Comparative Study of Phenotypic and Genotypic … PDF/3/7.pdfIsolated from Urinary Tract Infections in Mansoura Hospitals ... Urology and Nephrology Center (UNC), Mansoura University,

Egyptian Journal of Medical Microbiology, July 2011 Vol. 20, No. 3

67

Comparative Study of Phenotypic and Genotypic Expression of some Virulence Factors in Escherichia Coli and Klebsiella Pneumoniae Isolated from Urinary Tract Infections in Mansoura Hospitals

El-Naggar W. (1), Hassan R.(1), El-Sawy E. (2), Abd El Galil K. (1) and El-Mahdy A. (1)

(1)Microbiology Department, Faculty of Pharmacy, Mansoura University, Egypt (2) Urology and Nephrology Center (UNC), Mansoura University, Egypt.

ABSTRACT

Aim: The aim of this study is to estimate the phenotypic characters of some virulence factors in Escherichia coli and Klebsiella pneumoniae isolated from urinary tract infections and their relative gene expression level. Methods: Escherichia coli and Klebsiella pneumoniae clinical isolates were collected, identified. Their antimicrobial sensitivity pattern was determined. The presence of different virulence factors were evaluated. Relative expression level of different genes responsible for the appearance of the tested virulence factors was evaluated using QRT-PCR and PCR. Results: In this study, when testing the expression level of some genes like BssS and iss genes in E. coli, we found that quinolone sensitive isolates of E. coli had shown higher expression level of the tested genes than that of quinolone resistant E. coli isolates. These results agreed with the phenotypic characters of the tested virulence factors for the same isolates. On the other hand, in K. pneumoniae tested isolates, the expression level of BssS and fimH genes was evaluated and they showed higher expression level in quinolone resistant isolates than sensitive ones. These results agreed with the phenotypic characters of the tested virulence factors for the same isolates. PCR detection of iss gene on both plasmid and chromosomal DNA in K. pneumoniae isolates has demonstrated that isolates that exhibit iss gene on both chromosomal and plasmid DNA were those that had shown higher expression at the genetic and phenotypic levels.

INTRODUCTION

Urinary tract infections (UTIs) in humans are the most frequent bacterial disease, affecting both inpatients and outpatients. Especially the uncomplicated cases are mainly due to extraintestinal pathogenic E. coli (ExPEC)(1). In gram negative bacteria, the most common virulence factor identified was biofilm formation, as biofilm formation protects bacteria from hydrodynamic flow conditions, for example in the urinary tract, also against phagocytosis and host defense mechanisms, as well as antibiotics(2). More than 50% of all bacterial infections reported involve biofilm formation(3). A cascade of several precisely, tightly regulated events are required for proper biofilm formation.

Serum resistance has been shown in numerous bacterial systems to be critical for the survival of certain invading bacteria and the establishment of disease, since mutations which result in the loss of serum resistance render several bacterial pathogens avirulent(4). Hemolysin production is associated with pathogenicity of isolates, especially the more severe forms of infection. It has been suggested that colonization with hemolytic strains of E. coli is more likely to develop into urinary tract infections. Although hemolysis is not essential

for establishment of acute pyelonephritis, it may contribute to tissue injury, survival in renal parenchyma and entry into blood stream(5).

Many gram negative bacteria, including a majority of E. coli strains may express up to 300–500 copies of Type 1 fimbriae on their outer membranes enabling them to bind to mannosylated residues of bladder or intestinal epithelial cell surface proteins. In recent years, management of UTIs has become increasingly problematic due to the emergence of resistance to first-line antibiotics among the causative bacteria, particularly among uropathogenic E. coli (UPEC) and K. pneumoniae strains. This phenomenon involves quinolones (Q) and fluoroquinolones (FQ)(6)

, drugs of paramount importance in the treatment of several other infectious diseases. Indeed, the renal excretion of these molecules and the availability of oral and parenteral formulations have allowed them to compete with aminoglycosides and betalactams in the therapy of complicated UTIs, especially in the hospital setting. Their appropriate spectrum and good tolerability have also led to increased empirical adoption in uncomplicated infections, although their usage for these conditions in outpatients is still under debate. In E. coli, as in other gram-negative bacteria, DNA gyrase, which codifies type II DNA topoisomerases, is the main target of Q


68

and FQ, and mutation in gyrA is the most common way to acquire resistance. In this connection, several investigations have shown that Q- and FQ-resistant UPEC strains display overall reduced virulence and invade compromised patients. By contrast, susceptible E. coli strains are virulent and affect uncompromised hosts.

There is clear evidence that the relationship among virulence properties of E. coli, phylogenetic background, and antibiotic resistance is a complex phenomenon, resulting from their different interplays. Therefore, we thought that these possibilities were not mutually exclusive. It is also possible that the geographic source of isolates represents an important additional element to be taken into consideration(7)

. The analysis of a collection of UPEC strains from a particular region may therefore be useful in order to correlate the patterns of antibacterial resistance with local trends in the human usage of antibiotics and/or consumption of animal products.

In this study, we evaluated the phenotypic and genotypic expression of some virulence factors in Escherichia coli and Klebsiella pneumoniae isolated from urinary tract infections in Mansoura Hospitals.

MATERIALS & METHODS 1. Clinical strains:

Forty clinical isolates of Escherichia coli and thirty-nine isolates of Klebsiella pneumoniae were isolated and identified from Urology and Nephrology Center (UNC), Mansoura, Dakahlia governorate, Egypt. All the bacterial isolates were obtained from urine clinical specimens. The specimens were processed immediately using standard procedures and were identified according to Barrow and Feltham, 1993(8) and Collee et al., 1996(9)

. 2. Antimicrobial Susceptibility Testing:

The antimicrobial susceptibility testing of the identified bacterial isolates were carried out according the standard disc diffusion method(10) and the following antimicrobials were used: ampicillin, amoxicillin/clavulanic acid, cefoxitin, ceftazidime, cefotaxime, imipinem, amikacin, gentamicin, netlimicin, tobramycin, ciprofloxacin, norfloxacin, ofloxacin, nitrofurantoin and trimethoprim/ sulphamethoxazole. The results were interpreted as susceptible, intermediate, or resistant, based on the criteria listed in the National Committee for Clinical Laboratory Standards(11)

.

3. Phenotypic Detection of Virulence Factors: a) Quantitative analysis of biofilm formation

Microtiter plate assay was used to determine slime production and biofilm formation(12 & 13). Briefly, overnight growth of bacteria on Colombia agar plates was subcultured onto TSA supplemented with 0.25% glucose. The optical densities of bacterial suspensions were adjusted to 1 McFarland turbidity and aliquots of 100 µl were inoculated into evenly to six parallel wells of a sterile 96-well flat bottomed polystyrene microtiter plate (negative control wells contain broth only). After 24 h incubation at 37˚C, the content of each well was rinsed three times with PBS (pH 7.4). The plates were vigorously shaken in order to remove all non-adherent cells. The remaining attached bacteria were fixed with 150 µl per well of absolute methanol and after 15 minutes, plates were emptied and left to dry, then stained by adding crystal violet (1%W/V) for 20 minutes. Excess stain was rinsed off and the plates were air dried. The dye bound to the adherent cells was resolubilized with 33% (V/V) of glacial acetic acid and the optical density (OD) of each well was measured at 492 nm using ELISA reader. For each clinical isolate, the mean OD of the six wells was calculated (ODT). The cut-off OD (ODc) was defined as three standard deviations above the mean OD of the negative control wells. The tested isolated strains were classified as follows: ODT ≤ ODc non- adherent ODT > ODC [≤ 2 ODC] weakly adherent ODT > 2 ODC [≤ 4 ODC] moderately adherent ODT > 4 ODC strongly adherent b) Haemagglutination

The haemagglutination was detected by clumping of erythrocytes by fimbriae of bacteria in the presence of D-mannose. This test was carried out as in the direct bacterial haemagglutination test – slide method. Isolates were inoculated into 1% nutrient broth and incubated at 37°C for 48 hours for full fimbriation. A panel of red blood cells was selected by obtaining blood from human (blood group 'O'). The red blood cells were then made up to a 3% suspension in fresh saline (used within one week). On a glass slide, one drop of the RBC suspension was added to a drop of the broth culture and the slide was rocked at room temperature for 5 minutes. Presence of clumping was taken as positive for haemagglutination. Mannose-sensitive haemagglutination was detected by the absence of haemagglutination in a parallel set of test in


69

which a drop of 2% w/v D-mannose was added to the red cells and a drop of broth culture. Mannose-resistant haemagglutination was detected by the presence of haemagglutination of 3% 'O' group human RBC suspension in the presence of 2% D-mannose(14)

. c) Serum Resistance

Serum resistance was analyzed using a turbidmetric assay. One hundred and fifty microliters of serum was mixed with 50 µl of bacterial suspension in a 96 well microplate. Each isolate was tested in duplicate and negative controls (0.9% NaCl instead of serum) were included. The initial absorbance at 620 nm was measured, and compared with the absorbance after 3 hours of incubation, using a microplate reader. The final absorbance was determined as the average of the two replicates, and the percentage remaining absorbance relative to the initial absorbance was calculated. If the remaining absorbance after 3 hours (OD620, 3 h) was higher than 100% ( relative to the initial absorbance), isolates were designated serum resistant and less than 100% were considered sensitive(15)

. 4. Genotypic analysis of virulence factors a) Total RNA Isolation

Total RNA of 18 isolates (10 E. coli and 8 K. pneumoniae) was prepared using SV Total RNA isolation system Cat. No. Z3100 supplied by Promega Corporation according to promega protocol 2009. Briefly, an overnight bacterial culture was grown in LB media at 37 °C. The following day, the culture was diluted 1:50 and allowed to grow until the OD600 is 0.6–1.0. The suspension was then centrifuged and the supernatant was carefully removed, leaving the pellet as dry as possible. The pellets were resuspended in 100 µl of freshly prepared TE containing 0.4 mg/ml lysozyme then incubated at RT for 3-5 min. RNA Lysis Buffer was added to the resuspended pellet. RNA Dilution Buffer was added. The cleared lysate solution was transferred to a fresh microcentrifuge tube where 95% ethanol was then added and the mixture was transferred to the spin column, which was centrifuged. RNA Wash Solution was added to the spin column that was centrifuged and the collection tube was emptied. For each RNA isolation to be performed, the DNase I incubation mix was applied directly to the membrane inside the Spin Basket and incubated for 15 min. at 20-25 °C. After this incubation, DNase Stop Solution was added to the spin column which was then centrifuged. RNA Wash solution was added to the spin column and centrifugation was performed and the solution in the collection tube was

discarded. RNA Wash solution was added to the spin column that was centrifuged at high speed for 2 minutes, then the spin basket was transferred to 1.5 ml elution tube and finally 50µl nuclease-free water were added to the membrane and the microcentrifuge tube was centrifuged at 12,000-14,000 xg for 1 minute. The elution tube was capped and stored at -80°C. b) First Strand cDNA Synthesis

i. DNaseI treatment: Prior to cDNA synthesis, RNA was treated

with DNase I, RNase-free to remove trace amounts of genomic DNA. To an RNase-free tube, 1 µg of RNA was added to 1u of DNaseI and 10X reaction buffer. This mixture was incubated at 37 °C for 1 hour, then 1 µl of 50 mM EDTA was added and the mixture was then incubated at 65 °C for 10 min. The prepared RNA was used as template for reverse transcriptase. ii. First strand cDNA synthesis:

First strand cDNA of 18 isolates (10 E. coli and 8 K. pneumoniae) was prepared using RevertAid™ H Minus First Strand cDNA Synthesis Kit Cat. No. #K1631supplied by Fermentas. To an RNase-free tube, RNA was added at a concentration ranging between 0.1ng – 5 µg and mixed with random hexamer primer. In another tube, 5X reaction buffer, RibLock™ RNase Inhibitor, dNTP mix and RevertAid™ H Minus M-MuLV Reverse Transcriptase were mixed. The contents of both tubes were mixed, then incubated at 25 °C for 5 min., followed by 60 min. at 42 °C. The reaction was terminated by heating at 70 °C for 5 min. The reverse transcription reaction product can be directly used in QPCR or stored at –20 °C. c) QPCR The primers used in this study were specifically designed before in Biodiversity Institute of Ontario, University of Guelph, Canada (Table 1). Maxima® SYBR Green/Fluorescein qPCR Master Mix (Maxima® SYBR Green/ Fluorescein qPCR Master Mix (2X) Handbook, Fermentas, 2010), A reaction mixture was prepared as follow: Maxima® SYBR Green/Fluorescein qPCR Master Mix (2X), forward primer (100nM), reverse primer (100 nM), and RNase-free water. The reaction mixture was mixed thoroughly and appropriate volumes were dispensed into PCR tubes. Rotor-Gene Q was programmed according to the following program: PCR initial activation step for 10 min at 95ºC, three-step cycling: denaturation for 40 sec at 94ºC, annealing for 1 min at (50 ºC for fimH, iss and 48 °C for BssS genes) and extension at 72 ºC for


70

1 min. The three- step cycling was repeated for 35-40 repeats. 16S rRNA was used as a housekeeping gene as an internal control using different thermal conditions as follows: initial activation step for 10 min at 95ºC, three-step cycling: denaturation for 15 sec at 94ºC, annealing for 30 sec at 46 ºC and extension at 72 ºC for 30 sec. The three- step cycling was repeated for 45 repeats. Data acquisition was performed during the extension step. Melting curve analysis of the PCR product(s) to verify their specificity and identity was performed. The specificity of the PCR product(s) was checked by agarose gel electrophoresis. d) DNA extraction

The plasmid contents of 46 isolates (22 E. coli and 24 K. pneumoniae) were prepared using QIAprep Spin Miniprep DNA purification system Kit cat. No. 27106 supplied by Qiagen protocol 2006. The genomic DNA of the isolated strains of E. coli and K. pneumoniae

was prepared using QIA amp® DNA mini Kit Cat. No. 51304 supplied by Qiagen Inc. according to the manufacturer instructions for bacteria 2003. DNA was eluted by adding 50 µl Qiagen EB buffer (10 mM Tris-Hcl, pH 8.5) and visualized by electrophoresis on horizontal gels containing 1 % agarose. e) PCR

For the detection of iss gene in E. coli and K. pneumoniae isolates using PCR reaction, amplification was performed in a total volume of 25 µl containing 1µl DNA extract, 1µl of forward primer (10 µM), 1 µl of reverse primer (10 µM), 12.5 µl of DreamTaq™ Green PCR master mix and 9.5 µl of nuclease-free water. PCR was carried out using PCR machine FPROGO2D, Tchne LTD, Oxford Cambridge, U.K. The generated amplicons were visualized on 1.5% agarose gel electrophoresis stained with ethidium bromide and illuminated under UV transilluminator.

Table (1): Specific amplification primers for some virulence factors genes

Gene Primer Oligonucleotide sequence (5'-3') Amplicon size (bp)

Pap C F R

GACGGCTGTACTGCAGGGTGGCG ATATCCTTTCTGCAGGGATGCAATA 328

Fim H F R

TACTGCTGATGGGCTGGTC TCGTTATGGCAAAAGATTTGCGT 190

iss F R

GGCAATGCTTATTACAGGATGTGC GAGCAATATACCCGGGCTTCC 260

Biofilm F R

GATTCAATTTTGGCGATTCCTGC TAATGAAGTCATTCAGACTCATCC 225

V1 to V6 region of 16S-rRNA F R

AGAGTTTGATCMTGGCTCAG ACGAGCTGACGACARCCATG 166

RESULTS 1. Antimicrobial Susceptibility Testing:

The antibiotic susceptibility pattern of E. coli and K. pneumoniae isolates was demonstrated (Fig. 1). It has shown that most isolates were sensitive to amikacin and imipinem (90%-100%). Maximum resistance was recorded for ampicillin 95% for E. coli and 100% for K. pneumoniae. The range of sensitivity of amoxicillin/clavulanic acid against

all isolates was (13%-62%) while for cephalsporines (cefoxitin, ceftazidime, and cefotaxime) was (35%-72%). Aminoglycosides (gentamicin, netlimicin, and tobramycin) were more effective against isolated strains (43%-72%) than quinolones (ciprofloxacin, norfloxacin and ofloxacin) ranging between (28%-62%). Nitrofurantoin sensitivity ranged between (26%-68%) and for trimethoprim/sulphamethoxazole, it was (25%-29%).


71

AM: Ampicillin AMC: Amoxicillin/Clavulanic acid FOX: Cefoxitin CAZ: Ceftazidim CTX: Cefotaxime IMP: Imipenem AK: Amikacin CN: Gentamicin NET: Netlimicin TOB: Tobramycin CIP: Ciprofloxacin NOR: Norfloxacin OFX: Ofloxacin F: Nitrofurantoin SXT: Trimethoprim/Sulphamethoxazole

Fig. (1): Antibiotic sensitivity testing of E. coli and K. pneumoniae clinical isolates 2. Phenotypic estimation of virulence factors

A total of 89 isolates of which 40 clinical isolates of E. coli and 39 isolates of K. pneumoniae were isolated from specimens collected from urinary tract infections. These were investigated for their possession of virulence factors such as haemagglutination, serum resistance and biofilm formation.

Biofilm formation was determined quantitatively where our results have shown that 14(35%) and 12(31%) of E. coli and K. pneumoniae isolates, respectively were categorized as medium biofilm formation while only 8(20%) of K. pneumoniae isolates showed strong biofilm formation.

The prevalence of biofilm production was thus higher than reported in another study: 17% for faecal strains, 43% for strains isolated from patients with cystitis, 40% for pyelonephritis and 42% for bacteraemic E. coli strains(16)

. On the other hand, the same authors reported a high, 63 %, prevalence of biofilm formation among strains from patients with prostatitis. It was also observed that the isolates scarcely expressed soluble enzymatic virulence factors.

Hemolysin production is associated with pathogenicity of the organism(17)

. In the present study, few isolates produced hemolysin. It was observed in (17%) of E. coli, (7%) of K. pneumoniae isolates.

Haemagglutination is mediated by fimbriae. Type I fimbriae, which binds to a mannose-containing receptor are found in most urinary isolates. The expression of type I fimbriae is indicated by MSHA(18)

. In this study, percentage of MRHA isolates (72%-83%) was much higher than MSHA.

The pathogenicity of Gram negative bacteria is partly a function of their ability to evade the bactericidal effect of serum, which is mediated by the complement cascade. Commensal microorganisms are generally vulnerable to the bactericidal effect of serum, while nosocomial bacteria tend to be much more serum resistant(19-21)

. In the present study, 37% of E. coli and 33% of K. pneumoniae isolates were resistant to serum bactericidal activity. A previous study showed serum resistance in 68% of E.coli isolated from urine.(22)

. In another

study, 32.7% of the urinary isolates were resistant to serum bactericidal activity which is comparable to our results(23)

. Out of the tested clinical isolates, 18 isolates

(10 E. coli and 8 K. pneumoniae isolates) were randomly selected and their relative gene expression level of different genes responsible for the appearance of specific virulence factors was estimated. The phenotypic characters of such isolates were demonstrated in Table 2.


72

Table (2): Phenotypic characters of some virulence factors for selected E. coli and K. pneumoniae isolates

Sensitivity to quinolones Clinical isolate No.

Serum resistance

Biofilm formation (quantitative detection) CIP NOR OFX

Haemagglutination

E1 R M S S S MRHA E2 S W R R R MSHA E3 S W R R R MRHA E7 R M S S S MSHA E8 R M R R R MRHA E13 R M S S S MRHA E20 S W S S S MSHA E23 S M R R R MSHA E30 R M S S S MRHA E32 R M R R R MRHA K2 R W S S S MSHA K4 R S R R R MSHA K10 R W S S S MSHA K12 S W S S S MSHA K15 R M S R S MSHA K16 S W R R R MSHA K19 R S R R R MSHA K20 S M S S S MSHA

3. Genotypic evaluation of tested virulence factors a) QPCR

The virulence genes of mannose-resistant haemagglutination MRHA (papC), mannose-sensitive haemagglutination MSHA (fimH), serum resistance (iss) and biofilm formation (BssS) were amplified and quantified using QRT-PCR. The relative expression level of these genes was estimated. Complementary DNA was made from total RNA extracted from different E. coli and K. pneumoniae isolates. A

single round of quantitative PCR amplification of all mRNAs was possible. The primers readily detected targets specifically (Figures 2 & 3) and cDNAs were quantitated by SYBR Green PCR. With the use of these specific primers, BssS gene amplicon size was detected at 225 bp in the tested clinical isolates, iss gene amplicon was detected at 260 bp and fimH amplicon was detected at 190 bp. 16S rRNA gene was used as a house keeping gene as an internal control and its amplicon was detected at 166 bp.

Fig. (2): Relative expression level of BssS and iss genes in E. coli isolates after normalizing

using 16S rRNA gene


73

The results have shown that BssS gene was highly expressed in isolates E1, E7, E13 and E30, unlike other strains which have shown less expression level of BssS gene (Fig.2). These results were in agreement with the results obtained from measuring biofilm formation quantitatively confirming the accuracy of our assay and that BssS gene is one of the key genes that might be responsible for appearing this property (biofilm formation).

Also, in E. coli isolates, iss gene showed higher expression level in isolates E1, E7 and E30 in agreement with our data obtained from measuring the serum resistance and this was confirmed by running gel electrophoresis that showed three distinguished bands.

Previous investigations clearly demonstrated that resistance of E. coli strains to several antimicrobial agents, e.g., ampicillin, aminoglycosides, and co-trimoxazole, does not significantly correlate with the presence of fewer virulence factors (VFs) than in their susceptible counterparts(16,23,31)

. From the data obtained in studying E. coli clinical isolates, it was clear that quinolone resistant E. coli isolates harbor not only fewer virulence factors than susceptible ones, as reported before(26) but also lower expression level of the tested virulence factors as seen in E. coli isolates number 1, 7, 13 and 30 compared to other tested isolates.

K. pneumoniae is an opportunistic pathogen that can cause severe infections in hospitalized, immunocompromised hosts with severe underlying diseases(27)

. Depending on the study and type of infection, the prevalence of K. pneumoniae ranges from 3 to 17% of all nosocomial bacterial infections(28). Extensive use of antibiotics has contributed greatly to the emergence of multidrug-resistant strains that cause hospital infections. After the onset of inflammation, invading Klebsiella strains meet the cellular and humoral bactericidal components of the innate immune system. The host's first line of defense against invading microorganisms includes the bactericidal effect of serum.

Because both serum resistance and expression of certain virulence factors are thought to be factors in the pathogenicity of Klebsiella(19), it can be hypothesized that their superior resistance to the bactericidal activity of serum are indicators of the greater pathogenic potential of those strains.

In our study, K. pneumoniae isolates have shown as in Fig. (3) that BssS gene was highly expressed in isolates K4, K15, K16 and K19 isolates unlike other strains which have shown less expression of BssS gene. These results were in agreement with the results obtained from measuring biofilm formation quantitatively confirming the accuracy of our assay.

Fig. (3): Relative expression level of BssS and fimH genes in K. pneumoniae isolates after normalizing

using 16S rRNA gene


74

At the same time, in K. pneumoniae isolates, iss gene showed high expression level in isolate K4 only and this was confirmed by running gel electrophoresis that showed only one distinguished band for the mentioned isolate.

Also, in K. pneumoniae isolates, fimH gene showed higher expression level in K4, K15, K16 and K19 isolates than other strains which have shown lower expression of fimH gene that was confirmed by running gel electrophoresis.

From the phenotypic detection of some of the virulence factors and the relative expression level data in K. pneumoniae isolates together with the quinolone resistance estimated, we found that unlike E. coli, resistant K. pneumoniae strains harbor higher expression level of virulence factors than susceptible ones as seen in K. pneumoniae isolates number 4, 15, 16 and 19.

b) PCR The virulence genes: (fimH, iss and BssS )

were detected and amplified on both genomic and plasmid DNA in some isolates of the 46 E. coli and K. pneumoniae isolates studied. In E. coli, iss gene could be detected on genomic DNA (260 bp) of 7 isolates out of 22; these are isolates No. 1, 7, 13, 16, 24, 30 and 37. However, the same gene was detected in 8 isolates only of all studied isolates on plasmid DNA; isolates No. 1, 7, 16, 24, 28, 30, 32 and 37. Regarding iss gene in K. pneumonia isolates, fig. (4) showed that only 2 isolates gave amplicon size of 260 bp for iss gene on genomic DNA; these are isolates No. 10 and 28. While on plasmid DNA, 10 isolates harbored the same gene, isolates No. 2, 4, 8, 10, 15, 17, 18, 19, 25 and 28 as shown in fig. (5).

M 10 2 3 4 5 7 8 15 17 28 19 23 25 con.

3000

1000

500

100 Fig. (4): Agarose gel electrophoresis of iss amplicons amplified by PCR. Lane M was 1 Kb ladder molecular weight marker. Lanes 1 to 14 were amplicons from genomic DNA of K. pneumoniae isolates No. 10, 2, 3, 4, 5, 7, 8, 15, 17, 28, 19, 23, 25 and PCR control respectively.

M 1 2 4 8 10 15 5 7 17 18 19 25 27 31 28 Con.

3000

1000

500

100

Fig. (5): Agarose gel electrophoresis of iss amplicons amplified by PCR. Lane M was 1 Kb ladder molecular weight marker. Lanes 1 to 16 were amplicons from plasmid DNA of K. pneumoniae isolates No. 1, 2, 4, 8, 10, 15, 5, 7, 17, 18, 19, 25, 27, 31, 28 and PCR control respectively.


75

From PCR and QRT-PCR data for iss gene in K. pneumoniae, we might conclude that iss gene and quinolone resistance genes are carried on the same plasmid. This was suggested since iss gene was amplified on both plasmid and chromosomal DNA isolated from different K. pneumoniae isolates and we found that iss gene was detected in only 2 samples on chromosomal DNA, and in 10 samples on plasmid DNA for the same isolates. In other words, K. pneumoniae isolates harboring iss gene on their plasmids are those which are showing higher quinolone resistance.

From this data, it is anticipated that Klebsiella strains will become more virulent and resistant to antibiotics in the future, an eventuality that could contribute to the spread of certain Klebsiella clones by virtue of their greater resistance to antibiotics and better adherence to host tissues.

CONCLUSION

Phenotypic characterization of some virulence factors of E. coli and K. pneumoniae isolates was performed to determine the most virulent isolates. These phenotypic findings were correlated with the genotypic studies and confirmed by the results of gene expression. In E. coli, isolates having higher expression level of virulence factors, the higher their susceptibility to quinolone antibiotics unlike in K. pneumonia, isolates having higher expression level of virulence factors, they have higher resistance to quinolone antibiotics. Further studies are needed to investigate the exact correlation between the resistance against different antimicrobials and the expression level of different virulence factors.

REFERENCES 1. Sobel, J. D., and Donald, K. ( 2005):

Urinary tract infection, p. 875–883. In Mandell, G. L., Bennett, J. E. and Dolin, R. (ed.), Principles and practice of infectious diseases, 6th ed. Elsevier Inc., Philadelphia, PA.

2. Hanna, A., Berg, M., Stout, V. and Razatos, A. (2003): Role of capsular colanic acid in adhesion of uropathogenic Escherichia coli. Appl Environ Microbiol., 69: 4474–4481.

3. Costerton, J. W., Stewart, P. S. and Greenberg, E. P. (1999): Bacterial biofilms – a common cause of persistent infections. Science, 284: 1318–1322.

4. Elkins, C., Morrow, K. J. and Olsen, B. (2000): Serum Resistance in Haemophilus ducreyi Requires Outer Membrane Protein DsrA. Infection and Immunity, 68: 1608-1619.

5. Sharma, S. K., Fatma, T. and Thukral, S. S. (1999): A simple and rapid serum bactericidal assay and its evaluation in clinical isolates of Klebsiella pneumoniae. J. Microbiol. Meth., 39: 45–48.

6. Karaca, Y., Coplu, N., Gozalan, A., Oncul, O., Citil, B. E. and Esen, B. (2005): Co-trimoxazole and quinolone resistance in Escherichia coli isolated from urinary tract infections over the last 10 years. Int. J. Antimicrob. Agents 26:75–77.

7. Duriez, P., Clermont, O., Bonacorsi, S., Bingen, E., Chaventre, A., Elion, J. Picard, B. and Denamur, E. (2001): Commensal Escherichia coli isolates are phylogenetically distributed among geographically distinct human populations. Microbiology, 147:1671–1676.

8. Barrow, G.I. and Feltham, R.K. (1993): Cowan and Stell’s Manual for the identification of Medical Bacteria 3rd ed., University press, Cambridge, U.k: 136–38.

9. Collee, J.G., Miles, R.S. and Watt, B. (1996): Tests for the identification of bacteria. In: Mackie and Macartney Practical Medical Microbiology, 14th edn., Vol., I, pp. 413–424. Churchill Livingstone, N.Y, U.S.A.

10. NCCLS, (2003): Performance standards for antimicrobial disk susceptibility tests, 8th ed. Approved standard M2-A8. National Committee for Clinical Laboratory Standards, Wayne, Pa.

11. CLSI (2007): Performance Standards for Antimicrobial Susceptibility Testing, approved Standard M100–S17. Wayne, PA: Clinical and Laboratory Standards Institute.

12. Stepanovic, S., Vukovic, D., Dakic, I., Savic, B. and Svabio-Vlahovic, M. (2000): A modified microtitre plate test for quantitation of staphylococcal biofilm formation. J. Microbiol. Methods, 40: 175–9.

13. Abdi-Ali, A., Mohammadi-Maher, M. and Agha Alaei, Y. (2005): Bactericidal activity of various antibiotics against biofilm producing Pseudomonas aeruginosa. Inter. J. Antimicrob. Agents, 27: 196–200.

14. Vagarali, M. A., Karadesai, S. G., Patil, C. S., Metgud, S. C., Mutnal, M. B. (2008): Haemagglutination and siderophore production as the urovirulence markers of


76

uropathogenic Escherichia coli. Indian journal of Medical Microbiology 26 (1): 68–70.

15. Vandekerchove, D., Vandmaele, F., Adriensen, C., Zaleska, M., Hernalsteens, J. P., Baets, L. D., Butaye, P., Immerseel, F. V., Wattiau, P., Laevens, H., Mast, J., Goddeeris, B. and Pasmans, F. (2005): Virulence-associated traits in avian Escherichia coli: Comparison between isolates from colibacillosis-affected and clinically healthy layer flocks. Veterinary Microbiology, 108: 75–8.

16. Soto, S. M., Smithson, A., Martinez, J. A., Horcajada, J. P., Mensa, J. &Vila, J. (2007): Biofilm formation in uropathogenic Escherichia coli strains: relationship with prostatitis, urovirulence factors and antimicrobial resistance. J Urol, 177: 365–368.

17. Johnson, J.R. (1991): Virulence factors in Escherichia coli urinary tract infection. Clin Microbiol Rev, 4: 81–128.

18. Raksha, R.; Srinivasa, H. and Macaden, R.S. (2003): Occurrence and characterization of uropathogenic Escherichia coli in urinary tract infections. Indian J Med Microbiol, 21: 102-7.

19. Olling, S. (1977): Sensitivity of gram-negative bacilli to the serum bactericidal activity: a marker of the host parasite relationship in acute and persisting infections. Scand. J. Infect. Dis., 10: 1–40.

20. Schoolnik, G. K., Buchanan, T. M. and Holmes K. K. (1976): Gonococci causing disseminated gonococcal infection are resistant to the bactericidal action of normal human sera. J. Clin. Investig., 58: 1163–1173.

21. Simberkoff, M. S., Ricupero, I. and Rahal, J. J. J. (1976): Host resistance to Serratia marcescens infection: serum bactericidal activity and phagocytosis by normal blood leucocytes. J. Lab. Clin. Med., 87: 206–217.

22. Seigfried, L., Kmetova, M., Puzova, H., Molokacova, M. and Filka, J. (1994): Virulence associated factors in Escherichia coli strains isolated from children with urinary tract infections. J Med Microbiol, 1: 127–152.

23. Horcajada, J. P., Soto, S., Gajewski, A., Smithson, A., Jimeńez de Anta, M. T., Mensa, J., Vila, J. and Johnson, J. R. (2005): Quinolone-resistant uropathogenic Escherichia coli strains from phylogenetic group B2 have fewer virulence factors than their susceptible counterparts. J. Clin. Microbiol., 43: 2962–2964.

24. Johnson, J. R., Kuskowski, M. A., O’Bryan, T. T., Colodner, R. and Raz, R. (2005): Virulence genotype and phylogenetic origin in relation to antibiotic resistance profile among Escherichia coli urine sample isolates from Israeli women with acute uncomplicated cystitis. Antimicrob. Agents Chemother., 49: 26–31.

25. Martıńez-Martıńez, L., Fernandez, F. and Perea, E. J. (1999): Relationship between haemolysis production and resistance to fluoroquinolones among clinical isolates of Escherichia coli. J. Antimicrob. Chemother. 43: 277–279.

26. Piatti, G., Mannini, A., Balistreri, M. and Schito, A. M. (2008): Virulence Factors in Urinary Escherichia coli Strains: Phylogenetic Background and Quinolone and Fluoroquinolone Resistance. J. Clin. Microbiol., 46 (2): 480–487.

27. Podschun, R., and Ullmann, U. (1998): Klebsiella spp. as nosocomial pathogens: epidemiology, taxonomy, typing methods, and pathogenicity factors. Clin. Microbiol. Rev., 11: 589-603.

28. Gikas, A., Samonis, G., Christidou, A., Papadakis, J., Kofteridis, D., Y. Tselentis, D. and Tsaparas, N. (1998): Gram-negative bacteremia in non-neutropenic patients: a 3-year review. Infection, 26: 155-159.


77

لمستوى التعبير لبعض دراسة مقارنة بين الخواص الظاهرية و الجينية عوامل الضراوة الخاصة باالشرشيا آوالى والكليبسيال نومونيا المعزولة من عدوى المسالك

البولية فى مستشفيات المنصورة

)١(، أريج المهدي)١(، خالد عبد الجليل)٢(، عصام الصاوي)١(، رمضان حسن)١(وائل النجار . جامعة المنصورة–صيدلة قسم الميكروبيولوجي والمناعة و آلية ال)١ (

. جامعة المنصورة–مرآز الكلي والمسالك البولية )٢(

سالك دوى الم تنتاول هذه الدراسة عزل مجموعة من عترات اإلشرشيا آوالى والكليبسيال نومونيا من مرضى مصابين بع

ا بمستوى ا سئولة البولية و التعرف على الخواص الظاهرية لبعض عوامل الضراوة ومدى ارتباطه ات الم بعض الجين ر ل لتعبي .عن ظهورها

شار من ة االنت رات باستخدام طريق ة العت وعند تم استخدام ثالثة عشرة قرصا من المضادات الميكروبية في اظهار مقاومنم واألميكاسين نهم %) ١٠٠-%٩٠(قرص المضاد الميكروبى أظهرت النتائج أن معظم العترات المعزولة حساسة لإلميبي ولك

ة في درجة %). ١٠٠-%٩٠( مقاومة لألمبيسيللين بنسبة مقاومة تتراوح بين أآثر م نسب متفاوت اقي المضادات فكانت له أما ب . الحساسية

وين BssS وعند إختبار مستوى التعبير لبعض الجينات مثل جين سئول عن iss وجين (biofilm) والمسئول عن تك الم(serum resistance) عترات اإلشرشيا آوالى فقد وجد أن العترات الحساسة للكينولينات قد أظهرت مستوى تعبير أعلى فى

.من تلك الجينات عن العترات المقاومة منها وآان ذلك متمشيا مع نتائج التحديد الظاهرى لعوامل الضراوةسئول fimH وجين (biofilm) والمسئول عن تكوين BssSأما عند دراسة مستوى التعبير لبعض الجينات مثل جين الم

د أظهرت مستوى فى (Haemagglutination)عن ات ق ة للكينولين رات المقاوم د وجد أن العت ا فق عترات الكليبسيال نوموني . تعبير أعلى من تلك الجينات عن العترات الحساسة منها وآان ذلك متمشيا مع نتائج التحديد الظاهرى لعوامل الضراوة

رات issائج أيضا أنه من خالل الكشف عن تواجد جين وقد أوضحت النت دات و الكروموسومات الخاصة بعت فى البالزميى ر أعل ى جبن الكليبسيال نومونيا أن العينات التى أظهرت مستوى تعبي وت عل ى إحت دات و iss هى الت فى آل من البالزمي

.الكروموسوماترا ا خطورة تواجد عت ات من ومن خالل تلك الدراسة يتضح لن ة للكينولين ى أظهرت فى ت مقاوم ا والت سيال نوموني الكليب

.نفس الوقت مستوى أعلى من بعض عوامل الضراوة خالفا للمتوقع والتى نشأت نتيجة سوء استعمال المضادات الحيوية


78

Documents

Comparative Study of Phenotypic and Genotypic … PDF/3/7.pdfIsolated from Urinary Tract Infections in Mansoura Hospitals ... Urology and Nephrology Center (UNC), Mansoura University,