RTBs induction at pH 4.0 (Tables 3.4 and 3.5). Primary embryoids

lead to secondary embryoids due to cytokinins in the medium.

-5

0

5

10

15

20

25

30

35

40

45

3 4 5 6 7

Me

an N

o. R

hiz

oid

s

pH Level

NAA

0.50

1.00

1.50

2.00

3.00

4.00

**

**

Results Chapter 3

100

Table 3.4 Effect of TDZ/BAP concentration on rhizoid tubers (RTBs) induction at low pH

in S. lycopersicum cv. Riogrande (no distinction of explant type).

Data represent the mean (no. of RTBs) ± standard error (S.E) calculated from 120 explants in four replicates

for each treatment. Means followed by the same letter within column are not significantly different as

determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. TDZ: N-phenyl-N′-1, 2, 3-thiadiazol-5-ylurea. (Saeed et al., 2019)

Table 3.5 Effect of pH values on development of rhizoid tubers (RTBs) irrespective of

explant type in S. lycopersicum cv. Riogrande supplemented with 5 mg/L of TDZ

Data represent the mean (no. of RTBs) ± standard error S.E calculated from 120 explants in four replicates

of each treatment. Means followed by the same letter within column are not significantly different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. (Saeed et al., 2019)

TDZ mg/L pH value Mean no. of RTBs /explant

±S.E

5 3.0 0.00±00e

5 4.0 46.35±0.05a

5 5.0 15.5±0.08b

5 6.0 7.94±0.02c

5 7.0 2.16±0.07d

TDZ

mg/L

pH Mean No. of RTBs

/explant ±S.E

BAP

mg/L

Mean No. of RTBs

/explant ±S.E

Induction time

5 4.0 45.75±1.25a 5 44.5± 3.41a 12 Days

10 4.0 30.50±3.22b -- -- 12 Days

15 4.0 18.25±1.97c -- -- 12 Days

20 4.0 14.00±2.08cd -- -- 12 Days

Results Chapter 3

101

After 12 days of inoculation on rhizoid tuber induction medium under light conditions

(16/8 h, light/dark, white fluorescent lights 80 μmolm-2s-1), individual hair like rhizoids

started formation of club shaped clusters termed as: rhizoid tubers (RTB) [Figure 3.8].

Contrary to photoperiod condition, the rhizoids left in dark lead to callus formation. It has

been found that RTBs were induced only on pH 4.0, while no such structures were

observed at pH 5.8. The result analysis indicated that pH 4.0 satisfies formation of both

rhizoids and RTBs. Effect of increasing concentration of TDZ (5-20 mg/L) while keeping

the pH of medium to 4.0 showed that number of RTBs decreases with increasing

concentration of TDZ (Table 3.4). Maximum number of RTBs were 46 that appeared on

medium with 5 mg/L of TDZ at pH 4.0. BAP at equal concentrations was also found

correspondingly effective in RTBs formation (44 RTBs). Addition of TDZ to primary

somatic embryos further enhanced the process of embryogenesis and many globular and

torpedo- and heart shaped somatic embryos became visible after 3 days of incubation

(Figure 3.8 A-D). While sequential incubation of primary embryos and rhizoid clusters on

TDZ and BAP 5 mg/L encouraged shift of somatic embryos to shoot organogenesis.

Figure 3.83.8 Origination of RTBs from rhizoids at pH 4.0.

(A) Induction of secondary embryogenesis as RTBs on media supplemented with 5 mg/L TDZ. Highlighted

portion and arrows show formation of novel structures RTBs (B) Individual RTBs excised and allowed to

mature for embryo germination. Scale bars (A & B, 200 mm).

Results Chapter 3

102

RTBs were seen on both ends of explants in contact with medium while, central parts

mainly showed progression through globular embryos, heart-torpedo and pre-cotyledonary

embryo at the tip: as prospective shoot tip. Former were excised and allowed for in vitro

shooting while, later formed well-developed shoot tip and in vivo germination of embryo

(Figures 3.9 & 3.10). Various level of medium pH tested against fixed concentration of

TDZ showed that with increasing pH levels, number of RTBs again started decreasing

much like the trend seen with increasing TDZ concentration (Table 3.5). With increasing

concentration of TDZ (20 mg/L) only somatic embryos were formed and number of pro-

tubers and mature rhizoid tubers declines at pH 4.0. Which means that somatic embryos

resulted due to cytokinins and low pH, rearranged their fate to germination and seedling

formation with elevated level of cytokinins i.e. TDZ.

Shoot organogenesis from RTBs and calli

Whole plantlet formation form RTBs

Use of cytokinins at low pH with normal photoperiod induced secondary embryogenesis

in tomato cell cultures having primary embryoids. Cytokinins dose and type has shown

differential response in development and maturation of secondary somatic embryos. When

different concentration of TDZ or BAP were supplemented in MS medium at pH 4.0,

secondary somatic embryos at the surface of explants appeared. With increasing

concentration of TDZ (20 mg/L), only somatic embryos were formed and number of pro-

tubers and mature rhizoid tubers declines at pH 4.0. However, when explants were

cultivated on medium with TDZ or BAP (5 mg/L) at pH 4.0, maximum number of RTBs

was formed in first week, whereas, globular and heart torpedo shaped became visible

(Figure 3.9 A, B and C). When further incubation occurs under light conditions all primary

embryos were converted to secondary embryos and shoot tip appeared at the top of explant

(Figure 3.9 D). These pre-cotyledonary embryos were distinctly different from primary

somatic embryos. The cluster of RTBs formed adventitious shoots directly when cultured

on TDZ or BAP (5 mg/L) at pH 5.8 (Figure 3.9 E). Whereas, different stages of somatic

embryos: globular and heart torpedo stages on the surface of explants were more prominent

at pH 4.0. These embryos germinated like typical SE, an apical shoot developed first and

Results Chapter 3

103

sequentially leaves appeared later (Figure 3.8 D and E). Induction of in vitro shoots was

exceptionally high on pH 5.8 in comparison to in vivo shoot morphogenesis, which was

found to be slow at a lower pH 4.0 (Figure 3.10). This suggests that a lower pH with auxins

(NAA) is required for rhizoid induction in the dark. Cytokinins (TDZ/BAP) addition in

media with lower pH under light conditions induced novel structures – rhizoid tubers

(RTBs) in S. lycopersicum cv. Riogrande. However, in vitro regeneration from RTBs was

more favourable at pH 5.8 (Figure 3.10). The low H+ concentration of growth media

remained ubiquitous in tomato tissue culture in this study for induction of rhizoids, somatic

embryos and RTBs formation. RTB embryoids were found to be novel structures consist

of embryonic cells that spontaneously develop to form multiple plantlets in 2 weeks (Figure

3.10). Thus, a new regeneration system for fast and efficient propagation was optimized.

Figure 3.93.9 Induction of RTBs from rhizoids on MS media supplemented with

(5 mg/L) at pH 4.0.

(A-B) Induction of RTBs in light conditions, arrows showing development of club shaped structures. (C-D) Maturation of RTBs to pre-cotyledonary stage embryo at the tip of rhizoid cluster. (E) In vivo germination

of somatic embryos to whole plantlet. Scale bars (A-E) 20 mm.(Saeed et al., 2019)

Results Chapter 3

104

Figure 3.103.10 Stages of whole plantlet development via in vitro shooting from excised

(A-C) Maturation of excised RTBs in light conditions at pH 4.0 with 5 mg/L TDZ arrows showing

development of club shaped structures. (D-F) Development in vitro shoots and roots directly from RTBs. (Saeed et al., 2019)

Shoot and root organogenesis form callus culture

The dose of cytokinins alone as well as their combination with auxins has been found

critical for shoot organogenesis in tomato. Therefore, in this study we evaluated explant

type, cultivar and treatment for regeneration of four tomato varieties were compared. BAP

alone at 3-5 mg/L induced more adventitious shoots and greater shooting percentage for

all four varieties. Statistically significant differences were observed among shoot

organogenesis between genotypes and explant types. The maximum numbers of shoots

Results Chapter 3

105

were induced on SIMT6 media with BAP (3 mg/L) and IAA (0.1 mg/L) with 45 shoots

produced per explant of cv. Riogrande Figure 1 G). BAP alone at 35 mg/L was found

second most effective medium (SIMT3) in shoot regeneration. cv. Riogrande showed

56.9% shoot induction frequency for cotyledon-derived explants at SIMT6. Significant

differences were observed among all treatments at (p<0.05); all four cultivars depicted

differential response to each treatment. The order of varietal shoot-induction frequency

from cotyledons was Rio>Roma>Hybrid>M82. The effect of treatment ×genotype was

found highly significant (Table 3.6). The time for morphogenesis of shoots ranged from

3.5 for SIMT6 and SIMT3 to 6 weeks for complete shoot organogenesis.

The newly regenerated shoots were excised from callus interface and cultivated on root

induction media (RIM), containing different hormones (Table 3.7). Rooting was observed

2 weeks post inoculation. RIM 5 with either NAA 0.1 mg/L or 0.5 mg/L and RIM 6

containing IBA 1 mg/L rendered a maximum number of roots. cv. Riogrande was most

profound in rooting response with 12 roots/shoot on RIM 5. Irrespective of treatment cv.

Riogrande and Roma showed 100 percent rooting frequency. However, differences in

number and extent of rooting were seen. Well-rooted plantlets were hardened by shifting

to soil substrate over a month before transferring them to natural environment. More than

90% of the plants survived with normal physiology with abilities to develop flowers and

fruit. The steps of complete in vitro regeneration of tomato are shown in Figure 3.11.

Results Chapter 3

106

Table 3.6 Effects of culture media and explant type on shoot regeneration in four S.

lycopersicum cultivars.

Treatment/

cv

Riogrande

BAP

(mg/L)

NAA

(mg/L)

IAA

(mg/L)

KIN

(mg/L)

Percentage of explants with

Shoots± S.E

Mean no. of

shoots± S.E

No distinction

of explant type

Cotyledon Hypocotyl

SIMT1 2 --- --- --- 37.65±0.71e 35.01±0.81c 1.00±0.81 ab

SIMT2 3 --- --- --- 43.66±0.83c 40.23±0.76b 1.51±0.34ab

SIMT3 5 --- --- --- 47.69±1.38ab 30.74±2.0b 3.48±0.21a

SIMT4 1 0.1 2 41.9348d 25.94±0.93d 1.05±0.61ab

SIMT5 3 0.1 --- --- 48.25±0.83ab 45.67±0.36a 2.50 ± 1.0a

SIMT6 3 --- 0.1 --- 56.18±1.28a 43.68±1.9a 5.55±1.0a

Treatment/

cv Roma

BAP

(mg/L)

NAA

(mg/L)

IAA

(mg/L)

KIN

(mg/L)


Shoots ± S.E

Mean no. of

shoots± S.E

No distinction

of explant type

Cotyledon Hypocotyl

SIMT1 2 --- --- --- 35.05±0.93d 33.05±2.09c 0.55±1.0ab

SIMT2 3 --- --- --- 39.23±0.67c 30.98±0.72d 0.88±0.19ab

SIMT3 5 --- --- --- 52.74±1.04a 44.74±2.7ab 3.00±0.16 a

SIMT4 1 0.1 2 31.94±0.78e 34.94±0.73c 1.55±0.21ab

SIMT5 3 0.1 --- --- 47.67±0.83b 46.90±0.836a 2.00±1.03 a

SIMT6 3 --- 0.1 --- 47.68±1.49 b 44.67±1.49ab 4.34±0.51 a

Treatment/

cv hybrid

BAP

(mg/L)

NAA

(mg/L)

IAA

(mg/L)

KIN

(mg/L)


Shoots ± S.E

Mean no. of

shoots± S.E

No distinction

of explant type Cotyledon Hypocotyl

SIMT1 2 --- --- --- 29.99±1.03d 30.05±2.09c 0.65±0.11a

Results Chapter 3

107

Data represent the mean (no. of explants with shoots /total no. of inoculated explants *100) ± standard error

S.E calculated from 200 explants. Means followed by the same letter within column are not significantly

different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. SIM: Shoot induction medium. (Saeed et al., 2019)

SIMT2 3 --- --- --- 39.22±0.6c 33.98±0.72b 1.10±0.51a

SIMT3 5 --- --- --- 40.20±1.08a 38.74±2.7 a 2.6±0.89 a

SIMT4 1 0.1 2 30.39±1.52d 30.94±0.73c 1.23±0.23a

SIMT5 3 0.1 --- --- 28.61±1.40de 30.90±0.83bc 1.8±0.16 a

SIMT6 3 --- 0.1 --- 34.61±1.80b 32.67±1.49bc 2.00±0.41 a

Treatment/

cv M82

BAP

(mg/L)

NAA

(mg/L)

IAA

(mg/L)

KIN

(mg/L)


Shoots ± S.E

Mean No. of

shoots ± S.E

No distinction

of explant type

Cotyledon Hypocotyl

SIMT1 2 --- --- --- 17.70±0.63b 13.05±1.09c 0.33±0.21ab

SIMT2 3 --- --- --- 16.06±0.51c 13.28±1.72c 1.11±0.36 a

SIMT3 5 --- --- --- 21.39±2.10a 15.24±0.7b 1.5±0.18 a

SIMT4 1 0.1 2 13.13±0.81d 15.24±1.73b 1.07±0.19 a

SIMT5 3 0.1 --- --- 16.53±0.21c 18.20±0.836a 0.55±0.3 ab

SIMT6 3 --- 0.1 --- 13.67±0.50d 10.67±1.49e 0.72±0.16 a

Results Chapter 3

108

Table 3.7 Effect of auxins on rooting of in vitro regenerating shoots of four S. lycopersicum

cultivars after 8-10 weeks of incubation.

Data represent the mean (no. of roots developed from each shoot) ±standard error S.E of three replications

calculated from 200 explants for each treatment. Means followed by the same letter within column are not

significantly different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. (Saeed et al., 2019)

Treatment

IBA

(mg/

L)

NAA

(mg/L)

IAA

(mg/L)

Mean no.

of Roots±

S.E

cv

Riogrande

Mean no. of

Roots± S.E

cv Roma

Mean no.

of Roots±

S.E

cv Hybrid

Mean no.

of Roots±

S.E

cv M82

RIMT1

0.1 --- ---

6.16±0.7c 4.66±0.57c 3.33±0.57c 1.33±0.77

b

RIMT2

0.2 --- ---

4.66±2.08

c

5.33±1.15d 2.33±0.57d 0.33±0.57d

RIMT3

0.5 --- ---

8.0±0.50 ab 4.66±1.52c 4.0±1.00 b 1.66±1.5 b

RIMT4

1 --- ---

9.6±1.52 b 6.33±1.52 b 2.0±1.00 e 4.0±1.00 a

RIMT5

--- 0.5/0.1 ---

12.6±2.08a 10.33±1.52a 7.33±0.57a 1.0±1.00 c

RIMT6

--- --- 0.1

7.0±1.00ab 5.66±2.08c 4.66±1.52

b

1.33±1.52b

RIMT7

0.2

6.66±1.52c 4.66±2.08 c 2.33±0.57d 1.33±0.57

b

Results Chapter 3

109

Figure 3.113.11 Steps of complete in vitro regeneration in S. lycopersicum cv. Riogrande.

(A) In vitro grown one week seedlings of cv. Riogrande. (B) Cotyledonary explants. (C) Hypocotyls explants.

(D-E) Calli induced from cotyledons and hypocotyls. (F-G) shoot and root organogenesis. (H) Acclimitization of in vitro regenerated plantlets. Scale bars for (A, B, C, D, E and G), 150 mm. Scale bar for

(F) 20 mm. Scale bar for (H) 120 mm.

.

Results Chapter 3

110

Histological Analysis of RTBs

Microscopic observation of the transverse section of mature RTBs and calli containing

embryos stained with safranin showed an internal arrangement of embryonic cells and non-

embryonic cells. After 12 days, RTBs cultivation on tuber induction medium, rhizoid pro-

embryos accepted the dye and turned visibly dark pink, while non-embryonic tissues

remained unstained (Figure 3.12 A-D). The embryonic tissues were distinctly stained

pinkish red with globular, nodular, bi-lobed heart shaped and cotyledon shaped stages

(Figure 3.12 C, D, and E). Each tuber exhibited multiple embryoids at different stages of

development, hence progressing like typical somatic embryogenesis to a whole plantlet

(Fig 3.10 A, B). Cluster of pro-embryogenic masses (PEMs) and meristematic cells

surrounded the globular somatic embryos which was a pre-requisite for successful

proliferation and dedifferentiation somatic embryos. Most of the meristematic cells formed

callus at later stages with isodiametric cells while somatic embryos were often found

attached to these cells (Figures 3.12 A&C, 3.13 A, B, F&G). The secondary somatic

embryos were developed via regenerative process from primary ones. These somatic

embryos developed directly by cell division at epidermal and sub epidermal layers of

primary embryos (Figures. 3.13 F & 3.14 A-B). The RTBs are previously un-characterized

somatic embryos that were seen as agglomeration of somatic embryos of different stages

(globular, heart and bipolar/torpedo) after 12 days of incubation. These secondary embryos

particularly RTBs germinated by development of shoot apices.

Results Chapter 3

111

Figure 3.123.12 Light microscopic sections of rhizoid tubers (RTBs) stained with safranin

on tuber induction medium supplemented with 5 mg/L TDZ at pH 4.0 from cotyledon

explants of S. lycopersicum cv. Riogrande.

(A) Section of regenerating rhizoid tubers after 25 days of incubation showing globular and nodular embryos arising from aggregate of callus tissues, 40 X. (B) Enlarged view of T-section showing embryonic cells. (C)

Transverse section of mature RTB, 20X automatic scanning system [ASS]. (D) Enlarged view of section under box showing multiple embryoids. Scale bars (A, C) 200 μM. Scale bars (B, D) 50 μM. (Saeed et al.,

2019)

Results Chapter 3

112

Figure 3.133.13 Histology of somatic embryos developed via direct somatic

from cotyledons explants of S. lycopersicum cv. Riogrande.

Section of explants with various stages of somatic embryos showing abundance of globular stage embryos,

after one week on tuber induction medium. (B) Enlarged view of transverse section under red box. (C)

Globular shaped embryos [nucleus not stained] (D) Heart shaped embryos. (E) Torpedo-shaped cells. (F)

Longitudinal section of single RTB club shaped embryo attached to explant. (G) Safranin stained section

showing different stages of SE scale bars (A, G) 200 μM. Scale bars (C, D, and E) 200 μM. Scale bar (B, F)

50 μM. (Saeed et al., 2019)

Results Chapter 3

113

Figure 3.143.14 Histology of rhizoid cluster containing RTBs, globular and torpedo

embryos

Arrows showing globular and torpedo shaped secondary embryos. Scale bar (A) 20 mm. Scale bar (B) 50

μM

Results Chapter 3

114

Cloning of putative SL biosynthetic genes and transformation of S.

lycopersicum cv. Riogrande

During multi species, meta-analysis strigolactones (SL) and underpinnings of SL-ABA

cross-talk that has been increasingly spotlighted by research aimed at dissecting and

understanding abiotic stress tolerance. We evaluated tThehe genes involved in the

biosynthesis and signalling pathways of (SL) and their possible role in ABA mediated

stress physiology in plants particularly in tomato were investigated.. The findings

suggested various unexplored SLs cross talk with phytohormones particularly ABA at

biosynthetic level by substrate competition. Taking into account the data available on SL

synthesis and their pleiotropic role in stress physiology, We developed various pathways

for possible interactions between two hormones considering their shared carotenoid

basedorigion were proposed partially unexplored research (Figure 3.15). The systemic

analysis showed possible interaction of SL biosynthetic particularly CCD7, precursor for

SL synthesis with ABA biosynthetic gene at various level. It was also found one of the two

phytohormones is vital cause of stress induced cross talk between both hormones (Saeed

et al., 2017; Visentin et al., 2016). Based on systematic analysis, specific we designed our

strategy forbased on cloning and overexpression of SLCCD7/LJCCD7 and SLD14 in

pGreen based binary vector was adoptedplant expression vector. For this purpose in first

phase a reproducible and efficient in vitro regeneration system in tomato was developed.

The second phase consisted of vector construction, cloning and subsequent transformation

of tomato cv. Riogrande followed by characterization of transgenic plants and their

physiological assessment under stress conditions.

Results Chapter 3

115

Figure 3.153.15 Cross talk between SLs and abscisic acid (ABA) biosynthesis for the

adaptability of plants in response to challenging environmental.

Dotted lines represent the unexplored/ partially explored interactions (Saeed et al., 2017)

Results Chapter 3

116

Vector construction and functionality test

Isolation of CCD7 and D14 genes

CCD7 gene encoding carotenoid cleavage dioxygenases 7 (CCD7) and receptor protein of

SL signalling machinery α/β-fold hydrolase named (At) D14/DAD2/RMS3 sequences

were isolated from Solanum lycopersicum cv. M82 cDNA library coding sequence data

available from NCBI nucleotide repository: CCD7 (GI 262262693 & 100313501) D14 (GI

101258450/ XP_004253481.2).

PCR based amplification of CCD7 and D14 genes

The total RNA isolated from root and leaves of tomato M82 and its integrity was confirmed

by gel electrophoresis and nanospectrometer quantification. The RNA samples with

260/280 ratios ≥ 2.0 with good concentration as shown in Figure 3.16 were selected for

cDNA synthesis.

Figure 3.163.16 Total RNA quality and quantity from leaves and roots of tomato M82

(A) Dnase-1 treated RNA samples (B) Non treated RNA. Sample 1-4 (Lane 1-4) M82 leaves, Sample 5-8 (Lane

5-8) M82 roots. Right lane 9: 1kb DNA ladder (Viogene)

Results Chapter 3

117

Sequence analysis of SLD14 (GeneID:100313501) revealed that the start codon of open

reading frame was at extreme 5’end for which 5’ RACE PCR reactions were set up. The

confirmatory RACE PCR with gene specific primers of CCD7 gene was found negative

and needed extended 5’ RACE for full gene amplification. For the sake of convenience

insteadconvenience instead of SLCCD7, Lotus japonicas LjCCD7 cloned in

pGEX_LjCCD7 vector with glutathione S-transferase (GST) tag was used for positive

amplification kindly provided by Prof. Francesca Cardinale [Figure 3.17] (Liu et al.,

2013).

Figure 3.173.17 Vector map of pGEX-LjCCD7 (Liu et al., 2013)

Results Chapter 3

118

(A) PCR amplified fragments of LjCCD7 (B) Restriction map of amplified PCR product with XbaI-

HindIII full and partial double digestion. Lane 1 : 100 bp ladder (5PRIME, 100-1500 bp bands), Lane

2&4: Partially digested fragment with XbaI-HindIII giving 2 bands of 1560 bp & 322 bp. Lane 3,5&6:

fully digested fragment with XbaI-HindIII giving rise to one fragment of 1896bp. Lane 7: Partially

digested fragment with XbaI-HindIII giving 3 bands of 1870 bp,1560 bp & 322 bp.

The targeted gene was amplified with gene specific primers and a sequence of 1867 bp

corresponding to Lotus japonicus CCD7-like protein (CCD7) was obtained. Similarly

SLD14 was amplified and desired fragment of 817 bp was acquired (Figures 3.18 & 3.19).

The PCR products were purified using column based kit and cloning sites XbaI–-HindIII,

XmaI–- NotI and NcoI–- NotI were added to LjCCD7 and D14. The desired fragment was

confirmed via restriction mapping as shown in Figure 2.2. The restriction map shown in

Figure 2.2 showed that the LjCCD7 gene has 2 HindIII sites at 1577 bp and 1890 bp while

one XbaI site. On full digestion one band of 1570 bp and one band at 322 bp was generated

due to two restriction sites as seen from the shift in the band in lane 3 and 5. While partial

digestion with different incubation time returned mixed results of 1870 bp fragment, 1570

bp fragment and 322 bp fragment as shown in lane 7 of Figure 3.17. These results further

Figure 3.183.18 Amplified LjCCD7 fragment of 1899 bp and restriction map

created with XbaI-HindIII digestion.

Results Chapter 3

119

confirmed our targeted gene with cloning compatible restriction enzyme sites is the PCR

amplified product.

Lane 1, 7, 12: 1 kb ladder 5PRIME, Lane 2-6:2 kb CCD7 PCR amplified fragment, Lane 8-11: 817 bp

SLD14 PCR fragment

TA Cloning of LjCCD7 and SLD14

The gene of interest confirmed after PCR and restriction mapping was ligated with pGEMT

vector Promega linearized vector with a single 3´-terminal thymidine at both ends and PCR

products having A residues on 5’ or 3’ end ligate in two different orientation as shown in

Figure 3.19. Ligated products after transformation in highly competent cells gave positive

white colonies and negative colonies as blue due to presence of lacZ gene on vector

backbone (Figure 3.20). The positive colonies confirmed by colony PCR and plasmid

extraction through alkaline lysis showed 1870 & 817 base pair fragments corresponding to

targeted fragments (Figure 3.21). The final confirmation of the targeted gene was done by

sequencing of PCR amplified fragments ligated in pGEMT vectors. The sequence analysis

and alignment by chromas lite. The sequence homology with LjCCD7 was found 100 %

with the destination vector and reported sequence while SLD14 was found 99% similar to

Figure 3.193.19 PCR amplified LJCCD7 and SLD14 fragments

Results Chapter 3

120

reported sequence with one base change at 716 bp where Threonine (Thr/T) amino acid

codon ACT was replaced with ACC which was attributed to different cultivars of tomato

used in previous studies.

Figure 3.203.20 TA cloning of LjCCD7 & SLD14 in pGEMT vector

Figure 3.213.21 Blue white screening of TA clones in E. coli

Results Chapter 3

121

Figure 3.223.22 Colony PCR results showing desired gene from white positive clones

containing TA cloned gene of interest

(A) 1870 bp fragment corresponding to LjCCD7 gene from 50 white colonies. Lane 4, 6,7,8,9 &11 positive

amplified product. Lane 12: 100 bp ladder 5PRIME

(B) 817 bp SLD14 PCR fragment amplified from 50 colonies Lane 1: 1 Kb 5PRIME, Lane 2-10 positive

amplified product.

Sub-cloning of LjCCD7 and SLD14 in pGreenII0029 binary vector

system

LjCCD7 was subcloned to desination binary vector system for expression in plant under

MAS promoter and as 35S- TL-TEV: translational leader sequence from tobacco etch virus

promoter enhanncer (super promoter) with GFP fusion at C terminal via XbaI-HindIII &

XmaI- NotI cut out respectively. While, SLD14 was sub cloned, as N-C terminal fusion

(D14-GFP) via NcoI- NotI cut out. Both destination vector and insert after double digestion

were separated by gel electrophoresis to get fragments of desired size as shown in Figure

3.22. The XbaI-HindIII double digestion resulted in exclusion of GUS 1806 bp from

pGII0229MASgus/luc and linearized vector backbone of 7kb based on basic pGII0229

cassette having first cistron GUS under the control of P-MAS and second cistron (LUC)

under the control of tobacco mosaic virus (tmv) IRES element.

Results Chapter 3

122

For GFP fusion constructs assembly pGreenII0029-35S-TL-GFP XmaI- NotI & NcoI- NotI

resulted in 6180 bp linearized fragment shown in Figure 3.22. The fragment were of desired

size and gel purification of fragment was followed by ligation of targeted vector and insert

backbone to get advance expression vector system based on pGreen binary vector system

as shown in Figures 3.23, 3.24 and 3.25. The desired vector obtained showed presence of

genes confirmed via PCR with gene specific primers.

Figure 3.233.23 Restriction enzyme digestion of vector and insert

(A) Restriction fragmentation for sub cloning of SLD14. Lane 1: 1 kb gene ruler 5PRIME, Lane 2

NcoI- NotI digested SLD14. Lane 3: undigested SLD14. Lane 4-5: NcoI- NotI digested vector (pGreenII0029-

35S-TL-GFP). Lane 6:undigested vector (B) Restriction fragmentation for sub cloning of LjCCD7 gene. Lane 1: 100 bp gene ruler 5PRIME.

Lane 4: undigested vector 1. Lane 5: XbaI-HindIII digested vector (pGreenII0029-35S-TL-GFP). Lane 6:

undigested vector 2. Lane 7: XmaI- NotI digested vector 2. Lane 8: RE digested LjCCD7.

Results Chapter 3

123

Figure 3.243.24 Sub cloning of LjCCD7 in dicistronic vector in pGII0229

Figure 3.253.25 Sub-cloning of LjCCD7 fused with N terminal of GFP in pGII0229

Results Chapter 3

124

Figure 3.263.26 Sub-cloning of SLD14 fused with N terminal of GFP in pGII0229

Vector functionality in tomato by transient infiltration

The vector construct transformed in agrobacterium strains were evaluated for their

functionality in tomato leaves and fruits by GUS assays and GFP imaging. Efficiency

of transient expression was found dependent on various factors including type of

agrobacterium strain, infiltration medium, bacterial density, acetosyringone

Acetosyringone concentration and infection time.

Effect of bacterial density and infection time

Bacterial density showed significant effect on transient expression of GUS and GFP genes.

Once leaves were saturated with inoculum, increasing density leads to death of explants.

However, optical density was also found to depend on type Agrobacterium strain. For

Agrobacterium strains EHA105 & GV3101, lower bacterial density <0.3 resulted in mild

or no visible signal/stain and consequently low gene expression. Whereas, higher densities

Results Chapter 3

125

>1 lead to tissue necrosis and wilting. For EHA105 OD600 0.5-0.7 confers better

transformation efficiency ranging from 70-80 % (Table 3.8). GV3101 was found to be

virulent strain at the same density and most of the leaves died after 24 hr. Henceforth,

GV3101 harboring plasmids pGII0229MASCCD7-IRES-luc and pGII0029-35S-TL-

CCD7-GFP were found effective at OD600 0.3. The frequency of positive signal after

infiltration was found to be >80 % for EHA105. The efficiency of EHA105 can be

attributed to disarmed pTioB542 (Hood et al 1993) harboring Vir A and Vir G genes that

are required for efficient T-DNA transfer. The infiltrated samples incubated for 24, 48 and

72 hr investigated for development of signal showed that the transient expression was

maximum after 48 hr, while the intensity of signal/ colour decreases after 48 hr. 24 hr

incubation failed to produce desirable expression or too little signal was obtained.

Table 3.8 Effect of optical density on transient expression of T-DNA

Agrobacterium

strain

Optical

Density

(600 nm)

Incubation

time (hr)

Infiltration medium % Leaves

expression

EHA105 0.2-0.4 48 hr MS salt with vitamins, 2%

sucrose 200 µM

acetosyringoneAcetosyringone

2 mg/L NAA

32.80±0.9d

0.5-0.7 86.62±1.21a

0.8-1 44.01 ±2.2c

GV3101 0.2-0.4 48 hr MS salt with vitamins, 2%

sucrose 200 µM

acetosyringone

Acetosyringone 2 mg/L NAA

53.29 ±0.76b

0.5-0.7 17.3 ± 1.09e

0.8-1 8.2 ±2.0f

Data represent the mean ± standard error S.E calculated from 10 explants per treatment in there replicates.

Means followed by the same letter within column are not significantly different as determined by a pairwise

comparison using Tukey’s test at p<0.05.

Effect of infiltration medium and acetosyringoneAcetosyringone in

transient expression assay

Three different infiltration media (IFM) were used initially for transient assay along with

sterile water. The Infiltration medium influenced overall efficiency of agroinfection. The

level of acetosyringoneAcetosyringone was found prime factor to improve the transient

assay in expression of reporter genes (GUS, LUC, GFP). 0.9 % saline or dd H2O tested

Results Chapter 3

126

with various concentration of acetosyringoneAcetosyringone used as infiltration medium

gave <10% leaves with detectable signal. Our results showed that MS medium with sucrose

used as inoculation and suspension medium of bacterial pellet with 200 µM

acetosyringoneAcetosyringone was most suitable for infiltration and subsequent expression

of genes. Additions of auxins to IFM further enhanced the process of infection with >90

percent of leaves depicting GUS/GFP activity as evident form Table 3.8. Various

parameter tested for vector functionality test showed that Agrobacterium EHA105

harboring plasmids with optical density of 0.5-0.7 was most suitable when suspended in

NAA supplemented liquid MS medium after 48 hr of incubation as shown in Figure 3.27

& Table 3.9.

Table 3.9 Effect of acetosyringoneAcetosyringone concentration on transient expression

Infiltration medium

IFM

Aacetosyringonecetosyringone

concentration µM

% leaves with

Gus/GFP signal

0.9% Saline (IFM1) 0 0 ± 0k

100 6 ± 1.2gh

200 5.5 ±0.78gh

400 3.0 ± 0.5j

DdH2O (IFM2) 0 0 ± 0k

100 2.5 ±0.23i

200 8.9 ±0.65g

400 4.1 ±0.59i

MS salt with vitamins,

2% sucrose (IFM3)

0 0 ± 0k

100 63 ± 0.67e

200 75 ±0.33d

400 67 ± 1.9f

MS salt with vitamins,

2% sucrose + 2 mg/L

NAA (IFM4)

0 0 ±0k

100 78 ± 2.0c

200 96 ± 0.43a

400 88 ± 0.19b

Data represent the mean ± standard error S.E calculated from 10 explants per treatment in three replicates.

Means followed by the same letter within column are not significantly different as determined by a pairwise

comparison using Tukey’s test at p<0.05.

Results Chapter 3

127

Figure 3.273.27 Analysis of reporter gene expression in detached leaves and fruits of S.


(A-A1) GUS gene expression in leaves of tomato. (B) GUS gene expression in pulp of mature fruit (C) In

planta penetration and GUS expression of individual seeds. (D) GFP imaging under direct UV irridation.

(E) GFP imaging under UV hand held lamp after transient infiltration of vector with CCD7/D14.

Results Chapter 3

128

Stable transformation of S. lycopersicum cv. Riogrande

After screening of favourable regeneration potential from four tomato cultivars, cv.

Riogrande with most prolific response towards organogenesis and somatic embryogenesis

was selected for Agrobacterium mediated transformation. Several factors were optimized

for transformation of cotyledons and hypocotyl explants including, age of explant, pre-

culture treatment, orientation of explant, optical density of agrobacterium, infection

duration, co-cultivation time, effect of wounding, selection antibiotics. The parameters

optimized for one variety may differ slightly for other cultivars due to differences in their

genotype.

Effect of age and orientation of explants

The age, size and orientation of explants influence overall response of explant towards cell

culture. In tomato, cell culture younger plants were found more responsive to in vitro

regeneration and somatic embryogenesis of all four cultivars used in the study. Young and

soft cotyledons were found more suitable in our study. The size of explant was also found

to affect the overall success of transformation procedures. During the preliminary

experiments of in vitro regeneration 7 days, old seedlings of Rio and Roma having vigorous

growth characteristics reached up to 1.5 cm cotyledons which were found ideal size for

transformation and regeneration. However, hybrid 17905 and model cultivar M82 were

slow in producing desired size cotyledons. Orientation of explant is found very critical for

rapid regeneration. It was found that explants with their physiological base away from

medium i.e. upside-down orientation was more favourable for somatic embryogenesis and

callus induction. During agrobacterium mediated infection process, it was found that

adaxial side of explants was more resilient to Agrobacterium infection and selection in later

stages.

Effect of pre-culture on regeneration of transformed shoots

We evaluated theThe effect of pre-culturing and wounding treatment on regeneration of

Kanamycinkanamycin resistant shoots of Riogrande was comaped. The explant pre

incubated on PCM (Table 2.2) in dark were found to remain more stable during the

Agrobacterium infection and subsequent washing post co-cultivation. Fresh wounded,

cotyledons wilted during co cultivation and were found more prone to contamination and

bacterial over growth. A statistically significant difference was observed between the

Results Chapter 3

129

wounded precultured and wounded fresh cotyledons (Figure 3.28). As shown in figure 3.28

precultured explants up to 5 days increased the percentage of kanamycin resistant shoots

as compared to fresh cotyledons. It was observed that pre-incubation of explants allowed

those to swell that assisted them to withstand infection, co cultivation and washing steps.

Infection and co cultivation duration

Time of bacterial infection and co-cultivation and bacterial density are important factors

that are dependent on each other. The results of our study indicated that too long co

cultivation time i.e. > 48 hr resulted in vigorous multiplication of bacteria which stemmed

regrowth of agrobacteria post washing and selection while too short co cultivation time

decreased the transformation efficiency. The time of co₋cultivation in turn has been

attributed to govern by bacterial density. As evident from preliminary vector functionality

assays, bacterial density ≥1 and <0.3 resulted in poor GUS expression while optical density

of 0.5₋0.7 at 600 nm gave 80% explants with detectable GUS expression. Consistent with

our previous results stable transformation frequency was found to be ~45% when co

cultivation for 48 hr was carried out with OD600 of 0.4–₋0.5 (Figure 3.28 & Table 3.10). In

the subsequent our experiments, we used infection time of 10, 15 & 20 min was utilized.

It was found from the pilot tests that 15 min infection time was best suited for infection of

Agrobacteria (Table 3.10).

Results Chapter 3

130

Table 3.10 Agrobacterium mediated stable transformation parameters optimized for S.


Optical Density (600

nm)

Co-cultivation

time (hr)

Infection

time (min)

Regeneration efficiency (%)

on 50 mg/L

Kanamycinkanamycin

selection media

0.05-0.2

24 15 7.6 ± 0.29kl

20 9.0 ± 0.27j

48 15 10.0 ± 3.2hi

20 12.0 ± 1.29hi

72 15 15 ±0.78h

20 20 ± 0.89f

0.4-0.5 24 15 30 ± 1.7d

20 35 ± 2.67bc

48 15 45.4 ±2.23a

20 38.7 ± 1.09b

72 15 22.7±0.65f

20 19.6±0.86g

0.6-0.7 24 15 30.80 ± 1.0d

20 25.7 ± 0.45e

48 15 20.8 ± 1.37f

20 16.7 ± 3.09fg

72 15 19.7 ±0.25g

20 13.8 ± 1.82j

0.8-1 24 15 18.2 ±1.57fg

20 13.9 ± 1.0hi

48 15 10 ± 2.6hi

20 6.2 ± 0.55m

72 15 7.9 ± 0.43k

20 4.2± 1.03gh

Data represent the mean ± S.E calculated from 60 explants per treatment in there replicates. Means followed

by the same letter within column are not significantly different as determined by a pairwise comparison using

Tukey’s test at p<0.05.

Results Chapter 3

131

Figure 3.28 & 3.29 Data represent the mean values of three different experiments ± S.E. ** shows statistically

significantly difference (P < 0.01)

Figure 3.283.28 Effect of pre-culture treatment on transformation efficiency

Figure 3.293.29 Effect of bacterial density on transformation efficiency

Results Chapter 3

132

Figure 3.303.30 Effect of pre culture treatment Vs fresh cotyledons after co-cultivation


(A-B) Pre culturing of explants for 2 days in dark conditions (C-E) Stages of recovery after co cultivation

and regeneration of explants. The explant showed clear sign of proliferation and callus development on

selection medium at the edges. (F-G) Fresh cotyledons after co cultivation showed obvious signs of necrosis

and browning when compared to pre conditioned explants. (H-I) Cell death and necrosis of explants without

pre culture treatment.

Results Chapter 3

133

Antibiotic sensitivity test

Elimination of Agrobacterium from the culture is an important pre requisite for successful

transformation after co cultivation. This was achieved by addition of antibiotics effective

against Agrobacterium. Various bacteriostatic antibiotics and their sensitivity towards

explants was tested. carbencillin and cefotaxime are mostly used in tomato cell culture.

100-300 mg/L of various antibiotics like carbencillin, cefotaxime, and 300-600 mg/L of

Timintin (ticarcillin disodium and clavulanate potassium) was tested alone. The result

showed that cefotaxime at 200 mg/L in combination with 100 mg/L carbencillin, and 300

mg/L timintin were most effective not only in limiting Agrobacterium after co cultivation

but also in survival of explant. Higher dose of antibiotics cefotaxime and carbencillin

resulted in necrosis of explant and lower dose lead to excessive contamination and death

of explants. We also tested Augmentin combination at 300 mg/L with lower dose of all

three antibiotics were also evaluated to in order to eliminate Agrobacteria post co-

result also showed that EHA105 was easiersy to remove from mediumlimit after co

with above mentioned treatments as compared to GV3101. Overall timentin which is β-

lactam antibiotic was found most effective that are active against Gram-negative bacteria

tumefaciens and tolerable for explants at high dose alone and at low dose in combination

as shown in Table 3.11.

Table 3.11 Antibiotic sensitivity screening for selection media optimized for S.


Agrobacterium

strain

Cefotaxime

(mg/L)

Carbencillin

(mg/L)

Timentin

(mg/L)

Percentage of

survival

explants (based

on Kan resistant

shoots)

Appearance of

explants

EHA105 100 100 300 56.9 ±0.11.d Green healthy

200 100 300 61.3 ±1.21c Green healthy

300 - - 35.9±1.8g Necrosis

500 - - 43.7±1.2f Pale yellow

- - 600 75.0±2.0a Yellow green

GV3101 100 300 - 28.29 ±0.76c Necrosis

200 300 54.3 ± 1.09e Browning

300 - - 18.2 ±0.98i Bacterial growth

500 - - 23.0±1.29h Bacterial growth

- 600 69.0±1.0b Pale yellow

Results Chapter 3

134

Data represent the mean ± S.E calculated from 30 explants per treatment in three replicates. Means followed

by the same letter within column are not significantly different as determined by a pairwise comparison using

Tukey’s test at p<0.05.

Regeneration of putatively transformed explants and shooting

Following agrobacterium infection the cotyledonary explants and hypocotyls aplaced on

CIMT12= 2 mg/L IAA, 2 mg/L NAA, 2 mg/L BAP, 4mg/L KIN containing basal medium

with 50mg/L Kanamycinkanamycin and 600 mg/L Timentin for one week. The explants

turned green showing the successful event of transformation while non transformed

explants depicted necrosis and cell death following co cultivation as shown in Figure 3.30

(C-I). The growing calli were shifted to shoot inducing medium SIMT6 containing 3 mg/L

BAP and 0.1 mg/L IAA/NAA. After one week of incubation when shoot primordia

appeared the regenerating explant were sub cultured and selection antibiotic removed to

enhance shoot and root organogenesis. The Kanamycinkanamycin concentration was also

monitored in on/off manner during sub-culture passages. The shoot organogenesis time

was recorded as 3-5 week irrespective of explant type. Transformation efficiency was

calculated by the mean number of Kanamycinkanamycin regenerated putative transformed

shoots. After 4 weeks of incubation, on average 4 shoots appeared from cotyledons derived

explant and 2 shoots from hypocotyl explants with transformation efficacy range of 30-40

% as shown in table. There was a considerable decrease in survival of positively

transformed calli owing to subsequent contamination of explants with yeast due to which

transformation efficiency decreased. The shoots were excised and placed on root induction

media for individual plantlet formation. Thereafter, plentiful rooting was observed on

medium supplemented with 0.5 mg/L NAA.

Table 3.12 Regeneration efficiency of putatively transformed Kanamycinkanamycin

of S. lycopersicum cv. Riogrande

Data represent the mean ± S.E calculated from 90 explants per treatment in three replicates. Means followed

by different letters within column are significantly different from each other as determined by a pairwise

comparison using Tukey’s test at p<0.05

Explant type % reporter

gene

expression

Regeneration

frequency %

Shoots/explant Transformation

frequency

Hypocotyls 56.23±0.65b 23.18 ± 2.1b 2.34±0.38b 35±1.83b

Cotyledons 68.32±1.89a 35.12±1.24a 4.78±1.28a 44±2.2a

Results Chapter 3

135

Ex-vitro acclimatization of transformed plantlets

Following rooting of transformed shoots after 2.5 months of culture, the regenerated fully

grown plants were transplanted to peat moss in small plastic pots (W × D × H: 4 × 3 ×7

inches; 22 oz) and covered with plastic polythene bag with holes for adaptation of plantlets.

Plantlets were allowed to grow for 6 weeks under 23±2°C, 30–50% humidity and a 16/8 h

Light/Dark photoperiod. Each plantlet was given 1 mL of half strength MS with vitamins

twice in a week. Moreover, on a daily basis, they were exposed to an open-air environment

for hardening before being fully transferred to a glass house. Well-developed plantlets were

transferred to a 900 g of substrate composed of soil: peat: organic compost 1:1:1 (w/w/w)

in plastic pots (W × D × H, 4.72×3.9×5.9 inches). The plants were transferred to

greenhouse net conditions during winters. For morphological characteristics comparison

WT plants were included in the study. The plants transferred in the month of December

were unable to set flowers and subsequently died. However, plants were transplanted in

mid -Mmarch gave flowers in natural environment in May. The fruiting set occurred after

3-4 weeks.

Results Chapter 3

136

Figure 3.313.31 Regeneration of Agrobacterium infected transformed cotyledon explants

(A-D) Callus formation (E-J) Root and shoot organogenesis

Results Chapter 3

137

Figure 3.323.32 Acclimatization of CCD7 transformed regenerated plants and

flowers and fruits in S. lycopersicum cv. Riogrande

(A-D) Transfer and acclimitization of transgenic shoots (E) Green house accessment and maturation of

transgenic plants (F-G) Flower and Fruit development.

Molecular characterization of transformed shoots

T0 and T1 transgenic shoots of LUC+/GFP+/CCD7+ Kanamycinkanamycin resistant plants

were selected for PCR and RT-PCR confirmation. Putative transformed plants were

characterized for the presence of /LUC/GFP/ CCD7 genes by using PCR amplification

with gene specific primers (Figure 3.33). We utilized Modified (Doyle, 1991) method of

2XCTAB method was used to extract DNA from leaves of tomato. 10

Kanamycinkanamycin resistant tomato leaves were randomly selected from each line. All

the samples showed desired 817 bp LUC gene and positive control showed same size

product as well shown in Figure 3.33-A lane 10, 11. 405 bp of GFP was also confirmed in

8 leaf samples of transgenic tomto, corresponds to lane 1-8 in Figure 3.33-A. Multiplex

PCR showed amplification of both LUC gene 817 bp and 300 bp bar gene in over

expression line 1 (OE1).

Results Chapter 3

138

Figure 3.333.33 PCR confirmation of LUC, GFP and CCD7 genes in putative transformed

lines

(A) Lane 1-8 GFP integration in T1 shoots, Lane 9 positive control, Lane 10-11 LUC gene integration, Lane

12 positive control, Lane 13 &14 negative control, Lane 15 100 bp gene ruler (Viogene).

(B) Multiplex PCR amplification of transgenic shoots, Lane 2-5 300 bp bar gene amplification, Lane 6

negative control, Lane 7-10 simultaneous amplification of LUC 800 bp and bar 300 bp genes (C) Multiplex

amplification of 1900 bp CCD7 and LUC gene expression, Lane 6&14 100 bp ladder (5PRIME).

Results Chapter 3

139

Morphological assessment of T0 & T1 plants

Fruit quality, number, size, shape firmness and color are major areas of economic

importance in tomato breeding management. The phenotypic characteristics were

compared with wild counterparts at reproductive stages and apparently found no striking

difference in T0CCD7(OEO) transgenic plants as shown in Figure 3.34. However, when

T1(OE1) were used for phenotypic evaluation, more apparent diffrences in morphological

chatacters like plant height, no of nodes/internodes and branches were observed. There

were comparable but statistically insignificant differences in the germination percentage

and emergence rate. The transgenic plants showed comparively less height when compared

with WT during fall season. The number of branches were also less and plants were more

slenderer and less bushy as compared to wild type (For details see section discussion).

Transgenic plants flowerd later than wild type plants both in controlled and open

environment. Number of flowers as well as fruit was also fewer as compared to WT. Stem

diameter and leaf morphology was also affected (Table 3.13). Overall CCD7 gene was

found responsible for above ground changes in plant architecture characteristcs of most

natural and synthetic SLs and SL related compounds.

Results Chapter 3

140

Figure 3.343.34 Phenotypic evaluation of transgenic CCD7 lines in comparison to WT

Riogrande at reproductive age

(A) Leaves (B-C) Flowers (D-E) Fruits

Results Chapter 3

141

Physiological indices associated to dehydration resistance of

transgenic tomato plants

Dehydration response assay & relative water content (RWC) of mature transgenic plants

was measured under drought to access their stress tolerance due to overexpression of CCD7

gene and disclose the mechanism involved in SL related effects. Three months old soil

grown transgenic and WT tomato plants were exposed to dehydration response assay by

withdrawing water for 2 weeks to observe the phenotypic difference and drought resilience.

Considering tomato is extremely sensitive to irrigation, after 7 days WT tomato plants

started to show typical drought induced wilting symptoms whereas transgenic plants

showed no signs of drought stress. After 14 days of drought stress, WT plants withered

extremely with visual signs of tissue necrosis, yellowing, leaf rolling and loss of

chlorophyll as shown in Figure 3.35C. While transgenic plants at this level were less wilted,

minimal rolling and yellowing of leaves was evident. Most of leaves maintained normal

photosynthetic capacity and phenotypically still green and active as shown in Figure 3.35

C& D. Additionally when watering was resumed after 21 days after which less than 20 %

of WT plants survived while more than 80% transgenic plants recovered from drought

stress as shown in Figure 3.36. Relative water content estimation of control and transgenic

plants showed that during well irrigated and 7 days mild water deficit conditions, showed

thatdetached leaves of transgenic plant expressing LjCCD7 lost less water and over a longer

period as compared to control leaves. Tranegeic plants in general require significantly less

water and leaves are able to lose less weight over the time of 6 hr as compared to WT

(Figure 3.36 2-3).

Results Chapter 3

142

Figure 3.353.35 Drought tolerance response of LJCCD7 overexpressing Riogrande

(A-B) A water withholding survival assay was performed with 3 months old plants for 3 weeks time. Left

WT, Right Transgenic plants under irrigated conditions (C) Transgenic line on Left Vs WT on Right after 21

days of water deprivation (D) Transgenic plant after recovery

Results Chapter 3

143

Figure 3.363.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing

Riogrande plants

(1)Survival rate of drought induced LJCCD7 overexpressing Riogrande plants (A)Transgenic lines after recovery period and irrigation after 21 days water stress (B) Survival rate of OE1 line Vs WT. (C) Irrigation

resumed after 21 day stress (D) WT plant showing in severe damage and unable to recover from drought

stress.

Results Chapter 3

144


Riogrande plants

(2) Percent leaf water loss in detached leaves of OE1 and and WT plants. 10 Weeks old plants under well

irrigated condition and under mild stress of 7 days water deprivation treatment. Data represents the means ±

S.E (n = 3).

0

20

40

60

80

100

120

0 30 60 90 120 150 200 250 300 360

We

igh

t o

f le

ave

s(%

in

itia

l we

igh

t)

T=min

ControlT1L(NS)

WT1L(NS)

0

20

40

60

80

100

120

0 30 60 90 120 150 200 250 300 360

We

igh

t o

f le

ave

s(%

in

itia

l we

igh

t)

T=min

Mild stressTL(S)

WTL(S)

Results Chapter 3

145


Riogrande plants

(3) % Relative water content 10 Weeks old plants from detached terminal leaves of OE1 and and WT plants

measured after water deficit of 0,7,15 and 21 days drought treatment. Data represents the means ± S.E (n =

3). * indicates values that are significantly different from each other according to Tukey’s test at p<0.05.

DAS: Days after stress

0

10

20

30

40

50

60

70

80

90

100

0 DAS 7DAS 15 DAS 21 DAS

Rel

ativ

e w

ater

co

nte

nt

(%)

T=min

RWCT1

RWCWT*

Results Chapter 3

146

Estimation of antioxidant enzyme potential, MDA and chlorophyll

content analysis of drought stressed transgenic lines.

Plants exposed to abiotic stresses like drought, heat, salinity, mineral depletion result burst

of reactive oxygen species (ROS) which act as alarm system of plant when produced in

low quantities. However, the quenching activity in plant by antioxidant enzymes scavenge

these ROS to maintain normal physiological state of plant. The balance between ROS

production and their quenching is crucial aspect of abiotic stress resilience in plants. . We

evaluated the ROS quenching ability of transgenic plant stem as well as leaves at normal

physiological state and after 15-21 days of water deficit treatment was measured.

Thereafter oxidative burst during the dehydration stress was assessed by quantification of

enzyme activities like SOD, POD, CAT, APX and MDA content analysis transgenic as

compared to their wild type counterparts shown below.

Superoxide Dismutase (SOD) activity analysis

Superoxide radicals that are by products of stress response in plant tissue are converted to

hydrogen peroxide (H2O2) by SOD antioxidant enzyme. Our result showed that there has

been constitutive increase in SOD activity of CCD7 overexpression line as the water

depletion increased as compare to their wild counterparts. The transgenic leaves showed

10–-15 ₋fold increased SOD activity after 21 days of water depletion as compare to WT

leaves. For 15 days of drought stress, there was no statistically significant decrease in the

SOD contents of transgenic leaves and stem which shows their ability to scavenge active

ROS production, while WT plants had low activity at irrigated stage. WT tomato leaves

and stem did showed increase of SOD activity after 15 days of water stress; however, this

increase was not enough for survival of WT plants under dehydration stress. On the other

hand transgenic leaves and stem showed 2.1 and 2.2–₋fold increase in SOD contents as

compare to well irrigated conditions while at the same time WT leaves and stem

experienced >1.5–₋fold decrease in SOD activity (Figure 3.37). Our results showed that

over expression of CCD7 gene in tomato confers drought stress tolerance as cued by

increase amount of SOD contents i.e. superoxide radicals in mitochondria and chloroplast

are scavenged by increase SOD content in a bid to rescue water stress physiology in

transgenic plants.

Results Chapter 3

147

Figure 3.373.37 SOD content analysis of leaves and stem of CCD7 overexpressing lines

against WT

Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each

other at p<0.01 according to tukey’s test. Enzyme extraction was carried out by randomly selecting 3 samples

(100mg) from each plant. DAS: Days after stress

Guaiacol Peroxidase (POD) activity

Dehydrogenation of organic compounds like guaiacol, pyrogallol, phenols and aromatic

amines are catalyzed by peroxidases (POD). POD are the enzymatic antioxidants that play

prime role in removal of ROS and H2O2 accumulation due to unfavorable environment in

plants. The dehydration response experiment showed that transgenic plants showed three₋fold

increase of POD activity after 21 days of water depletion over WT plants. The leaves and stem

of CCD7 overexpressed lines showed 2₋fold more POD activity even before the onset of

dehydration treatment showing that the transgenic line were stress tolerant with efficient

antioxidant response factors. When the stress level increased a 7.7–₋9.1 ₋fold, proportional

increase was seen as compared to WT leaves and stem as shown in Figure 3.38. Over all leaves

of OE1 line showed statistically in significant increase of POD activity as compared to stem

tissues.

0

50

100

150

200

250

300

OE1Leaf WTLeaf OE1stem WTstem

SOD

Act

ivit

y (

U/g

FW

0 DAS

15 DAS

21 DAS

**

**

Results Chapter 3

148

Figure 3.383.38 POD content analysis of leaves and stem of CCD7 overexpressing

lines against WT


other at p<0.01 according to tukey’s test. DAS: Days after stress

Catalase (CAT) activity

Accumulation of ROS mediated oxidative stress and cell death in plants occur because of

excessive cellular H2O2 accumulation due to water deficit. Plants have developed their

defence mechanism to cope with oxidative burst by activation of CAT activity which is

generally considered as positive indicator of the degree of drought experienced by plants.

Increase in CAT activity in leaves of drought stressed leaves and stem of transgenic CCD7

overexpressing lines showed that these plants can withstand sever water deficit by removal

of photorespiratory H2O2. The leaves and stem of transgenic lines showed 2–fold increase

in CAT activity with increasing time of water deficit while opposite happened for WT

plants that showed 2–fold decrease in enzyme activity. It was interesting that at normal

irrigated conditions CAT activity of both transgenic and WT leaves increased until day 15

of water stress although the activity of OE1 lines were 2–3 fold higher at this point. When

0

10

20

30

40

50

60

70


PO

D A

ctiv

ity

(m

M/m

in g

FW

0 DAS

15 DAS

21 DAS

** **

Results Chapter 3

149

extreme water stress occurred after 21 days the CAT activity of transgenic leaves and stem

further increased 1.2-1.6₋fold; however, WT tissue showed concomitant decline in activity

as shown in Figure 3.39.

Ascorate peroxidase (APX) activity

In plants, ascorbic acid is synthesized in the Smirnoff–Wheeler pathways resulting in

generation of electron donors having high capacity for detoxification of ROS by reduction

of H2O2 subsequently H2O generation through the APX reaction this preventing the

oxidative stress and celleular protection (Egea et al., 2018). The ascorbate estimation of

wild type and transgenic plants showed that during drought stress the APX increased 2

times as compared to WT plants when they encounterd water stress. Due to high affinity

of APX towards reduction of H2O2 increase in the activity is attributed to scavenging

activity of APX in removal of H2O2 due to drought stress. Wild type plants did showed

some non-significant increase after 15 days of water stress but due to stress sensitivity the

APX units decrease further 2₋fold after 21 days of water deficit as shown in Figure 3.39.

Results Chapter 3

150

Figure 3.393.39 Effect of drought stress on H2O2 scavenging acticity due to CAT and

leaves and stem of CCD7 overexpressing Riogrande lines against WT

Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each other at p<0.01 according to Tukey’s test.

0

0.05

0.1

0.15

0.2

0.25

0.3


CA

T A

ctiv

ity

(m

M/m

in-g

FW

0 DAS

15 DAS

21 DAS

**

0

1

2

3

4

5

6

OE1Leaf WTLeaf

AP

X A

ctiv

ity

(U

/min

-mg

FW

0 DAS

15 DAS

21 DAS

**

**

Results Chapter 3

151

Estimation of Malondialdehyde (MDA)

Malondialdehyde is on one of the key product of lipid peroxidation. The decomposition of

polyunsaturated fatty acids produce MDA that has been utilized as biomarker in stress

induced lipid peroxidation. MDA content has been determined in transormed and WT

control plants as an indicator of degree of damage under water stress. Before water stress,

both transgenic plants showed similar MDA levels. However, after 2 weeks of water stress

the transgenic plants accumulated significantly less MDA contents as compared to the

control WT plants (Figure 3.40). Further WT leaf and stem tissues accumulated 2.89-3.1

₋fold higher MDA levels after 21 days of drought stress. Thus it could be inferred that

transgenic tomato plants experience minimal lipid peroxidation of membranes owing to

active antioxidant enzyme activity that scavenge oxidative burst produced as result of water

deficit. Higher MDA content in case of control WT plants are the prime cues for oxidative

damage to lipids, cell membrane damage, loss of enzyme activity as well as protein- protein

linking that lead to severe necrosis and cell death shown in survival assay Figure 3.36 B.

Figure 3.403.40 Malondialdehyde (MDA) levels in the transgenic OE1 tomato after 21

of drought stress treatment


other at p<0.01 according to Tukey’s test.

1

4

7

10

13

16

19

22

25

28

31

34


MD

A (

µM

/g F

W

0 DAS

15 DAS

21 DAS

**

**

Results Chapter 3

152

.

Total chlorophyll content analysis

Total chlorophyll content of leaves is considered as direct measure of physiological state

of plants. Loss of chlorophyll during water stress is an indicator of malfunctions in

photosynthetic ability of plant. In this study chlorophyll, content of control and transgenic

line were determined at normal physiological state and after 14 & 21 days water deficit.

Before water stress the basal level of total chlorophyll content of both control and CCD7

overexpression lines were found similar. As the water deficit increased the total chlorophyll

content of transgenic plants showed some damping of chlorophyll content from initial

value; however, when the water deficit reached the maximum level i.e. 21 days of water

stress, transgenic leaves interestingly showed about 15 % increase of chlorophyll content

as compared to non-stressed conditions as shown in Figure 3.41. While control plants

showed 2₋fold decrease in the total chlorophyll content when water deficit occurred. Thus,

indicating limited photosynthetic potential under water stress. Hence, it could be deduced

that CCD7 overexpressing tomato plants can withstand severe drought and water deficit.

Results Chapter 3

153

Figure 3.413.41 Leaf chlorophyll content analysis of CCD7 overexpressing Riogrande

tomato

Data represents means of three replicates ± S.E. * indicates values that are significantly different from each

other at p<0.05 ** p<0.01 according to Tukey’s test.

Phenolic, Flavonoid, and antioxidant Composition

Tomato is considered as rich source of phenolic derivatives that contribute not only to

nutritional profile of tomato fruits but also substantial role for plant’s physiochemical

performance. Additionally, phenolic compounds and flavonols are natural antioxidants

that are indicators of plant adaptive reponse to abiotic and biotic stress. To compare

transgenic tomato fruits with wild type, and the possible impact of CCD7overexpression

on nutritional content of tomato, phtochemical analysis were performed. The results

showed that the transgenic fruit skin showed 50 % increase in flavonols and phenolic

content as mg QU 100 g−1 and mg GAE 100 g−1 respectively as shown in Table 3.13.

0

0.5

1

1.5

2

2.5

3

3.5

OE1Leaf WTLeaf

Ch

loro

ph

yll (

mg/

gFW

)

0 DAS 15 DAS 21 DAS

*

** 8 8

Results Chapter 3

154

Studies have shown accumulation of phenols, flavanol and antioxidants due to heat stress

(Junglee et al., 2014). Quercetin was one of most abundant flavonoid found in transgenic

tomato with a range of 129–-255 mg/100g fresh weight against 76 mg/100g fresh weight.

It is evident from the results that secondry metabolite production that increase in the

transgenic plant tissues as compared to wild type. It was found that plant expressing

LjCCD7 gene showed enhanced production of flavonoids, phenols. Ascorbic acid and

total antioxidant potential as shown Table 3.13.

Table 3.13 Physiochemical characteristics of T1 transgenic plants

Sample

ID

Plant

Height

(cm)

Stem

Diameter

(cm)

No. of

branches

Total

phenolic

content (mg

GAE /

g) ± S.E

Flavonoid

content (mg

QU/ g) ± S.E

DPPH radical

scavenging

activity

IC 50Value

(μg/mL)

WT1 120a 3a 28 b 32.3 ± 0.44f 76.65 ± 3.56e 39.8± 1.44d

WT2 100c 2.8 ab 25bc

WT3 67g 2.5c 23c

T1.1 45.6h 2cd 11f 56.5± 1.45 d 129.99 ± 5.47d 51.02±4.25bc

T1.2 71.9e 1.98d 13e 48.8± 1.67 e 127.99 ± 4.67d 39.7± 3.98d

T1.3 72.0ef 1.5e 9g 61.1± 1.56 c 187.99 ± 6.17b 60.06± 7.65a

T1.4 90.5d 2cd 14d 69.9± 2.56 a 255.99 ± 6.65a 54.7± 4.44abc

T1.5 110ab 2.87 ab 30 a 64.7± b 0.34 160.99 ± 9.17c 47.8± 5.0 bc Data represents means of three replicates ± S.E. Different letters in the columns indicate

significant differences between treatments according to Tukeys test (p ≤ 0.05). T= Transgenic,

WT= Wild type

Results Chapter 3

155

Development of STRI Tools: SL analogues and in planta

quantitative assay to study SL binding mode

Synthesis of new molecules

The models designed for predicting the strigolactone hormonal roles in plants were

used for the rational development of new SL candidate(s) and of selective D14 inhibitor(s)

with optimized properties. In particular, lactam based strigolactone analogues and mimics

were predicted to effectively bind D14. Specific SL analogues mimics were prepared

according to methodologies previously done by (Lombardi et al., 2017) at Department of

Chemistry, University of Turin. General strategy followed to prepare D–-Lactams is shown

in scheme 1 (Figure 3.42). Moving backwards, the final step involves a SN2 reaction

between an enolate, generated from the lactone C of the ABC core (TYPE 1), and the

bromo lactams type 2 (Scheme 1). These latter intermediates were obtained as a result of

allylic bromination of lactams 1.

Scheme 1. General synthetic approach

A range of molecules were considered and used in bioassays to check their activity as

compared to (+)-GR24 used as the reference compound. Strigol was included as being

representative of natural SLs. ST23b, EGO10, and EDOT were selected for their reported

high activity in inducing germination and hyphal branching in P. aegyptiaca seeds and the

AM fungus Gigaspora margarita, respectively, along with their ability to affect root

architecture (Prandi et al., 2011; Cohen et al., 2013; Mayzlish-Gati et al., 2015). N-tert-

butyloxycarbonylation (N-Boc) protected derivatives of GR24-D-lactam were prepared as

racemic mixture (rac- 1 and rac-2, Figure. 2.11) to modulate the molecular accommodation

of Boc group inside the receptor pocket and respective H-bonding interactions with

catalytic triads of important amino acids of the receptor pocket. Similarly, unprotected

Results Chapter 3

156

derivatives were obtained (rac-3 and rac- 4 Figure 2.11). The stereochemistry of rac-1 and

rac-3 corresponded to the strigol family, while that of rac-2 and rac-4 corresponded to the

orobanchol family of natural SLs. Rac-5 and its N-Boc precursor rac-6, corresponds to

EGO10 backbone (Figure 2.11). In order to investigate the effect of a lactone-to-lactam

modification two SL mimics, rac-7 and rac-8, as NH D-lactam and N-Boc were also

prepared. rac-9 was designed derived EGO10-D-lactams but devoid of enol ether bridge

connecting the ABC core to the D-ring. It was We hypothesized that bioactivity of rac-9

inside receptor pocket will be effected by its non hydrolysability due to lack of enol ether

bridge.

Figure 3.423.42 Synthesis module of GR24-D-Lactams

Stability of newly synthesized compounds

Differential activity of SL analogues was presumed due to their instability in aqueous

medium. In order to investigate this point, stability of newly synthesized SL-D-lactams

was tested in aqueous solution, and compared to the (+)-GR24 standard. Two different

conditions were considered, a 30% solution of MeOH in water and a 1:1 solution of ace-

tonitrile in water. As expected, stability in MeOH was highly compromised for all

compounds, but to a greater extent for analogues showing both the Michael acceptor

function (enol ether bridge) and an unprotected N in the D-lactam ring, as for rac-3, rac-4,

rac-5, and rac-7 (Table 3.14): after a few hours 50% of the compounds were degraded. This

was not surprising from a chemical point of view, as the functional group in SL-D-lactams

Results Chapter 3

157

is an amine, which is more prone to hydrolysis than the acetal of the natural SL skeleton.

By contrast, rac-9, in which the enol ether bridge was missing and the lactone C–-ring was

directly connected to the lactam D-ring, showed high stability in both solvents. All

compounds with an N-Boc-protected function showed higher stability (rac-1, rac-2, rac-6,

rac-8) compared to their unprotected (NH) versions. For the GR24-family compounds,

both NH (rac-3) and N-Boc (rac-4) lactams showed very low stability values, as the half-

life time was estimated to be around 3 h. For rac-5, the NH compound in the EGO10 family,

the half-life dropped to 2 h. These data should be taken into account when considering the

results of both bioassays (parasitic seed germination and D14 degradation tests).

Table 3.14 Chemical stability of lactams, named as described in Fig. 2.11, in 30% MeOH

or 1:1 acetonitrile (ACN): water at 21 °C and pH 6.7.

Compound Half-life (t1/2, h)

30% MeOH ACN:Water, 1:1

(+)-GR24 rac-1 80 3375

rac-1 110 720

rac-2 21 140

rac-3 3 3.8

rac-4 3.3 4.4

rac-5 2 24

rac-6 190 528

rac-7 11 17

rac-8 230 1080

rac-9 1100 2900

*t1/2 values were extrapolated from the plots of peak area versus time (Annexure III).

Results Chapter 3

158

Germination activity of new SL- Analogues

The effect of synthesized SLs analogues on the induction of parasitic weed seed

germination was investigated. The newly synthesized SL–-D–-lactams were applied in

acetone dissolved form on seeds of P. aegyptiaca and compared to rac-GR24 as the

reference standard. Appropriate acetone control was included as negative control and

strigol as positive control. Analogues ST23b, EGO10, and EDOT (Prandi et al., 2011) were

also tested for comparison. Maximum activity of rac-GR24 was found to be induced at

concentration of greater than 10-5 M concentration according to dose response curve of (+)-

GR24 & EGO10 as shown in Figure (3.44)

The result showed in Figure 3.43 illustrates that the D-lactams rac-1–9 were all less

effective in comparison with (+)-GR24 germination assay. rac-1, 3, and 7 showed high

activity only at concentrations equal to 10 μM, thus indicating ~100₋fold lower potency

than rac-GR24. The GR24-D-lactams rac-2 and rac-4 were the most active compounds of

the series, as some germination activity could be detected even at 1 μM; all other

compounds were inactive throughout the whole range of concentrations. Surprisingly, rac-

2 and 4 showed overlapping activity profiles, as if the presence of the Boc group on N was

not affecting the perception by parasitic seeds. The same trend could be observed for all

other compounds, for which a substantial difference between cognate NH and N-Boc

derivatives could not be detected.

Results Chapter 3

159

rac-1–9, strigol, ST23b, EGO10, and EDOT at different concentrations, compared to rac-GR24 0.1 μM as a

positive control and to acetone as a negative control Data are means (±S.E) of n>250 seeds. Confidence intervals at 95% are used to express errors of the means. (Sanchez et al., 2018)

Luminometer based D14 degradation assay

D14 is a target for proteasome-dependent destruction upon interaction with its ligand(s),

which explains why fluorescence of D14::GFP fusion proteins is quenched upon SL

treatment in transgenic Arabidopsis (Chevalier et al., 2014). To use this as proof of concept

exploited this molecular network in transgenic Arabidopsis expressing D14::LUC under

the control of the D14 endogenous promoter in a quantitative activity assay that inversely

correlated luminescence to perception of SL-related molecules. The assay was first

calibrated by using (+)-GR24 & EGO10 over a range of concentrations (Figure 3.44), and

0

20

40

60

80

100

120

140

GR24 0.1 µm 10 µM 1 µM 0.1 µM 0.01 µM 0.001 µM acetone

Rel

ativ

e ge

rmin

atio

n %

Strigol ST23b EGO10 EDOT rac-1 rac-2 rac-3 rac-4 rac-5 rac-6 rac-7 rac-8 rac-9

D-lactamsD-lactams

D-lactams

D-lactams D-lactams

Figure 3.433.43 Germination-inducing activity of D-Lactams on Phelipanche aegyptiaca seeds

Results Chapter 3

160

the calculated EC50 value was found to be 1.62 μM. Later We then used the assay was

utilized to test various SLs in the same range, namely strigol as an example of natural SLs:

ST23b, EGO10, & EDOT as rac mixture and all the SL-D-lactams of natural SLs. The dose

response curve of (+)-GR24 & EGO10 as shown in Figure 3.44. As shown Figure 3.45

strigol, ST23b, EGO10, and EDOT induced high levels of D14 degradation although pure

enantiomer (+)-GR24 was most active in degradation of D14. All D-Lactams tested in the

range of 0.01–100 µM were ploted for 15 hr and their efficacy was calculated at 6 hr time

when 50% D14 signal has been decreased after addition of (+)-GR24 1 µM corresponding

to EC50 value of 1.62 μM. However, most of D-lactam analogs were less efficient with

some detectable activity shown in the range of 10–100 μM only as shown in Figure 3.45

& 3.46. The comparative efficacy analysis showed rac-6 was most active at 10 µM

concentration followed by rac-1, rac-7, rac-5, rac-2, rac-3, rac-4 while rac-8 & rac-9 were

found inactive even after 15 hr of incubation (Figures 3.47 & 3.49 A-B). At highest

concentration i.e 100 µM of all D-Lactams, rac-1 and rac-6 showed maximum activity

(Figures 3.47). As rac-9 was inactive in both bioassays at 10 µM, it was we then tested

whether it could behave as an antagonist in a luminometer based competition assay. For

this purpose, rac-9 was kept constant at the highest inactive concentration (10 µM), while

concentrations of (+)-GR24 were varied in the range 0.01–100 µM. The efficacy values

were calculated at 6 hr time after addition considering 100 % efficacy of (+)-GR24 alone

as positive control. As shown in Figure 3.48 the results indicated no antagonistic behavior

for rac-9 under our experimental conditions.

Results Chapter 3

161

Figure 3.443.44 Dose response assay with (+)-GR24 & EGO10 normalized to acetone

Data was generated from means of relative luminescence values of atleast 12 individual plants at each time

point. The original values were normalized with appropriate acetone control and represented as percent

activity. Confidence intervals at 95% were used to express errors of the means.

0%

20%

40%

60%

80%

100%

120%

0.00 3.00 6.00 9.00 12.00 15.00

%Lu

cife

rase

act

ivit

y R

.L.U

T(h)

EGO10 1uM EGO10 5uM EGO10 10uM

EGO10 20uM EGO10 100nM GR241uM

GR240.5uM MS Acetone

0%

20%

40%

60%

80%

100%

120%

0.00 3.00 6.00 9.00 12.00 15.00

%Lu

cife

rase

act

ivit

y R

.L.U

T(h)

ContH MS GR2420uM GR245uM

GR241uM GR24 0.5uM GR24100nM GR2410nM

GR241nM GR2410uM

Results Chapter 3

162

Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings and readings. The EC50 curve for (+)-GR24 obtained using GraphPad Prism 7.00. The curve was calculated by linear

regression fitting of the data at different concentrations, minus values for acetone-treated samples (negative controls)

and normalized to GR24 at 0.01 μM, which was set to 0%. Confidence intervals at 95% are used to express errors of

the means.

Figure 3.453.45 Luciferase assay with D-Lactam based SL analogues series

Results Chapter 3

163

Figure 3.46 A- Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in comparison

with at 1 μM (+)-GR24

-20

0

20

40

60

80

100

120

%Ef

fica

cy

T=6hrs

GR241uM

Control

rac-6 100uM

rac-6 10uM

rac-6 1uM

rac-6 0.1uM

rac-6 0.01uM

-60

-40

-20

0

20

40

60

80

100

120

%Ef

fica

cy

T=6hrs

GR241uM

Control

rac-8 100uM

rac-8 10uM

rac-8 1uM

rac-8 0.1uM

rac-8 0.01uM

A

Results Chapter 3

164

Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings

and readings minus values for acetone-treated samples (negative controls) and normalized to GR24 at 1 μM,

which was set to 100%. Confidence intervals at 95% are used to express errors of the means. 6hrs time was

selected after addition of treatment when 50% luminesense signal due to D14 degradation went down for GR24.

-40

-20

0

20

40

60

80

100

120

%Ef

fica

cy

T=6hrs

GR241uM

Control

rac-2 100uM

rac-2 10uM

rac-2 1uM

rac-2 0.1uM

rac-2 0.01uM

-20

0

20

40

60

80

100

120

%Ef

fuca

cy

T=6hrs

GR241uM

Control

rac-1 100uM

rac-1 10uM

rac-1 1uM

rac-1 0.1uM

rac-1 0.01uM

B

Figure 3.463.46 A-B Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in

comparison with at 1 μM (+)-GR24

Results Chapter 3

165

Figure 3.473.47 Highest concentrationn (100 μM) of D-Lactam analogues in

(+)-GR24

Results Chapter 3

166

Figure 3.483.48 Luciferase competition test between rac-9 and (+)-GR24

Efficacy values for (+)-GR24 from left across a range of concentrations normalized to the value at 1 μM, which was set to 100%. Data are means (±S.E) of n=5 replicates

Results Chapter 3

167

Fig

ure 3

.49

3.4

9 (A

-B) L

uciferase D

14 d

egrad

ation activ

ity o

ver 1

5 h

r treatmen

t again

st 1µ

M (+

)-GR

24

Results Chapter 3

168

Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings and readings. Confidence intervals at 95% are used to express errors of the means.

Fig

ure 3

.49 B

Lu

ciferase D14

deg

radatio

n a

ctivity

ov

er 15

hr treatm

ent ag

ainst 1

µM

(+)-G

R2

4

Results Chapter 3

169

Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual

seedlings and readings. Confidence intervals at 95% are used to express errors of the means

Figure 3.503.50 Luciferase D14 degradation assay with SL mimics across a range of concentrations

(0.01–100 μM).

Results Chapter 3

170

Similarly, SL mimics CL and CL-BP conjugated with fluorescent functional group

BODIPY during D14 degradation assay showed the two mimics were only slightly active

at very high concentration (10-4M) and the response was found statistically similar to 10-

7M racGR24 activity as shown in Figure 3.50. Both molecules were found completely

inactive at 10 µM which provide indications about their inhibitory effects that need further

insights on their SAR studies.

nDocking of D-Lactams

Validation of the compounds tested through germination and luminmeter assay was done

by docking analysis of analogues to decipher their binding mode within receptor pocket.

We performed Docking simulations of three SL-D-lactam compounds within the binding

pocket of D14 were executed. In thisour studies, the structure of rice D14 co-crystallized

with GR24 was selectedwe selected as a template the structure of rice D14 co-crystallized

with GR24 [PDB code 5DJ5] (Zhou F et al., 2015). We used the Same approach was

utilized to investigate the pose of the new D-lactams rac-3, rac-4 and rac-9 in the D14

pocket. Rac-3 is the GR24-D-lactam whose configuration is “strigol-type” while rac-4 is

the correspondent “orobanchol-type”. Both enantiomers for rac-3 and rac-4 were docked

in the enzyme pocket. As expected, the most reasonable pose was obtained for the

enantiomer of rac-3 possessing absolute configuration (SSR), having the same

stereochemistry of the (+) GR24 co-crystallized with D14 (Figure 3.51 A), and showing a

very similar orientation. The ligand is able to interact with the catalytic Ser97 and His247,

with Ser220 and also with Trp155, lining the upper part of the binding site. Hydrophobic

moieties properly fit the pocket hydrophobic region lined by Phe28, Phe126, Phe136 and

Val144. Located and stabilized through hydrophobic and electrostatic interactions in the

binding site, the molecule could then be easily hydrolysed by Ser97 and thus mimic SL

activity. A less favourable pose was obtained for the enantiomer (RRS) (ent-strigol

configuration, Figure 3.51 B), which maintains the contact with Ser97 but, because of the

different stereochemistry, moves the hydrophobic condensed ring towards Trp155 and

loses the contact with Ser220 and His247. Additional interactions are made with Tyr159,

as shown in Figure 3.51 B. Similarly, to rac-3, also rac-4 showed less reliable poses than

the co-crystallized GR24, again in agreement with poor activity data in the D14: LUC

degradation bioassay. In particular, both enantiomers maintain the interaction with the

Results Chapter 3

171

catalytic Ser97 and with Tyr159 and both experience an adjustment of the pyrrolone ring

and of the indeno-furan system. Rac-1 and rac-2 did not give any reasonable pose when

docked in D14, because of the presence of the Boc group.

Figure 3.513.51 Docking model of rac-3 and rac-4 in the binding site of rice D14

(A) Rac-3, (SSR, strigol configuration). (B) rac-3 (RRS ent-strigol configuration). (C) rac-4 (RRR,

orobanchol configuration). (D) rac-4 (SSS, ent-orobanchol configuration). The ligand and the residues

lining the pocket are shown as capped sticks. For each racemic mixture, both enantiomers were modelled.

Hydrogen bonds are represented as black dashed lines. The protein is represented as cartoon. Residues 158-

166 were removed for clarity. Tyr159 is shown only when relevant for the complex stabilization. Only

closest residues to the ligand are labelled.

Results Chapter 3

172

Rac-9 was also docked in D14 (Figure. 3.52 a); only the enantiomer (SS) that gave the best

pose is shown in the Figure 3.52. When located in the pocket, the pyrrolone ring of rac-9

maintained the interaction with Ser97 but no other H-bond was formed. Hydrophobic and

polar groups both superimposed quite well with the corresponding Molecular Interaction

Fields, with the exception of the indolone methyl group, which was probably too close to

Trp155. Nevertheless, due to the reduced number of hydrogen bonds, the presence of

negative hydrophobic– polar contacts, and the higher rigidity of the molecule, the D14

complex with rac-9 was likely to be far less stable than the one with (+)-GR24

Figure 3.523.52 Docking model of rac-9 in the binding site of rice D14

Only enantiomer SS is reported. (A) Crystallographic pose. The ligand and the residues lining the pocket are

shown as capped sticks. Hydrogen bonds are represented as black dashed lines. The protein is represented as cartoon. Residues 158-166 were removed for clarity and only closest residues are labelled. (B) Molecular

Interaction Fields calculated by FLAP. Red, blue and yellow contours identify the H-bond acceptor, H-bond

donor and hydrophobic Molecular Interaction Fields, respectively.

Results Chapter 3

173

Luminometer assay based dynamic of other phytohormones

Although yet ambiguous, improved understanding of complex hormone signaling and

perception networks lead to permissible comparisons between hormones. The post

translation modification of receptor protein via ubiquitination mechanism of SL signal

transduction is similar to signaling pathways of abscisic acid (ABA), auxins, jasmonic acid

(JA) and gibberellic acid (GA) and ethylene (ET). The degradation of receptor via

ubiquitin/26S proteasome pathway remain fundamental aspect of signal transduction in all

above mentioned phytohormones. Our meta-analysis data also showed that SLs act via

cross linking of various phytohormonal pathways to employ their effects as shown in

Figure 3.53 (Saeed et al., 2017).

Figure 3.533.53 SL cross talk with various phytohormones during abiotic stresses (Saeed et

2017)

Results Chapter 3

174

We utilized same transgenicTransgenic Arabidopsis based quantitative assay was

employed to check D14 degradation. The residual fluorescence of phytohormones and

relative efficiency in D14 florescence quenching at varying concentration as compared to

acetone control and rac GR24 are shown in Figures 3.54 & 3.55. It was evident from the

percent residual luminescence that all the phytohormones (ABA, GA3, KIN, and IAA)

when compared to 1µM rac GR24 showed only detectable activity to quench the LUC

signal at very high concentration of 50-100µM. Even at high concentration the molecules

remained inactive over the time of 15-24 hr. ABA at 50 & 100µM was most effective of

all the tested hormones as shown in Figure 3.55a. Interestingly ABA treatment unfolded

an exceptional increase in luminescence signal starting from time 0 hr with maximum

florescence detected at 3 hr highlight with yellow arrow (Figure 3.54). Whilst at the same

time 1µM rac GR24 degradation of D14::LUC based florescence reduced to half.

Seedlings treated with ABA 10µM depicted an increase starting from time 0 hr and

continued >100% luciferin signal for 15 hr. In order to extrapolate the unusual behavior of

ABA, we performed competitive luminometerLuminometer based assay was tested to see

if it act as antagonist to (+)-GR24. Both hormones were added in same quantity to see if

the D14 degradation is promoted or not. As evident from Figure 3.54 (red highlighted bar)

even when (+)-GR24 was increased to 5 µM, no inhibitory effect of ABA was seen in

luminometer setup.

This kind of extraordinary luciferin based fluorescence signal solely obtained with ABA

treatment of pD14::D14::LUC Arabidopsis seedlings suggested the binding affinity of (±)-

ABA within the receptor binding pocket of D14. ABA treated seedlings were pooled out

at 0, 3, 6, 15 hr showed an increasing trend in expression of SL biosynthetic genes CCD7

and CCD8 and NCED3 essential for ABA biosynthesis during drought stress. The change

in relative expression of all the genes normalized to ubiquitin transcripts was noticeably

higher when treated with ABA as compared to non-treated seedlings (Figures 3.56 & 3.57).

Increase in CCD7 expression was most eminent when 10 µM ABA treatment was given

that show gradual increase with increasing treatment time. This point corresponds to the

time where luminometer data showed increase in signal more than control seedlings as

shown in Figure 3.52. There was no difference in relative expression of CCD8 gene while

NCED3 showed somewhat elevated relative expression only after long time of exposure to

Results Chapter 3

175

10 µM ABA treatment (Figure 3.56). Our results showed that transcript abundance of all

three genes increased with increase in treatment concentration of ABA. While NCED3

showed differential expression pattern when ABA treatment was increased to 50-100 µM

and the difference became more pronounced when treatment time increased. Unlike CCD7

and NCED3, CCD8 expression doesn’t change with remarkably until a threshold treatment

of 100 µM ABA treatment as shown in Figure 3.57. Which explains that at this point the

plant has perceived ABA in media as a stress signal as evident from differential expression

of all three genes.

Figure 3.543.54 Luminometer based D14 degradation assay with phytohormones at T=3

(a) ABA (b) GA3 (c) KIN (d) IAA. Data are means (±S.E) of n=5 replicates, where each replicate consists

of at least three pooled individual seedlings and readings. Confidence intervals at 95% are used to express

errors of the means

Results Chapter 3

176

Figure 3.553.55 Luminometer based D14 degradation assay with phytohormones over

Results Chapter 3

177

Figure 3.563.56 Transcript accumulation of genes involved SL & ABA metabolism

ABA treatment

Relative expression of CCD7, CCD8 and NCED3 normalized to ubiquitin in transgenic Arabisopsis. Data

are means (±S.E) of n=3 replicates, where each treatment of replicate consists of at least five pooled

individual seedlings from which total RNA was isolated. qRT-PCR was performed on total RNA using gene-specific primers listed. Transcript level were normalized to internal reference gene (UBI). Confidence

intervals at 95% are used to express errors of the means.

0.0

2.0

4.0

6.0

8.0

10.0

12.0

14.0

16.0

18.0

20.0

22.0

24.0

26.0

UB

Q10

no

rm

ali

zed

tr

an

scrip

ts

ABA 10µM

0hr 3hrs 6hrs 15hrs

-2.0

0.0

2.0

4.0

6.0

8.0

10.0

12.0

14.0

16.0

18.0

UB

Q10

norm

ali

zed

tr

an

scrip

ts ABA 50µM

0hr 3hr 6hr 15hr

Results Chapter 3

178

Figure 3.573.57 Transcript accumulation of genes involved SL & ABA metabolism

following 100 µM ABA treatment

Relative expression of CCD7, CCD8 and NCED3 normalized to ubiquitin in transgenic Arabisopsis. Data

are means (±S.E) of n=3 replicates, where each treatment of replicate consists of at least five pooled

individual seedlings from which total RNA was isolated. qRT-PCR was performed on total RNA using gene-specific primers listed. Transcript level were normalized to internal reference gene (UBI). Confidence

intervals at 95% are used to express errors of the means.

Docking simulation of ABA in At-D14

In order to interpret the extraordinary cross talk at various level throughout the

experimental work and explain the possible competitive binding affinity during ligand

based degradation of receptor, docking simulations of ABA were we performed docking

simulations of ABA within orthologue of rice D14 receptor. The docking pose showed

only one enantiomer of GR24 in the pocket with superimposed ABA within the binding

pocket thus suggesting that ABA may bind in the same space of ligand binding pocket

(Figure 3.58). The crystal structure ABA inside receptor pocket shows that the molecule is

H-bonded to Trp 155 while Phe 195 & 126 are also involved in hydrophobic interactions

-5.0

0.0

5.0

10.0

15.0

20.0

25.0

UBQ10

no

rmal

ized

tra

nsc

rip

ts

ABA 100µM

0hr 3hr 6hr 15hr

Results Chapter 3

179

as shown in Figure 3.59. The docking pose showed that ABA and GR24 superimpose each

other at ligand binding pocket. The favourable pose generated in Figure 3.60 depicts that

despite being structurally different ABA is able to occupy the D14 receptor-binding pocket

and may occupy the catalytic site via H-bonding of Trp-55 residues close to ligand binding

moiety. This notion requires further confirmation through hydrolysis and competitive

simulations.

Figure 3.583.58 Plausible binding mode of (+)-GR24 (cyan-a) in AtD14 (green) binding

pocket

The ligand and the residues lining the pocket are shown as capped sticks. For each racemic mixture, both

enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented

as magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are

labelled.

Results Chapter 3

180

Figure 3.593.59 Plausible binding mode of S-(+)-ABA (yellow-b) in AtD14 (green)

pocket


enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented as

magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are labelled.

Results Chapter 3

181

Figure 3.603.60 Superimposed pose of (+)-GR24 (cyan) & S-(+)-ABA (yellow) in

(green) binding pocket


enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented as

magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are labelled .

Discussion Chapter 4

182

Chapter 4

Discussion

Formatted: Right: 0"


183

4. Discussion Plant growth regulators and their complex integrated molecular dialogue is the main source

of morphological plasticity and adaptability of plants in response to changing

environmental conditions. Under abiotic stresses, sessile plants modulate their growth by

alteration of synthesis, signaling and transport of stress related hormones. Although ABA

is the most studied stress-responsive hormone, the individual role of ethylene, CKs, BRs,

and auxins during environmental stress is emerging, as is the impact of their mutual cross-

talk (Fujita et al., 2011; Arc et al., 2013; Fahad et al., 2015; Wani et al., 2016). SLs as

well, were recently shown to play a prominent role in response to abiotic stresses, responses

and thus we have thus entered into a new phase in which their interaction with other

phytohormones in the frame of abiotic stress resistance is being targeted experimentally.

The characterization of the molecular mechanisms regulating hormone synthesis and

signaling are facilitating the modification of hormone biosynthetic pathways for the

generation of transgenic plants with enhanced abiotic stress tolerance (Saeed et al., 2017).

The bBiosynthetic and developmental interactions also suggest the underlying role of ABA

on production or regulation of SLs. Therefore, SLs focused research has entered into new

phase of attempts to reveal the molecular level interaction with ABA in monitoring stress

resilience in plants, which is comparatively new and of utmost importance. Some of these

subtle interactions are highlighted in the figure 3.15. It is tempting to speculate that both

hormones interact with each other at the biosynthetic level, and that induction of ABA

biosynthesis influences SLs formation and vice versa (Figure 4.1). Therefore, prime

objective of the study was to overexpress SL biosynthetic gene CCD7 in a bid to explore

its role in abiotic stress resilience in tomato and to investigate SL-ABA possible cross

linking in transgenic Arabidopsis. Theis discussion deals with the hypotheses followed in

this dissertation is divded into 3 chapters. and 3 parts of the work has already been

published as:


184

Figure 4.14.1 Organ level dynamics of strigolactones during abiotic stresses encountered

plants

Strigolactone (SL) mediated signal transduction and changes in physiological response due to Pi depletion

and abiotic stresses encountered by the plant. Blue arrows represent the process promoted by the SLs and

capped blue lines represents repression


185

Tomato cell culture, somatic embryogenesis and Agrobacterium

mediated transformation studies

In vitro morphogenesis response of various tomato cultivars rely on number of factors such

as genotype, type/size/age of explant, media formulations and growth room conditions

(humidity, temperature, photoperiod) due to which tomato transformation is not reliable

nor straightforward (Bhatia et al., 2005). Although considerable efforts have been made in

tomato cell cultures, but the techniques of morphogenesis have not been well established

to implement in multiplication of in vitro grown plantlets for commercial cultivars.

Additionally most of the established protocols for transformation are laborious, time

consuming and cumbersome involving preculture on feeder layers of tobacco and/or

petunia and that is also exceedingly genotype dependent (Hamza and Chupeau, 1993;

Plastira and Perdikaris, 1997). For this reason, we optimization ofed the in vitro

regeneration potential of four tomato varieties two cultivated commercial varieties, a

hybrid and one model cultivar was done. Comparison was done among four varieties by

optimization of seed sterilization, germination and then regeneration. Most prolific variety

was selected for investigation on regeneration potential via somatic embryogenesis and

Agrobacteroim mediated transformation. Development of above-mentioned system will be

of great value in germplasm conservation, somatic embryogenesis, clonal propagation and

genetic engineering of otherwise recalcitrant tomato varieties.

Seed sterilization and storage conditions affect the general process of in vitro

morphogenesis and overall seedling vigor. Containment of various type of fungal or

bacterial contamination during in vitro micropropagation is one of the prime prerequisite

for successful tissue culture and regeneration process. In this study, the effect of

concentration range NaOCl (1-20%) on germination index of four tomato varieties was

evaluated which were grown on MS medium with and without sucrose. Different

combination of disinfectants were tested and the result showed that 6% NaOCl with or

without surfactant was most proficient in controlling bacterial and fungal contamination of

tomato cell culture. More than 90% seed germination was achieved in RioGrande and

Roma with 5-7% contamination rate. Whereas, moderate germination activity was

observed for hybrid 17905 (>80%). We found that Model cultivar cv. M82 was severely

affected by various sterilization treatments. Higher concentration of NaOCl, although


186

decreased the contamination rate, but seed germination frequency was adversely reduced.

70% ethanol and 3–-8% NaOCl has been reported to induce 90% germination in tomato

seeds, while Gubis et al., (2003) indicated 4 % NaOCl for sterilization of seeds. In our

experiments <3% NaOCl resulted in fungal contamination of seeds and > 8% was

inhibitory for all four varieties. The varietal differences in rate of seed germination against

same concentration of disinfectant explains the genotype specific response in tomato

cultivars M82 and hybrid [17905] that has been previously reported by Park et al., 2011.

Moreover, the results are in agreement with (Shah et al., 2015; Sun et al., 2006) where

similar disinfection in vitro germination of tomato seeds was reported. Both half strength

and full-strength MS medium (with vitamins) without addition of sucrose was evaluated

for seed germination. Although sucrose is incorporated as universal carbon source for in

vitro morphogenesis, optimal concentration for growth is genotype dependent (Chen et al.,

1999; Compton and Veilleux, 1991; Gubiš et al., 2005). We achieved

contaminationContamination free seed germination without sucrose was achieved in our

experiments. Even though, sucrose is an important component required for tomato cell

cultures; however, seedling emergence can be achieved without sucrose as well. For

example, inclusion of 3% sucrose have been reported by various cell culture experiments

(Cano and Moreno, 1990; Costa, 2007; Gubiš et al., 2018). However, sucrose addition for

optimal seeed germination wasn’t found necessary in this study. we couldn’t verify

mandatory sucrose addition for optimal seeed germination. Thus, the results may

suggestrecommend that sucrose is required only during later stages of morphogenesis,

while seedling and cotyledon emergence can be achieved without any carbon source in the

medium.

As previously mentioned organogenesis in tomato is greatly influenced by nutrients

components particularly combination and concentration of plant PGRs. Genotypic

variation imposes one of the most paramount constraint for the success of in vitro

morphogenic response (Bhatia et al., 2004, 2005; Cano and Moreno, 1990). Therefore,

development of callus cultures and their subsequent morphogenesis with right PGRs was

essential for cell cultures. Different concentrations of PGRs were used alone and in

combination to evaluate in vitro regeneration response. Explants (one week old cotyledons

and hypocotyls) were used for callus induction on 16 different media compositions.


187

Highest callus induction was observed from the MS basal medium containing 2 mg/L IAA,

2 mg/L NAA, 2 mg/LBAP, 4 mg/L KIN (CIMT12) in both young cotyledons and hypocotyls

of Riogrande and Roma where callus induction index was >80%. While, M82 and hybrid

17905, responded to a completely different set of PGRs owing to genotypic differences.

Both hybrid and M82 showed poor regenerating calli (Figures 3.2 & 3.3). M82 lead to

callus formation only when zeatin was added in the callus induction media. Many

researchers have reported preferential regeneration by using zeatin (Gubiš et al., 2004).

Such observations are in line with previous reports, where various combinations of PGRs

were found cultivar-dependent and accounted as a trivial cause of slow in vitro

regeneration.

Our results are consistent with (Durzan, 1984; Hamza and Chupeau, 1993; Hu and Phillips,

2001; Moghaieb et al., 1999) where the regeneration capacity of juvenile explants was

reported found enhanced as compare to adult explants. Cotyledons and hypocotyls have

been shown apparently good source of explant for organogenesis during this study.

Generally, cotyledons have been indicted to acquire better callogenesis response in less

time as compare to hypocotyl and high regeneration potential (Schuetze and Wieczorrek,

1987). However, cotyledons have also been used for transformation and morphogenesis in

literature (Hamza and Chupeau, 1993; Fillatti et al., 1987; Frary and Van Eck, 2005).

Embryogenic calli derived from cotyledon explants depicted a high-shoot regeneration

potential in Riogrande and Roma whereas, the other two cultivars had pale white compact

calli indicative of slow organogenesis. Hypocotyl derived calli have many embryoids in

Riogrande; however, callus induction was slower and calli were less totipotent as compared

to cotyledons.

Various shoot induction treatments containing BAP at high concentration with or without

low dose of auxins were evaluated for in vitro shoot formation and number of shoot

primordia per calli. Regenerating calli led to multiple shoot formations in a 3-week time

period on SIMT6 containing 3 mg/L BAP and 0.1 mg/L IAA. On an average, 4-5 shoots

were induced on SIM in case of Riogrande with 56% shooting frequency followed by

Roma, hybrid 17905 and M82. BAP alone at 5 mg/L was found second most effective

treatment in terms of shoot organogenesis. These findings corroborates with reports of

using high cytokinins particularly BAP for short-time shoot multiplication in different


188

tomato cultivars (Botau, D., 2002; Kartha et al., 1976). The data presented here showed

that cv. Riogrande and Roma have better regenerating potential as compared to hybrid

17905 and cv. M82 (Tables 3.6 & 3.7).

Individual regenerated shoots (3-4 cm) were excised and subsequently cultured on rooting

medium containing different levels of IAA, NAA, and IBA. Thereafter, highest number of

roots (~12) were observed from shoots of cv. Riogrande with 0.1 or 0.5 mg/L of NAA in

basal medium followed by cv. Roma (~10). IBA concentration 1 mg/L was found second

most effective rooting hormone. These findings could be explained by positive effect of

exogenous auxins on root development (Klerk et al., 1999). Our results strengthens

previous findings on use of IBA and IAA for more than 10 roots/shoot in tomato (Osman

et al., 2010). Whole organogenesis process was completed in less than 2.5 months for cv.

Riogrande with 3 weeks of callogenesis, 3 weeks for shoot multiplication, and 12 days of

rooting. This high frequency standardized procedure yields acclimatized plantlets in 2-3

months. Regeneration of the explants in the in vitro conditions remarkably changes the

physiology of regenerated plants when they were acclimatized to natural environment.

These alterations in growth characteristics could be attributed to elimination of exogenous

PGRs. Thus, in vitro regenerated plant showed some variation in growth characteristics

like reduced height, fruits and flowers as compare to greenhouse grown plants. The fruit

size and number also decreased; however, no genetic aberrations were observed. These

somaclonal variations are common in cell culture of many plants. Nevertheless, subtle

changes can pose serious drawback to micro propagation of true to type plants (Larkin and

Scowcroft, 1981). Other than shape changes in fruit and reduced numbers, no obvious

difference were seen in in vitro grown plants which could be indorsed to cell culture stress

and exogenous PGRs as reported by Morrison, Whitaker, and Evans, (1988).

To further, shorten the time of in vitro plantlet regeneration, organogenesis via Somatic

embryogenesis (SE) of most responsive variety in cell culture cv. Riogrande was

developed. SE represents a complex model of totipotency regulated by cascade of signaling

pathways to reprogram the fate of cell dedifferentiation and proceed to embryogenesis.

Such reprogramming is often initiated by external cues such as cytokinins and auxins or

stress conditions (Méndez-Hernández et al., 2019). The effect of growth media pH on SE

is reported here as a novel aspect of tomato regeneration which influences the overall


189

progress of clonal propagation and cell cultures. SE in tomato was achieved in two steps

by induction of rhizoid and rhizoid tubers. In the first step, rhizoids were induced form a

week-old cotyledons and hypocotyls by using two auxin analogues at various concentration

(NAA & 2, 4-D) in dark conditions at pH 4.0. NAA concentration at 0.5 or 2 mg/L

promoted substantial rhizoid induction while 2, 4-D failed to induce these structures. The

role of auxin to promote induction phase in SE is well documented. In particular, the

embryogenic cultures are induced by the little quantity of auxins in the culture medium

while increase in concentration of auxins favors callus formation (Nic-Can et al., 2013;

Nic-Can and Loyola-Vargas, 2016). Embryogenesis primarily rely on manipulation of

PGRs irrespective of plant species; however, competence of particular type of explant

towards exogenous hormones is largely dependent on genotype makeup and is more like a

serendipitous process (Victor M. Jiménez, 2005). Unlike many previous reports of using

2, 4-D for initiation of SE, the result showed that in tomato Riogrande, no embryogenesis

was observed when explants were exposed to varying concentration of 2, 4-D at pH 4.0 as

evident from data shown in Table 3.3. It is noteworthy to mention here that various levels

of pH 3.0-7.0 tested with same concentration of NAA revealed that pH×NAA correlation

is vital in induction of SE as shown in Figure 3.7. Without low pH (4.0) or NAA no rhizoids

were seen which shows genotypic specificity for dedifferentiation. In a previous report on

sweet potato, treatment of calli with 5 µM 2, 4-D and polar auxins transport inhibitor 2,

3,5-triiodobenzoic acid restricted the development of embryo promoting only callus

morphogenesis. This shows that exogenous phytohormones particularly auxins, influence

endogenous polar IAA transport to facilitate or inhabit embryo development (Chée and

Cantliffe, 1989). Due to presence of particular type of auxins in the culture medium, NAA

in our study, pro-embryogenic masses already present in the culture were primed to

undergo primary SE and initiation of cell polarity occurs. Thus, initiation phase began by

one of two auxins. Once the auxins were removed from the culture, embryogenesis

proceeded rapidly. Such observations have been verified in many plant species (Jiménez,

2001). Individual rhizoids, upon transfer to a medium containing 5 mg/L TDZ or BAP in

light conditions, produced secondary embryogenesis and novel structures – rhizoid tubers

(RTBs) with many somatic embryoids (Figure 3.9 A). Unlike, many reports of continuous


190

dark regime, it is noteworthy that induction of SE was initiated in dark conditions while

maturation of RTBs was more prominent in light photoperiod (Gow et al., 2009).

Sequential dark and light impulses are reported here for quick embryogenesis response at

pH 4.0. Different novel structures like RTBs, frog- egg-, and bulbil-like bodies were

already reported through SE recently (Ning and Bao, 2007; Xu et al., 2014, 2016) and our

findings are in agreement with the previous literature (Xu et al., 2015). TDZ at high

concentration not only induced RTBs but also germination of embryos to cotyledonary

nodes on top of explants. When TDZ has been used for in vitro plantlet regeneration of

excised RTBs, they spontaneously germinated to shoot primordia without any intermediate

stages. TDZ have been known as potent inducer of de-differentiation in diverse plant

species where it mimics cytokinins like activity and change the level of endogenous auxins

(M. J. Hutchinson, Murch, and Saxena, 1996). The morphogenetic responses were

modulated by high concentration of TDZ that may constitute inductive signal for

embryogenic expression. The results are in line with (Victor et al., 1999; Yang et al., 2012)

where combination of TDZ and BAP at high concentration resulted in somatic embryos,

while sequential incubation on BAP followed by TDZ, shoot organogenesis occurred. By

simply changing or alternating two cytokinins, shift from somatic embryos to shoot

formation could be achieved for RTBs. TDZ and BAP at 5 mg/L in light not only favored

formation of RTBs but also in vivo shoot organogenesis occurred when RTBs from TDZ

were transferred to medium with BAP (Figure 3.9). Additionally, we excised individual

RTBs were excised to investigate in vitro regeneration potential. This was done to

determine if RTBs if they are typical secondary embryos and germinate to whole plantlet

like other somatic embryos. It was an interesting property of novel RTBs, that even when

separated from cluster of rhizoids and incubated on media containing TDZ/BAP 5 mg/L,

shoot and root organogenesis occurred simultaneously as shown in figure 3.10-D. Thus,

confirming RTBs are previously unknown secondary somatic embryos that can be used

independently to generate true to type plants.

Further confirmation was done with microscopic investigations to determine the ontogeny

of RTBs. Originated as secondary somatic embryos from primary ones, RTBs consisted of

multiple embryonic cells and hence, multiple embryo formation within RTBs occured.


191

Histological studies of RTBs demonstrated their composition of embryogenic cells with

multiple embryonic stages (Figure 3.13 and 3.14-B). These embryos sprout from epidermis

of rhizoids and then develop into whole plantlets through various stages of embryogenesis.

The whole procedure of embryogenesis was completed in initiation phase (6 days),

maturation and secondary embryogenesis (6 days), shoot and root morphogenesis (15

days), shoot proliferation and acclimatization of plantlets (12 days). Thus, the process

following germination of one-week old seedling, initiation of embryogenesis and

subsequent germination of cotyledonary embryos to whole plantlet was completed in 45

days. Eventually these embryos germinate spontaneously and are capable of high

frequency in vitro shoot formation. These results demonstrate the uniqueness of novel

structures - RTBs for complete organogenesis in less time and labor over routinely used

explants sources.

To our knowledge, there is no report of in vitro regeneration in tomato at pH 4.0. However,

low pH has been used to initiate cell cultures of other plants. An increased number of

regenerated shoots at lower pH (4.5) in Bacopa monnieri has been reported (Naik et al.,

2010). pH range (3-7) was used to evaluate the regeneration capacity in pine buds showing

that initially low pH of media is more suitable for in vitro morphogenesis (Andersone and

Ievinsh, 2008). Consistent with this idea low medium pH also impose tissue culture

impulses and may be perceived as a stress signal, thus forcing the reprogramming of cell

dedifferentiation to embryogenesis in cv. Riogrande. Such notion has been supported by

(Wilkinson, 1999) where increase in xylem pH has been associated with elevated ABA

concentration in the apoplastic region adjacent to guard cell of leaf epidermis. The medium

pH tend to affect nutrient availability as well as enzymatic and hormonal activities in

tomato thus increasing shoot biomass in cv. Redcoat (Bhatia and Ashwath, 2005).

However, contrary to previous observation, pH 4.0 in our study with specific auxins at low

concentration favours rapid somatic embryogenesis by formation of rhizoids and RTBs,

while higher concentration of auxins at pH 4.0 led to callogenesis. Here low pH is reported

as novel aspect of embryogenesis competency in cv. Riogrande, not established previously.

The result shown above validated the optimal response of cv. Riogrande in terms of in vitro

cell culture experiments. So, it was designated as seamless source for Agrobacterium


192

mediated integration of SL biosynthetic pathway genes. Prior to infection of explants with

Agrobacterium, the vector designed during cloning steps were checked for their

functionality in tomato.

EHA105::pGII0229MAS-CCD7-cp148-LUC and EHA105::pGreenII0029-35S-TL-

GFPCCD7/D14 transient expression was accessed in leaves and fruits of tomato.

Fluctuating levels of GUS/GFP/LUC activity irrespective of transient or stable expression

were detected in leaves depending on incubation time post infiltration. The efficiency of

transient assay has been found to be dependent on compatibility between plant and the

strain of Agrobacterium being used. In our experiment for EHA105 OD600 0.5-0.7 gave

>80% GUS expression in leaves and fruits, GV3101 harboring dicistronic vector resulted

in tissue necrosis and wilting of plants. This could be attributed to virulence of

Agrobacterium strains towards particular plant species and physiological state of the host

plant. Similar observation were put forward by (Wroblewski et al., 2005). In the light of

results obtained, infiltration media, optical density of Agrobacterium and incubation time

have been regarded as three important factors that affect transient expression of pGreen

based binary vectors. The optical density of the bacterial suspension was optimized for

infiltration experiments as shown in Table 3.8. It was observed during our course of

experiments that OD600<0.1 failed to give any desirable expression even after 72 hr of

incubation while OD600>1 resulted in tissue necrosis. Effect of addition of Acetrosyringone

in superior amount to increase the transient and stable transformation efficiency (0-400

µM) was tested. The data is in agreement with Cortina and Culi, (2004) that addition of

200 µM Acetrosyringone to the infiltration or co-cultivation medium gave desirable

transgene expression. Results of transient expression pattern of GUS staining and GFP

imaging were also in compliance with Jefferson et al., (1987) and Chalfie et al., (1994).

For stable transformation, factors that are pertinent for maximum transformation efficiency

were secreened. Different factors reported previously such as preculture treatment (Ahsan

et al., 2007), optical density and Acetrosyringone (Murray et al., 1998), co cultivation

duration and selection antibiotics (Hu and Phillips, 2001) were established for development

of efficient transformation system. Our data showed that one week old cotyledons of cv.

Riogrande when precultured on PCM1 (1 mg/L NAA, 1 mg/L BAP) for 2-5 days were


193

swollen and they could endure the steps of Agrobacterium infection and co-cultivation, as

compared to fresh explants shown in Figure 3.30. Effect of preculture in dark was found

significant on transformation frequency giving >60 percent regeneration of

Kanamycinkanamycin resistant shoots. Fresh explants without preculture treatment were

more prone to necrosis and wilting occurred after 2 days of inoculation (Figure 3.30 F-I).

Preculture treatment of young explants before Agrobacterium mediated infection has also

been recommended by (Ellul et al., 2003; McCormick, 1991; Park et al., 2011). Optical

density of 0.4-0.5 for EHA105 and 0.2-0.4 for GV3101 and 15 min of infection time

followed by 48 hr of co cultivation at 19C. Along with these optimized parameters 200

uM Acetrosyringone has been used to enhance the transfer of T-DNA. Previously, Roy et

al., (2006) has also reported co-cultivation of 2 days for successful regeneration of

Kanamycinkanamycin resistant shoots. Time of infection of Agrobacterium strains to

adhere with cell wall of explant has been indicated as detrimental factor in recovery of

explants post co-cultivation (Rai et al., 2012). Consistent with Gao et al., (2009) increase

in incubation period beyond 15-20 min resulted in decrease in transformation efficiency in

all the tested varieties during our experiments. Further the data of transformation related

parameters for cv. Riogrande are similar to previous work (Yasmeen, 2009). Variable

bacterial densities ranging from 0.1-1 have been utilized for tomato transformation in past

(Chyi and Phillips, 1987; Anne Frary and Earle, 1996; Gao et al., 2009). For example,

optical density of 0.5-0.6 was used for maximum transformation efficiency in tomato

(Costa and Nogueira, 2000; Hu and Phillips, 2001). Thereafter, 90% GUS expression was

achieved and subsequently >40% transformation rate in Riogrande with O.D600 of 0.4-0.6.

Different antibiotics were tested against EHA105 and GV3101 to get rid of excessive

growth is inevitable for regeneration of cotyledon and hypocotyl explants. High

concentrations of Agrobacterium can result in over-growth problems and explants death

during stable transformation (Dan et al., 2006). Therefore, elimination of excessive

bacterial growth from regeneration media following co-cultivation is vital for successful

recovery of transgenics. It was We have found that GV3101 is harder to eliminate from

cell culture even at higher concentration of antibiotic (600 mg/L Augmentin, 600 mg/L

timentin and/or 300 mg/L cefotaxime), while EHA105 was more acquiescent to 300-600


194

mg/L Timentin in combination with 300 mg/L cefotaxime and/or 600 mg/L augmentin. Out

of all bacteriostatic antibiotics tested Timentin (mixture of ticarcillin and clavulanic acid)

at 300-600 mg/L alone was found significantly effective as compare to cefotaxime,

carbencillin and/or augementin as evident from data shown in Table 3.11. Nauerby et al.,

(1997) have also confirmed vitality of Timentin as compared to other routinely used

antibiotics to restrict growth of Agrobacterium post co cultivation with minimal phytotoxic

effects on explants. Following co-cultivation and selection steps explants were cultivated

on callus induction medium CIMT12 with 50 mg/L Kanamycinkanamycin. After one week

of incubation callus formation started from the cut surface of the explants. The regenerating

calli were chimera of transformed and non-transformed areas, which eventually turned

brown due to necrosis and susceptibility to Kanamycinkanamycin in the regeneration

medium. Proliferating calli were sub-cultured after one week of incubation. Regeneration

started after 4 weeks of culture on CIM, followed by transfer to shoot induction media

containing high concentration of BAP and low quantity of auxins NAA/IAA. The data

showed that juvenile explants lead to better transformation efficiency, while increase in

bacterial concentration and infection time lead to poor transformation efficiency as

reported previously (Hamza and Chupeau, 1993; Hu and Phillips, 2001). The role of BAP

2-5 mg/L in shoot induction is also well documented (Devi et al., 2008; Gubis, et al., 2003;

Otroshy et al., 2013). The putative transformed shoots were rooted on medium with 50

mg/L Kanamycinkanamycin on medium supplemented medium. Transformation

efficiency was calculated based on number of Kanamycinkanamycin resistant shoots

produced from an independent transformation event after 10 weeks of culture. Highest

transformation efficiency was achieved by using one-week-old cotyledons with 35%

regeneration frequency and 44 % transformation frequency. The result presented

superiority of cotyledons as explant material, which, has been reported previously by many

researchers (Anne Frary and Elizabeth D. Earle, 1996; Fillatti et al., 1987; Hamza and

Chupeau, 1993). Such differential response can be attributed to genotypic variations.

Different genotypes of WT and cultivated tomato behave uniquely to combination of PGRs

(Kurtz, S.M. Lineberger, 1983). Hence, choice of explant as well as age is critical and

dependent on genotype. 35-44 % transformation efficiency as achieved with both types of

explants used in our study. Similar results have been reported previously with 40%


195

transformation efficiency obtained in cv. Hezuo 908 (Chyi and Phillips, 1987; Sun et al.,

2015). While, many published transformation experiments claimed 60-70 % of achievable

efficiency (Hu and Phillips., 2001; Mathews et al., (2003). Such reports; however, were

found ambiguous about how transformation rates were confirmed and also lack essential

experimental procedure.

The transgenic shoots were confirmed for the presence of CCD7, LUC, GFP and D14 genes

via PCR amplification. The rooted plants were shifted in peat and soil mixture and

acclimatized before transferring them to Green house, where they were evaluated for

morphological parameters.

Putative transformed plants T0 were self-fertilized to get T1 fruits and seed. The

morphological parameters were analyzed for both T0 and T1 leaves, flower and fruits due

to shoot morphology regulating role of SLs. The morphological and biochemical

determinants for overexpression of CCD7 gene and possible resilience to drought stress

was also assessed in T0 &T1. As shown in Figure 3.34, 4.2 & 4.3, the tomato plants over

expressing CCD7 showed some morphological deviation from normal physiology of WT

plants which could be seen as 2-3 lobed true leaves, abnormal plant height and 4 different

shapes of fruit as persimmon, bilobed and oval shaped (Figure 4.2 A-G). As previously

reported by Liu et al., (2013), in Lotus knockout lines of LjCCD7 showed stunded and

bushy phenotype. Such observation could be attributed to the role of SLs in controlling

shoot architecture. Consequently, upregulation of SLs at bisosynthetic level sould have

opposite effect. Our data showed that the LjCCD7 over expressing lines were less bushy

with 50% reduced number of branches, and reduced height (Table 3.13). After 10 weeks,

number of branches and internode were reduced remarkably in T1 as compared to T0.

Transgenic tomato plants showed fewer cotyledonary, primary, and secondary aerial

branches (9) in T1.3 plant as compared to wild type (23–-25). Similarly, stem diameter was

and height also showed reduction in T1 lines. Most of the transgenic plants were

significantly shorter except anamolously behaving T1.5 which showed height and

branching approximately equivalent to WT plants. The LjCCD7 expressing tomato plants

had smaller less serated leaved which are more oval and bilobed as compared to wild type

plants in T0 lines as shown in Figure 4.2. The leaves were less serrated in T1

plants after 4


196

weeks, but attained normal physiology towards full vegetative growth (Figure 4.3). Mild

wrinked leaves were also observed. Flowers were of normal shape but fewer in number

(data not shown). Apparently, fruit size and number was also affected; however, the

difference was insignificant.

In conclusion, the results unanimously proved that cv. Riogrande is promising cutivar for

in vitro morphogenesis, somatic embryogenesis and Agrobacterium mediated gene

transfer as compared to other cultivar(s). The protocol described above is efficient and

reproducible without involving feeder layers. Number of factors governs the in vitro

regeneration response synergistically; however, effect of genotype was more profound.


197

Figure 4.24.2 Morphological assessment of T0 Transgenic plants of cv. Riogrande


198

Figure 4.34.3 Morphological features of T1 transgenic plants Vs WT plants


199

Overexpression of LjCCD7 gene enhances drought stress tolerance

in tomato by ROS scavenging mechanism

The juvenile explants of tomato cv. Riogrande were utilized for over expression of LjCCD7

gene by Agrobacterium mediated transformation. The gene has been previously

characterized in osmotic stress tolerance due to dehydration in SL deficient lotus plants

[Ljccd7 knocked out lines] (Liu et al., 2015). The transgenic lines (OE1) confirmed for

presence of LjCCD7 were greenhouse acclimatized, where they were challenged for 21

days dehydration survival assay against corresponding WT plants. After 7 days of water

deficit transgenic CCD7 overexpressing leaves showed minimal signs of wilting,

yellowing and leaf rolling as compared to WT plants. Subsequently 21 days of extreme

water stress was given and resumption of irrigation lead to 80% survival of transgenic

CCD7 lines while, WT plants wilted due to extreme necrosis, accumulation of reactive

oxygen species (ROS) and associated oxidative damage caused by extreme drought and

drought induced osmotic stress. The results obtained here are in line with Liu et al., (2015)

whereby, SL depleted LjCCD7 silenced lotus plants showed reduced level of total ABA

content as well as ABA hyposensitivity in leaves under combined phosphate deficiency

and osmotic stress due to absence of SL synthesis. The precocious wilting of WT stressed

leaves of tomato versus OE1 lines after drought stress explicates why CCD7 lotus plants

were more susceptible to drought stress reported by Liu et al., (2015). The results

apparently showed that transgenic OE1 lines were more heighted and bushier than WT

plants. CCD7 and CCD8 are required for inhibition of shoot branching and suppression of

bud outgrowth in plants which regulates above ground architecture of land plants (Gomez-

Roldan et al., 2008; Matusova et al., 2005; Umehara et al., 2008). Being rhizosphere

derived signals; more SLs are produced during abiotic stresses in shoots. This increase

serves as messengers of stress indication and diverse physiological activities are regulated

coherently in plant development besides shoot branching (Zhang et al., 2015; Zhang and

Haider, 2013). Abnormal height of the transgenic OE1 lines in our experiment is in

agreement with Liu et al., (2013); Vogel et al., (2010); Waters et al., (2012).


200

SLs regulate plant development and growth via close cross-talk with auxin and represses

shoot branching largely due to depletion of PIN1 (PIN- FORMED PIN proteins) from

plasma membrane. Conversely, cytokinins are promoter of bud outgrowth and SLs interact

with them antagonistically in the presence of auxins to control bud outgrowth (Dun et al.,

2012). However, surprisingly inhibition of shoot branching which is the character

attributed to SL expression is not observed in T0 tomato lines in thisour experiment.

Instead, the transgenic plants were found long but bushy. This effect could be attributed to

the fact that cv. Riogrande is heirloom determinate variety used in thisour study and it has

natural tendency to form bushes with lot of branches. It could be established that

overexpression of LjCCD7, which was reported to be responsible for branching phenotype

and stunted height in mutant lines of lotus and SlCCD7 in M82 was not very distinctive in

CCD7 overexpression lines T0 due to genotypic differences. This notion can only be

confirmed with further characterization of T1 and T2 plants. Phenotypic evaluation of T1

plants at their reproductive age showed that CCD7 expression decreased the branching

phenotype due to deficiency or absence of SLs initially resported in Lotus plants (Liu et

al., 2013). The transgenic plants were less bushy as compared to wild type plants due to

fewer (9-11) primary and secondary branches (Figure 4.4). These phenotypic characters

could be due to above ground effects of naturally occurring indignous SLs and SL like

compounds due to over expression of CCD7 gene. Moreover, CCD7 transcripts also

decreased the stem diameter and height of transgenic lines, although the difference was

non-significant. For fruit and flower development even though there is no obvious role for

a branching hormone reported uptil now; nonetheless there may be unidentified

interactions of CCD7 derived apocarotenoids for fruit development or flavour attributes as

CCD7 clevage products i.e beta-ionone contribute in tomato flavour (Vogel et al.,2010).


201

Figure 4.44 Morphological assessmet of T1 transgenic plants

Data represent the mean values of three randomly selected plants/leaves of each line under

well irrigated conditions ± S.E. Means followed by the different letters are significantly

different as determined by a pairwise comparison using Tukey’s test at p<0.05


202

It could be established that overexpression of LjCCD7, which was reported to be

responsible for branching phenotype and stunted height in mutant lines of lotus and

SlCCD7 in M82 was not very distinctive in CCD7 overexpression lines T0 due to

genotypic differences. This notion can only be confirmed with further characterization of

T1 and T2 plants. Phenotypic evaluation of T1 plants at their reproductive age showed that

CCD7 expression decreased the branching phenotype due to deficiency or absence of SLs

initially resported in Lotus plants (Liu et al., 2013). The transgenic plants were less bushy

as compared to wild type plants due to fewer (9-11) primary and secondary branches.

These phenotypic characters could be due to above ground effects of naturally occurring

indignous SLs and SL like compounds due to over expression of CCD7 gene. Moreover,

CCD7 transcripts also decreased the stem diameter and height of transgenic lines,

although the difference was non-significant. For fruit and flower development even

though there is no obvious role for a branching hormone reported uptil now; nonetheless

there may be unidentified interactions of CCD7 derived apocarotenoids for fruit

development or flavour attributes as CCD7 clevage products i.e beta-ionone contribute in

tomato flavour (Vogel et al.,2010).

To respond and resist, water deficit, plants have evolved various strategies enabling them

to integrate activities at the whole-plant level. These strategies may involve drought

avoidance and/or the development of drought tolerance mechanisms. Constitutively

overexpression of LjCDD7 gene in tomato resulted in significant reduction of growth

parameters during well irrigated conditions and extreme water defict with reduced leaf

area, less serration of leaves, reduced number of branches and height as well as less wilting

and yellowing of leaf as compared to wild type plants. All these phenotypes depict the

‘drought avoidance’ properties of the transgenic lines forexample, through reduced leaf

area to evaporate less water from surface and high survival rate than wild type by reducing

water loss during drought. Hence, LjCCD7 gene employs stress avoidance and resilience

mechanisms to cope with water stress in OE0 and OE1.

Thus, involvement of SLs and abiotic stress resilience is juxtaposed concept in higher

plants now and is confirmed in past by Ha et al., (2014) that Arabidopsis plant deficient in

SL synthesis were found to be sensitive to dehydration due to less endogenous


203

strigolactones level. Hence, our results showed that over expression of CCD7 gene which

is differentially expressed in shoots and roots of plants exposed to drought or osmotic stress

synthesize higher level of precursor apocarotenoids, hence more SL or SL related

compounds were produced, to create a physiological state that is similar to stress

encountered plants. Elevated level of SLs or its precursor may have facilitated the ABA

hypersensitivity that requires either exogenous SL treatment or local increase in SL

synthesis observed in tomato, Lotus and Arabidopsis. This indicated a persuasive proof that

SL increase or synthesis is required for proper ABA functioning at guard cell level for

stress regulation. The high antixodidant enzymes activity in transgenic OE1 tomato plants

also confirmed our hypothesis. These datasets certainly show that high level of SLs give

an important positive contribution to stress resistance by increasing ABA sensitivity.

Exposure to drought and osmotic stress cause oxidative damage in plants due to free

radicals and reactive oxygen species (ROS) in land plants (Munné-Bosch and Alegre,

2000). However, the quenching activity in plant by antioxidant enzymes scavenge these

ROS to maintain normal physiological state of plant (Ren et al., 2016). The balance

between ROS production and their quenching is crucial aspect of abiotic stress resilience

in plants. Evaluation of the ROS quenching ability of transgenic plants (stem and leaves)

at normal physiological state and after 15 & 21 days of water stress treatment was done.

In order to test if CCD7 gene overexpression regulated the ROS level, H2O2 and O2

radicals in response to 21 days drought challenge vs non- stressed conditions., we assayed

antioxidantAntioxidant enzymes specifically peroxidases viz: . Superoxide dismutase

(SOD), Peroxidase (POD), Catalase (CAT) Ascorbate peroxidase (APX) and

Malondialdehyde (MDA) content of transgenic and WT leaves and stem tissues were

investigated after 0, 15 and 21 days of water deficit. The data generated indicates that

enzyme activities of transgenic lines OE1 increased as the stress increased when compared

to basal level of enzyme activity in WT tissues. The dataset indicated that transgenic lines

have enhanced antioxidant defense enzyme system that scavenges ROS production due

drought stress and maintained the physiological homeostasis of plants. While, WT plant

facing similar conditions showed not only lower basal level of antioxidant enzymes but

also, signs of tissue necrosis, cell death and deformed photosynthetic ability as shown in


204

Figure 3.36. Maintenance of higher level of CAT, SOD, POD and APX activities in

drought stressed leaves of transgenic plants allowed the removal of H2O2 and superoxide

radicals, especially under severe drought stress. These observations are in agreement with

stress physiology of tolerant plant species widely reported in literature (Cruz de Carvalho,

2008; Ren et al., 2016; Yuan et al., 2010; Zhu et al., 2015). Foliar concentration of these

antioxidant enzymes have been reported to increase during drought stress which supports

our results (Lim et al., 2016; Wujeska, Bossinger, and Tausz, 2013). It is important to

mention here that the without stress the indigenous level of antioxidant activities were

significantly higher in leaves and stem of transgenic lines. Nevertheless, with increasing

time of drought stress treatment, these antioxidant enzymes increased 4-6₋fold as

compared to stressed WT counter parts. This may indicate that even before the onset of

stress, transgenic OE1 plants were in drought avoidance physiology possibly due to high

level of SLs or SL related molecules. The level of MDA contents that are end products of

lipid peroxidation of biological membranes due to oxidative burst in extreme drought

stress were also found to be significantly lower in CCD7 overexpressing leaves and stem

tissue as compare to WT plants under stress. These results are in line with (Ijaz et al.,

2017; Lim et al., 2016; Mittova et al., 2002) whereby enhanced antioxidant system,

minimal MDA level and enhanced photosynthetic and chlorophyll contents were reported

in response to abiotic stresses. Together it could be deduced that CCD7 gene

overexpression in tomato Riogrande created drought hyposensitivity and exhibited

significant increase in antioxidant enzyme activity with low MDA level, less chlorophyll

pigment loss and with higher survival rates under drought stress. Amplified level of

carotenoid cleavage enzyme precursor has primed transgenic plants with enhanced stress

responsive network due to cross talk with other phytohormones particularly ABA. The

phytochemical analysis of tomato fruit skin and pulp of transgenic plants showed

enhanced antioxidant properties with 2-3₋fold increase in phenolic and flavonoid

compounds. Periago et al., (2002) demonstrated increase in bioactive compounds in

tomato cultivars subjected to abiotic stress. The increase in the antioxidant enzyme system

and impoved phenolic and flavonoid properties in tissue of tomato, reaffirms the

conclusion drawn by many reports that ROS scavenging and enzymatic antioxidant


205

system are most employed mechanism in tomato to avoid abiotic stress (Dewanto et al.,

2002; Kumar et al., 2014; Li et al., 2008; Pal et al., 2016).

Improvement in water use efficiency and development of drought resistant crops are

considered as needful innovations nowadays. Drought adaptation and tolerance regulating

pathways in plants are increasingly targeted for manipulation of drought resistance (Egea

et al., 2018). SLs are documented as new stress players and they promote drought

tolerance in Arabidopsis thaliana, Lotus japonicus, and Solanum lycopersicum by cross

talking and regulation of ABA-dependent and ABA-independent pathways (Ha et al.,

2014; Liu et al., 2015; Visentin et al., 2016; Vogel et al., 2010). It can be concluded that

overexpression of one or more genes of SL pathway like CCD7 will open meticulous

strategies to engineer plants for enhance water use efficiency.

Structure and activity relationships (SARs) in natural and

synthetic analogues decoded via quantitative in planta assay and

docking simulations

Plants produce diverse canonical and non-canonical SLs that differ structurally and

stereochemically under different physiological conditions within single plant species (Al-

Babili and Bouwmeester, 2015). However, due to lack of targeted tools for investigation

of structure and function relationships (SARs) and the fact that SLs are produced in

minimal quantities (pM), there is a niche in the idiosyncrasies and localization events.

Development of smart molecular tools for investigation of these specificities in SL

signaling and perception will be great innovation for understanding of specie-based SL

dynamics. Therefore, genetically encoded model as plant-based bioassay in A. thaliana

was developed. In last few years stereochemistry of SLs have been extensively explored

and its relevance in discovery and design of SLs mimics and analogues have been clearly

demonstrated (Lombardi et al., 2017; Mwakaboko and Zwanenburg, 2016; Zwanenburg et

al., 2013). The SAR studies and synthesis of new analogues offer valuable tool to explicate

molecular basis of receptor-ligand interactions and discovery of new SL analogues or

antagonist. Additionally, real time monitoring of SLs related activity in root exudates was

also missing. The assay was developed to associate florescence quenching of LUC fused

to D14 receptor under the control of indigenous promoter. GR24 racemic mixture was used


206

to calibrate assay in the dynamic range of (100 nM-20 µM). The D ring of the synthetic

and natural SLs are susceptible to nucleophilic attack in aqueous environment that leads to

hydrolysis product (Boyer et al., 2012). X-ray analysis and enzymatic assays have

underpinned that D14 receptor contains conserved residues as catalytic triad of Ser-His-

Asp at the bottom of ligand binding pocket. These residues attack and cleaves enol ether

moieties of C and D rings in SLs (Yao et al., 2016). It is evident that the D-ring is amenable

to various substitutions and derivations with similar physical and chemical properties to

study structure and activity (SAR) relationships of strigolactones (Artuso et al., 2015;

Sanchez et al., 2018). Based on selective modification of D ring series of analogues by

replacing butenolide moiety with lactam functional group termed, as D-lactams were

prepared. Considering the involvement of an easy leaving group for activity of SL along

with D ring, we designed SL mimics were designed lacking ABC ring moiety and enol-

ether bridge and BODIPY derivatives as florescent analogues suitable to study localization

of SLs receptor-ligand complex. To further analyse whether SL-D-lactams are active as

plant hormones, the assay was tested with 6-7 days old Arabidopsis transgenic lines

expressing AtD14 fused to the firefly luciferase (LUC) (Chevalier et al., 2014) in a D14

degradation based quantitative assay and confirmed by germination assay on seeds of

parasitic weed Peliphanche aegyptiaca and compared to GR24, used as reference standard.

The obtained results have been rationalized by in silico modeling.

Natural and synthetic SLs are rapidily decomposable through cleavage of D-ring at pH

9.38 as reported by and are sensitive to hydrolysis at pH 7 (Vurro et al., 2016) . The stability

of designed analogues as a function of their activity in aqueous medium and in methanol

was investigated. The results showed that higher activity of SL analogues is proportional

to their instability in aqueous medium due to nucleophilic attack on D ring as compared to

GR24 as standard. The activity differences between SL analogues may be attributed to their

instability in aqueous medium (Halouzka et al., 2018; Kannan and Zwanenburg, 2014). As

expected, the stability in the presence of MeOH was highly compromised for all the

compounds used in the study. Not surprisingly, the presence of the N-tert-

butyloxycarbonylation (N-protecting group Boc) slows down the hydrolysis rate in all the

analyzed compounds. Next, all the analogues were screened for germination activity

against seeds of P. aegyptiaca. The test itself is trivial, but it is very sensitive and widely


207

used to obtain preliminary clues about the germination-inducing activity of new

compounds. The dose-response curves of the D-lactams are all shifted to right (higher

concentration) thus complying a lower activity in comparison to GR24. Diastereoisomers

D2 of GR24-D lactam (rac-2 and rac-4, Figure 3.43) depicted the same profile thus

meaning that the presence of the Boc group on N is not affecting the perception. All the

SL-D-lactams proved to be less potent inducers of germination than rac-GR24, with rac-1,

rac-2, and rac-4 showing the highest activity; at 10 μM SL-D-lactams were comparable to

rac-GR24 at 0.1 μM, i.e. ~100₋fold lower activity. rac-3 and rac-1 and the mimic

derivatives rac-7 and rac-8 do not reach a plateau at concentration below 10 μM.

Surprisingly, N-Boc-derivatives (rac-1, rac-2, rac-6, and rac-8) were as active as the

corresponding NH structures. This was unexpected as, in principle, the bulking-group Boc

can barely be accommodated in the receptor pocket, as confirmed by the docking

simulations. However, our results might be explained by the active pocket in the D14-like

receptor(s) of the parasitic plants being larger than in D14 (Toh et al., 2015), and/or with

the Boc group being lost just before the molecule reaches the active site. It was We assumed

that the removal of the Boc group, results in an unprotected compound, occurs at some

point along the pathway that leads to the target site, and probably is due to other sources

of catalysis present in vivo (De Groot et al., 2000)

To overcome these inherent uncertainties, and to obtain SAR data for the D14–-dependent

hormonal activity of SLs, this novel in planta bioassay: luminescence based was utilized

for the measurement of the decrease in luminescence of transgenic Arabidopsis expressing

a translational D14::LUC fusion. For example, like other plant hormones, SLs act as

interfacial molecules, promoting and stabilizing protein-protein interactions; in this case,

between the ligand-binding moiety of the SL receptor complex (the α/β hydrolase D14)

and the co-receptor moiety (the F-box MAX2). Such interaction promotes further binding

between MAX2 and its target(s), leading to ubiquitination and degradation of the latter by

the proteasome machinery (Saeed et al., 2017; Zhao et al., 2015). D14 itself is a target for

proteasome-dependent destruction, which explains why fluorescence of D14::GFP fusion

proteins quenches upon SL treatment in transgenic Arabidopsis (Chevalier et al., 2014).

This molecular network was exploited to implement a quantitative activity assay, inversely

correlating luminescence to perception of SL-related molecules in transgenic Arabidopsis


208

expressing D14::LUC under the control of D14 endogenous promoter. Our initial results

showed that though indirect, the bioassay has an acceptable dynamic range, is relatively

simple to execute, up-scalable and robust enough to be exploitable for SAR studies

determined through variable concentration range of known synthetic strigolactones like

GR24 and EGO10. The reporter lines have been tested in a concentration range of various

SL-D-lactams as reported in Figure 3.45. Our results suggested that this molecular assay

could be applied to test and compare the hormonal activity of SL analogs, particularly

molecules with relatively low stability. The data indicates that most of the analogues,

mimics and various phytohormones tested for their SL like activity are based on SL–-

triggered D14 degradation that is required for minimal turnover signaling in D14 type

receptors at a ratio of one SL like ligand molecule to one receptor. Thus without specific

level of ligands to interact with the receptor, and signal amplification would typically fail

(McCourt et al., 2017).

This could be accounted for low activity of D-Lactams, mimics and phytohormones at 10-

50 µM based on D14 degradation signal as shown in Figure 3.46 & 3.47. However, the

EC50 value of GR24 was in the μM range, i.e. within the range for GR24 to induce

physiological responses, and within that commonly adopted for exogenous treatments. D14

degradation based assay is reported recently as StrigoQuant (Samodelov et al., 2016) and

the tests is more sensitive to luminescence based assay due to expression of D14 under

strong constitutive promoter as compare to endogenous promoter in our case. Additionally,

the above mentioned assay treatments were delivered to protoplasts rather than to intact

plants, which are needed to absorb the compounds being tested through their roots and to

translocate them systemically before a signal can start to be recorded (taking several min

for very active compounds in the micromolar range). However, for the same reasons, the

test reported here is less laborious, expensive, and technically demanding than

StrigoQuant; it is also a true whole-plant bioassay in which the (reporter-tagged) receptor

is expressed according to its native physiological level and profile. The assay calibrated for

SAR studies of range of analogues and most of the D lactams and phytohormones showed

only detectable activity at 100 μM (Figure 3.47). Rac–- 9 and CL–-BP smallest and most

bulky derivative respectively were also found in active at low concentrations. On the other

hand, strigol, ST23b, EGO10, and EDOT, rac GR24 mixture and each enantiomer showed


209

better response. Implementation of a quantitative assay demands real time quantification

of SL related activity not only with purified SL derivatives, analogues and antagonist but

also in root exudates containing SLs. To test the dynamic range of assay, we extracted the

root exudates of tomato with enhanced SLs synthesis were extracted following protocol

developed by (Visentin et al., 2016). The extracted root exudates were purified from

hydroponics and further diluted in liquid MS. The dilutions were checked for SL related

activity for the first time. Interestingly the highest dilution of exudates were more or less

active like 10-7 µM GR24 racemic mixture as shown in the Figure 4.54

Figure 4.5 SLs quantification based on LUC luminisence degradation activity of tomato

normalized to mock and acetone control

Root exudates were extracted by using three plants from each line by following method of (Visentin et al.,

2016). Crude exudates were concentrated and purified with solid phase extraction assembly (SPE manifold

CNW) by using C18 cartridges.

In our quest to investigate the variable dynamic range and to check the activity of different

hormones that share same signaling mechanism with SL particularly to elucidate the

underpinnings of SL-ABA cross talk, we checked different hormones like IAA, KIN, GA3,

and ABA at 100 nM–-100 µM concentration range were tested. The result showed that

similar to D-Lactam derivatives, these hormones were only active at very high

concentration i.e. 50-100 µM concentration. Which could be attributed to non-availability

of detectable ligand signal or catalytic pocket size constraints. However, ABA treatment

0%

20%

40%

60%

80%

100%

120%

0.00 3.00 6.00 9.00 12.00 15.00

%R

.L.U

T(h)

MS

Acetone

10-1dilution

10-2dilution

10-1dilution

10-3dilution

GR2410-6

GR2410-7


210

of 1–-100 µM, instead of gradual decrease of luminescence, started increase in D14 based

luminescence and showed maximum of 30% increase in the signal over control treatment.

Such anomalous behavior of ABA when compared with other tested molecules particularly

3 hr post treatment as shown in Figure 3.54a & 3.55a is both surprising and insightful to

decipher the SL-ABA dynamics. It could be proposed that somehow ABA blocked or

occupied the ligand-binding pocket of D14. We performed Competitive binding assay of

GR24 and ABA together were studied and found no such signal as with ABA or GR24

alone. Further analysis of ABA treated seedling for transcript quantification revealed that

treated Arabidopsis seedlings showed time and concentration dependent response to

exogenous application of ABA. 10 µM ABA treatment increased the expression of CCD7

gene 3₋fold more when compared with non-treated seedlings. Recent studies have

established the link between ABA and SLs in organ specific stress (Saeed et al, 2017).

Exogenous application of ABA has shown to induce accumulation of SLs in shoots in

tomato and Arabidopsis (López-Ráez, 2016; López-Ráez et al., 2010); however, the

possible synergistic effects of ABA-SL mediated stress response still remain; elusive.

Although SL biosynthetic mutants of tomato were found defective in ABA biosynthesis,

which showed involvement of ABA in regulation SL biosynthesis; however, their mode of

cross talk is still ambiguous. The change in expression pattern of SL biosynthetic genes in

transgenic Arabidopsis seedling are in line with (Ha et al., 2014) where ABA was shown

to induce MAX3(CCD7) and MAX4(CCD8) transcript accumulation in Arabidopsis.

Osmotic stress and nutrient starvation together repressed ABA level in SL depleted shoots

of Lotus as compared to WT, while in root this effect was found missing. Many reports

have also explained that CCD7 mutants were found hyposenstive to exogenous application

of ABA at 5–-20 µM response (Liu et al., 2015; Visentin et al., 2016). Hence, differential

expression of SL and ABA metabolic enzyme was most predicted outcome following ABA

treatment, which further strengthen SL–-ABA cross talk in Arabidopsis. It was unclear if

SLs exerts their role in abiotic stresses due to ABA or latter regulate SLs when stress is

perceived. It could be presumed that both phytohormones target some shared protein and

/or genes which are stress responsive and presence of both hormones in stress resilience is

inevitable.


211

The structure activity relationships of various synthetic SLs and validation of data obtained

after quantitative D14 assay, prompted for more detailed knowledge of receptor- ligand

binding mode. To validate the results docking analysis of D lactam analogues and ABA

was done to elucidate their binding mode within D14 receptor.

Molecular docking allows the identification of the low-energy binding modes of a ligand

within the active site of a macromolecule. It predicts substrate conformation and

orientation, revealing key groups or atoms for binding that are closest to the catalytic

residue, for instance. Ideally, it allow us to characterize the behavior of small molecules in

the binding site of target proteins as well as to elucidate fundamental biochemical processes

(Meng et al., 2011). The docking process consists in repeatedly posing and ranking the

molecules inside the binding pocket. The prediction of the ligand conformation as well as

its position and orientation is usually referred to as pose. Ranking is calculated by a scoring

function, which orders the preferred ligand conformations using force field, empirical, or

knowledge-based approaches, by evaluating the energy of interaction of the ligand-protein

complex. To assess whether the lack of activity of the D-lactam compounds was

exclusively attributable to the reduced reactivity of the D-lactam versus the D-lactone ring,

or whether it was the result of poor accommodation of the molecule into the receptor

pocket, docking simulations were undertaken for rac-3, rac-4, and rac-9. The results

showed that, albeit with slight differences, NH derivatives of the SL-D-lactams series could

dock favorably in the receptor pocket, while the N-Boc derivatives could not. This finding

supports our contention that in order for the germination and D14::LUC degradation data

to be explained, the Boc group must be lost before the ligands reach the catalytic pockets.

On the other hand, the fact that rac-3 was almost inactive can be explained by the high

intrinsic instability of the compound, the half-life time of which (<4 h) is shorter than the

measurement time, independent of the bioassay. Similarly, rac-4 also showed less reliable

poses in D14 than the co-crystallized GR24, again in agreement with its weak activity in

the luciferase bioassay. As a germination inducer; however, rac-4 at 1 μM could attain an

efficiency comparable to GR24, even if its potency was ~10₋fold lower, which was

possibly because of its instability. The enhanced sensitivity towards SLs and their

analogues in the parasitic versus producing host plants (in the picomolar versus micromolar

range) (Toh et al., 2015) could possibly explain this apparent discrepancy. Among the D-


212

lactams, rac-9 was designed to resist hydrolysis and this was confirmed by the high stability

of the compound in strong nucleophilic solvents (t1/2 in the range 1000–3000 h, depending

on the solvent). Due to its having very little activity in both the bioassays used, it was we

initially suspected that rac-9 was possibly acting as a SL antagonist. However, a

competition experiment with (+)-GR24 at various concentrations indicated that it did not

possess antagonistic activity, at least under our experimental conditions, although at very

high concentration (100 μM) it behaved as a partial agonist. The docking results for this

compound indicated, as a possible explanation, that the rac-9–D14 complex could be not

stable enough for rac-9 to act as a competitive inhibitor of (+)-GR24.

Docking simulations were done with (+)-GR24 and S-(+)-ABA inside D14 orthologue of

rice D14, AtD14 having rmsd < 0.85 Å. (+)-ABA) is indispensable for many structure

activity based processes in plants like stomatal closure, response to abiotic stresses, seed

dormancy and maturation as reported by (Zhang et al., 2013). Signaling and binding of

ABA in its canonical kinase PYL/PYR receptors follow binding mechanisms that differs

from SLs strikingly (Miyazono et al., 2009). Nonetheless, ABA analogues containing

sulfonamide group have been reported as potential ABA mimics such as pyrabactin and

quinabactin, both are capable to bind with ABA receptors and elicit ABA like responses

(Okamoto et al., 2013). Sulfonamide mimics have also been utilized as SL mimics with

modification of D ring. Thus, it could be inferred that AtD14 though unconventional

receptor, binds ABA within pocket with direct and occasional water meditated H-bonding

with TRP155 residue of catalytic site. The binding poses though less stable, perfectly

superimposed with GR24 and S-(+)-ABA molecule docked well in the catalytic pocket of

AtD14. Currently we are unclear about the possible implications of ABA competitive

binding inside AtD14 pocket are largely unclear. Provided the fact that rice d14 (PDB code

5dj5) is conventionally utilized ins docking studies and that exact structure & activity

mechanism of orthologue AtD14 is not yet confirmed, except that later can hydrolyzed

GR24 but with reduced reactivity as compared to OsD14 (Zhao et al., 2013). More subtle

docking studies will be needed in future to rationalize the concept. These prospective

dynamics of ABA binding with D14 receptor require further validation in the field of in

silico modelling to reveal downstream signaling and cross talk with SLs at receptor level

that could endure results, which could be both exciting and promising.


213

Conclusion

In this work, we have presented various methodologies wereare adopted to optimize and

characterize role of SLs as new players in abiotic stress tolerance because of wide focus on

possibility of phytohormones engineering. Our growing knowledge of SLs definitely

require deep insights into SL–-ABA dilemma before it’s possible for improvement of crops

under natural stress conditions. These interactions are key regulators of plant adaptation to

diverse range of stress levels conferred by the plant and are mostly sought to understand

how SLs biosynthesis and regulation is linked to other factors for SL–-regulated

developmental processes. Similarly, plant response to changing environment provides

clues for the adaptation of SL biosynthetic machinery. Overall, still plentitude of

challenges left, to be uncovered. We developed optimized protocols for In Vitro

regeneration protocol was developed for the efficient and reproducible Agrobacterium

mediated gene transformation of tomato cultivar(s) with carotenoid cleavage oxygenase

CCD7 isolated from L. japonicas roots. Genotype, explant type and PGRs were three main

factors that were found critical for regeneration of tomato. Significant differences were

found in regeneration capacity among different cultivars, explant types, callus morphology

and number of shoo primordia. cv. Riogrande was found to have maximum regeneration

capacity (cotyledons & hypocotyls) further selected for somatic embryogenesis to reduce

the regeneration time and frequency. Thereafter, low pH of medium (4.0) and NAA

(2mg/L) was found to induce primary somatic embryogenesis in dark conditions by

formation of rhizoids. For induction of secondary somatic embryos, auxins were removed

from the media and cytokinins TDZ/BAP at various concentration were tested at pH 4.0.

Secondary somatic embryos were induced as novel structures rhizoid tubers which were

evaluated for their embryonic nature and regeneration potential. Unlike typical

organogenesis from callus, these rhizoid tubers (RTBs) spontaneously germinate to new

seedling without any sub culture procedure. Thus, the procedure is not only efficient and

quick but also lot less laborious as compared to conventional organogenesis. Following

Agrobacterium mediated gene transfer; different factors were optimized for CCD7 gene

expression. 2 days precultured cotyledons of one-week-old seedlings were infected with

bacteria having optical density of 0.4–-0.6 at 600 nm, followed by co cultivation of

Agrobacterium in presence of 200 μM acetosyringoneAcetosyringone for 48 hr.


214

Transformation frequencies ranged from 35–-44 % in hypocotyls and cotyledons explants

respectively. The event of successful transformation was confirmed via PCR amplification

of CCD7, GFP & LUC genes from regenerated Kanamycinkanamycin resistant leaves of

cv. Riogrande. The transgenic plants were tested for their morphological and

physiochemical performance under drought stress. The phenotypic as well as biochemical

determinants showed that overexpression of CCD7 was responsible for drought stress

hyposensitivity in transgenic tomato. T0 and T1 plants followed Mendelian segregation of

3:1 and found tolerant to water deficit with an enhanced antioxidant enzyme system. In this

study, in vitro regeneration protocols for efficient transfer of traits in tomato wereas We

developed and up scaled novel in vitro regeneration protocol for efficient transfer of traits

in tomato. More focused research on CCD7 mediated abiotic stress response in tomato

under environmental constraints and possible overlap with other regulatory pathways likely

ABA and miRNAs would shed light on spatial and temporal distribution of stress related

hormones in combined and individual stresses. A novel in planta bioassay in Arabidopsis

was developed which is more indirect than a biochemical interaction assay, conveys a

biologically meaningful output, with an acceptable dynamic range, relatively simple to

execute, up-scalable, and robust enough to be exploitable for SAR studies. The assay was

employed to evaluate the biological activity of a class of novel SL analogues,

phytohormones, tomato root exudates and stress hormone ABA. Docking studies

demonstrated that the synthetic molecules fitted perfectly into the D14 receptor pocket

establishing almost the same interactions with the catalytic triad as active SLs. Assuming

that the mode of action of SLs relies on a nucleophilic reaction occurring inside the receptor

onto the butenolide D-ring, the reasons for inactivity of SL-D-lactams can be then ascribed

to the change of the lactone functional group to a lactam, and to the lower reactivity of the

latter to nucleophiles.

SL-ABA dynamics Arabidopsis were also quantified by expression analysis of SLs

biosynthetic genes and ABA stress inducible NCED3 and as expected exogenous

application, significantly upregulated the SL genes with increase in time of exposure to

exogenous ABA as stress signal. The strategies adapted in this work have provided

convincing missing links in the far from complete picture of SL-ABA dynamics in model


215

plants tomato and Arabidopsis. Several unanswered gaps and missing links of course

persist, to understand fully the role and cross talk of SL & ABA during combined stress.

In this scenario SL activity readouts via sensitive and quantitative methods, preferably at

single cell level and temporal localization of these complexes through fluorimetery is much

needed to fully acquire knowledge of SL mediated crop management strategies.

Future prospects

1- Evaluation of T1 transgenic plants and seeds with for stable integration events via real time

quantitative PCR and determination of copy number. Screening of phenotypic and

molecular determinants of CCD7 overexpression in T1 plants.

2- Grafting studies on CCD7 overexpressing shoot stock and WT roots to create organ

specific dynamics and evaluation of differential expression of abiotic stress related genes,

transcription factors and specially miRNA155 &156 during quasi state stress conditions.

3- Use of RTBs as explant source for stable transformation procedures and comparison of

transformation and regeneration potential to our conventional procedure.

4- Development of fluorescent read out assay using GFP-D14 complex in tomato for SAR

studies.

References Chapter 5

216

Chapter 5

References

Formatted: Left: 1.56", Right: 1", Width: 8.5", Height:

11"


217


218

5. References

Abe, S., Sado, A., Tanaka, K., Kisugi, T., Asami, K., Ota, S., Nomura, T. (2014).

Carlactone is converted to carlactonoic acid by MAX1 in Arabidopsis and its methyl

ester can directly interact with AtD14 in vitro. Proceedings of the National Academy

of Sciences of the United States of America. 111(50), 18084–18089.

Abu-El-Heba, G.A., Hussein, G. M., & Abdalla, N.A. (2008). A rapid and efficient tomato

regeneration and transformation system. Landbauforschung Volkenrode. 58(1–2),

103–110.

Aflitos, S., Schijlen, E., de Jong, H., de Ridder, D., Smit, S., Finkers, R., Peters, S. (2014).

Exploring genetic variation in the tomato (Solanum section Lycopersicon) clade by

whole-genome sequencing. The Plant Journal. 80(1), 136–148.

Afroz, A., Chaudhry, Z., Khan, R., Rashid, H., & Khan, S. A. (2009). Effect of GA3 on

regeneration response of three tomato cultivars (Lycopersicon esculentum). Pakistan

Journal of Botany. 41(1), 143–151.

Agusti, J., Herold, S., Schwarz, M., Sanchez, P., Ljung, K., Dun, E. A., Greb, T. (2012).

Strigolactone signaling is required for auxin-dependent stimulation of secondary

growth in plants. Proceedings of the National Academy of Sciences U S A. 109(35),

14277.

Ahsan, N., Lee, S.-H. H., Lee, D.-G. G., Anisuzzaman, M., Alam, M. F., Yoon, H.-S. S.,

Lee, B.-H. H. (2007). The effects of wounding type, preculture, infection method and

cocultivation temperature on the Agrobacterium-mediated gene transfer in tomatoes.

Annals of Applied Biology. 151(3), 363–372.

Ahuja, I., de Vos, R. C. H., Bones, A. M., & Hall, R. D. (2010). Plant molecular stress

responses face climate change. Trends in Plant Science. 15(12), 664–674.

Formatted: Font:


219

Formatted: Font: Italic

Ainsworth, E. A., & Gillespie, K. M. (2007). Estimation of total phenolic content and

other oxidation substrates in plant tissues using Folin-Ciocalteu reagent. Nature

Protocols. 2(4), 875–877.

Akin-Idowu, E., P., Ibitoye, O., D., Ademoyegun, & T., O. (2009). Tissue culture as a

plant production technique for horticultural crops. African Journal of Biotechnology.

8(16), 3782–3788.

Al-Babili, S., & Bouwmeester, H. J. (2015a). Strigolactones, a Novel Carotenoid-Derived

Plant Hormone. Annual Review of Plant Biology. 66(1), 161–186.

Aldemita, R., & Hodges, T. (1996). Agrobacterium tumefaciens-mediated transformation

of japonica and indica rice varieties. Planta. 199(4), 612–617.

Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., Al-Babili, S.

(2012). The Path from β-Carotene to Carlactone, a Strigolactone-Like Plant

Hormone. Science. 335(6074).

Ali, Z., Schumacher, H. M., Heine-Dobbernack, E., El-Banna, A., Hafeez, F. Y.,

Jacobsen, H. J., & Kiesecker, H. (2010). Dicistronic binary vector system-A versatile

tool for gene expression studies in cell cultures and plants. Journal of Biotechnology.

145(1), 9–16.

Andersone, U., & Ievinsh, G. (2008). Medium pH affects regeneration capacity and

oxidative enzyme activity of Pinus sylvestris in tissue culture. Acta Universitatis

Latviensis. 745, 25–35.

Anjum, S.A., Xie, X.Y., Wang, L.C., Saleem, M.F., Chen, M & Wang, L. (2011).

Morphological, physiological and biochemical responses of plants to drought stress.

African Journal of Agricultural Research. .6(9), 2026-2032.

Anne Frary and Elizabeth D. Earle. (1996). An examination of factors affecting the

efficiency of agrobacterium-mediated transformation of tomato. Plant Cell Reports.,

16, 235-240.


220


Arc, E., Sechet, J., Corbineau, F., Rajjou, L., & Marion-Poll, A. (2013). ABA crosstalk

with ethylene and nitric oxide in seed dormancy and germination. Frontiers in Plant

Science., 4, 63.

Arite, T., Iwata, H., Ohshima, K., Maekawa, M., Nakajima, M., Kojima, M. Kyozuka, J.

(2007). DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud

outgrowth in rice. The Plant Journal  for Cell and Molecular Biology. , 51(6), 1019–

1029.

Arite, T., Umehara, M., Ishikawa, S., Hanada, A., Maekawa, M., Yamaguchi, S., &

Kyozuka, J. (2009). d14, a strigolactone-insensitive mutant of rice, shows an

accelerated outgrowth of tillers. Plant & Cell Physiology., 50(8), 1416–1424.

Arnon, D. I. (1949). Copper enzymes in isolated chloroplasts. Polyphenoloxidase in beta

vulgaris. Plant Physiology., 24(1), 1–15.

Arshad, W., Haq, I.-U., Waheed, M. T., Mysore, K. S., & Mirza, B. (2014).

Agrobacterium-mediated transformation of tomato with rolB gene results in

enhancement of fruit quality and foliar resistance against fungal pathogens. PLoS

ONE., 9(5), e96979.

Artuso, E., Ghibaudi, E., Lace, B., Marabello, D., Vinciguerra, D., Lombardi, C., Prandi,

C. (2015). Stereochemical Assignment of Strigolactone Analogues Confirms Their

Selective Biological Activity. Journal of Natural Products., 78(11), 2624–2633.

Auldridge, M. E., McCarty, D. R., & Klee, H. J. (2006). Plant carotenoid cleavage

oxygenases and their apocarotenoid products. Current Opinion in Plant Biology. ,

9(3), 315–321.

Baroni, M., Cruciani, G., Sciabola, S., Perruccio, F., & Mason, J. S. (2007). A Common

Reference Framework for Analyzing/Comparing Proteins and Ligands. Fingerprints

for Ligands and Proteins (FLAP): Theory and Application. Journal of Chemical

Information and Modeling., 47(2), 279–294.


221


Beauchamp, C., & Fridovich, I. (1971). Superoxide dismutase: Improved assays and an

assay applicable to acrylamide gels. Analytical Biochemistry., 44(1), 276–287.

Behki, R. M., & Lesley, S. M. (1980). Shoot Regeneration from Leaf Callus of

Lycopersicon esculentum. Zeitschrift Für Pflanzenphysiologie., 98(1), 83–87.

Bhatia, P., & Ashwath, N. (2005). Effect of medium pH on shoot regeneration from the

cotyledonary explants of tomato. Biotechnology., 4(1), 7–10.

Bhatia, P., Ashwath, N., & Midmore, D. J. (2005). Effects of genotype, explant

orientation, and wounding on shoot regeneration in tomato. In Vitro Cellular &

Developmental Biology -– Plant., 41(4), 457–464.

Bhatia, P., Ashwath, N., Senaratna, T., & Midmore, D. (2004). Tissue culture studies of

tomato (Lycopersicon esculentum). Plant Cell, Tissue and Organ Culture., 78(1), 1–

21.

Bhattacharya, C., Bonfante, P., Deagostino, A., Kapulnik, Y., Larini, P., Occhiato, E. G.,

Venturello, P. (2009). A new class of conjugated strigolactone analogues with

fluorescent properties: synthesis and biological activity. Organic & Biomolecular

Chemistry. , 7(17), 3413–3420.

Bhau, B. S., & Wakhlu, A. K. (2001). Effect of genotype, explant type and growth

regulators on organogenesis in morus alba. Plant Cell, Tissue and Organ Culture, .

66(1), 25–29.

Birch, R. G. (1997). Plant Transformation: Problems and strategies for practical

application, Annual Review Of Plant Physiology and Plant Molecular BiologyAnnu.

Rev. Plant Physiol. Plant Mol. Biol., 48, 297–326.

Bonneau, L., Huguet, S., Wipf, D., Pauly, N., & Truong, H.-N. (2013). Combined

Phosphate and Nitrogen Limitation Generate A Nutrient Stress Transcriptome

Favorable For Arbuscular Mycorrhizal Symbiosis In Medicago Truncatula. New

Phytologist., 199(1), 188–202.


222


Booker, J., Auldridge, M., Wills, S., McCarty, D., Klee, H., & Leyser, O. (2004).

Max3/ccd7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel

plant-signaling molecule. Current Biology., 14(14), 1232–1238.

Booker, J., Sieberer, T., Wright, W., Williamson, L., Willett, B., Stirnberg, P., Leyser, O.

(2005). MAX1 Encodes a Cytochrome P450 Family Member that Acts Downstream

of MAX3/4 to Produce a Carotenoid-Derived Branch-Inhibiting Hormone.

Developmental Cell., 8, 443–449.

Botau, D., Frantescu & A. Darlea M. F. (2002). Indirect regeneration on Lycopersicon

esculentum. Biodiversitate., 10, 57–62.

Boursiac, Y., Léran, S., Corratgé-Faillie, C., Gojon, A., Krouk, G., & Lacombe, B. (2013).

ABA transport and transporters. Trends in Plant Science., 18(6), 325–333.

Boyer, F.-D., de Saint Germain, A., Pillot, J.-P., Pouvreau, J.-B., Chen, V. X., Ramos, S.,

Rameau, C. (2012). Structure-Activity Relationship Studies of Strigolactone-Related

Molecules for Branching Inhibition in Garden Pea: Molecule Design for Shoot

Branching. Plant Physiology., 159(4), 1524–1544.

Brasileiro, A. C. R., Willadino, L., Carvalheira, G. G., & Guerra, M. (1999). Callus

induction and plant regeneration of tomato (Lycopersicon esculentum cv. IPA 5) via

anther culture. Ciência Rural., 29(4), 619–623.

Brewer, P. B., Dun, E. A., Gui, R., Mason, M. G., & Beveridge, C. A. (2015).

Strigolactone Inhibition of Branching Independent of Polar Auxin Transport. Plant

Physiology., 168(4), 1820–1829.

Brewer, P. B., Koltai, H., & Beveridge, C. A. (2013). Diverse Roles of Strigolactones in

Plant Development. Molecular Plant., 6(1), 18–28.

Brewer, P. B., Yoneyama, K., Filardo, F., Meyers, E., Scaffidi, A., Frickey, T., Beveridge,

C. A. (2016). LATERAL BRANCHING OXIDOREDUCTASE acts in the final


223


stages of strigolactone biosynthesis in Arabidopsis. Proceedings of the National

Academy of Sciences., 113(22), 6301–6306.

Brothaerts, W., Mitchell, H. J., Weir, B., Kaines, S., Smith, L. M. A., Yang, W., Jefferson,

R. A. (2005). Gene transfer to plants by diverse species of bacteria. Nature.,

433(7026), 629–633.

Bu, Q., Lv, T., Shen, H., Luong, P., Wang, J., Wang, Z., Huq, E. (2014). Regulation of

drought tolerance by the F-box protein MAX2 in arabidopsis. Plant Physiology., 164,

424–439.

Cano, E., & Moreno, V. M. R. (1990). The role of culture medium, explant source and

genotype on callus growth in cultivated and wild tomato species and interspecific

hybrids. Proceedings of the XIth Eucarpia Meeting on Tomato Genetics., 167–172.

Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., & Prasher, D. C. (1994). Green

fluorescent protein as a marker for gene expression. Science. , 263(5148), 802–805.

Challis, R. J., Hepworth, J., Mouchel, C., Waites, R., & Leyser, O. (2013). A role for more

axillary growth1 (MAX1) in evolutionary diversity in strigolactone signaling

upstream of MAX2. Plant Physiology., 161(4), 1885–1902.

Chaudhry, Z., Abbas, S., Yasmin, A., Rashid, H., Ahmed, H., & Anjum, M. A. (2010).

Tissue Culture Studies in Tomato (Lycopersicon Esculentum) Var. Moneymaker.

Pakistan Journal of Botany., 42(1), 155–163.

Chaudhry, Z., Afroz, A., & Rashid, H. (2007). Effect of variety and plant growth

regulators on callus proliferation and regeneration response of three tomato cultivars

(Lycopersicon esculentum). Pakistan Journal of Botany., 39(3), 857–869.

Chen, H., Zhang, J., Zhuang, T., Xuebao, G. Z. (1999). Studies on optimum hormone

levels for tomato plant regeneration from hypocotyl explants cultured in vitro, Acta

Agriculturae Shanghai., 15(2), 26–29.


224


Chen, L., Xin, X., Yuan, Q., Su, D., & Liu, W. (2014). Phytochemical properties and

antioxidant capacities of various colored berries. Journal of the Science of Food and

Agriculture., 94(2), 180–188.

Cheng, M., Hsi, D. C. H., & Phillips, G. C. (1994). Recovery of Primary Transformants

of Valencia-type Peanut Using Agrobacterium tumefaciens 1. Peanut Science.,

21(2), 84–88.

Chevalier, F., Nieminen, K., Sánchez-Ferrero, J. C., Rodríguez, M. L., Chagoyen, M.,

Hardtke, C. S., & Cubas, P. (2014). Strigolactone promotes degradation of

DWARF14, an α/β hydrolase essential for strigolactone signaling in Arabidopsis.

The Plant Cell., 26(3), 1134–1150.

Chyi, Y. S., & Phillips, G. C. (1987). High efficiency Agrobacterium-mediated

transformation of Lycopersicon based on conditions favorable for regeneration.

Plant Cell Reports., 6(2), 105–108.

Cohen, M., Prandi, C., Occhiato, E. G., Tabasso, S., Wininger, S., Resnick, N., Kapulnik,

Y. (2013). Structure–Function Relations of Strigolactone Analogs: Activity as Plant

Hormones and Plant Interactions. Molecular Plant., 6(1), 141–152.

Compton, M. E., & Veilleux, R. E. (1991). Shoot, root and flower morphogenesis on

tomato inflorescence explants. Plant Cell, Tissue and Organ Culture., 24(3), 223–

231.

Cortina, C., & Culi, F. A. (2004). Tomato Transformation and Transgenic Plant

Production. Plant Cell, Tissue and Organ Culture., 76, 269–275.

Costa, G. M., Nogueira, F. T. S., Agrotecnologia, W. C. O. (2000). In vitro regeneration

of processing tomato (Lycopersicon esculentum Mill.)’IPA-5’and’IPA-6’. Cienc. e

Agrotecnologia., 24, 671–678.

Costa, Miguel; Huevelink, E. (2007). Today’s worldwide tomato production.

International Suppliers Guide., (January), 2006–2008.


225


Crossway, A., Oakes, J. V., Irvine, J. M., Ward, B., Knauf, V. C., & Shewmaker, C. K.

(1986). Integration of foreign DNA following microinjection of tobacco mesophyll

protoplasts. MGG Molecular & General Genetics., 202(2), 179–185.

Cruz de Carvalho, M. H. (2008). Drought stress and reactive oxygen species. Plant

Signaling & Behavior., 3(3), 156–165.

da Silva, G. J., & Costa de Oliveira, A. (2014). Genes Acting on Transcriptional Control

during Abiotic Stress Responses. Advances in Agriculture., 2014, 1–7.

Davies, W. J., Wilkinson, S., & Loveys, B. (2002). Stomatal control by chemical

signalling and the exploitation of this mechanism to increase water use efficiency in

agriculture. New Phytologist., 153(3), 449–460.

De Cuyper, C., Fromentin, J., Yocgo, R. E., De Keyser, A., Guillotin, B., Kunert, K., …

Goormachtig, S. (2015). From lateral root density to nodule number, the

strigolactone analogue GR24 shapes the root architecture of Medicago truncatula.

Journal of Experimental Botany., 66(1), 137–146.

De Groot, F. M. H., Van Berkom, L. W. A., & Scheeren, H. W. (2000). Synthesis and

biological evaluation of 2’-carbamate-linked and 2’-carbonate-linked prodrugs of

paclitaxel selective activation by the tumor-associated protease plasmin. Journal of

Medicinal Chemistry., 43(16), 3093–3102.

Devi, R., Dhaliwal, M. S., Kaur, A., & Gosal, S. S. (2008). Effect of growth regulators on

in vitro morphogenic response of tomato. Indian Journal of Biotechnology., 7(4),

526–530.

Dewanto, V., Wu, X., Adom, K. K., & Liu, R. H. (2002). Thermal processing enhances

the nutritional value of tomatoes by increasing total antioxidant activity. Journal of

Agricultural and Food Chemistry., 50(10), 3010–3014.

Dor, E., Yoneyama, K., Wininger, S., Kapulnik, Y., Yoneyama, K., Koltai, H.,

Hershenhorn, J. (2011). Strigolactone deficiency confers resistance in tomato line


226


SL-ORT1 to the parasitic weeds Phelipanche and Orobanche spp. Phytopathology.,

101(2), 213–222.

Doyle, J. (1991). DNA Protocols for Plants. In Molecular Techniques in Taxonomy (pp.

283–293). Berlin, Heidelberg: Springer Berlin Heidelberg.

Dubois, T., Guedira, M., Dubois, J., & Vasseur, J. (1990). Direct Somatic Embryogenesis

in Roots of Cichorium: Is Callose an Early Marker, Annals of BotanyAnn. Bot. ,

65(5), 539–545.

Dun, E. A., Brewer, P. B., & Beveridge, C. A. (2009). Strigolactones: discovery of the

elusive shoot branching hormone. Trends in Plant Science., 14(7), 364–372.

Durzan, D. (1984). Special problems: Adult vs juvenile explants. Handbook of Plant Cell

Culture, Vol. 2. W. R. Sharp, D. A. Evans, P. V. Ammirato, and Y. Yamada (Eds.).

MacMillan Publ. Co., NY., 2, 471–503.

Egea, I., Albaladejo, I., Meco, V., Morales, B., Sevilla, A., Bolarin, M. C., & Flores, F.

B. (2018). The drought-tolerant Solanum pennellii regulates leaf water loss and

induces genes involved in amino acid and ethylene/jasmonate metabolism under

dehydration. Scientific Reports., 8(1), 2791.

Egea, I., Albaladejo, I., Meco, V., Morales, B., Sevilla, A., Bolarin, M. C., & Flores, F.

B. (2018). The drought-tolerant Solanum pennellii regulates leaf water loss and

induces genes involved in amino acid and ethylene/jasmonate metabolism under

dehydration. Scientific Reports., 8(1), 2791.

Ellul, P., Garcia-Sogo, B., Pineda, B., Ríos, G., Roig, L., & Moreno, V. (2003). The ploidy

level of transgenic plants in Agrobacterium-mediated transformation of tomato

cotyledons (Lycopersicon esculentum L.Mill.) is genotype and procedure dependent.

Theoretical and Applied Genetics., 106(2), 231–238.


227


Khan, N. A., Nazar, R., Iqbal, N., and Anjum, N. A. (2012). Phytohormones and abiotic

stress tolerance in plants. Springer-Verlag Berlin Heidelberg.Springer

642-25829-9

Eyidogan, F., Oz, M. T., Yucel, M., & Oktem, H. a. (2012). Phytohormones and Abiotic

Stress Tolerance in Plants. Phytohormones and Abiotic Stress Tolerance in Plants.

Springer. https://doi.org/10.1007/978-3-642-25829-9

Fillatti, J. J., Kiser, J., Rose, R., & Comai, L. (1987). Efficient Transfer of a Glyphosate

Tolerance Gene into Tomato Using a Binary Agrobacterium Tumefaciens Vector.

Nature Biotechnology., 5, 726–730.

Fischlin, A., Midgley, G., Price, J., Leemans, R., Gopal, B., Turley, C., Velichko, A.

(2007). Ecosystems their properties goods and services. Climate Change 2007:

Impacts Adaptation and Vulnerability. Contribution of Working Group II to the

Fourth Assessment Report of the Intergovernmental Panel on Climate Change M.L.

Parry O.F. Canziani J.P. Palutikof P.J. van der Linden and C.E. Hanson Eds.

Cambridge University Press Cambridge.

Flematti, G. G. R., Scaffidi, A., Waters, M. T. M., & Smith, S. S. M. (2016).

Stereospecificity in strigolactone biosynthesis and perception. Planta., 243(6), 1361–

1373.

Fontanelli, M., Raffaelli, M., Martelloni, L., Frasconi, C., Ginanni, M., & Peruzzi, A.

(2013). The influence of non-living mulch, mechanical and thermal treatments on

weed population and yield of rainfed fresh-market tomato (Solanum lycopersicum

L.). Spanish Journal of Agricultural Research., 11(3), 593.

Foo, E., Ferguson, B. J., & Reid, J. B. (2014). The potential roles of strigolactones and

brassinosteroids in the autoregulation of nodulation pathway. Annals of Botany.,

113(6), 1037–1045.


228


Foolad, M. R., Subbiah, P., & Zhang, L. (2007). Common QTL affect the rate of tomato

seed germination under different stress and nonstress conditions. International

Journal of Plant Genomics., 2007, 97386.

Frary, A, Nesbitt, T. C., Grandillo, S., Knaap, E., Cong, B., Liu, J., Tanksley, S. D. (2000).

fw2.2: a quantitative trait locus key to the evolution of tomato fruit size. Science

(New York, N.Y.)., 289(5476), 85–88.

Frary, Anne, & Van Eck, J. (2005). Organogenesis from Transformed Tomato Explants.

In Transgenic Plants (pp. 141–150). New Jersey: Humana Press.

https://doi.org/10.1385/1-59259-827-7:141

Fujita, Y., Fujita, M., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2011). ABA-mediated

transcriptional regulation in response to osmotic stress in plants. Journal of Plant

Research., 124(4), 509–525.

Fukui, K., Ito, S., Ueno, K., Yamaguchi, S., Kyozuka, J., & Asami, T. (2011). New

branching inhibitors and their potential as strigolactone mimics in rice. Bioorganic

and Medicinal Chemistry Letters., 21(16), 4905–4908.

Gao, N., Shen, W., Cao, Y., Su, Y., & Shi, W. (2009). Influence of bacterial density during

preculture on Agrobacterium-mediated transformation of tomato. Plant Cell, Tissue

and Organ Culture (PCTOC)., 98(3), 321–330.

Gelvin, S. B. (2010). Plant Proteins Involved in Agrobacterium -Mediated Genetic

Transformation. Annual Review of Phytopathology., 48(1), 45–68.

Gomez-Roldan, V., Fermas, S., Brewer, P. B., Puech-Pagès, V., Dun, E. A., Pillot, J. P.,

Rochange, S. F. (2008). Strigolactone inhibition of shoot branching. Nature.,

455(7210), 189–194.

Gonzalez-Perez, S., Gutierrez, J., Garcia-Garcia, F., Osuna, D., Dopazo, J., Lorenzo, O.,

Arellano, J. B. (2011). Early Transcriptional Defense Responses in Arabidopsis Cell


229


Suspension Culture under High-Light Conditions. Plant Physiology., 156(3), 1439–

1456.

Gow, W. P., Chen, J. T., & Chang, W. C. (2009). Effects of genotype, light regime, explant

position and orientation on direct somatic embryogenesis from leaf explants of

Phalaenopsis orchids. Acta Physiologiae Plantarum., 31(2), 363–369.

Grossert, J. S., Pippione, A. C., Boschi, D., Lolli, M. L., & White, R. L. (2015).

Heterocyclic ring cleavage upon collision-induced dissociation of deprotonated 3-

hydroxy-1,2,5-oxadiazoles (3-hydroxyfurazans). Journal of Mass Spectrometry.,

50(12), 1433–1437.

Gubis, J. Lajchova, Z. Farago, J. Jurekova, Z. (2003). Effect of Genotype and Explant

Type on Shoot Regeneration in Tomato (Lycopersicon esculentum Mill ). In Vitro.,

(1), 9–14.

Gubiš, J., Lajchová, Z., & Klčová, L. (2018). The effect of carbon source on plant

regeneration in tomato. Horticultural Science., 32(No. 1), 6–8.

Gubiš, J., Lajchová, Z., Faragó, J., & Jureková, Z. (2004). Effect of growth regulators on

shoot induction and plant regeneration in tomato (Lycopersicon esculentum Mill.).

Biologia - Section Cellular and Molecular Biology., 59(3), 405–408.

Guo, M., Zhang, Y. L., Meng, Z. J., & Jiang, J. (2012). Optimization of factors affecting

Agrobacterium-mediated transformation of Micro-Tom tomatoes. Genetics and

Molecular Research: GMR., 11(1), 661–671.

H D Sherkar and A M Chavan. (2014). Studies on callus induction and shoot regeneration

in Tomato. Science Research Reporter., 4(1), 89–93.

Ha, C. Van, Leyva-González, M. A., Osakabe, Y., Tran, U. T., Nishiyama, R., Watanabe,

Y., Tran, L.-S. P. (2014). Positive regulatory role of strigolactone in plant responses

to drought and salt stress. Proceedings of the National Academy of Sciences of the

United States of America., 111(2), 851–856.


230


Halouzka, R., Tarkowski, P., Zwanenburg, B., & Ćavar Zeljković, S. (2018). Stability of

strigolactone analog GR24 toward nucleophiles. Pest Management Science., 74(4),

896–904.

Hamiaux, C., Drummond, R. S. M., Janssen, B. J., Ledger, S. E., Cooney, J. M.,

Newcomb, R. D., & Snowden, K. C. (2012). DAD2 Is an α/β Hydrolase Likely to Be

Involved in the Perception of the Plant Branching Hormone, Strigolactone. Current

Biology (Vol. 22).

Hamza, S, & Chupeau, Y. (1993). Re-evaluation of conditions for plant regeneration and

Agrobacterium -mediated transformation from tomato (Lycopersicum esculentum ).

Journal of Experimental Botany., 44(269), 1837–1845.

Hanafy Ahmed A. H, Mahmoud M. S. & Doaa. H. A. (2015). Agrobacterium-Mediated

Transformation of Super Strain B and Rio Grande Tomato Cultivars Using Gv3101

Binary Vector Harboring Ptdins-Plc2 Gene. International Journal of Bio-Technology

and Research (IJBTR)., 5(1), 11–22.

Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S., & Mullineaux, P. M. (2000).

pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant

transformation. Plant Molecular Biology., 42(6), 819–832.

Hood, E. E., Gelvin, S. B., Melchers, L. S., and Hoekema, A. (1993). New Agrobacterium

helper plasmids for gene transfer to plants. Transgenic Research., 2: 208-218

Hooykaas, P. J. J. (2010). Plant Transformation. Encyclopedia of Life Sciences, 286, 1–6.

Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D., Rogers, S. G., & Fraley, R. T.

(1985). A Simple and General Method for Transferring Genes into Plants. Science.,

227(4691), 1229–1231.

Hu, W., & Phillips, G. C. (2001). A combination of overgrowth-control antibiotics

improves Agrobacterium tumefaciens-mediated transformation efficiency for


231


cultivated tomato (L. esculentum). In Vitro Cellular & Developmental Biology-

Plant., 37(1), 12–18.

Hutchinson, M. J., Murch, S. J., & Saxena, P. K. (1996). Morphoregulatory role of

thidiazuron: Evidence of the involvement of endogenous auxin in thidiazuron-

induced somatic embryogenesis of geranium (Pelargonium x hortorum Bailey).

Journal of Plant Physiology., 149(5), 573–579.

Hutchinson, Margaret J., & Saxena, P. K. (1996). Acetylsalicylic acid enhances and

synchronizes thidiazuron-induced somatic embryogenesis in geranium (Pelargonium

× hortorum Bailey) tissue cultures. Plant Cell Reports., 15(7), 512–515.

Ijaz, R., Ejaz, J., Gao, S., Liu, T., Imtiaz, M., Ye, Z., & Wang, T. (2017). Overexpression

of annexin gene AnnSp2, enhances drought and salt tolerance through modulation of

ABA synthesis and scavenging ROS in tomato. Scientific Reports., 7(1), 12087.

Ishfaq, M., Nasir, I. A., Mahmood, N., & Saleem, M. (2012). In vitro induction of

mutation in tomato (Lycopersicon esculentum L.) cv. Roma by using chemical

mutagens. Pakistan Journal of Botany., 44(SPL.ISS.1), 311–314.

Jabeen, N., Mirza, B., Chaudhary, Z., Rashid, H., & Gulfraz, M. (2009). Study of the

factors affecting Agrobacterium mediated gene transformation in tomato

(Lycopersicon esculentum Mill.) cv. Riogrande using rice chitinase (cht-3) gene.

Pakistan Journal of Botany., 41(5), 2605–2614.

Jamil, M., Kountche, B. A., Haider, I., Guo, X., Ntui, V. O., Jia, K.-P., Al-Babili, S.

(2018). Methyl phenlactonoates are efficient strigolactone analogs with simple

structure. Journal of Experimental Botany., 69(9), 2319–2331.

Janssen, B. J., & Snowden, K. C. (2012). Strigolactone and karrikin signal perception:

receptors, enzymes, or both. Frontiers in Plant Science., 3, 296.


232


Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). GUS fusions: beta-

glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The

EMBO Journal., 6(13), 3901–3907.

Jehan, S., & Hassanein, A. M. (2013). Hormonal Requirements Trigger Different

Organogenic Pathways on Tomato Nodal Explants. American Journal of Plant

Sciences., 04(11), 2118–2125.

Jia, K.-P., Luo, Q., He, S.-B., Lu, X.-D., & Yang, H.-Q. (2014). Strigolactone-Regulated

Hypocotyl Elongation Is Dependent on Cryptochrome and Phytochrome Signaling

Pathways in Arabidopsis. Molecular Plant., 7(3), 528–540.

Jiang, L., Liu, X., Xiong, G., Liu, H., Chen, F., Wang, L., Li, J. (2013). DWARF 53 acts

as a repressor of strigolactone signalling in rice. Nature., 504(7480), 401–405.

Jiménez, V. M. (2001). Regulation of in vitro somatic embryogenesis with emphasis on

the role of endogenous hormones. Revista Brasileira de Fisiologia Vegetal., 13(2),

196–223.

Jiménez-Antaño, J. M., Pérez-Vargas, J., Ariza-Castolo, A., Guzmán, O. G., & Calva, G.

C. (2018). An efficient heat-shock protocol for transformation of Agrobacterium

rhizogenes without spontaneous generation to antibiotic resistance. Plant OMICS.,

11(1), 20–29.

Juan, J. X., Yu, X. H., Jiang, X. M., Gao, Z., Zhang, Y., Li, W., Yang, G. (2015).

Agrobacterium-mediated transformation of tomato with the ICE1 transcription factor

gene. Genetics and Molecular Research., 14(1), 597–608.

Junglee, S., Urban, L., Sallanon, H., & Lopez-Lauri, F. (2014). Optimized Assay for

Hydrogen Peroxide Determination in Plant Tissue Using Potassium Iodide.

American Journal of Analytical Chemistry., 05(11), 730–736.

Kagiyama, M., Hirano, Y., Mori, T., Kim, S.-Y., Kyozuka, J., Seto, Y., Hakoshima, T.

(2013). Structures of D14 and D14L in the strigolactone and karrikin signaling


233


pathways. Genes to Cells Devoted to Molecular & Cellular Mechanisms., 18(2),

147–160.

Kannan, C., & Zwanenburg, B. (2014). A novel concept for the control of parasitic weeds

by decomposing germination stimulants prior to action. Crop Protection., 61, 11–15.

Kapulnik, Y., Resnick, N., Mayzlish-Gati, E., Kaplan, Y., Wininger, S., Hershenhorn, J.,

& Koltai, H. (2011). Strigolactones interact with ethylene and auxin in regulating

root-hair elongation in Arabidopsis. Journal of Experimental Botany., 62(8), 2915–

2924.

Kartha, K. K., Gamborg, O. L., Shyluk, J. P., & Constabel, F. (1976). Morphogenetic

Investigations on in vitro Leaf Culture of Tomato (Lycopersicon esculentum Mill.

cv. Starfire) and high Frequency Plant Regeneration. Zeitschrift Für

Pflanzenphysiologie., 77(4), 292–301.

Kaya, C., & Higgs, D. (2003). Supplementary potassium nitrate improves salt tolerance

in bell pepper plants. Journal of Plant Nutrition., 26(7), 1367–1382.

Khokhar, K. M., & HRI, N. (2013). Present status and prospects of tomatoes in Pakistan.

Agricultural Corner-Farmers to Global Market. Repot, 1–21. /

Kissoudis, C., Sunarti, S., van de Wiel, C., Visser, R. G. F., van der Linden, C. G., & Bai,

Y. (2016). Responses to combined abiotic and biotic stress in tomato are governed

by stress intensity and resistance mechanism. Journal of Experimental Botany.,

67(17), 5119–5132.

Klein, T. M., Wolf, E. D., Wu, R., & Sanford, J. C. (1987). High-velocity microprojectiles

for delivering nucleic acids into living cells. Nature., 327(6117), 70–73.

Klerk, G. J. De, Krieken, W. M. Van Der, & Jong, J. C. De. (1999). The formation of

adventitious roots; new concepts, new possibilities. In Vitro Cellular and

Developmental Biology -– Plant., 35, 189–199.


234


Kobayashi, M., Nagasaki, H., Garcia, V., Just, D., Bres, C., Mauxion, J.-P., Aoki, K.

(2014). Genome-Wide Analysis of Intraspecific DNA Polymorphism in ‘Micro-

Tom’, a Model Cultivar of Tomato (Solanum lycopersicum). Plant and Cell

Physiology., 55(2), 445–454.

Koenig, D., Jimenez-Gomez, J. M., Kimura, S., Fulop, D., Chitwood, D. H., Headland, L.

R., Maloof, J. N. (2013). Comparative transcriptomics reveals patterns of selection

in domesticated and wild tomato. Proceedings of the National Academy of Sciences.,

110(28), E2655–E2662.

Kohlen, W., Charnikhova, T., Bours, R., López-Ráez, J. A., & Bouwmeester, H. (2013).

Tomato strigolactones: a more detailed look. Plant Signaling & Behavior., 8(1),

e22785.

Ku, Y. S., Sintaha, M., Cheung, M. Y., & Lam, H. M. (2018). Plant hormone signaling

crosstalks between biotic and abiotic stress responses. International Journal of

Molecular Sciences., 19(10).

Kumar, S., Sandhir, R., & Ojha, S. (2014). Evaluation of antioxidant activity and total

phenol in different varieties of Lantana camara leaves. BMC Research Notes., 7(1),

560.

Kurtz, S.M. Lineberger, R. D. (1983). Genotypic differences in morphogenic capacity of

cultured leaf explants of tomato [Lycopersicon esculentum]. American Society for

Horticultural Science (USA)., 108:710–714.

Lace, B., & Prandi, C. (2016). Shaping Small Bioactive Molecules to Untangle Their

Biological Function: A Focus on Fluorescent Plant Hormones. Molecular Plant. ,

9(8), 1099–1118.

Larkin, P. J., & Scowcroft, W. R. (1981). Somaclonal variation — a novel source of

variability from cell cultures for plant improvement. Theoretical and Applied

Genetics., 60(4), 197–214.


235


Lee, L.-Y., & Gelvin, S. B. (2008). T-DNA binary vectors and systems. Plant Physiology.,

146(2), 325–332.

Li, S. M., Hua, G. G., Liu, H. X., & Guo, J. H. (2008). Analysis of defence enzymes

induced by antagonistic bacterium Bacillus subtilis strain AR12 towards Ralstonia

solanacearum in tomato. Annals of Microbiology., 58(4), 573–578.

Li, S. M., Hua, G. G., Liu, H. X., & Guo, J. H. (2008). Analysis of defence enzymes

induced by antagonistic bacterium Bacillus subtilis strain AR12 towards Ralstonia

solanacearum in tomato. Annals of Microbiology., 58(4), 573–578.

Li, W., Tran, L.-S. S. P. (2015). Are karrikins involved in plant abiotic stress responses?

Trends in Plant Science., 20(9), 535–538.

Lim, M. Y., Jeong, B. R., Jung, M., & Harn, C. H. (2016). Transgenic tomato plants

expressing strawberry d-galacturonic acid reductase gene display enhanced tolerance

to abiotic stresses. Plant Biotechnology Reports. Plant Biotechnol. Rep, 10(2), 105–

116.

Lin, T., Zhu, G., Zhang, J., Xu, X., Yu, Q., Zheng, Z., Huang, S. (2014). Genomic analyses

provide insights into the history of tomato breeding. Nature Genetics., 46(11), 1220–

1226.

Ling, H. Q., Kriseleit, D., & Ganal, M. W. (1998). Effect of ticarcillin/potassium

clavulanate on callus growth and shoot regeneration in Agrobacterium-mediated

transformation of tomato (Lycopersicon esculentum Mill.). Plant Cell Reports.,

17(11), 843–847.

Liu, J., He, H., Vitali, M., Visentin, I., Charnikhova, T., Haider, I., Cardinale, F. (2015).

Osmotic stress represses strigolactone biosynthesis in Lotus japonicus roots:

exploring the interaction between strigolactones and ABA under abiotic stress.

Planta., 241(6), 1435–1451.


236


Liu, J., Lovisolo, C., Schubert, A., & Cardinale, F. (2013). Signaling role of Strigolactones

at the interface between plants, (micro)organisms, and a changing environment.

Journal of Plant Interactions., 8(1), 17–33.

Liu, J., Novero, M., Charnikhova, T., Ferrandino, A., Schubert, A., Ruyter-Spira, C.,

Cardinale, F. (2013). Carotenoid cleavage dioxygenase 7 modulates plant growth,

reproduction, senescence, and determinate nodulation in the model legume Lotus

japonicus. Journal of Experimental Botany., 64(7), 1967–1981.

Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using

real-time quantitative PCR and the 2-ΔΔCT method. Methods., 25(4), 402–408.

Liza, L. N., Zinnah, K.M.A., Chowdhury Md. Al Nayem., & Ashrafuzzaman, M. (2013).

In Vitro Growth Media Effect for Regeneration of Tomato (Lycopersicon

esculentum ) and Evaluation of the Salt Tolerance Activity of Callus. Journal of

Agriculture and Sustainability., 3(2), 132–143.

Lobell, D. B., Schlenker, W., & Costa-Roberts, J. (2011). Climate trends and global crop

production since 1980 - Supporting Online Material. Science., 333(6042), 616–620.

Lombardi, C., Artuso, E., Grandi, E., Lolli, M., Spirakys, F., Priola, E., & Prandi, C.

(2017). Recent advances in the synthesis of analogues of phytohormones

strigolactones with ring-closing metathesis as a key step. Organic & Biomolecular

Chemistry., 15(38), 8218–8231.

Lombardi, C., Artuso, E., Grandi, E., Lolli, M., Spyrakis, F., Priola, E., & Prandi, C.

(2017). Recent advances in the synthesis of analogues of phytohormones

strigolactones with ring-closing metathesis as a key step. Organic & Biomolecular

Chemistry, 15(38), 8218–8231.

López, J. R., Moreno, C. R., Cruz-mendı, A., Rivera-lo, J., Lo, M., & Herna, S. (2011). A

Simple and Efficient Protocol for Plant Regeneration and Genetic Transformation of

Tomato cv. Micro-Tom from Leaf Explants. HortScience., 46(12), 1655–1660.


237


López-Ráez, Juan A. (2016). How drought and salinity affect arbuscular mycorrhizal

symbiosis and strigolactone biosynthesis? Planta., 243(6), 1375–1385.

López-Ráez, Juan A., Kohlen, W., Charnikhova, T., Mulder, P., Undas, A. K., Sergeant,

M. J., Bouwmeester, H. (2010). Does abscisic acid affect strigolactone biosynthesis?

New Phytologist., 187(2), 343–354.

López-Ráez, Juan Antonio, & Bouwmeester, H. (2008). Fine-tuning regulation of

strigolactone biosynthesis under phosphate starvation. Plant Signaling & Behavior.,

3(11), 963–965.

López-Ráez, Juan Antonio, Charnikhova, T., Gómez-Roldán, V., Matusova, R., Kohlen,

W., De Vos, R., Bouwmeester, H. (2008). Tomato strigolactones are derived from

carotenoids and their biosynthesis is promoted by phosphate starvation. New

Phytologist., 178(4), 863–874.

Lumba, S., Holbrook-Smith, D., & McCourt, P. (2017). The perception of strigolactones

in vascular plants. Nature Chemical Biology., 13(6), 599–606.

Ma, J., Liu, T., & Qiu, D. (2015). Optimization of Agrobacterium-mediated

transformation conditions for tomato (Solanum lycopersicum L.). Plant OMICS.,

8(6), 529–536.

Manzi, M., Lado, J., Rodrigo, M. J., Zacarías, L., Arbona, V., & Gómez-Cadenas, A.

(2015). Root ABA Accumulation in Long-Term Water-Stressed Plants is Sustained

by Hormone Transport from Aerial Organs. Plant and Cell Physiology., 56(12),

2457–2466.

Marzec, M. (2016). Perception and Signaling of Strigolactones. Frontiers in Plant

Science., 7, 1260.

Marzec, M., Muszynska, A., & Gruszka, D. (2013). The role of strigolactones in nutrient-

stress responses in plants. International Journal of Molecular Sciences., 14(5), 9286–

9304.


238


Mathews, H., Clendennen, S. K., Caldwell, C. G., Liu, X. L., Connors, K., Matheis, N.,

Wagner, D. R. (2003). Activation tagging in tomato identifies a transcriptional

regulator of anthocyanin biosynthesis, modification, and transport. The Plant Cell.,

15 (8), 689–1703.

Matsukura, C., Aoki, K., Fukuda, N., Mizoguchi, T., Asamizu, E., Saito, T., Ezura, H.

(2008). Comprehensive Resources for Tomato Functional Genomics Based on the

Miniature Model Tomato Micro-Tom. Current Genomics., 9(7), 436–443.

Matusova, R., Rani, K., Verstappen, F. W. A., Franssen, M. C. R., Beale, M. H., &

Bouwmeester, H. J. (2005). The strigolactone germination stimulants of the plant-

parasitic Striga and Orobanche spp. are derived from the carotenoid pathway. Plant

Physiology., 139(2), 920–934.

Mayzlish-Gati, E., Laufer, D., Grivas, C. F., Shaknof, J., Sananes, A., Bier, A., Koltai, H.

(2015). Strigolactone analogs act as new anti-cancer agents in inhibition of breast

cancer in xenograft model. Cancer Biology and Therapy., 16(11), 1682–1688.

McCormick, Sheila, Niedermeyer, J., Fry, J., Barnason, A., Horsch, R., & Fraley, R.

(1986). Leaf disc transformation of cultivated tomato (L. esculentum) using

Agrobacterium tumefaciens. Plant Cell Reports., 5(2), 81–84.

McCormick, Shiela. (1991). Transformation of tomato with Agrobacterium tumifaciens.

In Plant Tissue Culture Manual., b6, 311-319.

McCourt, P., Lumba, S., & Bunsick, M. (2017). Chemical genetics and strigolactone

perception. F1000Research., 6, 975.

Méndez-Hernández, H. A., Ledezma-Rodríguez, M., Avilez-Montalvo, R. N., Juárez-

Gómez, Y. L., Skeete, A., Avilez-Montalvo, J., Loyola-Vargas, V. M. (2019).

Signaling Overview of Plant Somatic Embryogenesis. Frontiers in Plant Science.,

10, 77.


239


Meng, X.-Y., Zhang, H.-X., Mezei, M., & Cui, M. (2011). Molecular docking: a powerful

approach for structure-based drug discovery. Current Computer-Aided Drug

Design., 7(2), 146–157.

Min, Z., Li, R., Chen, L., Zhang, Y., Li, Z., Liu, M., Fang, Y. (2019). Alleviation of

drought stress in grapevine by foliar-applied strigolactones. Plant Physiology and

Biochemistry., 135, 99–110.

Mirghis, E., Mirghis, R., & Lãcãtus, V. (1995). Analysis of tomato cultivares and hybrids

for in vitro calus formation and regeneration. Acta Horticulturae., 412, 111–116.

Mitchell, J. P., Shennan, C., & Grattan, S. R. (1991). Developmental changes in tomato

fruit composition in response to water deficit and salinity. Physiologia Plantarum.,

83(1), 177–185.

Mittler, R. (2006). Abiotic stress, the field environment and stress combination. Trends in

Plant Science., 11(1), 15–19.

Mittova, V., Tal, M., Volokita, M., & Guy, M. (2002). Salt stress induces up-regulation

of an efficient chloroplast antioxidant system in the salt-tolerant wild tomato species

Lycopersicon pennellii but not in the cultivated species. Physiologia Plantarum.,

115(3), 393–400.

Miyazono, K., Miyakawa, T., Sawano, Y., Kubota, K., Kang, H.-J., Asano, A., Tanokura,

M. (2009). Structural basis of abscisic acid signalling. Nature., 462(7273), 609–614.

Moghaieb, R. E. A., Saneoka, H., & Fujita, K. (1999). Plant regeneration from hypocotyl

and cotyledon explant of tomato (Lycopersicon esculentum Mill.). Soil Science and

Plant Nutrition., 45(3), 639–646.

Morris, S. E., Turnbull, C. G., Murfet, I. C., & Beveridge, C. A. (2001). Mutational

analysis of branching in pea. Evidence that Rms1 and Rms5 regulate the same novel

signal. Plant Physiology., 126(3), 1205–1213.


240


Morrison, R. A., Whitaker, R. J., & Evans, D. A. Somaclonal Variation: Its Genetic Basis

and Prospects for Crop Improvement. In, Opportunities for Phytochemistry in Plant

Biotechnology. Recent Advances in Phytochemistry (Proceedings of the

Phytochemical Society of North America), Conn E.E. (eds). Springer, Boston, MA.,

pp. 1-18 (1988).

Mouchel, C. F., & Leyser, O. (2007). Novel phytohormones involved in long-range

signaling. Current Opinion in Plant Biology., 10(5), 473–476.

Munné-Bosch, S., & Alegre, L. (2000). Changes in carotenoids, tocopherols and

diterpenes during drought and recovery, and the biological significance of

chlorophyll loss in Rosmarinus officinalis plants. Planta., 210(6), 925–931.

Murashige, T., & Skoog, F. (1962). A Revised Medium for Rapid Growth and Bioassays

with Tobacco Tissue Cultures. Physiologia Plantarum. , 15(3), 473–497.

Murray, S.L., R. Janse van Vuuren and D.K. Berger, R. (1998). Tomato transformation is

influenced by acetosyringone and Agrobacterium tumefaciens cell density. Journal

of the Southern African Society for Horticultural Sciences.J. Southern Afr. Soc.

Hortic. Sci., 8, 60–64.

Mwakaboko, A. S., & Zwanenburg, B. (2016). Strigolactone Analogues with a D-Ring

Modified at C-2. European Journal of Organic Chemistry., 21, 3495–3499.

Nahar, K., & Gretzmacher, R. (2011). Response of Shoot and Root Development of Seven

Tomato Cultivars in Hydrophonic System under Water Stress. Academic Journal of

Plant Sciences., 4(2), 57–63.

Naik, P. M., Manohar, S. H., Praveen, N., & Murthy, H. N. (2010). Effects of sucrose and

pH levels on in vitro shoot regeneration from leaf explants of Bacopa monnieri and

accumulation of bacoside A in regenerated shoots. Plant Cell, Tissue Organ Culture.,

100(2), 235–239.


241


Najeebullah, M. (2014). Annual abridge report pertaining to vegetable research institute,

faisalabad. Faisalabad.

Nakamura, H., Xue, Y.-L., Miyakawa, T., Hou, F., Qin, H.-M., Fukui, K., Fukui, K.

(2013). Molecular mechanism of strigolactone perception by DWARF14. Nature

Communications., 4(2613),1-10.

Nakano, Y., & Physiology, K. A. (1981). Hydrogen Peroxide is scavenged by Ascorbate-

specific Peroxidase in Spinach Chloroplasts. Plant and Cell Physiology., 22(5),867-

880.

Nauerby, B., Billing, K., & Wyndaele, R. (1997). Influence of the antibiotic timentin on

plant regeneration compared to carbenicillin and cefotaxime in concentrations

suitable for elimination of Agrobacterium tumefaciens. Plant Science., 123(1–2),

169–177.

Nefkens, G. H. L., Thuring, J. W. J. F., Beenakkers, M. F. M., & Zwanenburg, B. (1997).

Synthesis of a Phthaloylglycine-Derived Strigol Analogue and Its Germination

Stimulatory Activity toward Seeds of the Parasitic Weeds Striga hermonthica and

Orobanche crenata. Journal of Agricultural and Food Chemistry., 45(6), 2273–2277.

Nelson, D. C., Scaffidi, A., Dun, E. A., Waters, M. T., Flematti, G. R., Dixon, K. W.,

Smith, S. M. (2011). F-box protein MAX2 has dual roles in karrikin and strigolactone

signaling in Arabidopsis thaliana. Proceedings of the National Academy of Sciences

of the United States of America., 108(21), 8897–8902.

Nic-Can, G. I., & Loyola-Vargas, V. M. The Role of the Auxins During Somatic

Embryogenesis. In Somatic Embryogenesis: Fundamental Aspects and Applications.

Ochoa-Alejo (eds). Springer, International Publishing Switzerland . , 121-170

(2016)

Nic-Can, G. I., López-Torres, A., Barredo-Pool, F., Wrobel, K., Loyola-Vargas, V. M.,

Rojas-Herrera, R., & De-la-Peña, C. (2013). New Insights into Somatic


242


Embryogenesis: leafy cotyledon1, baby boom1 and wuschel-related homeobox4 Are

Epigenetically Regulated in Coffea canephora. PLoS ONE., 8(8).

Nickavar, B., Kamalinejad, M., & Mohandesi, S. (2006). Comparison of the components

of the essential oils from leaves and fruits of Grammosciadium platycarpum.

Chemistry of Natural Compounds., 42(6), 686–688.

Ning, G. G., & Bao, M. Z. (2007). Plant regeneration from callus derived from immature

embryo cotyledons of Prunusmume. HortScience., 42(3), 744–747.

Nomura, S., Nakashima, H., Mizutani, M., Takikawa, H., & Sugimoto, Y. (2013).

Structural requirements of strigolactones for germination induction and inhibition of

Striga gesnerioides seeds. Plant Cell Reports., 32(6), 829–838.

Nover, L., Kranz, E., & Scharf, K. D. (1982). Growth Cycle of Suspension Cultures of

Lycopersicon esculentum and L. peruvianum. Biochemie Und Physiologie Der

Pflanzen., 177(6), 483–499.

Oerke, E.C. (2006). Crop losses to pests. The Journal of Agricultural Science., 144(01),

31.

Okamoto, M., Peterson, F. C., Defries, A., Park, S.-Y., Endo, A., Nambara, E., Cutler, S.

R. (2013). Activation of dimeric ABA receptors elicits guard cell closure, ABA-

regulated gene expression, and drought tolerance. Proceedings of the National

Academy of Sciences., 110(29), 12132–12137.

Osakabe, Y., Kajita, S., & Osakabe, K. (2011). Genetic engineering of woody plants:

current and future targets in a stressful environment. Physiologia Plantarum., 142(2),

105–117.

Osman, M., Elhadi, E., & Khalafalla, M. (2010). Callus formation and organogenesis of

tomato (Lycopersicon esculentum Mill, C.V. Omdurman) induced by thidiazuron.

African Journal of Biotechnology., 9(28), 4407–4413.


243


Otroshy, M., Khalili, Z., Ebrahimi, M. A., Nekoui, M. K., & Moradi, K. (2013). Effect of

growth regulators and explant on plant regeneration of Solanum lycopersicum L. var.

cerasiforme. Russian Agricultural Sciences., 39(3), 226–235.

Pal, S., Zhao, J., Khan, A., Yadav, N. S., Batushansky, A., Barak, S.,Rachmilevitch, S.

(2016). Paclobutrazol induces tolerance in tomato to deficit irrigation through

diversified effects on plant morphology, physiology and metabolism. Scientific

Reports., 6.

Park, J., & Yi, BY CK, L. (2011). Growth Regulators, Bud Length, Donor Plant Age, Low

Temperature Treatment and Glucose Concentration on Callus Induction and Plant

Regeneration. Journal of the Korean Society for Horticultural Science., 42(1), 32–

37.

Periago, M. J., Martínez-Valverde, I., Chesson, A., & Provan, G. (2002). Phenolic

compounds, lycopene and antioxidant activity in commercial varieties of tomato

(Lycopersicum esculentum). Journal of the Science of Food and Agriculture., 82(3),

323–330.

Plastira, V. A., & Perdikaris, A. K. (1997). Effect of genotype and explant type in

regeneration frequency of tomato in vitro. Acta Horticulturae., (447), 231–234.

Prandi, C., Ghigo, G., Occhiato, E. G., Scarpi, D., Begliomini, S., Lace, B., Noordik, J.

H. (2014). Tailoring fluorescent strigolactones for in vivo investigations: a

computational and experimental study. Organic & Biomolecular Chemistry., 12(18),

2960–2968.

Prandi, C., Occhiato, E. G., Tabasso, S., Bonfante, P., Novero, M., Scarpi, D., Miletto, I.

(2011). New Potent Fluorescent Analogues of Strigolactones: Synthesis and

Biological Activity in Parasitic Weed Germination and Fungal Branching. European

Journal of Organic Chemistry., (20–21), 3781–3793.


244


Qiu, D., Diretto, G., Tavarza, R., & Giuliano, G. (2007). Improved protocol for

Agrobacterium mediated transformation of tomato and production of transgenic

plants containing carotenoid biosynthetic gene CsZCD. Scientia Horticulturae.,

112(2), 172–175.

Rai, G. K., Rai, N. P., Kumar, S., Yadav, A., Rathaur, S., & Singh, M. (2012). Effects of

explant age, germination medium, pre-culture parameters, inoculation medium, pH,

washing medium, and selection regime on Agrobacterium-mediated transformation

of tomato. In Vitro Cellular & Developmental Biology -– Plant., 48(5), 565–578.

Raineri, J., Ribichich, K. F., & Chan, R. L. (2015). The sunflower transcription factor

HaWRKY76 confers drought and flood tolerance to Arabidopsis thaliana plants

without yield penalty. Plant Cell Reports., 34(12), 2065–2080.

Rakha, M., Scott, J., Hutton, S., & Smith, H. (2011). Identification of trichomes, loci and

chemical compounds derived from Solanum habrochaites accession LA1777 that are

associated with resistance to the sweetpotato whitefly, Bemisia tabaci in tomato, S.

lycopersicum. 43rd Tomato Breeders Roundtable Meeting.

Rani, K., Zwanenburg, B., Sugimoto, Y., Yoneyama, K., & Bouwmeester, H. J. (2008).

Biosynthetic considerations could assist the structure elucidation of host plant

produced rhizosphere signalling compounds (strigolactones) for arbuscular

mycorrhizal fungi and parasitic plants. Plant Physiology and Biochemistry., 46(7),

617–626.

Rao, A. Q., Bakhsh, A., Kiani, S., Shahzad, K., Shahid, A. A., Husnain, T., & Riazuddin,

S. (2009). The myth of plant transformation. Biotechnology Advances., 27(6), 753–

763.

Rasmussen, A., Depuydt, S., Goormachtig, S., & Geelen, D. (2013). Strigolactones fine-

tune the root system. Planta., 238(4), 615–626.


245


Rasmussen, A., Mason, M. G., De Cuyper, C., Brewer, P. B., Herold, S., Agusti, J.,

Beveridge, C. A. (2012). Strigolactones Suppress Adventitious Rooting in

Arabidopsis and Pea. Plant Physiology., 158(4), 1976–1987.

Ren, J., Sun, L. N., Zhang, Q. Y., & Song, X. S. (2016). Drought Tolerance Is Correlated

with the Activity of Antioxidant Enzymes in Cerasus humilis Seedlings. BioMed

Research International., 2016, 1–9.

Roy, R., Purty, R. S., Agrawal, V., & Gupta, S. C. (2006). Transformation of tomato

cultivar ‘Pusa Ruby’ with bspA gene from Populus tremula for drought tolerance.

Plant Cell, Tissue and Organ Culture., 84(1), 56–68.

Ruyter-Spira, C., Al-Babili, S., van der Krol, S., & Bouwmeester, H. (2013). The biology

of strigolactones. Trends in Plant Science,, 18(2), 72–83.

Ruyter-Spira, C., Kohlen, W., Charnikhova, T., van Zeijl, A., van Bezouwen, L., de

Ruijter, N., Bouwmeester, H. (2011). Physiological effects of the synthetic

strigolactone analog GR24 on root system architecture in Arabidopsis: another

belowground role for strigolactones? Plant Physiology., 155(2), 721–734.

Saeed, W., Naseem, S., & Ali, Z. (2017). Strigolactones Biosynthesis and Their Role in

Abiotic Stress Resilience in Plants: A Critical Review. Frontiers in Plant Science.,

8, 1487.

Saeed, W., Naseem, S., Gohar, D., & Ali, Z. (2019). Efficient and reproducible somatic

embryogenesis and micropropagation in tomato via novel structures - Rhizoid

Tubers. PLOS ONE., 14(5), e0215929.

Saker, M. M., Salama, H. S., Salama, M., El-Banna, A., & Abdel Ghany, N. M. (2011).

Production of transgenic tomato plants expressing Cry 2Ab gene for the control of

some lepidopterous insects endemic in Egypt. Journal of Genetic Engineering and

Biotechnology., 9(2), 149–155.


246


Sambrook, J., & Russell, D. W. (2001). Molecular cloning: a laboratory manual. Cold

Spring Harbor Laboratory Press.

Sambrook, J., & Russell, D. W. (2006). Preparation of Plasmid DNA by Alkaline Lysis

with SDS: Maxipreparation. 3rd ed. Cold Spring Harbor Protocols., 2006(1).

Samodelov, S. L., Beyer, H. M., Guo, X., Augustin, M., Jia, K. P., Baz, L., Zurbriggen,

M. D. (2016). Strigoquant: A genetically encoded biosensor for quantifying

Strigolactone activity and specificity. Science Advances., 2(11).

Sanchez, E., Artuso, E., Lombardi, C., Visentin, I., Lace, B., Saeed, W., Prandi, C. (2018).

Structure–activity relationships of strigolactones via a novel, quantitative in planta

bioassay. Journal of Experimental Botany., 69(9), 2333–2343.

Scaffidi, A., Waters, M. T., Bond, C. S., Dixon, K. W., Smith, S. M., Ghisalberti, E. L.,

& Flematti, G. R. (2012). Exploring the molecular mechanism of karrikins and

strigolactones. Bioorganic & Medicinal Chemistry Letters. (Vol. 22).

Schöb, H., Kunz, C., & Meins, F. (1997). Silencing of transgenes introduced into leaves

by agroinfiltration: a simple, rapid method for investigating sequence requirements

for gene silencing. Molecular & General Genetics. , 256(5), 581–585.

Schuetze, R., & Wieczorrek, G. (1987). Investigations into tomato tissue cultures, 1: Shoot

regeneration in primary explants of tomato. Archive for Breeding Research (German

DR)., 17,117-126

Serrano, R., Mulet, J. M., Rios, G., Marquez, J. A., Larrinoa, I. igo F. de, Leube, M. P.,

Montesinos, C. (2012). A glimpse of the mechanisms of ion homeostasis during salt

stress. Journal of Experimental Botany., 50(Special_Issue), 1023–1036.

Shah, S H, Ali, S., Jan, S. A., Din, J., & Ali, G. M. (2015). Callus Induction, In Vitro

Shoot Regeneration and Hairy Root Formation By The Assessment Of Various Plant

Growth Regulators In Tomato (Solanum lycopersicum Mill.). Journal of Animal and

Plant Sciences., 25(2).


247


Shah, Sabir Hussain, Ali, S., Hussain, Z., Jan, S. A., Jalal-ud-Din, & Ali, G. M. (2016).

Genetic improvement of tomato (Solanum lycopersicum) with AtDREB1A gene for

cold stress tolerance using optimized agrobacterium-mediated transformation

system. International Journal of Agriculture & Biology., 18(3), 471–482.

Shakoor, A., Sabri, M., Afzal, M., & Bashir, M. (2010). Role of plant morphological

characters towards resistance of some cultivars of tomato against phytophagous

mites (Acari) under greenhouse conditions. Pakistan Journal of Life and Social

SciencesPak J Life Soc Sci., 8(2), 131–136.

Sheeja, T. E., & Mandal, A. B. (2003). In vitro flowering and fruiting in tomato

(Lycopersicon esculentum Mill.). Asia-Pacific Journal of Molecular Biology and

Biotechnology. , 11(1), 37–42.

Shinozaki, K., & Yamaguchi-Shinozaki, K. (2006). Gene networks involved in drought

stress response and tolerance. Journal of Experimental Botany,, 58(2), 221–227.

Shinozaki, Kazuo, & Yamaguchi-Shinozaki, K. (2007). Gene networks involved in

drought stress response and tolerance. Journal of Experimental Botany. , 58(2), 221–

227.

Simons, J. L., Napoli, C. A., Janssen, B. J., Plummer, K. M., & Snowden, K. C. (2007).

Analysis of the DECREASED APICAL DOMINANCE Genes of Petunia in the

Control of Axillary Branching. Plant Physiology. , 143(2), 697–706.

Snowden, K. C., Simkin, A. J., Janssen, B. J., Templeton, K. R., Loucas, H. M., Simons,

J. L., Klee, H. J. (2005). The Decreased apical dominance1/Petunia hybrida

Carotenoid Cleavage Dioxygenase8 gene affects branch production and plays a role

in leaf senescence, root growth, and flower development. The Plant Cell., 17(3),

746–759.


248


Sofiari, E., Raemakers, C. J. J. M., Kanju, E., Danso, K., van Lammeren, A. M., Jacobsen,

E., & Visser, R. G. F. (1997). Comparison of NAA and 2,4-D induced somatic

embryogenesis in Cassava. Plant Cell, Tissue and Organ Culture., 50(1), 45–56.

Sofo, A., Scopa, A., Nuzzaci, M., & Vitti, A. (2015). Ascorbate peroxidase and catalase

activities and their genetic regulation in plants subjected to drought and salinity

stresses. International Journal of Molecular Sciences., 16(6), 13561–13578.

Sorefan, K., Booker, J., Haurogné, K., Goussot, M., Bainbridge, K., Foo, E., Leyser, O.

(2003). MAX4 and RMS1 are orthologous dioxygenase-like genes that regulate

shoot branching in Arabidopsis and pea. Genes & Development., 17(12), 1469–1474.

Soto, M. J., Fernández-Aparicio, M., Castellanos-Morales, V., García-Garrido, J. M.,

Ocampo, J. A., Delgado, M. J., & Vierheilig, H. (2010). First indications for the

involvement of strigolactones on nodule formation in alfalfa (Medicago sativa). Soil

Biology and Biochemistry., 2(42), 383-385

Sreenivasulu, N., Harshavardhan, V. T., Govind, G., Seiler, C., & Kohli, A. (2012).

Contrapuntal role of ABA: Does it mediate stress tolerance or plant growth

retardation under long-term drought stress? Gene., 506(2), 265–273.

Stirnberg, P., Furner, I. J., & Ottoline Leyser, H. M. (2007). MAX2 participates in an SCF

complex which acts locally at the node to suppress shoot branching. The Plant

Journal., 50(1), 80–94.

Stirnberg, P., van De Sande, K., & Leyser, H. M. O. (2002). MAX1 and MAX2 control

shoot lateral branching in Arabidopsis. Development (Cambridge, England)., 129(5),

1131–1141.

Sun, H. J., Uchii, S., Watanabe, S., & Ezura, H. (2006). A highly efficient transformation

protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant Cell

Physiol. , 47(3), 426–431.


249


Sun, S., Kang, X. P., Xing, X. J., Xu, X. Y., Cheng, J., Zheng, S. W., & Xing, G. M.

(2015). Agrobacterium-mediated transformation of tomato (Lycopersicon

esculentum L. cv. Hezuo 908) with improved efficiency. Biotechnology and

Biotechnological Equipment., 29(5), 861–868.

Sun, W.-H., Duan, M., Li, F., Shu, D.-F., Yang, S., & Meng, Q.-W. (2010).

Overexpression of tomato tAPX gene in tobacco improves tolerance to high or low

temperature stress. Biologia Plantarum., 54(4), 614–620.

Tai, Z., Yin, X., Fang, Z., Shi, G., Lou, L., & Cai, Q. (2017). Exogenous GR24 Alleviates

Cadmium Toxicity by Reducing Cadmium Uptake in Switchgrass (Panicum

virgatum) Seedlings. International Journal of Environmental Research and Public

Health., 14(852).

Toh, S., Holbrook-Smith, D., Stogios, P. J., Onopriyenko, O., Lumba, S., Tsuchiya, Y.,

McCourt, P. (2015). Structure-function analysis identifies highly sensitive

strigolactone receptors in Striga. Science., 350(6257), 203–207.

Tomato Genome Consortium, S., Albiero, A., Aoki, K., Asamizu, E., Bogden, R.,

Bombarely, A., Xu, X. (2012). The tomato genome sequence provides insights into

fleshy fruit evolution. Nature., 485(7400), 635–641.

Tomato Genome Consortium. (2012). The tomato genome sequence provides insights into

fleshy fruit evolution. Nature., 485(7400), 635–641.

Torres-Vera, R., García, J. M., Pozo, M. J., & López-Ráez, J. A. (2014). Do strigolactones

contribute to plant defence? Molecular Plant Pathology., 15(2), 211–216.

Trujillo-Moya, C., Peiró, R., & Gisbert, C. (2014). Leaf morphology and shoot

regeneration of in vitro cultured explants from species of the solanum peruvianum

s.l. complex. Turkish Journal of Botany., 38(3), 465–476.


250


Tsuchiya, Y., Vidaurre, D., Toh, S., Hanada, A., Nambara, E., Kamiya, Y., McCourt, P.

(2010). A small-molecule screen identifies new functions for the plant hormone

strigolactone. Nature Chemical Biology., 6(10), 741–749.

Umehara, M., Hanada, A., Magome, H., Takeda-Kamiya, N., & Yamaguchi, S. (2010).

Contribution of strigolactones to the inhibition of tiller bud outgrowth under

phosphate deficiency in rice. Plant and Cell Physiology. , 51(7), 1118–1126.

Umehara, M., Hanada, A., Yoshida, S., Akiyama, K., Arite, T., Takeda-Kamiya, N.,

Yamaguchi, S. (2008). Inhibition of shoot branching by new terpenoid plant

hormones. Nature , 455(7210), 195–200.

Umezawa, T., Fujita, M., Fujita, Y., Yamaguchi-Shinozaki, K., & Shinozaki, K. (2006).

Engineering drought tolerance in plants: discovering and tailoring genes to unlock

the future. Current Opinion in Biotechnology., 17(2), 113–122.

Velcheva, M., Faltin, Z., Flaishman, M., Eshdat, Y., & Perl, A. (2005). A liquid culture

system for Agrobacterium-mediated transformation of tomato (Lycopersicon

esculentum L. Mill.). Plant Science., 168(1), 121–130.

Verslues, P. E., & Zhu, J.-K. (2005). Before and beyond ABA: upstream sensing and

internal signals that determine ABA accumulation and response under abiotic stress.

Biochemical Society Transactions., 33(2).

Victor, J. M. R., Murthy, B. N. S., Murch, S. J., KrishnaRaj, S., & Saxena, P. K. (1999).

Role of endogenous purine metabolism in thidiazuron-induced somatic

embryogenesis of peanut (Arachis hypogaea L.). Plant Growth Regulation., 28(1),

41–47.

Visentin, I., Vitali, M., Ferrero, M., Zhang, Y., Ruyter-Spira, C., Novák, O., Cardinale, F.

(2016). Low levels of strigolactones in roots as a component of the systemic signal

of drought stress in tomato. New Phytologist., 212(4), 954–963.


251


Vogel, J. T., Walter, M. H., Giavalisco, P., Lytovchenko, A., Kohlen, W., Charnikhova,

T., Klee, H. J. (2010). SlCCD7 controls strigolactone biosynthesis, shoot branching

and mycorrhiza-induced apocarotenoid formation in tomato. Plant Journal., 61(2),

300–311.

Vurro, M., Prandi, C., & Baroccio, F. (2016). Strigolactones: how far is their commercial

use for agricultural purposes? Pest Management Science., 72(11), 2026–2034.

Wang, W., Vinocur, B., & Altman, A. (2003b). Plant responses to drought, salinity and

extreme temperatures: towards genetic engineering for stress tolerance. Planta.,

218(1), 1–14.

Wang, Y., Sun, S., Zhu, W., Jia, K., Yang, H., & Wang, X. (2013). Strigolactone/MAX2-

induced degradation of brassinosteroid transcriptional effector BES1 regulates shoot

branching. Developmental Cell., 27(6), 681–688.

Wani, S. H., Kumar, V., Shriram, V., & Sah, S. K. (2016). Phytohormones and their

metabolic engineering for abiotic stress tolerance in crop plants. The Crop Journal.,

4(3), 162–176.

Waters, M. T., Nelson, D. C., Scaffidi, A., Flematti, G. R., Sun, Y. K., Dixon, K. W., &

Smith, S. M. (2012). Specialisation within the DWARF14 protein family confers

distinct responses to karrikins and strigolactones in Arabidopsis. Development.,

139(7), 1285–1295.

Waters, Mark T., Scaffidi, A., Flematti, G. R., & Smith, S. M. (2012). Karrikins force a

rethink of strigolactone mode of action. Plant Signaling & Behavior., 7(8), 969–972.

Wayase, U. R., & Shitole, M. G. (2014). Effect of Plant Growth Regulators on

Organogenesis in Tomato (Lycopersicon esculentum Mill .) cv . Dhanashri, Int. J.

Pure Appl. Sci. Technol., 20(2), 65–71.


252


Wei, T., Deng, K., Zhang, Q., Gao, Y., Liu, Y., Yang, M., Zhang, Y. (2017). Modulating

AtDREB1C Expression Improves Drought Tolerance in Salvia miltiorrhiza.

Frontiers in Plant Science., 8.

Weigel, D., & Glazebrook, J. (2006). Transformation of agrobacterium using the freeze-

thaw method. Cold Spring Harbor ProtocolsCSH Protocols., 2006(7).

Wellburn, A. R. (1994). The Spectral Determination of Chlorophylls a and b, as well as

Total Carotenoids, Using Various Solvents with Spectrophotometers of Different

Resolution. Journal of Plant Physiology., 144(3), 307–313.

Wilkinson, S., & Davies, W. J. (2002). ABA-based chemical signalling: the co-ordination

of responses to stress in plants. Plant, Cell and Environment., 25(2), 195–210.

Wilkinson, Sally. (1999). PH as a stress signal. Journal of Plant Growth RegulationJ.

Plant Growth Regul., 28, 87–99.

Wimmer, E. A. (2003). Innovations: Applications of insect transgenesis. Nature Reviews

Genetics. 4(3), 225–232.

Wing, R., Zhang, H.-B., & Tanksley, S. (1994). Map-based cloning in crop plants. Tomato

as a model system: I. Genetic and physical mapping of jointless. MGG Molecular &

General Genetics. 242(6), 681–688.

Wroblewski, T., Tomczak, A., & Michelmore, R. (2005). Optimization of Agrobacterium-

mediated transient assays of gene expression in lettuce, tomato and Arabidopsis.

Plant Biotechnology Journal. 3(2), 259–273.

Wu, Y. F., Chen, Y., Liang, X. M., & Wang, X. Z. (2006). An experimental assessment

of the factors influencing Agrobacterium-mediated transformation in tomato.

Russian Journal of Plant Physiology. 53(2), 252–256.


253


Wujeska, A., Bossinger, G., & Tausz, M. (2013). Responses of foliar antioxidative and

photoprotective defence systems of trees to drought: a meta-analysis. Tree

Physiology. 33(10), 1018–1029.

Xie, X., Yoneyama, K. K., & Yoneyama, K. K. (2010). The Strigolactone Story. Annual

Review of Phytopathology, 48(1), 93–117.

Xie, X., Yoneyama, K., Kisugi, T., Uchida, K., Ito, S., Akiyama, K., Yoneyama, K.

(2013). Confirming stereochemical structures of strigolactones produced by rice and

tobacco. Molecular Plant. 6(1), 153–163.

Xiong, L., Schumaker, K. S., & Zhu, J.-K. (2002). Cell Signaling during Cold, Drought,

and Salt Stress. PLANT CELL. 14(suppl_1), S165-183.

Xu, Kedong, Chang, Y., Liu, K., Wang, F., Liu, Z., Zhang, T., Li, C. (2014). Regeneration

of Solanum nigrum by Somatic Embryogenesis, Involving Frog Egg-Like Body, a

Novel Structure. PLoS ONE. 9(6), e98672.

Xu, Ke-dong, Chang, Y., Zhang, J., Wang, P., Wu, J., Li, Y., Li, C. (2015). A Lower pH

Value Benefits Regeneration of Trichosanthes kirilowii by Somatic Embryogenesis,

Involving Rhizoid Tubers (RTBs), a Novel Structure. Scientific Reports. 5(1), 8823.

Xu, Kedong, Chang, Y., Zhang, Y., Liu, K., Zhang, J., Wang, W., Li, C. (2016). Rorippa

indica Regeneration via Somatic Embryogenesis Involving Frog Egg-like Bodies

Efficiently Induced by the Synergy of Salt and Drought Stresses. Scientific Reports.

6, 19811.

Yang, L., Li, Y., & Shen, H. (2012). Somatic embryogenesis and plant regeneration from

immature zygotic embryo cultures of mountain ash (Sorbus pohuashanensis). Plant

Cell, Tissue and Organ Culture. 109(3), 547–556.

Yang, X., Lü, J., da Silva, J. A. T., & Ma, G. (2012). Somatic embryogenesis and shoot

organogenesis from leaf explants of Primulina tabacum. Plant Cell, Tissue and

Organ Culture (PCTOC). 109(2), 213–221.


254


Yao, R., Ming, Z., Yan, L., Li, S., Wang, F., Ma, S., Xie, D. (2016). DWARF14 is a non-

canonical hormone receptor for strigolactone. Nature. 536(7617), 469–473.

Yasmeen, A. (2009). An improved protocol for the regeneration and transformation of

tomato (cv Rio Grande). Acta Physiologiae Plantarum. 31(6), 1271–1277.

Yoneyama, K. K., Xie, X., Kim, H. Il, Kisugi, T., Nomura, T., Sekimoto, H., Yoneyama,

K. K. (2012). How do nitrogen and phosphorus deficiencies affect strigolactone

production and exudation? Planta. 235(6).

Yoneyama, K., Xie, X., Kisugi, T., Nomura, T., & Yoneyama, K. (2013). Nitrogen and

phosphorus fertilization negatively affect strigolactone production and exudation in

sorghum. Planta. 238(5), 885–894.

Yuan, G.-F., Jia, C.-G., Li, Z., Sun, B., Zhang, L.-P., Liu, N., & Wang, Q.-M. (2010).

Effect of brassinosteroids on drought resistance and abscisic acid concentration in

tomato under water stress. Scientia Horticulturae. 126(2), 103–108.

Zamir, Dani. (2001). Improving plant breeding with exotic genetic libraries. Nature

Reviews Genetics. 2(12), 983–989.

Zamir, Daniel, Jones, R. A., & Kedar, N. (1980). Anther culture of male-sterile tomato

(Lycopersicon esculentum mill.) mutants. Plant Science Letters. 17(3), 353–361.

Zeevaart, J. A. D., & Creelman, R. A. (1988). Metabolism and Physiology of Abscisic

Acid. Annual Review of Plant Physiology and Plant Molecular Biology. 39(1), 439–

473.

Zhang, H.-X. X., & Blumwald, E. (2001). Transgenic salt-tolerant tomato plants

accumulate salt in foliage but not in fruit. Nature Biotechnology. 19(8), 765–768.

Zhang, Xiaohui, Zou, Z., Gong, P., Zhang, J., Ziaf, K., Li, H., Ye, Z. (2011). Over-

expression of microRNA169 confers enhanced drought tolerance to tomato.

Biotechnology Letters. 33(2), 403–409.


255


Zhang, Xingliang, Jiang, L., Wang, G., Yu, L., Zhang, Q., Xin, Q., Chen, Z. (2013).

Structural Insights into the Abscisic Acid Stereospecificity by the ABA Receptors

PYR/PYL/RCAR. PLoS ONE. 8(7), e67477.

Zhang, Y., Haider, I., Ruyter-Spira, C., & Bouwmeester, H. J. (2013). Strigolactone

Biosynthesis and Biology. Molecular Microbial Ecology of the Rhizosphere. 1, 355–

371.

Zhang, Y., Ruyter-Spira, C., & Bouwmeester, H. J. (2015). Engineering the plant

rhizosphere. Current Opinion in Biotechnology. 32, 136–142.

Zhao, J., Wang, T., Wang, M., Liu, Y., Yuan, S., Gao, Y., Li, X. (2014). DWARF3

participates in an SCF complex and associates with DWARF14 to suppress rice shoot

branching. Plant & Cell Physiology. 55(6), 1096–1109.

Zhao, L.-H., Zhou, X. E., Wu, Z.-S., Yi, W., Xu, Y., Li, S., Xu, H. E. (2013). Crystal

structures of two phytohormone signal-transducing α/β hydrolases: karrikin-

signaling KAI2 and strigolactone-signaling DWARF14. Cell Research. 23(3), 436–

439. 9

Zhao, L.-H., Zhou, X. E., Yi, W., Wu, Z., Liu, Y., Kang, Y., Xu, H. E. (2015).

Destabilization of strigolactone receptor DWARF14 by binding of ligand and E3-

ligase signaling effector DWARF3. Cell Research. 25(11), 1219–1236.

Zheng, K., Wang, X., Weighill, D. A., Guo, H. B., Xie, M., Yang, Y., Chen, J. G. (2016).

Characterization of DWARF14 Genes in Populus. Scientific Reports. 6, 21593.

Zhou, F., Lin, Q., Zhu, L., Ren, Y., Zhou, K., Shabek, N., Wan, J. (2013). D14–SCFD3-

dependent degradation of D53 regulates strigolactone signalling. Nature. 504(7480),

406–410.

Zhu, M., Chen, G., Dong, T., Wang, L., Zhang, J., Zhao, Z., & Hu, Z. (2015). SlDEAD31,

a Putative DEAD-Box RNA Helicase Gene, Regulates Salt and Drought Tolerance

and Stress-Related Genes in Tomato. PLOS ONE. 10(8), e0133849.


256


Ziska, L. H., Tomecek, M. B., & Gealy, D. R. (2010). Competitive Interactions between

Cultivated and Red Rice as a Function of Recent and Projected Increases in

Atmospheric Carbon Dioxide. Agronomy Journal. 102(1), 118.

Zwanenburg, B., & Mwakaboko, A. S. (2011). Strigolactone analogues and mimics

derived from phthalimide, saccharine, p-tolylmalondialdehyde, benzoic and salicylic

acid as scaffolds. Bioorganic & Medicinal Chemistry. 19(24), 7394–7400.

Zwanenburg, B., & Pospíšil, T. (2013). Structure and Activity of Strigolactones: New

Plant Hormones with a Rich Future. Molecular Plant. 6(1), 38–62.

Zwanenburg, B., Mwakaboko, A. S., Reizelman, A., Anilkumar, G., & Sethumadhavan,

D. (2009). Structure and function of natural and synthetic signallingmolecules in

parasitic weed germination. Pest Management Science. 65(5), 478–491.

Zwanenburg, B., Nayak, S. K., Charnikhova, T. V, & Bouwmeester, H. J. (2013). New

strigolactone mimics: structure-activity relationship and mode of action as

germinating stimulants for parasitic weeds. Bioorganic & Medicinal Chemistry

Letters. 23(18), 5182–5186.

Appendices

257

APPENDIX- I

Media formulations

Shoot Elongation media (SEM)

Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L.

Sucrose= (20 g/L).

Plant agar= (8 g/L).

NAA=0.1 mg/L.

BAP=3 mg/L

pH before autoclaving=5.8.

Autoclaved=121oC for 40 min

Co-cultivation media

Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L

Sucrose= 20 g/L

Plant agar= 8 g/L

Acetosyringone=200 Mm.

IAA=2 mg/L.

NAA=2 mg/L.

BAP=2 mg/L.

Kin=4 mg/L.



Selection and shoot induction Media Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L

Sucrose= 20 g/L

Plant agar= 8 g/L

BAP=3 mg/L.

NAA=2 mg/L



Cooled to Room Temperature and add .Kanamycinkanamycin 50mg/L and Ticarcillin 600

mg/L

Root Induction Media (RIM) Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L

Sucrose= 20 g/L Plant agar= 8 g/L

NAA=0.2 mg/L.


Formatted: Left: 1.56", Right: 1", Width: 8.5", Height:

11"

Appendices

258


Rhizoids induction medium Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L

Sucrose= (20 g/L).

Plant agar= (8 g/L)

NAA=2 mg/L.



Rhizoid Tubers induction Medium Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L

Sucrose= (20 g/L).

Plant agar= (8 g/L).

TDZ=5 mg/L.

pH before autoclaving=4.0


LB (Luria-Bertani) medium/plates (E. coli) Bacto-tryptone=10 g/L

Bacto-yeast extract= 5 g/L

Sodium chloride=10 g/L

pH = 7.0 ± 0.2

Agar = 15 g/L for plates only

LB (Luria-Bertani) medium (Agrobacterium) Bacto-tryptone

=10 g/L

Bacto-yeast extract= 5 g/L

Sodium chloride=5 g/L

pH = 7.0 ± 0.2

Yeast Extract Peptone solid medium (YEP-selection)

Bacto-yeast extract =10 g/L

Bacto peptone= 10g/L

NaCl= 5g/L

Bacto agar= 15g/L dissolved in distilled water.

pH = 7.0 ± 0.2

Supplemented with Kan=50 mg/L.

rRifampicin (Rif) = 25 mg/L

SOC medium

Appendices

259

Bacto Tryptone= 20 g/L

Bacto Yeast extract = 5 g/L

NaCl = 0.5 g/L

KCL =10Ml (250mM)

pH before autoclaving=7.0


Post autoclave 20 mM of filter sterilized glucose and 10 Mm MgCl2 is added.

IPTG/XGAL/Amp plates

20 mg/ml X-Gal solution was dissolved in DMSO and aliquots were stored at -20°C. 100

stock of IPTG solution in dH2O. LB agar was made with Bacto-tryptone=10 g/L, Bacto-

yeast extract= 5 g/L, Sodium chloride=5 g/L and 15g/L Bacto-agar. Media is autoclaved

and cooled to 60 °C. 50 mg/L ampicillin was added and about 25 mL poured into sterile

plastic plates. 40 μL of the X-Gal Solution (20 mg/mL) and 40 μL of 100 mM IPTG

Solution was added. Spread evenly on the plate with a sterile spatula.

Appendices

260

APPENDIX- II

Plant Growth Regulators Stock Preparation

Hormone MW Milligram in

1 µM

Milligram in

2 µM

Milligram in 4

µM

1 mg in

µM

BAP 225 0.225 0.45 0.9 4.44

KINETIN 215 0.215 0.43 0.86 4.65

TDZ 220 0.22 0.44 0.88 4.55

Zeatin 219 0.219 0.44 0.88 4.55

IAA 175 0.175 0.35 0.7 5.71

IBA 203 0.203 0.4 0.8 4.92

NAA 186 0.186 0.37 0.74 5.37

2,4 D 221 0.221 0.44 0.88 4.55

GA3 346 0.346 0.73 1.46 2.89

Equivalent molar concentrations of PGRs used in the study

Benzyl aminopurine (BAP)

A stock of 1000 ppm (1mg/mL) Benzyl aminopurine (BAP) was prepared by weighing

0.025 g BAP and first dissolved it in few drops of NaOH then the final volume was

adjusted to 25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and

aliquots were made in 1.5 mL Eppendorf stored at 4oC.

Kinetin

A stock of 1000 ppm (1mg/mL) Kinetin (Kin) was prepared by weighing 0.025 g KIN

powder and first dissolved it in few drops of NaOH then the final volume was adjusted to

25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and aliquots were

made in 1.5 mL Eppendorf stored at 4oC.

Indole Acetic Acid (IAA)

A stock of 1000 ppm (1mg/mL) Indole Acetic Acid (IAA) was prepared by weighing

0.025 g IAA and first dissolving it in few drops of NaOH then the final volume was

adjusted to 25 mL with autoclaved distilled water..0.2 µm syringe filter were used and

aliquots were made in 1.5 mL Eppendorf. Stored at 4oC.

Naphthalene Acetic Acid (NAA)

Appendices

261

A stock of 1000 ppm ppm (1mg/mL) Naphthalene Acetic Acid (NAA) was prepared by

dissolving 0.025g of NAA powder in few drops of NaOH then the final volume was

adjusted to 25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and

aliquots were made in 1.5 mL Eppendorf. Stored at 4oC.

Gibberelic Acid (GA3)

A stock of 1000ppm Gibberellic Acid was prepared by dissolving 0.05 g GA3 powder in

few drops of NaOH then the final volume was adjusted to 50 mL with autoclaved distilled

water. 0.2 µm syringe filter were used and aliquots were made in 1.5 mL Eppendorf.

Stored at 4oC.

Acetosyringone A stock of 200 mM acetosyringoneAcetosyringone (Mw. 196.20 g/mol) was prepared by

dissolving 0.784 g of 3',5'-Dimethoxy-4'-hydroxyacetophenone in 12 ml 95% ethanol,

then add 8 ml of sterile milli-Q water to equal 20 ml. Filter Sterilize and store at -20°C.

Stocks for vitamins and antibiotics.

KanamycinKanamycin Stock Solution

A stock of 50 mg/L Kanamycinkanamycin was made by weighing 0.5 g of

Kanamycinkanamycin and dissolved it in autoclaved distilled water to make the final

volume of 10 mL. The solution was then aliquoted in 1.5 mL tubes after filter sterilization

with 0.2 µm syringe filter 0.2 µm stored at 4C.

Rifampicin Stock Solution

A stock of 25 mg/L rifampicin (rif) was made by weighing 0.25 g of rifampicin and

dissolved it in 5 mL DMSO (Dimethyl Sulfoxide). Final volume of solution was adjusted

to 10 mL. The solution was then aliquoted in 1.5 mL tubes after filter sterilization with

syringe and 0.2µm filter and stored at -20°C.

Ampicillin Stock solution

A stock of 100 mg/L ampicillin (Amp) was made by weighing 0.5 g antibiotic powder in

5 ml of milli-Q water. The solution was then aliquoted in 1.5 mL tubes after filter

sterilization with 0.2 µm syringe filter 0.2 µm stored at 4C.

Cefotaxime/ Timentin/Augmentin

A stock of 600 mg/L cefotaxime was prepared by weighing 1.2 g of

cefotaxime/timentin/augmentin powder salt and dissolved it in 2 mL of autoclaved

distilled water with 2 drops of pure ethanol. The solution was then aliquoted in 1.5 mL

tubes after filter sterilization with 0.2 µm syringe filter 0.2 µm stored at 4C.

GUS staining solutions

Sodium Phosphate buffer

Appendices

262

A stock of 5 mM sodium phosphate buffer was prepared by weighing 81.97 mg and

dissolving it in distilled water. The pH of solution was adjusted to 7.0 before autoclaving

then stored at 4oC.

Ethylene-diamine-tetra-acetic Acid (EDTA)

A stock of 0.5 M EDTA was prepared by weighing 186.1 g of EDTA and dissolving it in

800 mL of distilled water by stirring vigorously on magnetic stirrer. 5 g of NaOH pellets

were added while dissolving the salt. Once pH reaches 8.0 solution becomes clear and

subsequently autoclaved.

10% Triton X

A stock of 10% triton X was prepared by dissolving 45 mL autoclaved distilled water into

5 mL of absolute triton X.

5-Bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc)

A stock of 25 mg/ mL (2 mM) was prepared by weighing 25mg of X-gluc salt and

dissolving it in 1 mL of Dimethyl Sulfoxide (DMSO). The solution was then filter sterilize

and aliquoted in in 1.5 mL Eppendorf tube.

Ethidium bromide staining solution

Concentrated stock of 10 mg/ml was prepared by dissolving 0.2 g ethidium bromide in 20

ml miliQ H2O. Mixed well and store at 4°C in dark or in a foil-wrapped bottle. Do not

sterilize.

TE (Tris/EDTA) buffer

10 mM Tris⋅Cl, pH 8.0

1 mM EDTA, pH 8.0

Store up to 6 months at room temperature

Tris⋅Cl, 1 M

1M stock was prepared by dissolving 121 g Tris base in 800 ml H2O. Adjust to desired pH with

concentrated HCl and adjust volume to 1 liter with H2O

Appendices

263

APPENDIX- III

Chemical stability of lactams as described in Figure 2, in MeOH and Acetonitrile/water

respectively 21˚C (pH 6.7).

640

650

660

670

680

690

700

710

720

730

740

0 5 10 15 20 25 30 35 40

Pea

k ar

ea a

t 25

4 n

m

Time (hours)

Chemical stability of rac Mimic-D-Lactam NBoc

30% MeOH Acetonile/water 1/1

Appendices

264

APPENDIX- IV

Gallic acid solution (100 μg/ml): 10 mg of gallic acid was dissolved in 100 ml of methanol in

volumetric flask.

y = 0.0096x + 0.3751

R² = 0.9316

0

0.5

1

1.5

2

2.5

0 50 100 150 200 250

Ab

sorb

ance

(nm

)

Concentration GA (ug/ml)

Appendices

265

APPENDIX- V

Standard curve of Quercetin solution (1000 μg/ml): 1000 μg/ml stock solution was prepared

by dissolving 100 mg of quercetin in 100 ml of absolute methanol.

Appendices

266

APPENDIX- VI

Standard curve of Ascorbic acid stock solution 1000μg/ml: Ascorbic acid was prepared in

distilled water of different concentration such as 60, 120, 180, 240, 300, 360, 420, 480 μg/ml.

y = 0.0016x + 0.0023

R² = 0.9905

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

0 100 200 300 400 500 600

Ab

sorb

ance

(nm

)

Concentration (ug/ml)

Appendices

i

Formatted: Left: 1.56", Right: 1", Section start: New

page, Width: 8.5", Height: 11"

Appendices

2

Formatted: Left: 1.56", Right: 1"

Documents

COMSATS University Islamabad Pakistan