BRIEF REPORT

Comparison of complete polyprotein sequences of two isolatesof salmon alphavirus (SAV) type I and their behaviourin a salmonid cell line

Iveta Matejusova • Katherine Lester •

Ziduo Li • Jimena Bravo • Fiona Bland •

Bertrand Collet

Received: 12 June 2012 / Accepted: 25 February 2013

� Springer-Verlag Wien 2013

Abstract Salmon pancreas disease virus is an alphavirus

(family Togaviridae) affecting mainly Atlantic salmon

(Salmo salar L.). Both polyprotein sequences of the Scot-

tish isolate (SAV4640) were determined and compared

with those of Irish isolate SAVF93-125. High amino acid

sequence similarity (99.4 %) was found. Six amino acid

deletions were found in the E2 gene of SAV4640.

SAVF93-125 demonstrated a high viral load in culture

despite high Mx expression. Approximately 50 % of cells

infected with SAVF93-125 exhibited a cytopathic effect by

day 8. SAV4640 successfully entered the cells, inducing

10,500-fold higher Mx expression at day 2 compared to

SAVF93-25; however, no replication was observed based

on results of the nsP1 qRT-PCR.

Keywords SPDV � SAV � Atlantic salmon � nsP1 � TO �GAG � Virulence

Pancreas disease (PD) in farmed Atlantic salmon Salmo

salar L. was first recognized in Scotland in 1976 and has

continued to cause serious economic losses in Europe.

Salmon pancreas disease virus belongs to the genus

Alphavirus (family Togaviridae). The genome of salmonid

alphavirus (SAV) is approximately 12 kb long, with two

open reading frames (ORFs) of 8 and 4 kb in length,

flanked by three untranslated regions. Despite similarities

in the genome organization to the mammalian alphavirus-

es, there is only approximately 40 % and 30 % amino acid

similarity in the non-structural and structural polyproteins,

respectively, between the two groups [15].

The diversity of salmon alphaviruses has been investi-

gated, and six subtypes can be distinguished based on

partial E2 and nsP3 genes. Pancreas disease affecting

mainly Atlantic salmon (Salmo salar) in the marine envi-

ronment around Ireland and the United Kingdom is asso-

ciated with subtypes I, II, IV, V and VI. The nucleotide

sequence divergence among the subtypes is relatively high

(3.4-28.1 %) based on partial nsP3 and E2 sequences.

Genetic diversity within the subtypes is generally low

(\5 %); however, in the case of a partial nsP3 fragment,

the variability within subtype II reaches up to 6.6 % [3].

The present study aimed to obtain the complete polyprotein

gene sequences of SAV subtype I to provide additional

information on variation within one of the most common

SAV subtypes in the UK.

Isolates SAVF93-125 (Ireland, passage number 13,

accession number AJ316244) and SAV4640 (Scotland,

passage number 3) were propagated in Chinook salmon

(Oncorhynchus tshawytscha) embryo cells (CHSE-214,

ATCC CRL 1681) for 7 days [11] and quantified using the

TCID50 technique. Six-well plates of TO cells (passage no.

P95) [16] were inoculated (MOI 0.01) and incubated at

15 �C. On days 1, 2, 3, 4, 6 and 8 after inoculation, the

cells in three infected and un-infected (control) wells were

lysed and harvested by draining the culture medium and

adding 600 ll RLT buffer (QIAGEN) with 1 % ß-

mercaptoethanol (Sigma).

Total RNA was extracted using an RNeasy Mini Kit,

(QIAGEN), and cDNA was synthesized using a TaqMan

Reverse Transcription Reagent Kit (Applied Biosystems),

in final volume of 25 ll. Seven overlapping PCRs were

performed in triplicate (KOD Hot Start DNA polymerase

kit, Merck). Primer sequences and annealing temperatures

I. Matejusova (&) � K. Lester � Z. Li � J. Bravo � F. Bland �B. Collet

Marine Scotland Science, 375 Victoria Road,

Aberdeen AB11 9DB, Scotland, UK

e-mail: Iveta.Matejusova@scotland.gsi.gov.uk

123

Arch Virol

DOI 10.1007/s00705-013-1689-4

are summarized in Table 1. Purified products (MinElute

Gel Extraction Kit, QIAGEN) were sequenced using a

GenomeLab DTCS Quick Start Kit (Beckman Coulter).

The viral load was measured as transcription of the nsP1

gene [6]. Antiviral response was measured as expression of

the Mx gene normalized against ELF-1a [13], using the

Pffafl method [14]. Real-time RT-PCR was performed as

described [12]. Differences in nsP1 and Mx expression

were tested by one-way analysis of variance, and the level

of expression at a given time point was compared to that on

day 1 by Tukey’s multiple comparison test (Minitab for

Windows).

For the SAV4640 isolate, the open reading frame (ORF)

encoding the non-structural proteins was 2,601 amino acids

(7,803 nt) long, and the ORF encoding the structural pro-

teins was 1,314 amino acids (3,942 nt) long. A non-trans-

lated junction region, situated between two ORFs, was 38 nt

long. The overall amino acid similarity between two iso-

lates reached 99.46 % and 98.71 % for the non-structural

and structural genes, respectively (Table 2). With respect to

the previously published results [3], the divergence between

two SAV type I isolates doubled (2.24 %) when the com-

plete E2 sequence was used for comparison. The observed

differences between two SAV type I isolates might be a

consequence of geographic variation, as one Irish and one

Scottish isolates were compared, while Fringuelli et al. [3]

compared isolates exclusively circulating in Irish aquacul-

ture. Another explanation might be that the observed

divergence reflects the ability of this virus to change and

adapt in the cell culture environment. For terrestrial al-

phaviruses, several different mutations associated with

differential binding to surface glycosaminoglycans such as

heparin sulfate (HS) [8] are located in a stretch of E2,

between amino acids positions 4 and 230 [1, 5, 8]. There

were a total of twelve amino acid differences in the E2

glycoproteins of SAVF93-125 and SAV4640. The only

substitution that might possibly contribute to an overall

change in the charge of E2 amino acid side chains of

SAV4640 is the tyrosine-histidine substitution at aa position

373. Therefore, it is unlikely that variation in the HS-

dependent binding itself is responsible for the observed

differences in kinetics of these two isolates in TO cells.

Changes in the amino acid sequence following serial

passages in the CHSE-214 cell line have been observed in

SAV type III [7]. Four amino acid substitutions in nsP2,

nsP3 and E2 have been reported in relation to serial pas-

sages in cell culture. Of these, three substitutions occurred

between passages 13 and 20 and appeared to be associated

with the occurrence of a rapid CPE. Both isolates investi-

gated in the present study shared some amino acid changes

found in the high-passage-number SAV type III isolate: for

example, the change from serine to proline in E2 position

206 aa. In addition, SAVF93-125, a high-passage-number

isolate for which CPE was observed, contained threonine at

position 375 of E2, while SAV4640 (a low-passage-num-

ber isolate) contained isoleucine, like the pre-passaged

SAV type III [7]. There is also a possibility that the sub-

stitution at position 375 of E2 might be associated with the

presence of CPE. However, this observation will need to be

fully investigated and confirmed in a follow-up study.

For SAVF93-125, no significant difference in nsP1 was

found between days 1, 2 and 3 (P[0.05). At day 4, the level

of SAVF93-125 nsP1 expression was significantly higher

than at day 1 postinfection (P\0.05), with an increasing

Table 1 PCR primer sets for amplification of the SAV4640 genome. The positions of the primers relate to their positions within the alignment of

the available full-genome sequence of SAV (GenBank accession numbers AJ316244, AJ316246, and AY04236-AY604238))

Viral gene Primer name Primer sequence (5’-3’) Annealing temperature Fragment size (bp) Primer position

nsP1 nsP1forward

nsP1reverse

AGCATACATATATCAATGATGCTAAA

GAAKGCCGTGATKACTTTCA

55 1,750 26-48

1,748-1,767

nsP2 nsP2forward

nsP2reverse

TGCAYGAGTTGACAGAGGARGAG

ACTTCRTCTTCGGCAGTGATGAT

62 2,765 1,574-1,596

4,320-4,343

nsP3 nsP3forward

nsP3reverse

CGTAYAAAATGCTGGCGAGR

CCGTWGTGTTGTTTGTCTGG

55 1,850 4,214-4,233

6,057-6,076

nsP4 nsP4forward

nsP4reverse

GGCCYYGGAGGGTATATATT

TGGTGAATTGCATGGGAAAC

60 1,900 5,995-6,014

7,874-7,893

Capsid, E3 capsidE3forward

capsidE3reverse

CAACCATGTTTCCCATGCAA

GCGATYATRTGTGTGTCGT

55 1,100 7,867-7,886

8,962-8,980

E2 E2forward

E2reverse

TCATTGCYGTCACCACCTGC

GGTCCACAYGTAGGCAATG

60 1,390 8,893-8,912

10,268-10,286

6K, E1 6KE1forward

6KE1reverse

ACCAYTGACCGCACTGACT

GACTCATCCTACTCCCTGTGG

66 1,700 10,196-10,214

11,880-11,901

I. Matejusova et al.

123

trend in viral load until day 6 (P\0.001), when signs of the

cytopathic effect (CPE) started to appear. The significant

decline in SAVF93-125 nsP1 expression at day 8 (Fig. 1)

coincided with cells being destroyed by the CPE (40-50 %

cells). There was no evidence of SAV4640 replication in

TO cells, as the expression of nsP1 did not increase over

the time of infection, and no CPE was reported until the

experiment was terminated at day 8 (Fig. 1). Significant

differences in nsP1 expression were found between the

studied isolates, with over 500-fold difference (P\0.05) at

day 4 and over 5,000-fold difference (P\0.001) at day 6.

On the other hand, higher Mx induction was reported for

SAV4640 from day 1, and throughout the experiment, its

levels remained similar and always significantly higher

than for SAVF93-125. In contrast to this, a significant

increase in Mx induction was observed in the first couple of

days after infection with SAVF93-125 isolates, followed

by a gradual decrease until the experiment was terminated

at day 8 (Fig. 1).

The antiviral Mx protein has been shown previously to

induce resistance in fish cells against yellow grouper ner-

vous necrosis virus or IPNV [9]. In contrast, no interferon

activity was detected in Atlantic salmon infected with SAV

type II [2]. Conversely, high induction of IFN-induced

genes was also observed in TO cells after infection with

SAV type II [4]. The present study demonstrated an ability

of SAV subtype I to induce a type I IFN response, and

significant differences (a 10,500-fold difference at day 2) in

induction of Mx by these two isolates were found. Our

results showed that SAVF93-125 induced a significantly

lower Mx response throughout the experiment, and the

viral load was rapidly increasing between days 4 and 6,

after which CPE occurred. On the other hand, SAV4640

induced significantly higher Mx expression, and the level

of nsP1 was never found to be significantly higher than it

Table 2 Summary of deduced amino acid sequence differences

between isolates SAVF93-125 and SAV4640. The positions of the

substitutions relate to their positions within each individual gene. Nt,

nucleotide; aa, amino acid; UTR, un-translated region. 1 amino acids

whose side chains have similar biochemical properties, 2 changes

from negative to positively charged aa side chains

Gene Size

(aa)

% nucleotide sequence

identity (nt differences)

% amino acid sequence

identity (aa differences)

Conservative

substitutions1Semi-conservative

substitutions2Radical

substitutions

Deletions

nsP1 562 99.53 (8 nt) 99.47 (3 aa) N18D, A473S G67D

nsP2 859 99.61 (10 nt) 99.53 (4 aa) F241L, F372I,

R785K

W832R

nsP3 571 99.36 (11 nt) 99.47 (3 aa) Q545R Y212S,

L352P

nsP4 609 99.34 (12 nt) 99.34 (4 aa) S229N, R393E,

A415V

E312V

Capsid 282 99.65 (3 nt) 99.29 (2 aa) C130R,

R205G

E3 71 97.18 (6 nt) 97.18 (2 aa) E39K V4A

E2 432 97.76 (29 nt) 97.22 (12 aa) M56I, Y373H S197N, S418P S222L,

T375I

TSPAAF in

SAV4640

6K 68 100 100

E1 461 99.64 (5 nt) 99.78 (1 aa) P415S

A

0

100

200

300

400

500

600

0 1 2 3 4 5 6 7 8 9

Time post infection (d)

nsP

1 ex

pres

sion

leve

l rel

ativ

e to

ELF

F93-1254640

*

***

**

*

B

0

2000

4000

6000

8000

10000

12000

14000

16000

18000

0 1 2 3 4 5 6 7 8 9

Time post infection (d)

MX

Fo

ld in

crea

se r

elat

ive

to c

on

tro

l

F93-1254640

*

*

**

*

*

Fig. 1 A Kinetics of nsP1 expression. Data represent mean values ±

SE (N = 3). B Kinetics of expression of the MX gene. Data represent

the fold increase of Mx relative to the uninfected control ± SE (N=3).

The level of significance is indicated as follows: *p\0.05; **p\0.01;

and ***p\0.001; calculated from the comparison tests for the two

isolates

Polyprotein sequences of salmon alphavirus type I isolates

123

was on day 1 postinfection, suggesting a lack of replica-

tion. The high level of Mx induction in cells infected with

SAV4640 would suggest that this virus had entered the

cells successfully, but its replication might have been

affected by the accumulation of Mx, as was recently

observed in CHSE cells [10].

In conclusion, comparison of two SAV I isolates

revealed amino acid substitutions in all SAV viral genes,

with the exception of 6K. The most significant variation

was observed in E2, including a 6-aa deletion in the

SAV4640 isolate. In addition, this isolate induced signifi-

cantly higher Mx expression than SAVF93-125 throughout

the experiment, despite the lack of replication as demon-

strated by the nsP1 qRT-PCR. Further research, including

development of an infectious clone, are ongoing and nec-

essary to explain potential functional differences between

these two isolates.

Acknowledgments ZL was supported by the British Council

(IAESTE). JB was supported by the Canary Islands Government

(PI042002/153).

References

1. Byrnes AP, Griffin DE (2000) Large-plaque mutants of Sindbis

virus show reduced binding to heparan sulphate, heightened

viremia, and slower clearance from the circulation. J Virol

74:644–651

2. Christie KE, Graham DA, McLoughlin MR, Villoing S, Todd D,

Knappskog D (2007) Experimental infection of Atlantic salmon

Salmo salar pre-smolts by i.p. injection with new Irish and

Norwegian salmonid alphavirus (SAV) isolates: a comparative

study. Dis Aquat Organ 75:13–22

3. Fringuelli E, Rowley HM, Wilson JC, Hunter R, Rodger H,

Graham DA (2008) Phylogenetic analyses and molecular epide-

miology of European salmonid alphaviruses (SAV) based on

partial E2 and nsP3 gene nucleotide sequences. J Fish Dis

31:811–823

4. Gahlawat SK, Ellis AE, Collet B (2009) Expression of interferon

and interferon-induced genes in Atlantic salmon Salmo salar cell

lines SHK-1 and TO following infection with salmon alphavirus

SAV. Fish Shellfish Immunol 26:672–675

5. Heil ML, Albee A, Strauss JH, Kuhn RJ (2001) An amino acid

substitution in the coding region of the E2 glycoprotein adapts

Ross River virus to utilize heparan sulphate as an attachment

moiety. J Virol 75:6303–6309

6. Hodneland K, Endresen C (2006) Sensitive and specific detection

of Salmonid alphavirus using real-time PCR (TaqMan�). J Virol

Methods 131:184–192

7. Karlsen M, Hodneland K, Endresen C, Nylund A (2006) Genetic

stability within the Norwegian subtype of salmonid alphavirus

(family Togaviridae). Arch Virol 151:861–874

8. Klimstra WB, Ryman KD, Johnston RE (1998) Adaptation of

Sindbis virus to BHK cells selects for use of heparan sulphate as

an attachment receptor. J Virol 72:7357–7366

9. Larsen R, Rokenes TP, Robertsen B (2004) Inhibition of infec-

tious pancreatic necrosis virus replication by Atlantic salmon

Mx1 protein. J Virol 78:7938–7944

10. Lester K, Hall M, Urquhart K, Gahlawat S, Collet B (2012)

Development of an in vitro system to measure the sensitivity to

the antiviral Mx protein of fish viruses. J Virol Methods 182:1–8

11. Lopez-Doriga MV, Smail DA, Smith RJ, Domenech A, Castric J,

Smith PD, Ellis AE (2001) Isolation of salmon pancreas disease

virus (SPDV) in cell culture and its ability to protect against

infection by the ‘wild-type’ agent. Fish Shellfish Immunol

11:505–522

12. Matejusova I, McKay P, McBeath AJA, Collet B, Snow M (2008)

Development of a sensitive and controlled universal real-time

RT-PCR assay to screen for the presence of viral haemorrhagic

septicaemia virus (VHSV) in the salmonid aquaculture industry

in Scotland. Dis Aquat Org 80:137–144

13. McBeath AJA, Snow M, Secombes CJ, Ellis AE, Collet B (2007)

Expression kinetics of interferon and interferon-induced genes in

Atlantic salmon (Salmo salar) following infection with infectious

pancreatic necrosis virus and infectious salmon anaemia virus.

Fish Shellfish Immunol 22:230–241

14. Pffafl MW (2001) A new mathematical model for relative

quantification in real-time RT-PCR. Nuc Acid Res 29:2002–2007

15. Weston J, Villoing S, Bremont M, Castric J, Pfeffer M, Jewhurst

V, McLoughlin M, Rodseth O, Christie KE, Koumans J, Todd D

(2002) Comparison of two aquatic alphaviruses, salmon pancreas

disease virus and sleeping disease virus, by using genome

sequence analysis, monoclonal reactivity, and cross-infection.

J Virol 76:6155–6163

16. Wergeland HI, Jakobsen RA (2001) A salmonid cell line (TO) for

production of infectious salmon anemia virus (ISAV). Dis Aquat

Org 44:183–190

I. Matejusova et al.

123