QuickTime™ and aYUV420 codec decompressor

are needed to see this picture.

QuickTime™ and aYUV420 codec decompressor

are needed to see this picture.

QuickTime™ and aYUV420 codec decompressor

are needed to see this picture.

Computational Biology

The Potts Model effectively models many complex behaviours of biological systems, from cell sorting and chemotaxis to various lifecycle stages of Dictyostelium and chicken limb development.

ft CAAjijiJH μλτστσσσ

+−+=∑ 2

',

)()]',','('),,,([

In-vivoIn-vivo In-SilicoIn-Silico

Using the Potts Model, a statistical mechanics simulation technique based on cellular automata, scientists develop in-silico computational models based on in-vivo observations about developmental processes. The OSL researches high-performance software and visualization systems used for Potts Model simulations.

// Acceptance based on probabilitydouble prob = acceptanceFunction->accept(temp, change);if (prob >= 1 || rand->getRatio() < prob) { // Accept the change energy += change; cellField->set(neighbor, cell); flips++;}

Bioinformatics

QuickTime™ and aTIFF (LZW) decompressor

are needed to see this picture.

Process Ideal Speedup Real Speedup Ideal/Real Throughput

SIMD 8.3x 9.7x 75%

Thread 15x 18.1x 77%

Thread (large data)

13.3 21.2 85%

void GenomeCompare(unsigned char *data, long len, unsigned char *result){ // “Diagnol” sum of all the values in data long i = 0; vector unsigned char score, score1, score2, vperm, newsum; newsum = vec_splat_u8(0); // create a constant for(i = 0; i < len - 16; i++) { // Load each vector if((i & 0x0000000f) == 0) { // aligned case score = vec_ld(0, &(data[i])); } newsum = vec_add(score, newsum); } vec_st(newsum, 0, result); // aligned store return;}

E-Coli …AGGATGACCAGATAGGAGTGACCGATTACCGGATAGC…

Human …AGGATGACCAGATAGGAGTGACCGATTACCGGATAGC…

Rat …AGGATGACCAGATAGGAGTGACCGATTACGGGATAGC…

Salamander …AGGATGACCAGATAGGAGTGACCGATTA---GATAGC…

Vector processors in modern computers enable the direct comparison of large genomes. However, obtaining the results is only the first challenge. Presenting the results in a meaningful way to scientists is difficult.

This research focuses on:• Studying the use of high-performance techniques on common bioinformatics algorithms• Using large format display walls and high-resolution (> 200 dpi) displays to present the results • Developing techniques for abstracting vector and cluster level parallelism to make these techniques accessible to scientists

Large genomes are compared using multiple vector processors

The results are rendered to high-resolution formats

Dictyostelium Simulation