Comparison of the Aspartate Transcarbamoylases …Comparison of the Aspartate Transcarbamoylases from Serratia marcescens and Escherichia coli* (Received for publication, December

THE JOURNAL OF BIOLOGICAL CHEMISTRY 0 1989 by The American Society for Biochemistry and Molecular Biology, Inc

Vol. 264, No. 28. Issue of October 5, pp. 16629-16637,1969 Printed in U.S.A.

Comparison of the Aspartate Transcarbamoylases from Serratia marcescens and Escherichia coli*

(Received for publication, December 18, 19%)

DeAndra Beck, Karen M. Kedziel, and James R. Wild4 From the Department of Biochemistry and Biophysics, Texas A&M University, College Station, Texas 77843-2128

The aspartate tra.nscarbamoylases (ATCase, EC 2.1.3.2) of Escherichia coli and Serratia marcescens have similar dodecameric enzyme structures (2(c3):3(r,)) but differ in both regulatory and catalytic characteristics. The catalytic cistrons (pyrB) of the ATCases from E. coli and S. marcescens encode polypeptides of 3 11 and 306 amino acids, respectively; there is a 76% identity between the DNA sequences and an overall amino acid homology of 88% (38 differences). The regulatory cistrons (pyrl) of these AT- Cases encode polypepkides of 153 and 154 amino acids, respectively, and there is a 75% identity between the DNA sequences and an overall amino acid homology of 77% (36 differences). In both species, the two genes are arranged as a bicistronic operon, with pyrB promoter proximal. A comparison of the deduced amino acid sequences reveals that the active site and the allosteric binding sites, as well as most of the intrasubunit interactions and intersubunit associations, are conserved in the E. coli and the S. marcescens enzymes; however, there are specific differences which undoubt- edly contribute to the catalytic and regulatory differences between the enzymes of the two species. These differences include residues that have been implicated in the T-R transition, c1:rl interface interactions, and the CTP binding site. A hybrid ATCase assembled in viuo with catalytic subunits from E. coli and regulatory subunits from S. marcescens has a 6 mM requirement for aspartate at half-maximal saturation, similar to the 5.5 mM aspartate rlequirement of the native E. coli holoenzyme at half-maximal saturation. However, the heterotropic response of this hybrid enzyme is characteristic of the hete!rotropic response of the native s. marcescens holoenzyme: ATP activation and CTP activation. Activation by both allosteric effectors indicates that the heterotropic response of this hybrid holoenzyme (Cec:Rsm) is determined by the associated S. marcescens regulatory subunits.

* This research has been supported by National Science Founda- tion Grant PCM-8409160, National Institutes of Health Grant GM33191, and Robert A. Welch Foundation Grant A-915. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduer- tisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted

505033. to the GenBankTM/EM13L Data Bank with accession nurnberfs)

$ Present address: Dept. of Pharmacology and Toxicology, Univer- sity of Arizona, Tucson, A Z 85721.

1012. § TO whom correspondence should be addressed. Tel.: 409-845-

The aspartate transcarbamoylase holoenzyme (ATCase’; aspartate carbamoyltransferase; carbamoy1phosphate:L-aspartate carbamoyltransferase, EC 2.1.3.2) catalyzes the first reaction unique to pyrimidine biosynthesis, the condensation of carbamoyl phosphate and aspartate to form carbamoyl aspartate and release inorganic phosphate (Yates and Pardee, 1962). In Escherichia coli K-12, the holoenzyme is a dodec- amer (Weber, 1968) composed of two catalytic trimers ( ~ 3 ) and three regulatory dimers (r2) (Cohlberg et al., 1972; Ger- hart and Schachman, 1964; Wiley and Lipscomb, 1968). This enzyme is feedback-inhibited by the pyrimidine nucleotide CTP and is activated by the purine nucleotide ATP (Gerhart and Pardee, 1962). The catalytic polypeptide of E. coli ATCase is encoded by the pyrB gene (Bachmann and Low, 19831, and the regulatory polypeptide is encoded by the pyr1 gene (Feller et al., 1981; Wild et al., 1981). These genes are arranged as a bicistronic operon withpyrB promoter proximal (Pauza et al., 1982; Roof et al., 1982; Turnbough et al., 1983).

The nucleotide sequence of the pyrBZ operon of E. coli has been reported, and the amino acid sequences of both polypeptides have been determined by chemical sequencing and re- fined from nucleotide sequencing data (Hoover et al., 1983; Konigsberg and Henderson, 1983; Schachman et al., 1984; Weber, 1968). The ATCase of E. coli has been studied exten- sively by a variety of methods and has been the subject of periodic reviews (Allewell, 1987, 1989; Gerhart, 1970; Jacob- son and Stark, 1973; Kantrowitz and Lipscomb, 1988; Kan- trowitz et al., 1980a, 1980b) and many ongoing studies. On this basis, various catalytic and regulatory functions have been assigned to specific amino acids located in structurally discrete regions of the enzyme, including the active site, the nucleotide effector binding site, intersubunit interfaces, and intrasubunit contacts (Honzatko et al., 1982; Honzatko and Lipscomb, 1982; Ke et al., 1984; Krause et al., 1985,1987; Volz et al., 1986). These regions are associated with functionally unique structural domains of each polypeptide: the aspartate and carbamoyl phosphate binding domains of the catalytic polypeptide and the allosteric and zinc binding domains of the regulatory subunit (Fig. 1).

Aspartate transcarbamoylases from other enteric bacteria are structurally similar to the ATCase of E. coli in both architecture (dodecamers of two catalytic trimers and three regulatory dimers) and molecular mass (275,000-315,000 Da) (Bethell and Jones, 1969; Wild et aL, 1980; Foltermann et ai., 1986), yet distinct catalytic and regulatory differences do exist (Bethell and Jones, 1969; Foltermann et al., 1981, 1986; Wild et al., 1976, 1980). For example, the ATCase of Serratia marcescens differs from the ATCase of E. coli in both homotropic and heterotropic characteristics (Table I). The half-

’ The abbreviations used are: ATCase, aspartate transcarbamoylase; c and r, catalytic and regulatory polypeptide chains; Sm, Serratia marcescens; Ec, Escherichia coli.

16629

16630 Aspartate Transcarbamoylase from S. marcescens

FIG. 1. Schematic illustration of a single catalytic-regulatory unit of aspartate transcarbamoylase. Cylin- ders designated H I , H2, etc. represent a helices, and the arrows designated 1 , 2, etc. represent 8 sheets. Adapted with permission (Honzatko and Lipscomb, 1982).

I I1 I ' Regulatory POlyoept!de Calalyflc Polyoeplide

Equatorial

Domal"

Polar Damam

TABLE I Comparison of enzymatic characteristics of ATCases

from E. coli and S. marcescens

Effector" [Sl0.6 aspb Response' vappd mM %

Native holoenzyme E. coli

None 5.5 100 CTP (-)

2.1 8.5 25

ATP (+) 2.8

2.2 140 1.7 S. marcescens

None 20 100 CTP (+) 15

2.4 135

ATP (+) 2.4

10 150 2.2 Catalytic trimer

E. coli 8.0 100 1.0 S. marcescens 17 100 2.0

a No effector with catalytic trimer; 2 mM nucleotide concentration (+b activation; -, inhibition).

Concentration of aspartate (asp) required to obtain half-maximal velocity a t saturating carbamoyl phosphate concentrations (Folter- mann et al., 1986 Wild et al., 1980).

Percentage relative activity in the presence of 2 mM nucleotide effector at the native [S],, aspartate requirement for each holoenzyme and at saturating levels of carbamoyl phosphate (Foltermann et al., 1986; Gerhart and Pardee, 1962; Wild et al., 1976, 1980).

* qapp was estimated from the slope of uo/( VmaX - uo) uersus log[S].

maximal aspartate requirement of 20 mM for the s. marcescem enzyme is significantly greater than the 5.5 mM requirement for aspartate of the E. coli enzyme; moreover, the nucleotide effector CTP, an inhibitor of the E. coli enzyme, has been shown to activate the ATCase of S. marcescens (Shanley et al., 1984; Wild et aL, 1976, 1980). While both holoenzymes possess similar homotropic responses to aspartate, the separate catalytic trimers show an approximately 3- 4-fold increase in Vmax over the regulatory-associated com- plexes.

The pyrE1 genes from various enteric bacteria are capable of complementing pyrBI mutations in E. coli (Foltermann et al., 1986; Shanley et al., 1984), and it has been possible to construct a variety of hybrid ATCases in vitro (O'Donovan et al., 1972; Shanley et al., 1984) and in vivo (Foltermann et al., 1986) using subunits derived from different bacterial species. While most hybrid ATCases exhibit enzymatic characteristics

similar to those of the parental enzymes, the hybrid constructed from the catalytic subunits of s. narcescem and the regulatory subunits of E. coli (Csm:Rec) showed characteristic E. coli ATP activation and CTP inhibition but required extremely high levels of aspartate to obtain maximal velocity ( [ S ] O . ~ = 125 mM aspartate) (Foltermann et al., 1981, 1986; Shanley et al., 1984). Furthermore, hybrid enzymes formed with catalytic subunits from other enteric bacteria and the E. coli regulatory subunit do not show this paralysis (Foltermann et al., 1986). Thus, paralysis of the (Csm:Rec) hybrid holoenzyme is clearly related to the catalytic subunit (Csm) of the hybrid enzyme, implicating amino acid substitutions within the S. marcescens catalytic polypeptide that contribute to the elevated substrate requirement of this enzyme.

In this paper, the enzymatic characteristics, nucleotide sequence, and deduced amino acid sequence of the pyrBI operon from S. marcescens are compared with that of the E. coli enzyme, and a hybrid enzyme comprised of catalytic subunits from E. coli and regulatory subunits from S. marcescem is constructed in vivo.

MATERIALS AND METHODS

Bacterial Strains and Media-The bacteria1 strain used as a DNA source for isolation of the pyrBZ operon of S. marcescens was strain HY (ATCC 8195). Genetic manipulations were performed in either E. coli JM103 (Messing and Vieira, 1982) or JM103 pyrBZ-, an ampicillin-resistant, Pyr auxotroph previously described (Foltermann et al., 1986). The host strain used for enzymatic characterization of ATCase was E. coli HB101-4442 (described in Foltermann et at., 1986). Bacteria were maintained on tryptone-yeast extract (TYE) medium, supplemented with ampicillin (40 pg/ml) and/or tetracycline (25 pg/mI) as required, or on a minimal T F medium (Kelmers et al., 1981; Munch-Peterson and Neuhard, 1964) supplemented with 0.2% glucose, 0.1% casamino acids (Difco), and 2 pg/ml thiamine. Cultures used for ATCase assays were grown in modified M56 medium (Wild et al., 1980).

Plasmid and Bacteriophage Vectors-A 1400-base pair PstI fragment expressingpyrl? was cloned into M13mp8 (Messing and Vieira, 1982) and in the reverse direction into M13mplO (Messing, 1983). The resulting two vectors, PBc8081-Sm and PBc8101-Sm, contained this insert in opposite orientations as determined by C-test analysis (Messing, 1983) and verified by restriction site mapping (data not shown). The nomenclature indicates a phage (or plasmid) from the pyrBI operon of 5'. marcescens which produces the holoenzyme (h) or the catalytic or regulatory chains alone (c or r). A Sau3A partial digest of pPBhlOl-Sm (Foltermann et al., 1986) containing the entire pyrBZ operon was subcloned into the BamHI site of M13mpl0,

Aspartate Transcarbamoylase from S. marcescens 16631

creating PBh5109-Sm. HindIII and PuuII were used to excise PyrI from PBh5109-Sm; subsequent ligation of this fragment into a HincIIIHindIII-cleaved Ml3mplO produced PBr5101-Sm. An XbaI digest of PBr5101-Sm ligated into M13mp19 (Norrander et al., 1983) created PBr5192-Sm and PBr5193-Sm, clones containing pyrl in opposite orientations. E. ccli holoenzyme and catalytic trimers were produced from HB101-4442 containing the plasmids pPBhlOl-Ec and pPBc201-Ec, respectively (Foltermann et al., 1986). The plasmids pPBhlOl-Sm and pPBclOl-Sm expressed in HB101-4442 were used to produce holoenzyme and catalytic trimers (Foltermann et al., 1986). PBr5101-Sm was restricteccl with PuuII and HindIII to generate a fragment containing pyrl expressed under lac control. This fragment was cloned into pACYC177 restricted with SmaI and HindIII (Chang and Cohen, 1978). The resulting plasmid, pPBr301-Sm, was used as the source of S. marcescem regulatory subunits. Phage vectors were maintained and utilized according to previously published methods (Messing, 1983). Transformations were performed according to the method of Dagert and Ehrlich (1978), and native acrylamide activity gels were used to verify enz:yme architecture (Foltermann et al., 1986). The rapid boiling method was used for screening isolates (Holmes and Quigley, 1981), and CsCl gradients were used for further purification (Maniatis et al., 1982) of both plasmid DNA and the replicative form of M13 DNA.

DNA Sequencing Strategies and Techniques-Replicative forms of PBc8081-Sm and PBc8101-Sm were digested with PstI, PuuII, A M I , and SmaI in varying combinations and subcloned into M13mplO or M13mpll to generate a series of fragments for DNA sequencing. Single-stranded phage templates were isolated and purified according to published methods (Messing, 1983). The dideoxy chain termination method of Sanger et al. 1;1977) was used to determine the DNA sequence for both strands of these templates.

The replicative form of l'Br5192-Sm was treated with exonuclease 111 using the method of Henikoff (1984) to generate a series of deletions at the 3' end of p y r l . Following vector religation, a series of templates were prepared as above and subjected to dideoxy chain termination sequencing using the Sequenase kit (United States Bio- chemical Corp.). synthetic oligonucleotides were made on an Applied Biosystems oligonucleotide synthesizer and used as primers to sequence the templates prepared from PBr5193-Sm to generate sequence data for the opposite strand.

DNA Sequence Ana1yst.s and Comparisons-Intelligenetics, Inc. software was used to evaluate DNA sequence data. Additional analyses were performed using the University of Wisconsin computer group software. All amino acid comparisons were carried out based on strict positional identity.

ATCase Characterizatiolz-Wild type cell extracts from S. marcescens and E. coli were prepared and protein purification was accom- plished as described previously (Shanley et al., 1984; Wales et al., 1988). Cell extracts of hybrid holoenzymes were prepared and par- tially purified using molecular sieve chromatography as described (Foltermann et al., 1986; Wild et al., 1976, 1980). Chromatography over a Sephadex G-200 column insures that the hybrid holoenzymes are completely free of contaminating catalytic subunits and regulatory-deficient species. The basic enzymatic characteristics of other ATCase holoenzymes prepared in our laboratory in this manner remained consistent throughout additional purification steps (data not shown). Standard colorimetric assay conditions were used to determine ATCase activity as described by Gerhart and Pardee (1962) and as modified by Bethell and Jones (1969; Foltermann et al., 1986).

Enzymes and Biocheml:ak-Restriction endonucleases, T4 DNA ligase, isopropyl-p-D-thiogalactoside, and 5-bromo-4-chloro-3-indoyl- P-D-galactoside, exonuclease 111, nucleotides, and the large fragment of DNA polymerase I (Kl'enow) were purchased from Bethesda Re- search Laboratories or Bo'ehringer Mannheim and used according to manufacturers' recommendations. Radioactive [CP~~P]~ATP was purchased from Du Pont-New England Nuclear.

RESULTS

Hybrid ATCase Characteristics-The aspartate saturation curves and effector responses of the (Cec:Rsm) hybrid enzyme are shown in Fig. 2. The apparent [S]o,5 for the enzyme is 6 mM aspartate in the absence of nucleotide effectors (Table Iv). This is substantially lower than the 125 mM aspartate requirement of the (Csm:Rec) hybrid. Both nucleotide effectors ATP and CTP are shown to activate the (Cec:Rsm)

hybrid holoenzyme: 130% ATP activation and 125% CTP activation (Table IV).

DNA Sequence Analyses-The nucleotide sequence and deduced amino acid sequence of the pyrBI operon from s. marcescens are shown in Fig. 3. The pyrB gene is promoter- proximal and is preceded by a putative leader sequence pyrL (+18 to +129). Translation of this open reading would produce a leader polypeptide of 37 amino acids, similar in size to that of E. coli (44 amino acids) but lacking any apparent attenuator or stem-loop structures (Wild et al., 1981). From the deduced amino acid sequence, the pyrB gene (+192 to +1109) is predicted to encode a catalytic polypeptide of 306 amino acids with a molecular mass of 33,244 Da, or approximately 100,000 Da for the trimer. ThepyrI (+1125 to +1586) gene is promoter distal and is predicted to encode a regulatory polypeptide of 154 amino acids with a molecular mass of 17,308 Da, or approximately 34,600 Da for the dimer. The predicted molecular mass of the holoenzyme is approximately 300,000 Da and closely corresponds to the estimations of molecular mass reported in previous studies (Foltermann et al., 1986; Shanley et al., 1984; Wild et al., 1976, 1980).

Each of the open reading frames (pyrL, pyrB, andpyrl) are preceded by putative ribosomal binding sites of equivalent strength; however, that of the leader polypeptide is positioned only 3-4 residues away from the translational start, probably too close for efficient initiation. Yet the genetic organization is similar to that of E. coli, and the presumed components of the promoter (-10 and -35 recognition sites) are homologous to sequences found in highly expressing promoters in E. coli. The G + C content of the pyrB sequence is 63%, and the G + C content of the pyrl sequence is 60%. These percentage values are consistent with the higher G + C content characteristic of S. marcescens DNA. The DNA sequences show similarities of 76 and 75% for pyrB and pyrl, respectively, with E. coli sequences.

Amino Acid Comparisons-The amino acid sequences of the pyrB and pyrl polypeptides from E. coli and S. marcescens are highly conserved. The positional identity of residues in the catalytic polypeptide is 88%, while that of the regulatory polypeptide is 77%. When aligned as in Fig. 4, there are 38 amino acid differences between the catalytic polypeptides from E. coli and S. marcescens. Twenty-three of these differences are apparently conservative changes, maintaining size, charge, or hydrophobicity of the residue (Dayhoff et al., 1972). In addition, there are five fewer amino acids in the S. marcescem polypeptide. The majority of the changes (24 changes, a 16% difference) are localized to the equatorial domain of the polypeptide, which has been shown to be involved in binding aspartate and corresponds to the carboxyl-terminal portion of the polypeptide. The polar domain, involved primarily in the r1:cl domain of bonding and carbamoyl phosphate binding, is more conservatively maintained (only 14 amino acid changes, a 9% difference). A similar bias toward conservation of the polar domain has also been observed between ATCases and orthinine transcarbamoylase (carbamoy1phosphate:L-ornithine carbamoyltransferase; EC 2.1.3.3) (Houghton et al., 1984; Van Vliet et al., 1984) and between the ATCases of E . coli and Bacillus sdtilis (Lerner and Switzer, 1986). All of the residues implicated directly in substrate binding in E. coli are conserved in the polypeptide from S. marcescens (Table 11); however, some amino acid changes do occur in neighboring regions (Ke et al., 1984; Krause et al., 1987).

When the amino acid sequences for the regulatory polypeptides of E. coli and S. marcescens are aligned as in Fig. 5, there are 36 amino acid differences between the two. Twenty-three of these differences are apparently conservative changes based

16632 Aspartate Transcarbamoylase from 5'. marcescens

FIG. 2. Saturation curves of native and hybrid ATCases. Relative activity ( VmaX in the absence of effectors = 100%) is plotted as a function of increasing aspartate concentration in the presence or absence of nucleotide effectors ATP or CTP (2 mM final concentration). Legend designation is Ec wt (E . coli native holoenzyme), Sm wt (S. marcescens native holoenzyme), Cec:Rsrn (Escherichia coli catalytic subunits and S. marcescens regulatory subunits), and Csm:Rec (S. marcescens catalytic subunits and E. coli regulatory subunits).

100

.- A

.- Z N 4

: 40

- 60

z

a -

20

0 0 5 1 0 1 5 2 0 2 5 3 0 3 5 4 0 4 5 5 0 5 5

0" , , , , , , , , , , I 0 5 1 0 15 2 0 2 5 3 0 3 5 4 0 4 5 5 0 5 5

Bo

40

20

0 0 1 0 2 0 3 0 4 0 5 0 6 0 7 0 8 0 9 0 100 m::

ATP

0 5 0 100 150 200 250 300 350 4 0 0

on the Dayhoff analysis (Dayhoff et al., 1972). There is one additional amino acid (Gln-15lr-Sm) in the S. marcescens polypeptide, located in the zinc binding domain near the carboxyl terminus. All of the residues located in the allosteric domain of the regulatory polypeptide and implicated in nucleotide binding in the E. coli enzyme are conserved in s. murcescens except one, Arg-96r-Ec, which has been replaced by Thr-96r-Sm (Table 111). Two structurally important regions demonstrate a concentration of amino acid changes: the "130's loop" (124r-132r) and the carboxyl terminus (144r- 154r). The cysteines directly involved in zinc binding are all conserved in the s. marcescens polypeptide.

DISCUSSION

The hybrid enzyme created from catalytic subunits of E. coli and regulatory subunits of S. marcescens (Cec:Rsm) is catalytically efficient (Fig. 2), with a half-maximal requirement for aspartate of 6 mM (Table IV). In contrast, the reverse hybrid (Csm:Rec) requires 125-130 mM aspartate for maximal velocity, suggesting that residues within the catalytic subunit of S. marcescens are uniquely responsible for the elevated substrate requirements of the Csm:Rec hybrid. It should be noted that other hybrid enzymes formed with regulatory subunits from E. coli do not show this catalytic paralysis (Foltermann et al., 1986) nor does the reverse hybrid reported in this study. In addition, each of the hybrid enzymes possess the unique regulatory characteristics associated with its regulatory chain: ATP activation and CTP activation or CTP inhibition (Fig. 2). This implies that specific amino acid substitutions within the regulatory polypeptide of S. marcescens dictate the unique heterotropic response of various associated catalytic trimers. Research is currently underway to determine the effects of varying combinations of nucleotides upon both hybrid enzymes since recent studies have revealed a synergistic effect of CTP upon ATP-activated enzymes (Wild et al., 1988).

By comparing the nucleotide sequences and the deduced amino acid sequences of the S. marcescens enzyme and the well characterized enzyme of E. coli, individual residues within the S. marcescens enzyme can be tentatively assigned specific functions. These residues provide critical targets for comparison and alteration in an attempt to understand the mecha-

IAspamtel aspa art at el

nisms of homotropic and heterotropic response in aspartate transcarbamoylase.

As seen in Table 11, all of the active site residues identified in the E. coli enzyme are conserved in the S. marcescens enzyme. This indicates that the differences in heterotropic and homotropic response of the S. marcescens enzyme are attributed to the interactions of residues other than those directly involved in substrate association. For example, both tryptophan residues of the E. coli catalytic polypeptide (Trp- 209c-Ec and Trp-284c-Ec) are replaced by tyrosine residues in the S. marcescens enzyme (Tyr-207c-Sm and Tyr-280c- Sm). Substitution of these residues with the tryptophan analog 7-azatryptophan in the E. coli enzyme resulted in increased heterotropic responses and a reduced affinity for the aspartate analog succinate, although independent contribu- tions of the 2 residues could not be determined (Footer et al., 1980). A proposed intra-equatorial polar link between Trp- 209c-Ec and Asp-203c-Ec is altered in the T to R transition. It has been suggested that chemical modifications increasing the strength of this polar link would stabilize the T state (Krause et al., 1987), requiring higher levels of substrate to promote the structural transition. When Trp-209c-Ec was replaced with Tyr-209c-Ec by suppression of a nonsense mutation in the E. coli enzyme, the [ S ] O . ~ increased from 5.5 to 10 mM aspartate, and the heterotropic responses to ATP and CTP increased. This was interpreted to indicate a stabiliza- tion of the T state, with some R state properties (Smith et al., 1986). These results are consistent with the decreased affinity of the S. marcescens enzyme for aspartate and its increased heterotropic response to nucleotide effectors (Wild et al., 1980). Furthermore, Asp-203c-Ec is replaced by Glu- SOlc-Sm, potentially providing a stronger salt-link association (Tyr-207c-Sm:::Glu-2Olc-Sm) in the S. murcescens enzyme. This substitution could directly contribute to the increased heterotropic activation and aspartate requirements of the S. marcescens enzyme in which ATP activates the S. marcescens holoenzyme more than 150% at native [SIo.& values of 20 mM aspartate compared to a 50% activation of the E. coli enzyme at its native [S]o .B value of 5.5 mM aspartate (Table I).

Only three of the 26 residues considered to be important in the catalytic intrapolar domain are different in the S. marcescens polypeptide. Based on comparative data (Lerner and Switzer, 1986; Michaels et al., 1987), this appears to be the


ACAACGTCAAAGGCTATCAATTGAACGCCGACATTGGTCTACTACGATCGCGTCAGCAAATACGCGAGGCCATC~CG~T -71

C G A T T G C G G G G C G G C A A A A A A C G G T T T T ~ T T ~ G T G G A A A A G C G C G A G ~ G C C A C A A T T T G C ~ ~ T 20 -35 -10 SD Me

GAAAAACGACGTTTGTTTTGTTAGCCGCAATCGA~CCGACTGCCTATCGGCGGCCAGCTGCCGTTGTTTCTCCTGTTGCT~CCG tLysAsnAspValCysPheValSerArgAsnArgGl~s~rgLeuProIleGlyGlyGlnLeuProLeuPhe~uLeuLeu~~snAr

ATCTTTTCAAGCCCCTCATTGACGGTTTTTTTTTGCCTTAAAAAGTCCCGCGCCACGGCACGCGTC~GT~TGGC~C gSerPheGlnAlaProHisEnd SD MetAlaAsn

CCGCTGTATCACAAACA~.TCATCTCTATTAACGATCTCAGCCGCGACGATCTGGAGCTGGT~TCGCGACCGCCGC ProLeuTyrHisLysHisIleIleSerIleAsnAspLeuSerArgAspAspAspLeuGlu~uValLe~aThrAl~aGlyLeuLysAla

AACCCGCAGCCGGAGCTGTTGAAACACAAGGTGATCGCCAGCTGCTTCTTCGAAGCCTCGACCCGTACCCGCCTGTCGTCGTTCG~CCTCG AsnProGlnProGluLeuI~uLysHisLysValIleAlaSerCysPhePheGlufilaSerThr~gThrArg~uSerPheGluThrSer

ATGCACCGCCTCGGCGCCTCGGTGGTCGGTTTCGCCGACGGCAG~CACCTCGCTC~~~G~CCCTGGCCGACAC~TC MetHisArgLeuGlyALaS~erValValGlyPheAlaAspGlySerAsnThrSerLeuGlyLysLysGlyGluThrLeuAlaAspThrIle

TCGGTGATCAGCACCTACGTGGACGCCATCGTGATGCGCCATCCGCAGGAA~CGCGCGCAT~CTCGGAGTTCTCC~CGTGCCG SerValIleSerThrTyr~~alAsp~aIleVa~etArgHisProGlnGluGlyALaArgMet~aSerGluPheSerGlyAsnValPro

GTGCTCAACGCCGGCGACC;GCAAC~GCACCCGACCCAGACCCTGCTGGATCTGTTCACCATCCA~CCCA~CGCCT~GCAAC ValLeuAsnAlaGlyAs~~lyAsnGlnHisProThrGlnThrLeuLeuAsp~uPheThrIleGlnGluThrGlnGlyArgLeuSerAsn

CTCAGCATCGCCATGGTC(;GCGACCT~GTACGGCC~CCGTGCACTC~T~CCCAGGC~TGGCCAAGTTCGAA~CCGCTTC LeuSerIleALaMetVal(~lyAspLeuLysTyrGlyArgThrValHisSerLeuThrGlnAlaLeuAlaLysPheGluGlyAsnArgPhe

TACTTCATCGCCCCAGAC(;CGCTGGCGATGCCGGCCTACATCCT~TGCT~GAGAAAGGCATCGAGTACA~TC~AC~~ TyrPheIleAlaProAsplllaLeuFLLaMetProAlaTyrIleLeuLysMetLeuGluGluLysGlyIleGluTyrSerSerHisGlySer

ATTGAAGAAGTGGTGCCG(;AGCTG~TATTCTCTACATGACCCGGGTGCA~GAGCGCCTCGATCCGTCCGAGTACGCCAACGT~G IleGluGluValValPro~~luLeuAspIleLeuTyrMetThr~gValGlnLysGl~gLe~spProSerGluTyr~~snValLys

GCGCAGTTCGTGCTCGCC(;CGGATCTGGCCGGCGCGGCCAACCTCAAGGTGCTGCACCCGCTGCCGCGCATCGACGAGATCGCCACCGAC AlaGlnPheValLeufilal~~spLe~aG~yAl~l~snLeuLysValLeuHisProLeuProArgIleAspGluIleAlaThrAsp

G T G G A T A A A A C G C C G C A C ( ; T T A C T A C T T C C A G C A G G C G ValAspLysThrProHisAlaTyrTyrPheG1nGlnAlaGlyAsnGlyIlePheAlaArgSerAlaLeuAlaLeuValValAs~laAsp

TTGGCTCTTTBBCr"r4ilCCGCCATGACTCATGACAACAAACTGCAGGTCGAAGCGATCAAA~GC~~C~~G~~C~~~~~~~~~~~ LeuAlaLeuEnd SD MetThrHisAspAsnLysLeuGlnValGluAlaIleLysCysGlyThrValIleAspHisIlePro

GCGCAGATCGGTTTCAAA(:TGCTGACGCTGTTCAAGCTGACCGCCACCGACCAGCGCATCACCATCGGCCTGAACCTGCCCTCCAACGAG AlaGlnIleGlyPheLys~~euLeuThrLeuPheLysLeuThrALaThrAspGlnArgIleThrIleGlyLeuAsnLeuProSerAsnGlu

CTGGGCCGCAAGGATCTC~TCAAGATCGAG~CACCTTCCTGACCGA~AGCAGGCCAACCAACTGGCGATGTACGC~CGAA~CACG LeuGlyArgLysAspLeu~leLysIleGluAsnThrPheLeuThrGluGlnGlnAlaAsnGlnLe~aMetTyrAlaProLysA~a~h~

GTAAACCGCATCGA~~rATGAAGTGGTGCGCGC~~TGACCCTCAGCCTGCCGGACCACATCGAC~GTGCTGACCTGCCCGAACGGC ValAs~gIleAspAsn'ryrGluValVa~gLysLeuThrLeuSerLeuProAspHisIleAspGlyValLeuThrCysProAsnGly

AACTGCATCAGCCGCAGCI;AGCCGGTGCGGTCGAGCTTCAGCGT~TCGCGCGGC~GAAGTGCACCTGAAATGCCGCTACTGCGAA AsnCysIleSerArgSer~~~uProVal~g~erSerPheSerValLysSerArg~lyGlyGluVa~HisLeuLy~~y~~g~y~~~~~~~

AAAGAGTTCGAGCATCA~;TGGTGTTGCAGGCCGACTAAGCCC~~T~~CG~GATGGCGCTGTCATTCTCCC~TGACGCCCT LysGluPheGluHisGlnValValLeuGlnAlaAspEnd

ATAATGGGATTTCTGGAT.AGAACAATCCTCGTTTATCAGGAGAAAACATGTCACGTAACATCAGCACT~CTC~CCC~GCCATTG

GTCCTTACGTGCAGGGCGTTGATCTGGGCAGCATGATCATCACTTCGCAGATCCG 1785

FIG. 3. The nucleotide sequence for the PyrBI operon of S. marcescens. The putative leader region extends from residues +18 to +129; thepyrB gene extends from residues +192 to +1109; and thepyrl gene extends from residues +1125 to +1586. Consensus sequences for polymerase binding (-35, -10) and ribosomal binding ( S D ) are indicated for each of the open reading frames.

110

200

2 90

380

470

560

650

740

830

92 0

1010

1100

1190

1280

1370

1460

1550

1640

1730

16634 Aspartate Transcarbamoylase from S. marcescens

1 10 EC Met A l a ASn P r o L e u T y r G l n Sm Met A l a A s n P r o L e u T y r H i s

L y s H i s Ile Ile Ser I le A s n A s p L e u Ser A r g A s p A s p L y s H i s I le I le Ser I le A s n A s p L e u Ser A r g A s p A s p

10

30 L e u V a l L e u A l a T h r Ala Ala L y s L e u V a l L e u A l a Thr Ala Ala Gly

L e u L y s A l a A s n P r o Gln P r o Glu L e u L e u L e u L y s A l a A s n P r o Gln P r o G l u L e u L e u 30

40 50 Ec L y s H i s L y s V a l I le A l a Ser C y s P h e P h e Glu A l a Ser T h r A r g T h r A r g L e u Ser P h e Sm L y s H i s L y s V a l I le A l a Ser C y s P h e P h e G l u A l a Ser T h r A r g T h r A r g L e u Ser P h e

40 50

60 70 E c G l n T h r Ser Met H i s A r g L e u Gly Ala Ser V a l V a l Gly P h e Sm Glu T h r Ser Met H i s A r g L e u G l y Ala Ser V a l V a l G l y P h e

60 70

80 90 E c Ser L e u Gly L y s L y s Gly G l u T h r L e u Ala A s p T h r I l e Ser V a l I le Ser T h r T y r V a l Sm Ser L e u Gly L y s L y s Gly G l u Thr L e u Ala A s p T h r I l e Ser V a l I l e Ser T h r T y r V a l

30 90

100 EC ASP A l a I l e V a l Met A r g H i s P r o Gln Glu ~m ASP A l a I l e V a l Met A r g H i s P r o Gln Glu

100 110

120 130 E c Gly A s n V a l P r o V a l L e u Asn Ala Gly Asp Gly Sm Gly Asn V a l P r o V a l L e u Asn Ala Gly Asp G l y

Ser A s n Gln H i s P r o T h r G l n T h r L e u ... A s n Gln H i s P r o T h r Gln T h r L e u

120 130

180 190 EC A s p Gly A s n A r g P h e T y r P h e I l e Ala P r o A s p A l a L e u A l a Met P r o Sm Glu Gly A s n A r g P h e T y r P h e I l e Ala P r o A s p A l a L e u A l a Met P r o

180 190

200

230 A s p I le L e u T y r Met Thr Arg V a l Gln L y s Glu A r g L e u A s p P r o Ser G l u A s p I le L e u T y r Met T h r Arg V a l G l n L y s Glu A r g L e u A s p P r o Ser Glu

220 230

240 250 Ec T y r A l a A s n V a l L y s A l a G l n P h e V a l L e u A r g A l a Ser A s p L e u H i s A s n A l a L y s A l a Sm T y r A l a A s n V a l L y s A l a Gln P h e V a l L e u I A l a n . . . L ] A l a A l a G l y a ...L

240 250

270 L y s V a l L e u H i s P r o L e u P ro Arg L y s V a l L e u H i s Pro L e u P r o Arg

V a l A s p Glu I l e A l a T h r A s p V a l A s p L y S I l e A s p Glu I le A l a T h r A s p V a l A s p LYS

260 270

290 T y r P h e Gln Gln Ala G l y A s n Gly I l e P h e A l a A r g T y r P h e G i n Gln Ala G l y A s n G l y I l e P h e A l a A r g

280 290

300 305


most highly conserved of all interactions in the ATCases. In contrast, 4 of the 13 residues implicated in the interactions within the intra-equatorial binding domain have been changed Asp-203c-Ec to Glu-20lc-Sm, Trp-209c-Ec to Tyr- 207c-Sm, His-156c-Ec to Ser-154c-Sm, and Arg-25Oc-Ec to Ala-248c-Sm. In E. coli, these residues appear to be involved in a series of associations that contribute to the structural

TABLE I1 Amino acids involved in the binding of N-(phosphonacetyl)-L-

aspartate in the active :sites of aspartate transcarbamoyhe E. coli

ATCase” Interaction S. marcescew ATCase

Ser-52c Thr-53c Arg-54c

Thr-55c

Ser-8Oc Lys-84c

Arg-105c

His-134c Arg-167c

Arg-229c Gln-231c Leu-267c

H bond to phosphonate H bond to phosphonate Salt-link to phosphonate H bond to phosphonate H bond to phosphonate H bond to CO of peptide bond H bond to phosphonate H bond to phosphonate H bond to a-carboxylate H bond to &carboxylate Salt-link to phosphonate H bond to a-carboxylate H bond to CO of peptide bond H bond to CO of peptide bond H bond to a-carboxylate H bond to 0-carboxylate H bond to 0-carboxylate H bond to @-carboxylate H bond to NH of peptide bond

Ser-5% Thr-53c Arg-54c

Thr-55c

Ser-8Oc LYS-84~

Arg-105c

His-133c Arg-165c

Arg-227c Gln-22% Leu-264c

integrity of the equatorial domain. A comparison of the crystal structures of the native, unli-

ganded E. coli enzyme (Honzatko et al., 1982; Ke et al., 1984) and the PALA-associated enzyme (Krause et al., 1985, 1987) has revealed both tertiary and quaternary changes in the structure. One of the most significant changes involves a closure of the polar and the equatorial domain to restructure the active site. There is a major structural reorientation of the “240’s loop” (residues Val-230c-Ec to Ala-245c-Ec) during the homotropic transition of the enzyme. The importance of this loop in structural transitions of the E. coli ATCase holoenzyme has been verified by recent site-specific mutation studies, and the domain closure appears to be essential for the propagation of heterotropic responses (Kantrowitz and Lipscomb, 1988; Middleton and Kantrowitz, 1986; Wales et al., 1988). This region of the ATCase catalytic polypeptide is completely conserved in the S. marcescens enzyme.

The majority of the differences between the amino acid sequences of the catalytic polypeptides are scattered throughout the sequence. However, one region (Arg-250c-Ec to Met- 281c-Ec) contains 13 amino acid alterations. This region also shows extensive substitution in Bacillus subtilis (Lerner and Switzer, 1986), Salmonella typhimurium (Michaels et al., 1987), and Proteus uulgaris.’ This sequence corresponds to a structurally nondescript region on the surface of the molecule between the important 240’s loop and the p sheet S-10 (Fig. 1). In comparison studies with orinithine transcarbamoylase, it was observed that a significant portion of this region (Leu- 254c-Ec to Lys-262c-Ec) was absent in the ornithine trans-

‘ E. coli data from Krause et al. (1985, 1987) and Volz et al. (1986). * J. R. Wild and K. F. Foltermann, unpublished observations.

10 H i s Asp Asn Lys Leu Gln V a l Glu Ala I le Lys Arg

Gly Thr V a l Ile Asp His His Asp Asn Lys Leu Gln V a l Glu Ala I le Lys Cys Gly Thr V a l Ile Asp His

10

21 30 Ec Ile Pro Ala Gln Ile Gly Phe Lys Leu Leu Ser Leu Phe Lys Leu Thr Glu Thr Asp Gln Sm Ile Pro Ala Gln Ile Gly Phe Lys Leu Leu l T h r G ] A l a G 21

41 EC Arg Ile Thr Ile Gly Leu Asn Leu Pro Gly Arg Lys Asp Leu Ile Lys Sm Arg I l e Thr I l e Gly Leu Asn Leu Pro Gly Arg Lys Asp Leu Ile Lys 41

E c Ile Glu Asn Thr Phe Leu Ser Glu Asp Gln V a l Asp Gln Leu Ala Leu Tyr Ala Pro Gln Sm k ~ l T h r ~ G l n Q A l a A s n G ] M e t G P r o ] L y s 61

90 V a l Asn Arg I le Asp Asn Tyr Glu V a l V a l V a l Asn Arg Ile Asp Asn Tyr Glu V a l V a l

90 ,

Ala Asn Asp Ile ?.la Gly Gly Glu V a l His

141 , , 1:; , ,,l53 Ec Cys Glu Lys Glu Phe Ser His Asn V a l Val Leu ... Ala Asn End Sm Cys Glu Lys Glu Phe Glu His Gln V a l Val Leu Gln Ala Asp End 141 154

FIG. 5. A comparison of the p y r l gene product of E. coli (Ec) and S. marcescens (Sm) . Identical residues are boxed. Underlined regions emphasize areas of nonidentity.

16636 Aspartate Transcarbamoylase from S. marcescem

TABLE 111 Amino acids involved in the binding of CTP in the regulatory subunit

of aspartate transcarbamovlase

ATCase“ E. coli Interaction S. marcescens

ATCase Val-9r Ile-12r

Asp-19r His-POr Lys-56r

Lys-6Or

Tyr-89r Lys-94r Arg“96r

H bond to 2”OH H bond to 4-amino H bond to N3 H bond to 3’-OH [H bond to y-P04]* [H bond to 3’-OH] [H bond to y-P04] H bond to 2-keto H bond to 2’-OH H bond to 4-amino [H bond to a-P04) IH bond to a-PO41

Va1-K Ile-12r

Asp-19r His-20r Lys-56r

Lys-6Or

Tyr-89r Lys-94r Tvr-96r

E. coli data from Krause et al. (1985,1987) and Kim et al. (1987). * Bracketed interactions based on crystallographic data from Kim

et at. (1987) are speculative under conditions of this refinement. No direct interaction has been verified between the phosphate groups of CTP and residues of the regulatory chain.

TABLE IV ComDarison of enzvmatic characteristics of hvbrid ATCases

Effector‘

E. coli (C):S. marcescens (R) None CTP (+) ATP (+)

S. rnarcescens (C):E. coli (R) None CTP (-) ATP (+)

[SIO., aspb

mw

6.0 3.5 2.5

~~

125 200 80

Response‘

%

100 3.0 125 2.2 130 2.2

100 3.0 25 2.3

170 2.9 a 2 mM nucleotide concentration (+, activation; -, inhibition). * Concentration of aspartate (asp) required to obtain half-maximal

velocity at saturating carbamoyl phosphate concentrations. e Percent relative activity in the presence of 2 mM nucleotide

effector at the native [S]0.6 aspartate requirement for each holoenzyme and at saturating levels of carbamoyl phosphate.

qsPp was estimated from the slope of U O / ( V,, - vo) versus log[S].

carbamoylase polypeptide, while other regions were more highly conserved (Houghton et al., 1984; Van Vliet et al., 1984). Several other residues which have been directly implicated in the association between the catalytic and regulatory polypeptides of the E. coli enzyme (Honzatko et al., 1982; Ke et al., 1984; Krause et al., 1985, 1987) are different in the S. marcescens polypeptide. These include Leu-114c-Ec (Met- 113c-Sm), Ser-13lc-Ec (absent in S. marcescem), and Asp- 2OOc-Ec (Lys-198c-Sm). It has been proposed that Asp-2OOc- Ec may participate in interactions at the cata1ytic:regulatory chain interface (Krause et al., 1987), providing a key contact between the equatorial domain of the catalytic polypeptide and the allosteric domain of the regulatory polypeptide. These altered residues may be responsible for the catalytic paralysis observed in the Csm:Rec hybrid (Shanley et al., 1984). The fact that the reverse hybrid, Cec:Rsm, is catalytically efficient suggests that Lys-198r-Sm could be involved in the c1:rl domain of bonding. None of the other hybrid enzymes formed with the E. coli regulatory chain show such extreme aspartate requirements (Foltermann et al., 1986).

Much less data are available concerning the residues that are necessary for the structural and functional integrity of the regulatory polypeptide. Most of the data have been derived from crystallographic analyses (Honzatko et al., 1982; Volz et al., 1986; Kim et al., 1987); however, a recent study has shown that when six amino acids from X DNA were substituted for

the eight terminal amino acids of E. coli pyrl, the resulting holoenzyme lacked homotropic cooperativity and was insen- sitive to CTP, yet was subject to heterotropic activation by ATP (Cunin et al., 1985; Ladjimi et al., 1985). Four of the eight carboxyi-terminal amino acid residues differ between the regulatory polypeptides of E. coli and S. marcescem. These differences include the insertion of an additional residue (Gln- 152r-Sm) and may have some bearing on both heterotropic and homotropic responses of the enzyme.

As seen in Table 111, those residues which appear to bind to the effector CTP in E. coli (Kim et al., 1987) are present in the S. marcescem polypeptide, with the exception of Arg-96r- Ec, which has been replaced by Thr-96r-Sm, a nonconserva- tive change. Kim et al. (1987) has reported that the distance between Arg-96r-Ec and the cu-PO4 of CTP may be so large as to preclude direct interaction, although slight changes in torsion angles could permit hydrogen bonding. Thus, it is unclear whether this residue is critical for effector binding or propagation of heterotropic response. All of the reported regu1atory:regulatory polypeptide chain interactions are conserved, and most of the regu1atory:catalytic interactions are maintained, as mentioned previously. Only two proposed in- teractive differences were found in the S. marcescem regulatory polypeptide, and both are in the r130’s loop. The Glu- 204c-Ec::Lys-129r-E~ interaction, proposed to be involved in the contact of the equatorial domain with the allosteric domain in E. coli, is Glu-202c-Sm::Ser-l29r-Sm, another non- conservative difference; and the Asp-200c-Ec::Arg-128r-E~ interaction is changed to Lys-198c-Sm::Lys-128r-Sm.

The implications drawn from all of these comparisons are that the interactions necessary for direct substrate binding, CTP binding, and polypeptide conformation are present on the S. marcescem enzyme; however, the equatorial domain, principally involved in binding of aspartate, possesses most of the alterations which could promote subtle differences in enzymatic characteristics. Although the resulting holoenzyme is catalytically paralyzed, it is possible for the catalytic subunits of the s. marceseens ATCase to form stable holoenzymes with E. coli regulatory subunits and to participate in the native allosteric responses of the E. coli enzyme: ATP activation and CTP inhibition (Foltermann et al., 1986; Shanley et al., 1984). Conversely, the catalytically efficient reverse hybrid constructed with E. coli catalytic subunits and S. marcescem regulatory subunits displays the native allosteric responses of the S. marcescem enzyme: ATP activation and CTP inhibition, suggesting that the regulatory subunit confers its characteristic heterotropic response to the ATCase holoenzyme.

REFERENCES Allewell, N. (1987) Trends Biochem. Sci. 12,331-332 Allewell, N. (1989) Annu. Rev. Biophys. Chern., in press Bachmann, B. J., and Low, K. B. (1983) Microbiol. Rev. 44, 180-230 Bethell, M. R., and Jones, M. D. (1969) Arch. Biochem. Biophys.

Chang, A. C. Y., and Cohen, S. N. (1978) J. Bacteriol. 134, 1141-

Cohlberg, J. A., Pigiet, V. P., Jr., and Schachman, H. K. (1972)

Cunin, R., Jacobs, A., Charlier, D., Crabeel, M., Herve, G . , Glansdorff,

Dagert, M., and Ehrlich, S. D. (1978) Gene (Amst.) 6,23-28 Dayhoff, M. O., Barker, W. C., and Hardman, J. K. (1972) in Atlas

of Protein Sequence and Structure (Dayhoff, M. O., ed) pp. 53-66, The National Biomedical Research Foundation, Silver Spring, MD

Feller, A., Pierard, A., Glansdorff, N., Charlier, D., and Crabeel, M. (1981) Nature 292, 370-373

Foltermann, K. F., Wild, J. R., Zink, D. L., and O’Donovan, G. A. (1981) Curr. Microbiol. 6,43-47

134,352-365

1156

Biochemistry 11,3396-341 1

N., and Pierard, A. (1985) J. Mol. Biol. 186, 707-713

Aspartate Transcarbamoylase from S. marcescem 16637

Foltermann, K. F., Beck, D.-A., and Wild, J. R. (1986) J. Bacteriol.

Foote, J., Ikeda, D. M., and Kantrowitz, E. R. (1980) J. Bwl. Chem.

Gerhart, J. C. (1970) Curr. Top. Cell. Regul. 2 , 275-324 Gerhart, J. C., and Pardee, A. B. (1962) J. Bwl. Chem. 237,891-896 Gerhart, J . C., and Schachman, H. K. (1964) Biochemistry 4 , 1054-

Henikoff, S. (1984) Gene (Amst.) 28,351-359 Holmes, D. S., and Quigley, M. (1981) Anal. Biochem. 114,193-197 Honzatko, R. C., and Lipscomb, W. N. (1982) J. Mol. Biol. 160,265-

286 Honzatko, R. C., Crawford, J. L., Monaco, H. L., Ladner, J. G.,

Edwards, B. F. P., Evans, D. R., Warren, S. G., Wiley, D. C., Ladner, R. D., and Lipscomb, W. N. (1982) J. Mol. Biol. 160,219- 263

Hoover, T. A., Roof, W. D., Foltermann, K. F., O’Donovan, G. A., Bencini, D. A., and Wild, J. R. (1983) Proc. Natl. Acad. Sci. U. S.

Houghton, J . E., Bencini, D. A., ODonovan, G. A., and Wild, J. R.

Jacobson, G. R., and Stark, G. R. (1973) in The Enzymes (Boyer, P.

Kantrowitz, E. R., and Lipscomb, W. N. (1988) Science 241 , 669-

Kantrowitz, E. R., Pastra-Landis, S. C., and Lipscomb, W. N. (1980a)

Kantrowitz, E. R., Pastra-Landis, S. C., and Lipscomb, W. N. (1980b)

Ke, H. M., Honzatko, R. B., and Lipscomb, W. N. (1984) Proc. Natl.

Kelmers, A. D., Phares, C. W., and Novelli, G. D. (1971) Methods

Kim, K. H., Pan, Z., Honzatko, R. B., Ke, H. M., and Lipscomb, W.

Konigsberg, W. H., and Hendersen, L. (1983) Proc. Natl. Acad. Sci.

Krause, K. L., Volz, K. W., and Lipscomb, W. N. (1985) Proc. Natl.

Krause, K. L., Volz, K. W., and Lipscomb, W. N. (1987) J. Mol. Biol.

Ladjimi, M. M., Ghellis, C., Feller, A., Cunin, R., Glansdorff, N.,

Lerner, C. G., and Switzer, R. L. (1986) J. Biol. Chem. 261 , 11156-

Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular

167,285-290

255,5154-5158

1062

A. 80,2462-2466

(1984) Proc. Natl. Acad. Sci. U. S. A. 81,4864-4868

D., ed) Vol. 8, pp. 225-30;3, Academic Press, New York

674

Trends Biochem. Sci. 5 , 1.24-128

Trends Biochem. Sci. 6 , 1.50-153

Acad. Sci. U. S. A. 81,4037-4040

Enzymol. 20,3-9

N. (1987) J. Mol. Biol. 196,853-875

U. S. A. 80,2467-2471

Acad. Sci. U. S. A. 8 2 , 1643-1647

193,527-553

Pierard, A., and Herve, G.. (1985) J. Mol. Biol. 186 , 715-724

11165

Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

Messing, J. (1983) Methods Enzymol. 101,20-79 Messing, J., and Vieira, J . (1982) Gene (Amst.) 19 , 269-276 Michaels, G., Kelln, R. A., and Nargang, F. E. (1987) Eur. J. Biochem.

Middleton, S. A., and Kantrowitz, E. R. (1986) Proc. Natl. Acad. Sci.

Munch-Peterson, A., and Neuhard, J. (1964) Biochim. Biophys. Acta

Norrander, J., Kempe, T., and Messing, J. (1983) Gene (Amst.) 261 , 101-106

O’Donovan, G. A., Holoubek, H., and Gerhart,. J. C. (1972) Nature New Biol. 238,264-266

Pauza, C. D., Karels, M. J., Navre, M., and Schachman, H. K. (1982) Proc. Natl. Acad. Sci. U. S. A. 79,4020-4024

Roof, W. D., Foltermann, K. F., and Wild, J. R. (1982) Mol. Gen. Genet. 187,391-400

Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467

Schachman, H. K., Pauza, C. D., Navre, M., Karels, M. J., Wu, L., andYang, Y. R. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,115-119

Shanley, M. S., Foltermann, K. F., O’Donovan, G. A,, and Wild, J. R. (1984) J. Bwl. Chem. 269,12672-12677

Smith, K. A., Nowlan, S. F., Middleton, S. A., O’Donovan, C., and Kantrowitz, E. F. (1986) J. Mol. Biol. 189,227-238

Turnbough, C. L., Hicks, K. L., and Donahue, J. P. (1983) Proc. Natl. Acad. Sci. U. S. A. 80,368-372

Van Vliet, F., Cunin, R., Jacobs, A., Piette, J., Gigot, D., Lauwereys, M., Pierard, A., and Glansdorff, N. (1984) Nucleic Acids Res. 12 , 6277-6289

Volz, K. W., Krause, K. L., and Lipscomb, W. N. (1986) Biochem. Bwphys. Res. Commun. 136,822-826

Wales, M. E., Hoover, T. A., and Wild, J. R. (1988) J. Biol. Chem.

Weber, K. (1968) Nature 218 , 1116-1119 Wild, J. R., Belser, W. L., and O’Donovan, G. A. (1976) J. Bacteriol.

Wild, J . R., Foltermann, K. F., and O’Donovan, G. A. (1980) Arch.

Wild, J. R., Foltermann, K. F., Roof, W. D., and O’Donovan, G. A.

Wild, J . R., Johnson, J. L., and Loughrey, S. J. (1988) J. Bacteriol.

Wiley, D. C., and Lipscomb, W. N. (1968) Nature 2 1 8 , 1117-1121 Yates, R. A., and Pardee, A. B. (1956) J. Biol. Chem. 221, 743-756

166,55-61

U. S. A. 83,5866-5870

80,542-551

263,6109-6114

128,766-775

Biochem. Biophys. 201,506-517

(1981) Nature 292 , 373-375

170,446-448

Documents

Comparison of the Aspartate Transcarbamoylases …Comparison of the Aspartate Transcarbamoylases from Serratia marcescens and Escherichia coli* (Received for publication, December