Complete List of Authors: Đspirli, Hümeyra; Bayburt ...(Fontana et al. 2015) using a thermal cycler (Benchmark, TC9639). PCR products were run on a gel to check the amplicon size

Draft

Characterization of functional properties of Enteroccoccus

feacium strains isolated from human gut

Journal: Canadian Journal of Microbiology

Manuscript ID cjm-2015-0446.R2

Manuscript Type: Article

Date Submitted by the Author: 11-Sep-2015

Complete List of Authors: Đspirli, Hümeyra; Bayburt University Demirbaş, Fatmanur ; Bayburt University Dertli, Enes; Bayburt University, Department of Food Engineering

Keyword: Gut bacteria, Enterococcus faecium, probiotic, virulence determinants, antibiotic resistance

https://mc06.manuscriptcentral.com/cjm-pubs

Canadian Journal of Microbiology

Draft

1

Characterization of functional properties of Enteroccoccus feacium strains

isolated from human gut

Hümeyra Đspirli, Fatmanur Demirbaş and Enes Dertli *

Department of Food Engineering, Faculty of Engineering, Bayburt University, Bayburt,

Turkey

* Enes Dertli, Department of Food Engineering, Faculty of Engineering, Bayburt University,

Bayburt, 69000, Turkey Tel: +90 (0) 458 2111153, Fax: +90 (0) 458 2111172, Email:

[email protected]

Page 1 of 29



Draft

2

Abstract

The aim of this work was to characterize the functional properties of Enterococcus faecium

strains identified after isolation from human faeces. Of these isolates strain R13 showed the

best resistance to low pH, bile salts and survival in the simulated in vitro digestion assay and

demonstrated an important level of adhesion to hexadecane as a potential probiotic candidate.

Analysis of the antibiotic resistance of E. faecium strains indicated that in general these

isolates were sensitive to the tested antibiotics and no strain appeared to be resistant to

vancomycin. Examination of the virulence determinants for E. faecium strains demonstrated

that all strains contained the virulence genes common in gut and food originated enterococci

and strain R13 harboured the lowest number of virulence genes. Additionally no strain

contained the genes related with the cytolysin metabolism and showed hemolytic activity.

The antimicrobial role of E. faecium strains were tested against several pathogens in which

different levels of inhibitory effects were observed and strain R13 was inhibitory to all tested

pathogens. The PCR screening of genes encoding enterocin A and B indicated the presence

of these genes in E. faecium strains. Preliminary characterization of bacteriocins revealed that

their activity was lost after proteolytic enzyme treatments but no alteration in antimicrobial

activity was observed at different pHs (3.5 to 9.5) and after heat treatments. In conclusion this

study revealed the functional characteristics of E. faecium R13 as a gut isolate and this strain

could be developed as a new probiotic after further tests.

Keywords: Gut bacteria, Enterococcus faecium, probiotic, virulence determinants, antibiotic

resistance,

Page 2 of 29



Draft

3

Introduction

Besides their role in environmental, clinical and food microbiology, Enterococci that are

members of lactic acid bacteria (LAB), are regular residents of GI (gastrointestinal) tract of

humans and animals (Pieniz et al. 2014). This advances their potential as being probiotics that

are live microorganisms which when administered in adequate amounts confer a health

benefit to the host (Nueno-Palop and Narbad 2011). Importantly several Enterococcus strains

were used as probiotics that might improve intestinal health and decrease the serum

cholesterol levels (Giraffa 2003; Hlivak et al. 2005).

Selection of probiotics depends on the essential characteristics that probiotics fulfil which

include the ability to survive under harsh environment of GI tract such as low pH, acid, bile

and gastric conditions and their adhesion capacity (Dunne et al. 2001). Additionally antibiotic

resistance and production of antimicrobial substances are also important for selection of

probiotics from safety and functional perspective of view, respectively (Ogier and Serror

2008). Several studies showed the probiotic potentials of both food and human originated

enterococci including Enterococcus faecium strains (Bhardwaj et al. 2010; Nueno-Palop and

Narbad 2011; Pieniz et al. 2014) and enterococci are also well know for the production of

enterocins that are a class of bacteriocins which can be able to inhibit the growth of

pathogenic organisms (Franz et al. 2007). But the presences of clinical enterococcal species

that may have pathogenic effects require not only determination of antibiotic resistance

profile but also the assessment of virulence genes of enterococci (Nueno-Palop and Narbad

2011). Additionally there is not a clear discrimination of pathogenic and safe enterococcal

strains and the latter might harbour virulence factors (Eaton and Gasson 2001). Several

virulence determinants in enterococci have been described so far that include cylA and cylB

which are associated with activation and transport of cytolysin, respectively and cytolysin

lyses the eukaryotic cells; agg related with aggregation that results in adherence to eukaryotic

cells; esp encoding a gene of a cell wall-associated protein involved in immune evasion;

efaAfs and efaAfm that encode adhesins expressed in serum by Enterococcus faecalis and

Enterococcus faecium respectively; cob and gelE which facilitates conjugation and

hydrolyzes gelatine, collagen and other bioactive compounds, respectively (Eaton and Gasson

2001; Nueno-Palop and Narbad 2011). In this study, we report the characterization of

functional characteristics of Enterococcus faecium strains isolated from human gut and

assessment of their safety. Results of this study revealed the potential of E. faecium R13 to be

further tested as a probiotic candidate strain.

Page 3 of 29



Draft

4

Materials and Methods

Isolation of gut bacteria

Two healthy adults (aged 20-40) who had not been prescribed antibiotics for at least three

months prior to this study and had taken any probiotics provided the faecal samples. For the

isolation of gut bacteria, freshly collected faecal samples were suspended in Phosphate Buffer

Saline (PBS) and after homogenisation serial dilutions were performed from these

suspensions by plating to de Man, Rogosa, Sharpe (MRS) and Brain Heart Infusion (BHI)

(Merck, Germany) agars and incubation of the plates were conducted at 37oC under anaerobic

conditions for 48 h. From these plates potential different isolates were selected and further

subcultured in MRS broth and then stored at − 80 °C in glycerol (40% v/v).

Bacterial identification by 16S RNA gene sequencing

All isolates were genotypically discriminated by rep-PCR as described previously (Sagdic et

al. 2014) and selected strains were identified. The c.1.5 kb 16S rRNA gene of the selected

strains were amplified with primers AMP_F (5’-GAGAGTTTGATYCTGGCTCAG-3’) and

AMP_R (5’- AAGGAGGTGATCCARCCGCA-3’) (Baker et al. 2003). PCR reaction

mixtures contained 1 µl DNA template from Genomic DNA extracted from each strain using

a DNA isolation kit (Qiagen, Turkey), 10 µl 5× PCR buffer for Taq polymerase (Promega),

0.4 µl dNTPs (Bioline), 1 µl of 20 mM primers AMP_F and AMP_R, 0.25 µl 5U Taq

polymerase (Promega) and up to 50 µl of sterile H2O. PCR was performed using a thermal

cycler (Benchmark, TC9639) with the following programme: 95°C for 2 min, 20 cycles of

95°C for 30 s, 55°C for 20 s, and 72°C for 30 s and 72°C for 5 min final extension. PCR

products were run on a gel to check the amplication and amplicons were further purified

using SureClean kit (Bioline). Sequencing reactions were prepared using primers AMP_F/

AMP_R at 1.6 µM concentrations and the ABI Prism BigDye Terminator v3.1 Cycle

Sequence Kit (Applied Biosystems) according to the manufacturer’s protocol. Sequences

obtained were interrogated with the NCBI database using the BLAST algorithm with a

similarity criterion of 97–100%.

Resistance to low pH and bile salts

To assess resistance to low pH and bile salts, strains were grown overnight aerobically in

MRS medium and then a 1% inoculum subcultured into MRS medium as a control and MRS

medium either adjusted to pH 4 using 1M HCl or containing bile salts (Bovine bile, Sigma) at

Page 4 of 29



Draft

5

concentration of 0.3% (v/v) to obtain an OD600 of 0.1. All samples in 20 ml bottles were

incubated at 37°C unshaken and the growth of E. faecium strains were measured at OD600

over 24 h using a Spectrophotometer (PG Instruments, T60).

Survival in simulated in vitro digestion

In vitro digestion tests of E. faecium strains were performed as described previously (Nueno-

Palop and Narbad 2011). Briefly, strains were grown in MRS media overnight and harvested

by centrifugation (4000 g for 10 min at 4°C). The harvested cells were then resuspended in

PBS to obtain an OD600nm ~ 1.0 and cell counts were determined. To simulate gastric

digestion, each sample was adjusted to pH 3.0 using 1M HCl and Pepsin (Sigma) was added

to a final concentration of 5% (w/v). The mix was incubated at 37°C for 90 min with

agitation at 110 rpm. To create intestinal digestion conditions, the sample was adjusted to pH

6.0 and solutions of pancreatin (Sigma) and bile salts at a final concentration of 0.1% and

0.3% (w/v) respectively were added. Samples were incubated for 150 min at 37°C with

agitation (110 rpm) and following the final incubation cell counts were determined. An

aliquot was serially diluted before and after digestion and then plated on MRS agar in

triplicate. The plates were incubated at 37°C for 48 h. The survival percentage was calculated

by comparing cell counts before and after digestion for each strain.

Bacteriocin activity and detection of bacteriocin coding genes

For the detection of antagonistic activity with regards to bacteriocin production of E. faecium

strains, cultures were grown overnight with 1% inoculation in 10 ml MRS broth. Cells were

removed by centrifugation at 14,000 g for 5 min. The supernatant was filtered through a

sterile 0.22 µm syringe filter in order to remove all bacterial cells that may remain in the

supernatant. The pH of the filtered supernatant was adjusted to pH 6.0 with NaOH for the

elimination of possible inhibition effects organic acids following the inhibition of H2O2 with

catalase (Merck) application at 25°C for 30 min. A final filtration step was applied and the 20

µl supernatants were applied to the TSB agar plates in which the target pathogen strains were

previously spread and the antimicrobial activity was observed after 24h incubation at 37°C by

measurement of the formed inhibition zones in each strain and expressed as diameters of the

inhibition zone in mm. The bacteriocin activities were also expressed as arbitrary units (AU

ml-1) in which one AU unit was defined as the reciprocal of the highest dilution showing a

clear zone higher than 2 mm as described previously (De Kwaadsteniet et al. 2005). Six

pathogen strains; Salmonella typhimurium RSSK 95091, Escherichia coli BC 1402, Bacillus

Page 5 of 29



Draft

6

cereus BC 6830, Yersinia enterocolitica ATCC 27729 and Staphylococcus aureus ATCC

25923, Staphylococcus aureus BC 7231. All pathogens were grown with Tryptic Soy Broth

(TSB) medium under aerobic conditions at 37°C.

The presence of the genes encoding enterocin A and B was PCR detected for E. faecium

strains with primer sets entA_F (AAATATTATGGAAATGGAGTGTAT), entA_R

(GCACTTCCCTGGAATTGCTC) and entB_F (GAAAATGATCACAGAATGCCTA),

entB_R (GTTGCATTTAGAGTATACATTTG), respectively (Toit et al. 2000). DNA was

isolated from each strain and PCR conditions were performed as described previously

(Fontana et al. 2015) using a thermal cycler (Benchmark, TC9639). PCR products were run

on a gel to check the amplicon size of 126 bp and 162 bp for the presence of enterocin A and

B, respectively.

Effect of enzymes, detergents, pH and temperature on the bacteriocin activity

The supernatants of E. faecium strains R3, R5, R6 and R13 were obtained as described above

and proteinase K (Sigma), pepsin (Sigma) and catalase (Merck) were added to the

supernatants at final concentration of 1 mg/ml and following 2 h incubation the antimicrobial

activity of the supernatants were tested against all pathogens as described above. Similarly

for the determination of the effect of the detergents on bacteriocin activity of E. faecium

strains sodium dodecyl sulphate (SDS), Tween 20 and Triton X-100 were added to the

supernatants at 1% final concentration and after 5 h incubation at 37°C the antimicrobial

activities were observed as described above. The effect of pH on bacteriocin activity was

determined by adjusting the supernatants between pH 3.5 and 9.5 with sterile 1 N HCl or 1 N

NaOH. Finally effect of high temperature on bacteriocin activity was determined by heating

the supernatants at 80, 90 and 100°C for 30 min. Untreated supernatants of E. faecium strains

were applied as control in all experiments.

Microbial adhesion to hexadecane (MATH) assay

The cell surface hydrophobicity of E. faecium strains was carried out using largely following

the method described previously (Sagdic et al. 2014). Briefly, overnight grown cultures were

collected by centrifugation (8000 × g for 10 min at 4°C) and resuspended in 50 mM K2HPO4

(pH 6.5) buffer to obtain an OD590 of 1.0. The bacterial cell suspension (3 ml) was then

mixed with 0.6 ml of hexadecane (Sigma). The mixture was vortexed for 1 min and then left

undisturbed for 20 min to allow complete phase separation. After equilibration, the aqueous

Page 6 of 29



Draft

7

phase was removed carefully, in order not to disturb the interfacial equilibrium, and the

OD590 was measured. The percentage adhesion was calculated using the following equation:

% Adhesion to hexadecane = (1-A1/A0) × 100, where A0 is the initial absorbance (OD600) of

the bacterial suspension and A1 is the absorbance after 20 min of incubation.

Antibiotic susceptibility

Resistance of E. faecium strains against ampicillin (Amp, 10 µg), chloramphenicol (C, 30

µg), erythromycin (E, 15 µg), kanamycin (K, 30 µg), tetracycline hydrochloride (TE, 30 µg),

vancomycin (VA, 30 µg), Gentamicin (Cn, 10 µg), Rifampicin (Rd, 5 µg), Carbenicillin

(CAR, 100 µg), Amoxicillin (Aml, 25 µg), Oxacillin (Ox, 1 µg) and Streptomycin (S, 10 µg),

(Oxoid, UK) was determined using antibiotic disks. Each strain was activated in MRS broth

and 1% inoculum added to MRS agar at 45–50 °C and poured into plates. Then, antibiotic

disks were placed at the center of the medium and plates were incubated at 37 °C for 24–48

h. The inhibition zones around the disks if presented were measured and expressed as

centimetre (cm).

Screening of E. faecium strains for virulence determinants

The PCR screening of the Enterococcal strains for the virulence determinants was conducted

targeting specific virulence factors (Agg, gelE, cylA, cylB, esp, efaAfs, efaAfm and cob)

using the primer sets described previously (Eaton and Gasson 2001). Genomic DNA was

isolated from overnight cultures of E. faecium strains using a commercial DNA isolation kit

(Qiagen, Turkey). The Tm of each primer set was determined and PCR was performed as

described previously (Eaton and Gasson 2001).

Determination of hemolytic activity

The haemolytic activity of Enterococcus strains were determined using previously described

methodology (De Vuyst et al. 2003). Basically strains were grown overnight in MRS medium

at 37 °C, and then transferred onto BHI and Blood Agar Base (Merck) plates containing 7%

of human blood (Bayburt State Hospital, Bayburt, Turkey). The plates were incubated

overnight under aerobic and anaerobic conditions at 37 °C and formation of a clear zone of

hydrolysis, a partial hydrolysis or no reaction around colonies reflecting β hemolysis, α

hemolysis and γ hemolysis, respectively was observed for the determination of the hemolytic

activity (De Vuyst et al. 2003).

Page 7 of 29



Draft

8

Results

In this study 3 Lactobacillus paracasei, 3 L. plantarum and 3 L. casei strains were isolated

from faecal samples together with 9 Enteroccus faecium strains. The genotypic

characterization revealed the presence of 4 different E. faecium strains (R3, R5, R6 and R13)

within these isolates. The functional properties of these strains including resistance to low pH

and bile salts, survival in simulated in vitro digestion, inhibition of pathogens and presence of

bacteriocin coding genes and production of bacteriocin(s), preliminary characterization of

bacteriocin(s) adhesion, antibiotic susceptibility, presence of the virulence determinant genes

and their hemolytic activity were determined. The 16S sequences of E. faecium strains R3,

R5, R6 and R13 were deposited in GenBank under accession numbers KT119620-

KT119623, respectively.

The effect of stress conditions on cell growth of E. faecium strains was measured by growing

cells at low pH, in the presence of bile salts and in MRS broth as a control over a 24 h period

(Figure 1A-B-C). In the first half of the growth period all strains showed reduced growth

rates except strain R13 which revealed increased growth after 8 h. In the second half of the

growth period strain R3 and R5 showed similar growth rates and reached to OD600 of 1.0

(Figure 1A). Strain E6 was the most affected strain from the low pH and reached to lower OD

values compared to the other three strains tested. In general strain R13 was the least affected

strain from the low pH and showed the highest growth rate at the end of the growth period.

Similar to the low pH, E. faecium strains was also affected from the bile salts but generally a

lower growth repression was observed except stain R6 (Figure 1B). This strain showed

significantly lower growth rates compared to the other strains and after reaching to its peak

growth at 4 h no significant growth was observed. Similar to the low pH, strain R13 showed

the highest growth compared to the other strains in the presence of the bile salts (Figure 1B).

All strains showed similar levels of growth under control conditions (Figure 1C) and reached

higher OD values than the low pH and bile salts conditions showing the detrimental effects of

the conditions tested.

One of the important characteristics of probiotic bacteria is to survive during the GI tract

passage. Table 1 shows the digestion survival of E. faecium strains tested in this study. There

were clear differences among the survival of E. faecium strains and strain E13 showed the

highest resistance during simulated in vitro survival test (Table 1).

Page 8 of 29



Draft

9

Similar to the survival under harsh conditions adhesion is also important for probiotic strains

to show their functional characteristics and the hydrophobicity of E. faecium strains was

assessed using adhesion to hexadecane (Table 1). The adhesion of E. faecium strains showed

marked differences among the four strains tested and the highest adhesion was observed for

strain R3 and R6. The adhesion of strain R13 was slightly lower than these strains and the

lowest adhesion was observed for strain R5 which was nearly half of the adhesion % of the

other three strains tested (Table 1).

Antibiotic resistance of probiotics and more importantly of enterococci is an important

concern and the antibiotic resistance of gut isolate E. faecium strains was tested against 12

antibiotics (Table 2). Several different patterns were observed for the antibiotic resistance of

E. faecium strains and all strains were resistant to streptomycin. Strain R3 was resistant to

vancomycin and kanamycin and strain R5 was also resistant to vancomycin. Addition of

strain R13 was resistant to gentamycin and kanamycin and strain R6 was appeared to be

sensitive to all tested antibiotics expect streptomycin (Table 2). In general, when the tested

strains were sensitive to the tested antibiotics, similar levels of inhibition zones were

detected.

Similar to the presence of antibiotic resistance, enterococcal strains can harbour several

virulence factors which have to be determined for selection of these strains as probiotics. In

this respect, the presence of the known virulent factors in E. faecium strains was tested by the

PCR detection of the putative virulence genes in these strains (Table 3). Several different

patterns were observed for the presence of the virulence determinants in tested E. faecium

strains and all strains possessed two or more virulence determinants (Table 3). All strains

possessed efaAfm and strains R3, R5 and R6 were found to be positive for cob, agg and

efaAfs determinants. Additionally strains R5 and R6 possessed gelE and esp, respectively.

Strain R13 was only positive for gelE in addition to the efaAfm determinant (Table 3).

Another important safety aspect for the selection of probiotic strains is their hemolytic

activity (FAO/WHO 2002) and we tested the hemolytic activities of the E. faecium strains

isolated from human gut. Importantly no hemolysis of human blood (γ hemolysis) was

observed with the tested strains.

The antagonist role of probiotic strains due to the production of antimicrobial substances is an

important functional role to exclude the pathogens from the GI tract. In this respect, the role

of E. faecium strains on inhibition of pathogens was tested in this study and several different

Page 9 of 29



Draft

10

patterns were observed (Table 4A). It should be noted that strain R13 was the only strain to

show antimicrobial effects to all pathogen strains tested compared to the other E. faecium

strains in which bacteriocin(s) produced by this strains revealed a large spectrum of inhibition

and this strain had the highest inhibitory effects in all conditions except its inhibitory effect

against Staph. aureus ATCC 25923 (Table 4A). All strains were able to inhibit Staph. aureus

ATCC 25923 and S. typhimurium with varying degrees and only strain R13 showed

inhibition effect to Y.enterocolitica and B. cereus. Strain R3 and R5 were not able to inhibit

Staph. aureus BC 7231 and the level of inhibitory effect of R6 and R13 to this strain was

reduced compared to the ATCC 25923. Addition of all E. faecium strains except strain R3

showed antimicrobial effects to E. coli (Table 4A).

The antimicrobial role of Enterococcus strains is well known originating from the production

of bacteriocins and/or bacteriocin like substances by these species. The presence of the

enterocins A and B genes in the tested gut isolate E. faecium strains were evaluated by PCR

and all strains were found to be positive (data not shown) for the presence of these genes

suggesting the production of these bacteriocins. The bacteriocin activity of the E. faecium

strains were further determined using Staph. aureus and S. typhimurium as the indicator

strains as all E. faecium strains showed antimicrobial activity to these pathogens. Strain R3,

R5, R6 and R13 showed 6400, 3200, 1600 and 3200 AU/ml activity against Staph. aureus,

respectively whereas the levels of activity against S. typhimurium were detected to be 3200,

3200, 800 and 3200 AU/ml for the tested strains R3, R5, R6 and R13, respectively (Table

4B).

Table 5 shows the evaluation of the bacteriocin activities of E. feacium strains after treatment

with enzymes, detergents, different pH and high temperatures. Treatment of cell-free

supernatants of all E. feacium strains with Proteinase K and pepsin resulted in complete

inactivation of the antimicrobial activity against tested pathogens (Table 5). But no alteration

of the antimicrobial activity observed after catalase treatment, setting the pH of the

supernatant between 3.5-9.5 as well as high temperature application as 80, 90 and 100°C 30

min (Table 5).

Discussion

Enterococci is a wide group of microorganisms that can be found in different niches

including GI tract of humans (Nueno-Palop and Narbad 2011), food products especially

fermented meat and dairy products (Gomes et al. 2008; Martín-Platero et al. 2009).

Page 10 of 29



Draft

11

Enterococcal species as starter cultures have been used in dairy industry for decades and they

were also shown to act as probiotics (Eaton and Gasson 2001). However enterococcal species

also contain pathogenic strains that can be responsible for serious infections in both humans

and animals (Carlos et al. 2010) and safety assessment of enterococci with regards to

antibiotic resistance and virulence traits is crucial for selection of these strains for industrial

purposes and more importantly as probiotics (Nueno-Palop and Narbad 2011). The aim of

this study was to evaluate the functional characteristics of E. faecium strains to be selected as

potential probiotics isolated from human GI tract.

One of the main desired characteristics of probiotic bacteria in order to show their functional

roles is their survival ability in the GI tract in which low pH, bile salts and digestion

conditions are the main factors affecting this ability (Tan et al. 2013). The low pH and bile

salts resistance of E. faecium strains tested in this study was similar to that of previous

observations compared to the other enterococci (Banwo et al. 2013; Pieniz et al. 2014) and all

strains showed exponential growth from the inoculation until the end of incubation period in

which strain R13 showed better growth abilities. One of the main criteria for selection of

probiotic bacteria is their resistance to bile salts and all E. faecium strains in this study except

R6 revealed good growth rates suggesting their potentials as probiotic candidates. However

all strains showed higher growth rates under control MRS medium conditions suggesting the

growth suppression effects of the low pH and bile salt conditions.

The survival ability of bacteria during their passage through the upper digestive tract to reach

the colon where their beneficial roles are expected to be observed is crucial for their selection

as probiotics (Bezkorovainy 2001; Charteris et al. 1998). All E. faecium strains survived

under simulated digestion conditions at different levels confirming previous report suggesting

that E. faecium strains might resist to the harsh conditions originating from pepsin and

pancreatin (Hosseini et al. 2009) and the highest survival ability in this study was observed

for strain R13 as 24% although Nueno-Palop and Narbad (2011) reported higher levels of

survival for enterococci. Similar to the survival, adhesion of probiotic bacteria to the

intestinal mucosa is critical for probiotic functions, which avoids their removal from the

colon by peristalsis (Nueno-Palop and Narbad 2011) and cell surface hydrophobicity may

determine bacterial adhesion (Dertli et al. 2015). All gut isolate E. faecium strains showed

marked hydrophobicity levels except R5 suggesting their potential adhesive properties.

Previously higher (Abdhul et al. 2014) and lower hydrophobicity levels (Favaro et al. 2014;

Page 11 of 29



Draft

12

Santos et al. 2015) were reported for E. faecium strains which reveal the importance of the

strains specific properties such as cell surface structure determining the adhesion properties

One of the major concern for selection of enterococci as probiotic organism or starter culture

is high risk of antibiotic resistance in these strains due to the fact that antibiotic resistance

genes in this organisms are generally plasmid encoded or transposon associated revealing the

potential risk of horizontal gene transfer (Hasman et al. 2005). However it was noted that in

general the antibiotic resistance of the non-clinical originated enterococcal isolates displayed

lower occurrence of antibiotic resistance compared to the clinical ones (Abriouel et al. 2008).

The susceptibility of gut isolates E. faecium strains to several antibiotics was determined in

this study and several patterns were observed. Vancomycin-resistant enteroccocci (VRE) is a

major health problem worldwide (Cetinkaya et al. 2000) and E. faecium strains R3 and R5

showed resistance to this antibiotic. But more importantly, strain R13 was sensitive to

vancomycin together with strain R6. Addition of strain R13 showed resistance to three

antibiotics gentamicin, streptomycin and kanamycin in which the number of antibiotic

resistance traits was lower than previous observation found for food isolate Enterococcus

strains (Abriouel et al. 2008). Similar to our observation kanamycin and gentamicin

resistances in food and gut isolate Enterococcus strains was reported to be at high levels

(Pesavento et al. 2014; Ruiz-Moyano et al. 2009). A recent report also tested the antibiotic

susceptibility of E. faecium strain from animal origin and this strain was found to be highly

sensitive to the tested antibiotics although vancomycin resistance was observed for this strain

(Zheng et al. 2015). In another report E. faecium strains from goat’s milk were tested for their

antibiotic resistance against 50 antibiotics and a very low incidence of resistance was

observed showing the crucial role of the origin potentially affecting the transmission of

resistance (Schirru et al. 2012). Consequently, although the level of antibiotic resistance of E.

faecium strains was low in the present report, the presence of vancomycin-resistant gut isolate

E. faecium strains should be noted.

The gut isolate E. faecium strains were also tested for the presence of putative virulence

genes due to the safety considerations in this study. We found that E. faecium strains R3, R5,

R6 and R13 carry four, five, five and two virulence genes, respectively which reveals that the

number of virulence factors in these strains is low as generally enteroccocci may carry

between 6 to 11 virulence genes (Nueno-Palop and Narbad 2011). But two recent reports also

showed the non-presence of these virulence factors in food isolate E. faecium strains (Santos

et al. 2015; Zheng et al. 2015) although previously several starter and food originated

Page 12 of 29



Draft

13

Enterococci were shown to harbour some of the virulence factors suggesting the importance

the strain specific properties for carrying these virulence factors (Eaton and Gasson 2001). In

our study all strains contained adhesion factor efaAfm gene which does not represent a high

risk value in which the high incidence of this factor was also previously shown (Eaton and

Gasson 2001; Ruiz-Moyano et al. 2009). Additionally efaAfs was presented in all isolates

except R13 in which its presence was shown to influence pathogenicity in animal models

(Singh et al. 1998) and previous studies also reported its high presence in enteroccocci

including potential probiotics and starter cultures (Eaton and Gasson 2001; Nueno-Palop and

Narbad 2011). The other adhesion determinant (esp) was only detected in strain R6

supporting low level of occurrence of this indicator in non-medical isolates as previously

suggested (Eaton and Gasson 2001). All gut isolate E. faecium strains except strain R13

carried sex pheromone determinants (cob and agg) which can be related with both virulence

and antibiotic resistance gene transfer mechanisms (Ruiz-Moyano et al. 2009) and Eaton and

Gasson (2001) previously reported the high incidence of these genes in other enterococcal

strains. In addition gelE which is associated with gelatinase activity as a pathogenicity factor

was found in strains R5 and R13 which supports previous findings revealing high occurrence

of this gene in commensal enterococci (Lempiäinen et al. 2005; Nueno-Palop and Narbad

2011). More importantly none of the E. faecium strains carried the virulence factors cylA and

cylB which are required in cytolysin metabolism which is the most important virulence trait

that lyses the eukaryotic cells (Kayser 2003). This was similar to the previous observations of

Abriouel et al. (2008) and Nueno-Palop and Narbad (2011) in which non-clinical isolates

from human or food originated enterococci did not carry any cytolysin genes.

Testing the presence of hemolysins in Enterococcus strains is also crucial for safety

considerations and previously several food and human isolate E. faecium strains was shown

to be positive for β-hemolysis although the incidence of β-hemolysis was reported to be

lower than the E. faecalis strains (De Vuyst et al. 2003). In this study no hemolytic reaction

was observed for E. faecium strains including strain R13 showing their safety in terms of

hemolysins supporting their potential to be tested for their functional characteristics.

Biosynthesis of antimicrobial components such as bacteriocins in gut environment is an

important functional characteristic of probiotic bacteria (Saarela et al. 2000). The production

of variety of bacteriocins called enterocins with broad spectrum activity is well known for

enterococci (Giraffa 2003) and E. faecium strains in this study showed varying levels of

antimicrobial effects to selected Gram + and Gram – pathogens suggesting the production of

Page 13 of 29



Draft

14

bacteriocins. Enterocins are generally active against Gram + bacteria (Giraffa 2003) but

several studies also reported enterocins active against Gram – bacteria (De Kwaadsteniet et

al. 2005; Line et al. 2008). Our findings confirmed these reports as all E. faecium strains

showed inhibitory effects to both Gram + and Gram – bacteria. The wide range inhibitory

activity of gut isolates can be specifically important in complex gut environment. The PCR

amplification of the genes required for the production of enterocins A and B was also positive

for all E. faecium strains supporting the production of enterocins by these isolates. Similar to

our findings previous studies also showed the presence of both genes in E. faecium strains

with antimicrobial effects (Banwo et al. 2013; Cocolin et al. 2007) and it was reported that in

the presence of enterocin A gene, enterocin B gene always occurs (De Vuyst et al. 2003)

confirming our findings. A recent report also revealed the high level of the presence of

bacteriocin related genes in enterococci which were suggested to be reason for the high

degree of bactericidal activity of these species (Fontana et al. 2015). The presence of these

genes and inhibitory effects in commensal E. faecium strains can be crucial and E. faecium

R13 displays important functional characteristics.

Similar to the previous knowledge (Campos et al. 2006; De Kwaadsteniet et al. 2005; Franz

et al. 1996; Toit et al. 2000), the antimicrobial activities of E. faecium strains were lost after

treatment of the supernatants with proteolytic enzymes confirming the proteinaceous nature

of bacteriocins but treatment with catalase resulted in no alteration in antimicrobial activity

eliminating the potential involvement of the H2O2 in the antagonism process (Schirru et al.

2012). Additionally bacteriocin activities were not affected from detergents SDS, Triton X-

100 and Tween 20, heat treatments as well as effect of pH between 3.5 and 9.5. Similar

results were recorded previously (Arihara et al. 1993; Campos et al. 2006; De Kwaadsteniet

et al. 2005) for other bacteriocins although loss of antimicrobial activity at different pHs and

after higher temperature applications were also reported (Schirru et al. 2012; Toit et al. 2000).

The preliminary characterization of the bacteriocins of the E. faecium strains supported the

role of these strains as a probiotic candidate with respect to their antimicrobial activities.

In summary we have showed that E. faecium R13 from human gut may be a probiotic

candidate with functional characteristics in terms of resistance to low pH and bile salts,

survival under digestion conditions and adhesion, antimicrobial properties, antibiotic

resistance and presence of the virulence factors as well as hemolytic reaction. Further work is

in progress to characterize the bacteriocin(s) as well as its probiotic functionality and to

determine the expression patterns of the virulence genes in this strain.

Page 14 of 29



Draft

15

Acknowledgments

This research was supported by Bayburt University through an internal fund.

References

Abdhul, K., Ganesh, M., Shanmughapriya, S., Kanagavel, M., Anbarasu, K., and Natarajaseenivasan, K.

2014. Antioxidant activity of exopolysaccharide from probiotic strain Enterococcus faecium (BDU7)

from Ngari. International journal of biological macromolecules 70: 450-454. doi:

10.1016/j.ijbiomac.2014.07.026.

Abriouel, H., Omar, N.B., Molinos, A.C., López, R.L., Grande, M.J., Martínez-Viedma, P., Ortega, E.,

Cañamero, M.M., and Galvez, A. 2008. Comparative analysis of genetic diversity and incidence of

virulence factors and antibiotic resistance among enterococcal populations from raw fruit and

vegetable foods, water and soil, and clinical samples. International journal of food microbiology

123(1): 38-49.

Arihara, K., Cassens, R.G., and Luchansky, J.B. 1993. Characterization of bacteriocins from

Enterococcus faecium with activity against Listeria monocytogenes. International Journal of Food

Microbiology 19(2): 123-134. doi: http://dx.doi.org/10.1016/0168-1605(93)90178-J.

Baker, G.C., Smith, J.J., and Cowan, D.A. 2003. Review and re-analysis of domain-specific 16S

primers. Journal of Microbiological Methods 55(3): 541-555. doi:

http://dx.doi.org/10.1016/j.mimet.2003.08.009.

Banwo, K., Sanni, A., and Tan, H. 2013. Technological properties and probiotic potential of

Enterococcus faecium strains isolated from cow milk. Journal of Applied Microbiology 114(1): 229-

241. doi: 10.1111/jam.12031.

Page 15 of 29



Draft

16

Bezkorovainy, A. 2001. Probiotics: determinants of survival and growth in the gut. The American

Journal of Clinical Nutrition 73(2): 399s-405s.

Bhardwaj, A., Gupta, H., Kapila, S., Kaur, G., Vij, S., and Malik, R.K. 2010. Safety assessment and

evaluation of probiotic potential of bacteriocinogenic Enterococcus faecium KH 24 strain under in

vitro and in vivo conditions. International journal of food microbiology 141(3): 156-164.

Campos, C.A., Rodríguez, Ó., Calo-Mata, P., Prado, M., and Barros-Velázquez, J. 2006. Preliminary

characterization of bacteriocins from Lactococcus lactis, Enterococcus faecium and Enterococcus

mundtii strains isolated from turbot (Psetta maxima). Food Research International 39(3): 356-364.

doi: http://dx.doi.org/10.1016/j.foodres.2005.08.008.

Carlos, A.R., Semedo-Lemsaddek, T., Barreto-Crespo, M.T., and Tenreiro, R. 2010. Transcriptional

analysis of virulence-related genes in enterococci from distinct origins. Journal of Applied

Microbiology 108(5): 1563-1575. doi: 10.1111/j.1365-2672.2009.04551.x.

Cetinkaya, Y., Falk, P., and Mayhall, C.G. 2000. Vancomycin-resistant enterococci. Clinical

microbiology reviews 13(4): 686-707.

Charteris, Kelly, Morelli, and Collins. 1998. Development and application of an in vitro methodology

to determine the transit tolerance of potentially probiotic Lactobacillus and Bifidobacterium species

in the upper human gastrointestinal tract. Journal of Applied Microbiology 84(5): 759-768. doi:

10.1046/j.1365-2672.1998.00407.x.

Page 16 of 29



Draft

17

Cocolin, L., Foschino, R., Comi, G., and Grazia Fortina, M. 2007. Description of the bacteriocins

produced by two strains of Enterococcus faecium isolated from Italian goat milk. Food Microbiol

24(7-8): 752-758. doi: 10.1016/j.fm.2007.03.001.

De Kwaadsteniet, M., Todorov, S.D., Knoetze, H., and Dicks, L.M.T. 2005. Characterization of a 3944

Da bacteriocin, produced by Enterococcus mundtii ST15, with activity against Gram-positive and

Gram-negative bacteria. International Journal of Food Microbiology 105(3): 433-444. doi:

http://dx.doi.org/10.1016/j.ijfoodmicro.2005.03.021.

De Vuyst, L., Foulquie Moreno, M.R., and Revets, H. 2003. Screening for enterocins and detection of

hemolysin and vancomycin resistance in enterococci of different origins. Int J Food Microbiol 84(3):

299-318.

Dertli, E., Mayer, M.J., and Narbad, A. 2015. Impact of the exopolysaccharide layer on biofilms,

adhesion and resistance to stress in Lactobacillus johnsonii FI9785. BMC microbiology 15(1): 8.

Dunne, C., O'Mahony, L., Murphy, L., Thornton, G., Morrissey, D., O'Halloran, S., Feeney, M., Flynn,

S., Fitzgerald, G., and Daly, C. 2001. In vitro selection criteria for probiotic bacteria of human origin:

correlation with in vivo findings. The American journal of clinical nutrition 73(2): 386s-392s.

Eaton, T.J., and Gasson, M.J. 2001. Molecular Screening of EnterococcusVirulence Determinants and

Potential for Genetic Exchange between Food and Medical Isolates. Applied and environmental

microbiology 67(4): 1628-1635.

Favaro, L., Basaglia, M., Casella, S., Hue, I., Dousset, X., Gombossy de Melo Franco, B.D., and

Todorov, S.D. 2014. Bacteriocinogenic potential and safety evaluation of non-starter Enterococcus

Page 17 of 29



Draft

18

faecium strains isolated from home made white brine cheese. Food Microbiol 38: 228-239. doi:

10.1016/j.fm.2013.09.008.

Fontana, C., Cocconcelli, P.S., Vignolo, G., and Saavedra, L. 2015. Occurrence of antilisterial structural

bacteriocins genes in meat borne lactic acid bacteria. Food Control 47(0): 53-59. doi:

http://dx.doi.org/10.1016/j.foodcont.2014.06.021.

Franz, C.M., Van Belkum, M.J., Holzapfel, W.H., Abriouel, H., and Gálvez, A. 2007. Diversity of

enterococcal bacteriocins and their grouping in a new classification scheme. FEMS Microbiology

Reviews 31(3): 293-310.

Franz, C.M.A.P., Schillinger, U., and Holzapfel, W.H. 1996. Production and characterization of

enterocin 900, a bacteriocin produced by Enterococcus faecium BFE 900 from black olives.

International Journal of Food Microbiology 29(2–3): 255-270. doi: http://dx.doi.org/10.1016/0168-

1605(95)00036-4.

Giraffa, G. 2003. Functionality of enterococci in dairy products. Int J Food Microbiol 88(2-3): 215-

222.

Gomes, B.C., Esteves, C.T., Palazzo, I.C.V., Darini, A.L.C., Felis, G.E., Sechi, L.A., Franco, B.D.G.M., and

De Martinis, E.C.P. 2008. Prevalence and characterization of Enterococcus spp. isolated from

Brazilian foods. Food Microbiology 25(5): 668-675. doi: http://dx.doi.org/10.1016/j.fm.2008.03.008.

Hasman, H., Villadsen, A.G., and Aarestrup, F.M. 2005. Diversity and stability of plasmids from

glycopeptide-resistant Enterococcus faecium (GRE) isolated from pigs in Denmark. Microbial Drug

Resistance 11(2): 178-184.

Page 18 of 29



Draft

19

Hlivak, P., Odraska, J., Ferencik, M., Ebringer, L., Jahnova, E., and Mikes, Z. 2005. One-year

application of probiotic strain Enterococcus faecium M-74 decreases serum cholesterol levels. Bratisl

Lek Listy 106(2): 67-72.

Hosseini, S.V., Arlindo, S., Böhme, K., Fernández-No, C., Calo-Mata, P., and Barros-Velázquez, J. 2009.

Molecular and probiotic characterization of bacteriocin-producing Enterococcus faecium strains

isolated from nonfermented animal foods. Journal of Applied Microbiology 107(4): 1392-1403. doi:

10.1111/j.1365-2672.2009.04327.x.

Kayser, F.H. 2003. Safety aspects of enterococci from the medical point of view. International Journal

of Food Microbiology 88(2–3): 255-262. doi: http://dx.doi.org/10.1016/S0168-1605(03)00188-0.

Lempiäinen, H., Kinnunen, K., Mertanen, A., and von Wright, A. 2005. Occurrence of virulence

factors among human intestinal enterococcal isolates. Letters in Applied Microbiology 41(4): 341-

344. doi: 10.1111/j.1472-765X.2005.01769.x.

Line, J.E., Svetoch, E.A., Eruslanov, B.V., Perelygin, V.V., Mitsevich, E.V., Mitsevich, I.P., Levchuk, V.P.,

Svetoch, O.E., Seal, B.S., Siragusa, G.R., and Stern, N.J. 2008. Isolation and Purification of Enterocin E-

760 with Broad Antimicrobial Activity against Gram-Positive and Gram-Negative Bacteria.

Antimicrobial Agents and Chemotherapy 52(3): 1094-1100. doi: 10.1128/aac.01569-06.

Martín-Platero, A.M., Valdivia, E., Maqueda, M., and Martínez-Bueno, M. 2009. Characterization and

safety evaluation of enterococci isolated from Spanish goats' milk cheeses. International journal of

food microbiology 132(1): 24-32.

Page 19 of 29



Draft

20

Nueno-Palop, C., and Narbad, A. 2011. Probiotic assessment of Enterococcus faecalis CP58 isolated

from human gut. International Journal of Food Microbiology 145(2–3): 390-394. doi:

http://dx.doi.org/10.1016/j.ijfoodmicro.2010.12.029.

Ogier, J.-C., and Serror, P. 2008. Safety assessment of dairy microorganisms: the Enterococcus genus.

International journal of food microbiology 126(3): 291-301.

Pesavento, G., Calonico, C., Ducci, B., Magnanini, A., and Nostro, A.L. 2014. Prevalence and antibiotic

resistance of Enterococcus spp. isolated from retail cheese, ready-to-eat salads, ham, and raw meat.

Food microbiology 41: 1-7.

Pieniz, S., Andreazza, R., Anghinoni, T., Camargo, F., and Brandelli, A. 2014. Probiotic potential,

antimicrobial and antioxidant activities of Enterococcus durans strain LAB18s. Food Control 37(0):

251-256. doi: http://dx.doi.org/10.1016/j.foodcont.2013.09.055.

Ruiz-Moyano, S., Martín, A., Benito, M.J., Aranda, E., Casquete, R., and Córdoba, M.d.G. 2009. Safety

and Functional Aspects of Preselected Enterococci for Probiotic Use in Iberian Dry-Fermented

Sausages. Journal of Food Science 74(7): M398-M404. doi: 10.1111/j.1750-3841.2009.01290.x.

Saarela, M., Mogensen, G., Fondén, R., Mättö, J., and Mattila-Sandholm, T. 2000. Probiotic bacteria:

safety, functional and technological properties. Journal of Biotechnology 84(3): 197-215. doi:

http://dx.doi.org/10.1016/S0168-1656(00)00375-8.

Sagdic, O., Ozturk, I., Yapar, N., and Yetim, H. 2014. Diversity and probiotic potentials of lactic acid

bacteria isolated from gilaburu, a traditional Turkish fermented European cranberrybush (Viburnum

Page 20 of 29



Draft

21

opulus L.) fruit drink. Food Research International 64(0): 537-545. doi:

http://dx.doi.org/10.1016/j.foodres.2014.07.045.

Santos, K.M.O.d., Vieira, A.D.S., Salles, H.O., Oliveira, J.d.S., Rocha, C.R.C., Borges, M.d.F., Bruno,

L.M., Franco, B.D.G.d.M., and Todorov, S.D. 2015. Safety, beneficial and technological properties of

Enterococcus faecium isolated from Brazilian cheeses. Brazilian Journal of Microbiology 46: 237-249.

Schirru, S., Todorov, S.D., Favaro, L., Mangia, N.P., Basaglia, M., Casella, S., Comunian, R., Franco,

B.D.G.d.M., and Deiana, P. 2012. Sardinian goat’s milk as source of bacteriocinogenic potential

protective cultures. Food Control 25(1): 309-320. doi:

http://dx.doi.org/10.1016/j.foodcont.2011.10.060.

Singh, K.V., Coque, T.M., Weinstock, G.M., and Murray, B.E. 1998. In vivo testing of an Enterococcus

faecalis efaA mutant and use of efaA homologs for species identification. FEMS immunology and

medical microbiology 21(4): 323-331.

Tan, Q., Xu, H., Aguilar, Z.P., Peng, S., Dong, S., Wang, B., Li, P., Chen, T., Xu, F., and Wei, H. 2013.

Safety Assessment and Probiotic Evaluation of Enterococcus Faecium YF5 Isolated from Sourdough.

Journal of Food Science 78(4): M587-M593. doi: 10.1111/1750-3841.12079.

Toit, M.D., Franz, C.M.A.P., Dicks, L.M.T., and Holzapfel, W.H. 2000. Preliminary characterization of

bacteriocins produced by Enterococcus faecium and Enterococcus faecalis isolated from pig faeces.

Journal of Applied Microbiology 88(3): 482-494. doi: 10.1046/j.1365-2672.2000.00986.x.

Page 21 of 29



Draft

22

Zheng, W., Zhang, Y., Lu, H.M., Li, D.T., Zhang, Z.L., Tang, Z.X., and Shi, L.E. 2015. Antimicrobial

activity and safety evaluation of Enterococcus faecium KQ 2.6 isolated from peacock feces. BMC

biotechnology 15: 30. doi: 10.1186/s12896-015-0151-y.

Tables and Figures

Table 1. Survival of E. faecium strains in simulated digestion condition and percentage

adhesion of these strains to hexadecane.

Table 2. Resistance of E. faecium strains against antibiotics (inhibition zone, cm).

Table 3. Detection of some virulence determinant genes in E. faecium strains tested in this

study.

Table 4. Antibacterial activity of E. faecium strains against selected pathogens (A) and

determination of the antibacterial activity of E. faecium strains as AU ml-1 against selected

pathogens (B).

Table 5. Effect of enzymes, detergents, pH and temperature applications on the antimicrobial

activity of E. feacium strains on S. typhimurium and Staphylococcus aureus ATC. Activity of

bacteriocin is expressed in: (+) = presence of inhibition zone (>2 mm); (-) = no inhibition.

Figure 1. Assessment of growth of E. faecium strains under low pH (A), bile salts (B) and

control (C) conditions over 24 h. E. faecium strains R3( ), R5( ), R6 ( ) and R13 ( )

were grown in MRS at pH 4 (A) or in the presence of 0.3% bile salts (B) and in MRS as a

control medium (C).

Page 22 of 29



Draft

23

Table 1.

Digestion survival (%) Adhesion to hexadecane Enterococcus faecium R3 20.4 ± 1.71 45.45 ± 0.9 Enterococcus faecium R5 11.3 ± 1.47 19.65 ± 2.47 Enterococcus faecium R6 14.2 ± 4.2 42.05 ± 0.77 Enterococcus faecium R13 24.3 ± 1.4 38.65 ± 1.06

Page 23 of 29



Draft

24

Table 2.

AMP C Va Cn Rd K E TE CAR Aml Ox S R3 1.4±0.2 1.2±0.1 - 0.2±0.04 0.4±0.01 - 0.3±0.02 1.4±0.01 1.2±0.02 1.3±0.02 0.1±0.01 -

R5 1.3±0.1 1.3±0.1 - 0.2±0.07 0.4±0.02 0.2±0.01 0.3±0.02 1.6±0.1 1.3±0.05 1.6±0.1 0.1±0.01 -

R6 1.5±0.3 1.0±0.1 1.0±0.1 0.2±0.03 0.3±0.02 0.8±0.01 0.7±0.03 1.6±0.2 1.3±0.2 1.2±0.2 0.1±0.03 -

R13 1.3±0.1 1.2±0.1 1.0±0.1 - 0.3±0.01 - 0.4±0.01 1.0±0.1 1.5±0.02 1.2±0.02 0.1±0.01 -

Amp: Ampicillin, C: Chloramphenicol, Va: Vancomycin, Cn: Gentamicin, Rd: Rifampicin,

K: Kanamycin, E: Erythromycin, TE: Tetracycline, CAR: Carbenicillin Aml: Amoxicillin,

Ox: Oxacillin, S: Streptomycin, - No inhibition zone.

Page 24 of 29



Draft

25

Table 3.

Strain Virulent factors Enterococcus faecium R3 cob; agg; efaAfm; efaAfs Enterococcus faecium R5 cob; agg; efaAfm; efaAfs; gelE Enterococcus faecium R6 cob; agg; efaAfm; efaAfs; esp; Enterococcus faecium R13 efaAfm; gelE

Page 25 of 29



Draft

26

Table 4.

A

EC SA ATC SA BC YE ST BC

Enterococcus faecium R3 - 8 ± 1.41 - - 6.5 ± 0.7 - Enterococcus faecium R5 2.5 ± 0.7 5.5 ± 0.7 - - 5.5 ± 0.7 - Enterococcus faecium R6 2.3 ± 0.6 4.5 ± 2.1 2.5 ± 0.7 - 3.5 ± 0.7 - Enterococcus faecium R13 4.5 ± 0.7 5 ± 1.4 3 ± 1.4 1.75 ± 0.35 4.5 ± 0.7 3.5 ± 0.7

Results are expressed as diameters of the inhibition zone and standard deviations in mm. EC:

E. coli, SA: S. aureus, YE: Y. Enterocolitica, ST: S. typhimurium, BC: B. cereus, -: No

inhibiton zone

B

Bacteriocin activity

Strains SA ATC ST

Enterococcus faecium R3 6400* 3200 Enterococcus faecium R5 3200 3200 Enterococcus faecium R6 1600 800 Enterococcus faecium R13 3200 3200

*Results are expressed as AU ml-1 calculated from the highest dilution showing a clear zone

> 2 mm. SA: S. aureus, ST: S. typhimurium.

Page 26 of 29



Draft

27

Table 5.

Bacteriocins R3 R5 R6 R13 Enzymes

Pepsin, Proteinase K catalase

- +

- +

- +

- +

Detergents

SDS Triton X-100 Tween 20

+ + +

+ + +

+ + +

+ + +

pH

3.5-9.5

+

+

+

+

Temperatures

80, 90, 100°C 30 min

+

+

+

+

Page 27 of 29



Draft

Figure 1

A

B

Page 28 of 29



Draft

C

Page 29 of 29



Documents

Complete List of Authors: Đspirli, Hümeyra; Bayburt ...(Fontana et al. 2015) using a thermal cycler (Benchmark, TC9639). PCR products were run on a gel to check the amplicon size