저작자표시-비영리-동일조건변경허락 2.0 대한민국

이용자는 아래의 조건을 따르는 경우에 한하여 자유롭게

l 이 저작물을 복제, 배포, 전송, 전시, 공연 및 방송할 수 있습니다. l 이차적 저작물을 작성할 수 있습니다.

다음과 같은 조건을 따라야 합니다:

l 귀하는, 이 저작물의 재이용이나 배포의 경우, 이 저작물에 적용된 이용허락조건을 명확하게 나타내어야 합니다.

l 저작권자로부터 별도의 허가를 받으면 이러한 조건들은 적용되지 않습니다.

저작권법에 따른 이용자의 권리는 위의 내용에 의하여 영향을 받지 않습니다.

이것은 이용허락규약(Legal Code)을 이해하기 쉽게 요약한 것입니다.

Disclaimer

저작자표시. 귀하는 원저작자를 표시하여야 합니다.

비영리. 귀하는 이 저작물을 영리 목적으로 이용할 수 없습니다.

동일조건변경허락. 귀하가 이 저작물을 개작, 변형 또는 가공했을 경우에는, 이 저작물과 동일한 이용허락조건하에서만 배포할 수 있습니다.

http://creativecommons.org/licenses/by-nc-sa/2.0/kr/legalcodehttp://creativecommons.org/licenses/by-nc-sa/2.0/kr/

의학박사학위논문

Expression of Oncogenes and Changes of the Liver and Bile Ducts in Cholangiocarcinoma of Syrian Golden Hamsters Induced by Clonorchis

sinensis and N-Nitrosodimethylamine

간흡충 감염 과 N-Nitrosodimethylamine에 의한 햄스터의 담관암에서 발암관련 유전자 발현과 관련

인자의 변동양상

2013 년 2 월

서울대학교 대학원

의학과 기생충학전공 Md. Hafiz Uddin

-i-

Abstract

Expression of Oncogenes and Changes of the Liver and Bile Ducts in Cholangiocarcinoma of Syrian Golden Hamsters Induced by Clonorchis

sinensis and N-Nitrosodimethylamine

Md. Hafiz Uddin

Parasitology and Tropical Medicine

The Graduate School

Seoul National University

Clonorchis sinensis has been reclassified as group-I bio-carcinogen for

cholangiocarcinoma (CCA) in humans by IARC in 2009, however, the

mechanism of carcinogenesis is little known. The present study investigated

CCA mechanism in hamster model by means of imaging, histopathology,

immunohistochemical analysis, and expression of oncogenesis related genes.

The experimental animals were divided into 4 groups: uninfected control

(Ctrl.), C. sinensis (Cs), N-Nitrosodimethylamine (NDMA), and C. sinensis

with NDMA (Cs+NDMA). The body weight of hamsters in every week and

liver and spleen weight at necropsy were measured. Abdominal

ultrasonography (USG) of all hamsters and magnetic resonance imaging

(MRI) of randomly selected hamsters were performed at every 2 weeks up to

16th week of infection. After 4, 8, 12, and 16 weeks animals were sacrificed

and investigated. USG detected first mass-forming lesion (MFL) in the

-ii-

Cs+NDMA group at 6th week and 77.3% of overall prevalence at 16th week of

infection. The MFLs were consistent and increased in size during the follow-

up examination. MRI recognized same MFLs with USG, but recovered a cyst

in the Cs+NDMA group at the 6th week. Findings by both USG and MRI of

the Ctrl. and NDMA groups were non-specific throughout the experiment.

The Cs+NDMA group hamsters underwent significant loss of body weight

(24.8%) and gain of the liver (88.6%) and spleen (255.2%) weight. Thin

slicing of the liver confirmed 100% prevalence of MFLs in the Cs+NDMA

group with an intensity of 10.92 ± 5.76. Semiquantitative histopathology (as

% of total tissue area) revealed severe inflammation (34.3% ± 3.6%),

proliferation of bile ducts (11.4% ± 2.1%), periductal fibrosis (11.2% ±

1.9%), and abscess (8.7% ± 3.13 %) in the Cs group. In the Cs+NDMA group

the above histopathological findings were present moderately but showed

intrahepatic CCA of well (21.8% ± 1.5 %), moderate (13.3% ± 1.3%), and

poorly (10.8% ± 1.3%) differentiated types. The CCA mass was packed with

collagen fibers, mainly of type I. Immunohistochemisty against proliferative

cell nuclear antigen (PCNA) found strong positive reaction in the Cs+NDMA

group. The metaplastic changes of bile duct epithelial cell to mucin secreting

cell was 7 times higher and mitotic figures were significantly increased in the

Cs+NDMA group. Real-time PCR and western blot analysis showed

dysregulation of a number of genes/proteins. A novel oncogene for CCA

called gankyrin was upregulated, CDK4 and p16INK4 genes were

overexpressed but, p53 gene and RB protein were downregulated in the tumor

-iii-

tissue. In conclusion, CCA in hamsters may develop in hamster model after 6

weeks of infection with weight loss and hepato-splenomegaly. The mass can

be monitored by USG and MRI. Upregulation of oncogene gankyrin, CDK4,

and downregulation of p53 gene and RB protein may play an important role

in the process of carcinogenesis of CCA in the C. sinensis-NDMA mediated

hamster model. Excessive mRNA expression of p16INK4 and increased

PCNA may be marker candidates for CCA in clonorchiasis.

Key words: Cholangiocarcinoma, Clonorchis sinensis, N-

Nitrosodimethylamine, Hamster, Histopathology, Gene expression

Student number: 2009-30777

-iv-

List of Tables

Table 1. Groups and numbers of hamsters … 8

Table 2. Oncogenesis related genes targeted primer pairs … 13

Table 3. Qualitative histopathological findings of the liver and

gallbladder by USG … 18

-v-

List of Figures

Fig. 1. Proposed etiopathogenetic mechanism of

cholangiocarcinogenesis showing interactions between

etiological agents and cholangiocyte response to injury (Sandhu

et al., 2007).

… 4

Fig. 2. Experimental design for the development of cholangiocarcinoma

in Syrian golden hamsters in association with C. sinensis (Cs)

and N-Nitrosodimethylamine (NDMA).

… 9

Fig. 3. Abdominal ultrasonography (USG) from 0–16 weeks of

infection at every 2 weeks interval.

… 25

Fig. 4. Abdominal magnetic resonance imaging (MRI) from 2–16

weeks of infection at every 2 weeks interval in randomly

selected hamsters of different groups.

… 26

Fig. 5. Weight and length of different organs of hamster at necropsy. … 27

Fig. 6. Mass-forming lesion’s (MFL) prevalence, intensity and gross

view.

… 28

Fig. 7. H&E staining of the liver sections in different groups of

hamsters (x100).

… 29

-vi-

Fig. 8. Masson’s trichrome, Sirius red and proliferative cell nuclear

antigen (PCNA) staining of liver tissue in different groups of

hamsters after 16 weeks of infection (x100).

… 30

Fig. 9. Semiquantitative non-neoplastic histopathological changes in

different groups of hamsters.

… 31

Fig. 10. Semiquantitative neoplastic histopathological changes in

different groups of hamsters.

… 32

Fig. 11. Cellular changes among the groups of hamsters. … 33

Fig. 12. Real-time PCR using SYBR Green I DNA binding dye. … 34

Fig. 13. Relative expression of oncogenesis related genes by real-time

PCR.

… 35

Fig. 14. Relative expression of oncogenesis related proteins by western

blot analysis.

… 36

Fig. 15. Relative expression of oncogenesis related genes/proteins by

real-time PCR and/or western blot analysis (A) and (A) a

simplified signal transduction pathway (dotted lines has been

affected in the present study).

… 37

-vii-

List of Abbreviations and Symbols

CCA Cholangiocarcinoma

Cs Clonorchis sinensis

Cs+NDMA C. sinensis with N-Nitrosodimethylamine

GB Gallbladder

MFL Mass-forming lesion

MRI Magnetic Resonance Imaging

NDMA N-Nitrosodimethylamine

ppm Parts per million

ROS Reactive Oxygen Species

RNS Reactive Nitrogen Species

T1WI T1 weighted image

T2WI T2 weighted image

USG Ultrasonography

°C Degree Celsius

-viii-

Contents

Introduction…………………………………………………… 1

Materials and Methods………………………………………… 6

Results…………………………………………………………. 16

Discussion……………………………………………………… 38

References……………………………………………………… 46

Abstract in Korean……………………………………………… 58

Acknowledgement……………………………………………… 61

-1-

Introduction

In a worldwide population of 6 billion, in the year 2000, approximately 10

million cancers were diagnosed, and there were an estimation of 6.2 million

cancer deaths (Schottenfeld et al., 2005). About 13% of all human deaths in

2007 was due to cancer (World Health Organization: WHO, 2006) and

estimated as 7.6 million (American Cancer Society, 2007), which was 1.4

million more than that of the year 2000. Cancer affects people at all ages and

its risk increases with age (Cancer Research UK, 2007). Cancer mortality has

a proportionate cause of 12% global deaths. The three cancer sites

contributing to the highest proportions of cancer deaths are the lungs (17.8%),

stomach (10.4%), and liver (8.8%) (Ferlay et al., 2001; Parkin, 2001; Pisani et

al., 2002; Pisani et al., 1999; Shin et al., 1996).

Liver cancer is one of the most common cancers in Southeast Asia and

the death rate among Koreans has been reported as one of the highest in the

world (Jemal et al., 2010). In the etiology of primary liver cancer, three major

types (hepatocellular carcinoma, cholangiocarcinoma (CCA), miscellaneous

tumors) may be considered (Shin et al., 1996). Among primary liver cancer,

CCA accounts for more than 20% of liver cancer in Busan, Korea (Jung et al.,

1993). CCA is known to be associated with heavy infestation by liver fluke,

Opisthorchis viverrini and Clonorchis sinensis (Watanapa and Watanapa,

2002). The liver fluke, C. sinensis is widely distributed in East Asia with

some heavily endemic zones such as China, Taiwan, Vietnam, and the

-2-

Republic of Korea and recently included in the control programs of neglected

tropical diseases by WHO (Hong and Fang, 2012). C. sinensis, also known as

oriental or Chinese liver fluke, causes clonorchiasis, which is characterized by

hyperplasia and metaplasia in the intrahepatic bile duct epithelium. The

incidence of CCA is also correlated to the prevalence of C. sinensis infection

(Shin et al., 2005). CCA is a highly lethal malignant tumor arising from the

biliary tract epithelium (Olnes and Erlich, 2004) and notoriously difficult to

diagnose. It is usually fatal because of its typically late clinical presentation

and the lack of effective non-surgical therapeutic modalities (Ishak et al.,

1994). In 2009, based on different epidemiological data C. sinensis was

defined as group-I biocarcinogen to human for CCA by International Agency

for Research on Cancer (IARC) (Bouvard et al., 2009; Shin et al., 2010).

Although a large and compelling body of evidence links clonorchiasis and

CCA, the mechanism involves in this process is little known (Kim et al.,

2008).

Few studies have been carried out to understand the mechanism of

oncogenesis in C. sinensis. The array of mechanisms under which the

organism becomes oncogenic can be categorized within four general

processes: direct effects on signal transduction pathways in host cells, chronic

inflammation, changes in host physiology, and effects on other organism

(Watanapa and Watanapa, 2002). The second process, chronic inflammation

can cause by the presence of liver flukes which promotes neoplasia by

-3-

increasing probability of mutagenic events (a simplified mechanism showed

in Fig. 1). Genotoxic effects of reactive oxygen and nitrogen species (ROS,

RNS) plays an important role in the process of carcinogenesis (Butel, 2000;

Oliviera, 2007; Blaser and Atherton, 2004).

Oncogenesis is a multi-step process in which alternation of cell-cycle,

apoptosis, oncogene expression, tumor suppressor and angiogenesis related

genes are involved. Boonmars et al. (2008) showed changes in apoptosis

related genes in hamster opisthorchiasis model. Boonmars et al. (2009)

showed an alternation of genes expression of retinoblastoma protein (RB)

pathway in same opisthorchiasis model. Angiogenesis related gene expression

was studied by Yang et al. (2009) in 7,12-Dimethylbenz(a)anthracene

(DMBA)-induced oral carcinogenesis in hamsters. There are a few works

have done regarding synergistic effect of C. sinensis and N-

nitrosodimethylamine (NDMA) for development of CCA in hamster model.

A number of studies showed that animals infected with C. sinensis alone did

not develop CCA (Wykoff, 1958; Bhamarapravati et al., 1978; Lee et al.,

1978a,b; Min and Han, 1985). However, CCA was successfully introduced in

Syrian golden hamsters by C. sinensis with a hepatocarcinogen, NDMA at

sub carcinogenic level (Lee et al., 1997). This is the only established CCA

animal model for C. sinensis. NDMA can be found in diverse consumable

items of human specially fermented or cured meat, fish, beers, and

tobacco smoke (Najm et al., 2001). Thus humans infected with C. sinensis are

-4-

Fig. 1. Proposed etiopathogenetic mechanism of cholangiocarcinogenesis

showing interactions between etiological agents and cholangiocyte response

to injury (Sandhu et al., 2007).

-5-

always at risk of developing CCA. Therefore it is a crying need to find out the

impact of C. sinensis and NDMA at molecular level to reveal the mechanism

of oncogenesis.

The present study was investigated the development of CCA by imaging,

histopathological and immunohistochemical observation in infected hamsters.

The cell proliferation, cell-cycle, apoptosis, tumor suppressor and

angiogenesis related genes or proteins expression were analyzed to

understand the mechanism of oncogenesis in C. sinensis and NDMA

mediated CCA in Syrian golden hamster.

-6-

Materials and Methods

1. Collection of metacercariae

Metacercariae were collected from naturally infected freshwater fish

Pseudorasbora parva. The fish flesh was digested in a 0.5% pepsin solution

with HCl and C. sinensis metacercariae were isolated under a

stereomicroscopic identification (Choi et al., 2004).

2. Experimental design

A total of 70 male Syrian golden hamsters (Mesocricetus auratus) of 4-5

weeks old were divided randomly into 4 groups. Group I (Ctrl.) included 15

hamsters as uninfected control, Group II (Cs) included 15 hamsters which

received 30 metacercariae of C. sinensis, Group III (NDMA) included 15

hamsters which were allowed to drink NDMA in drinking water, and Group

IV (Cs+NDMA) included 25 hamsters which received both metacercariae and

NDMA. The hamsters of the respective groups were infected with

metacercariae by intra-gastric intubation and received NDMA at a

concentration of 12.5 ppm in drinking water for 8 weeks ad libitum. The

hamsters were subjected to abdominal ultrasonography (USG) at every 2

weeks from baseline to the 16th week of infection and MRI done from 2nd-16th

weeks of infection in randomly selected hamsters. After 4, 8, 12 and 16 weeks,

the hamsters were sacrificed and investigated for the pathological and

-7-

molecular changes. The grouping and experimental design are summarized in

Table 1 and Fig. 2.

3. Measurement of weight

Body weights of all hamsters were measured in every week and weight of the

liver and spleen were measured at necropsy with an electronic balance

(Sartorius, Germany).

4. Ultrasonographic examination

All hamsters were subjected to high resolution abdominal ultrasonography

(USG; iU22, Philips Healthcare, Aandover, USA) with L15-7io linear

transducer probe (7-15 MHz) after every 2 weeks from baseline to the 16th

week of infection under general anesthesia throughout the study period to see

the development of any mass-forming lesion (MFL) in the liver. A mixture of

xylazine (10mg/kg; Bayer, Korea) and zoletil-50 (30mg/kg, Virbac, France)

were used for anesthesia. The anesthetic solution was injected into the thigh

muscle.

5. Magnetic resonance imaging

Randomly selected hamsters from different groups were subjected to

abdominal magnetic resonance imaging (MRI; Magnetom Trio (3T) Siemens)

at every alternate week from 2-16 weeks after infection under general

anesthesia for better observation of MFL in the liver. Contrast solution (Primo

-8-

Table 1. Groups and numbers of hamsters

Groups No. of hamsters

I. Uninfected control (Ctrl.) 15

II. C. sinensis (Cs) 15

III. N-Nitrosodimethylamine (NDMA) 15

IV. C. sinensis with NDMA (Cs+NDMA) 25

-9-

Fig. 2. Experimental design for the development of cholangiocarcinoma in

Syrian golden hamsters in association with C. sinensis (Cs) and N-

Nitrosodimethylamine (NDMA). The hamster received NDMA with drinking

water (Mc: metacercariae of C. sinensis).

-10-

-vist, Bayer, Korea, 1.3 ml/kg) was injected directly to the heart

(intraventricular bolus injection) using 26 gauze needle with ultrasonographic

guidance. A mixture of xylazine and zoletil-50 were used for anesthesia as

used in USG. Axial T1-weighted image (volumetric interpolated breath-hold

examination (VIBE); matrix size 256×123; slice thickness 0.7 mm), T2-

weighted image (respiratory triggered turbo spine echo (TSE); matrix size

256×177; slice thickness 0.7 mm), were performed to detect any anatomical

or pathological changes in the liver, GB and bile duct.

6. Gross observation at necropsy

The livers of hamsters from all groups were observed grossly for the presence

of any MFLs. After external observation and keeping the sample (about 100

mg) for RNA from the hilar region, rest of the liver was kept in neutral

buffered formalin (10%) for the hardening of the tissues. The fixed and

hardened tissues were subjected to 2-4 mm manual slicing for the presence of

any MFL inside the liver. Mean intensity or intensity of MFLs was calculated

as mean number of MFLs in the positive liver as below.

Intensity = Total No. of MFLs

No. of hamsters positive for MFL

7. Histopathology

A portion of the hilar tissues from the left, median and right lobes of each

liver after fixation in neutral buffered formalin (buffered 10% formaldehyde,

pH: 7.2) were prepared for histopathological analysis. Paraffin sections of 4

-11-

µm thickness were processed for routine hematoxylin and eosine (H&E)

staining. For semiquantitative analysis, histopathological findings were

expressed as percentage of total histological section area.

Masson’s trichrome staining was also performed in randomly selected

slides for the visualization of collagen fiber. Briefly, formalin fixed tissue

section was refixed in Bouin’s solution for 1 h at 56ºc after deparaffinization

and rehydration. Slides were stained with weigert’s iron hematoxylin solution

and Biebrich scarlet-acid fuchsin solution for about 10 minutes followed by

phosphomolybdic-phosphotungstic acid solution and aniline blue staining.

After differentiation in 1% acetic acid slides were mounted through

dehydration steps.

For better visualization of type I collagen fiber randomly selected sections

were subjected to Sirius red staining. In brief, rehydrated slides were stained

for 8 minutes with haematoxyline and putted under running tap water for 10

minutes. Then Sirius red Solution A was applied for 1 hour followed by

washing with 0.5% acidic water. Red stained fibers were counted as collagen

fibers.

8. Immunohistochemistry

To detect the proliferative cell nuclear antigen, immunohistochemisty

procedure was carried out using Histomouse MAX kit (Zymed laboratories,

Invitrogen immunodetection). The antigen was retrieved through incubation

-12-

with citrate buffer (pH = 6) at 100°C in a water bath for about 1 hour. At

primary antibody application step, PCNA monoclonal antibody (Clone IPO-

38, Cat#10004805, Cayman Chemical) was used. The 3-amino-9-

ethylcarbazole (AEC) was utilized for the production of red colour with HRP

conjugated secondary antibody.

9. RNA extraction and cDNA preparation

A portion of the liver tissue from the hilar region of the livers of all hamsters

groups were snap frozen in liquid nitrogen and stored in it for the extraction

of RNA. Total RNA was isolated using RNeasy plus mini kit (Cat# 74134,

Qiagen, Germany) according to the manufacturer instructions. Reverse

transcription of 3 µg of total RNA were done by Maxim RT premix (Korea)

cDNA synthesis kit. The cDNAs were kept at -70ºC until use.

10. Analysis of gene expression by Real-Time PCR Assay

The primer pairs for gankyrin was self designed using primer BLAST of

NCBI and the following genes Akt/PKB, BAX, RB1, p53, p16INK4, and

CDK4 as well as housekeeping gene glyceraldehydes-3-phosphate

dehydrogenase (GAPDH) were used based on the published sequence in the

Gene Bank and published journal articles showed in Table 2 (Boonmars et al.,

2008; Boonmars et al., 2009; Boonmars et al., 2010; Yang et al., 2009;

Kitahashi et al., 2004). SYBR Green I (Applied Biosystem) DNA binding dye

was used as fluorophore. After PCR amplification melting curve analysis

-13-

Table 2. Oncogenesis related genes targeted primer pairs for real-time PCR

Genes Sequences

Upper line: forward primer 5’-3’

Bottom line: reverse primer 5’-3’

Gene Bank

accession

Gankyrin TGTCTAAGGTCTGCAACCTGGCCT

AGCATGCCCAGTGTAATGCTGTTC

-

Akt/PKB CCCTTCTACAACCAGGACCA

ATACACATCCTGCCACACGA

M94355.1

BAX AGCTGCAGAGGATGATTGCT

CTCTCGGAGGAAGTCCAGTG

AJ582075.1

RB1 CAGATGGTGTGTAATAGTGACCGA

TTTTTCAGGGGCTTGGGAG

GQ246228

p53 AAGGCGATAGTTTGGCTCCT

CTGGGGTCTTCCAGTGTGAT

Y08900

p16INK4

GCAACACCCAAGTAGCCAGAC

CGCCAGAGTTTCCAAGAAGCC

AF292567

CDK4 CACCCTCGTGTTTGAGCATA

GTTTTCTGGTTTCAGGTCTCGG

GQ246229

GAPDH GACATCAAGAAGGTGGTGAAGCA

CATCAAAGGTGGAAGAGTGGGA

U10983

-14-

were performed to verify the PCR product. The standard curve was prepared

for the determination of PCR efficiency. Before real-time PCR, all of the

reactions were confirmed as single band in agarose gel electrophoresis by

conventional PCR. Single band was also observed after real-time PCR as

well. Gene expressions were calculated using 2-ΔΔCT (Livak) method.

11. Western blot analysis

To determine the oncogenesis related protein levels in the hamster tissue,

proteins were extracted according to the conventional method. Briefly, about

100 mg of the tissue was taken from each sample and grounded to a powdery

preparation with liquid nitrogen. Needle homogenization was performed. The

samples then underwent a process of 10 minutes homogenization and/or

sonication in the presence of tissue protein extracting solution (lysis buffer

containing 50 mmol/L Tris-Cl (pH 8.0), 150 mmol/L NaCl, 0.1% SDS, 100

μg/ml PMSF, 2 μg/ml aprotinin, 2 μg/ml leupeptin, and 1% NP40), cooling on

ice for 30 minutes, and centrifugation at 14,000 g for 5 minute at 4°C and the

supernatant fluid were collected.

Proteins were separated (80 µg/lane) by sodium dodecyl sulfate-

polyacrylamide gel electrophoresis (10% SDS-PAGE). The sample

concentration of proteins were determined previously by BCA protein assay

(Pierce, Thermo Scientific) using Nanodrop-1000 (Thermo Scientific)

according to manufacturer instruction. After electrophoresis, the proteins

-15-

were electro-transferred to polyvinylidene fluride (PVDF) membranes,

blocked in 5% non-fat milk for 1 h at room temperature (RT) and washed

with PBST (PBS with 0.1% Tween), and probed with following primary

antibodies: CDK4 (C-22: SC-260, Santa Cruz Biotechnology Inc.), Akt1 (C-

20: SC-1618, Santa Cruz), p53 (FL-393: SC-6243, Santa Cruz), RB (C-15:

SC-50, Santa Cruz), VEGF (A-20: SC-152, Santa Cruz), and E2F1 (C-20:

SC-193, Santa Cruz). Actin (I-19: SC-1616, Santa Cruz) and GAPDH (V-18,

SC-20357, Santa Cruz) used as control. The membranes were then incubated

with horseradish peroxidase-conjugated 1:4000 dilution of anti-rabbit (81-

6120, Zymax) or 1:2000 dilution of anti-goat (P-0449, Dako) secondary

antibody and the blot were treated with enhanced chemiluminescence reagent

(WEST-ZOL Plus Kit, iNtRON Biotechnology) and exposed to X-ray film.

The images were obtained by transmission scanner with the internal control of

the actin and GAPDH protein levels and relative quantitative analysis was

carried out based on the photo density ratio with ImageJ software of NIH.

11. Data analysis and statistics

Data obtained from the experiment were analyzed by Microsoft Excel (Ed.

2007, USA), GraphPad Prism 5 and SPSS-19 statistical software.

Comparisons of results were performed using a Student’s t-test. P values

-16-

Results

1. Monitoring the progression of CCA

(1) Abdominal ultrasonography (USG)

In USG, all hamsters of the control group showed normal shape, size and

echogenicity of the liver and gallbladder (GB). Hamsters in the Cs and

Cs+NDMA groups had enlarged liver with cirrhotic change and intrahepatic

bile duct dilatation. GB wall thickening and echogenic debris were commonly

observed in both groups. The cirrhotic appearances of the liver were more

prominent in Cs+NDMA group. First mass-forming lesion (MFL) appeared as

early as the 6th week of infection in the Cs+NDMA group (Fig. 3). The MFLs

in the liver were observed in 77.3% hamsters of the Cs+NDMA group after

16th week of infection as revealed by USG (Table 3). The MFLs were

consistent or increased in size and number among USG evaluations in the

Cs+NDMA group. Fig. 3 showed mass-forming lesions in different lobes of

the hamster liver in the Cs+NDMA group starting from the 6th week upto 16th

week. In the NDMA group, most of the hamsters showed coarse echogenicity

of the liver parenchyma but no bile duct dilatation. There were no distinctive

differences observed after 16 weeks compared to control group.

Hepatomegaly and GB wall thickening were observed almost equally in

both Cs (90% and 40% respectively) and Cs+NDMA group (100% and 37.5%

respectively). However, echogenic debris, cystic changes and GB inner

-17-

echogenic debris were more prevalent in the Cs+NDMA group (100%, 91.7%

and 62.5% respectively) (Table 3).

(2) Abdominal MRI

MRI of randomly selected hamsters from different groups showed normal

liver in the control group. In the Cs group, extensive dilatation of bile ducts

was observed but there were no MFL observed by contrast enhanced scans

(Fig. 4). In the NDMA group, MRI did not show any definite abnormalities

compared to control. On the contrary extensive dilatation of the bile duct was

noted in all of the liver lobes and multiple T2 high signal intensity area in the

Cs+NDMA group. Many of them were eventually enhanced when contrast

media was administered (Fig. 4). MRI also confirmed the first MFL and a

complicated cyst at the 6th week of infection in the Cs+NDMA group. The Cs

group restricted to ductal dilatation even after 16 weeks of infection (Fig. 4).

2. Gross findings at necropsy

(1) Body weight measurement

Significant reduction (26.8%) of body weight was observed in the Cs+NDMA

group (120.27 ± 8.2; P < 0.001) compared to the control group (160.54 ±

13.83) after 16 weeks of the study. The Cs group also showed significant

weight loss (21.6%) (128.65 ± 13.08; P < 0.001) whereas no significant

difference was observed in the NDMA group (149.32 ± 9.79; P = 0.081)

-18-

Table 3. Qualitative histopathological findings of the liver and GB by USG

Gro

ups

Mas

s for

min

g

Cys

tic c

hang

es (%

)

Ech

ogen

ic d

ebri

s

W

orm

(%)

Lym

ph n

odes

(%)

Hep

atom

egal

y (%

)

GB

wal

l thi

cken

ing

G

B in

ner

echo

geni

c

Control 0 0 0 0 0 0 0 0

Cs 0 50 10 30 20 90 40 0

NDMA 6.7 0 0 0 0 0 0 0

Cs+NDMA 77.3 91.7 100 12.5 29.2 100 37.5 62.5

-19-

relative to the control (Fig. 5A).

(2) Measurements of the liver and spleen

The liver weight in the control group measured 5.97 ± 0.86 gm whereas the

Cs group showed an average of 8.04 ± 1.45 gm. The NDMA group showed

similar weight (6.79 ± 1.27 gm) of the liver as the control. The highest liver

weight was observed in the Cs+NDMA group (11.32 ± 1.53 gm) which was

highly significant as well (Fig. 5B). Liver weight in the control group was

3.69% ± 0.54% of the body weight in average. However, it was 6.79% ±

1.37%, 4.41% ± 0.69% and 11.32% ± 0.86% in the Cs, NDMA and

Cs+NDMA groups respectively (Fig. 5C). The liver weight increased about 2

times in the Cs group and 3 times in the Cs+NDMA group compared to the

body weight suggesting hepatomegaly in the Cs and Cs+NDMA groups. The

weight gain of the liver was 88.6% in Cs+NDMA group. Increase of the liver

weight in NDMA group was insignificant. Spleen weight difference between

the control and the Cs groups as well as the control and the Cs+NDMA

groups were highly significant (P < 0.001). The heaviest spleen weight (0.52

± 0.22 g) was observed in the Cs+NDMA group suggesting splenomegaly

(Fig. 5D). The spleen weight percentages to the body weight were also

increased in the Cs and Cs+NDMA groups about 2 and 4 times respectively

(Fig. 5E). The spleen was gained about 255.2% weight in Cs+NDMA group.

Average spleen length in the control group was 34.67 ± 0.99 mm where as it

was 47.28 ± 1.29 mm in the Cs+NDMA group (Fig. 5F). Thus the increase of

-20-

length was 21.9%. Gross view of the spleen is displayed in Fig. 5G for visual

comparison.

(3) Mass-forming lesions (MFLs) in the liver

The prevalence of MFL in the Cs group was 33.3% and in the NDMA group

23.1%, but all hamsters (100%) of the Cs+NDMA group showed single or

multiple MFLs. The intensity of MFLs in the Cs group was 1.0 ± 0, NDMA

group 1.33 ± 0.58 whereas in the Cs+NDMA group it was 10.92 ± 5.76

distributed among the lobes of the liver (left lobe: 3.71 ± 2.31; median lobe:

3.46 ± 1.93; right lobe: 2.58 ± 2.24 and caudate lobe: 1.17 ± 1.37) (Fig. 6A,

6B). At necropsy all of the livers were photographed and representative livers

are summarized in Fig. 6C. The livers of the control and the NDMA groups

were normal in gross appearance. However, the livers of the Cs and

Cs+NDMA groups showed dilated biliary tree, blackish coloration and

cirrhotic appearance. Fig. 6D showed 2-4 mm sections of the formalin fixed

liver. Ultrasonographic monitoring helped to find out some tumors which

were not visible in the liver externally at necropsy (Fig. 6E).

3. Histopathological findings

(1) H&E staining of histopathological slides

The histopathology of the control group showed normal appearance of

hepatocytes, cholangiocytes and hepatic triad. No inflammatory cells were

accumulated in the control group. However, severe inflammation, bile duct

-21-

proliferation, periductal fibrosis were common in the Cs group. The NDMA

group showed almost normal appearance. Bile duct proliferation,

cholangiofibrosis, metaplasia and different grades of adenocarcinoma were

evident in the Cs+NDMA group. Representative H&E stained histological

features from 4-16 weeks are presented in Fig. 7.

(2) Collagen staining

The Masson’s trichrome staining recognized dense collagen fibers around the

bile ducts in the Cs and Cs+NDMA groups. Trace amount of collagen was

found in the control and NDMA group around the biliary triad (Fig. 8). Sirius

red staining showed traces of type I collagen around the blood vessel and bile

duct, periductal and bridging collagen in the Cs group and dense fibers around

the bile ducts in the Cs+NDMA group forming fibrous stroma of CCA tissues

(Fig. 8).

(3) Immunohistochemistry against proliferative cell nuclear antigen

(PCNA)

Among 4 groups of hamsters, only the Cs+NDMA group showed strong

positive reaction with PCNA antibody. Proliferative cell nuclear antigen

(PCNA) was mostly accumulated in and around the MFL which was

confirmed as cholangiocarcinoma by histopathology (Fig. 8).

-22-

(4) Semiquantitative histopathological findings in different groups

No measurable histopathological changes were observed in the control group.

The Cs group showed significantly higher level of inflammation (34.3% ±

3.6% tissue area), bile duct hyperplasia (11.4% ± 2.1% tissue area), periductal

fibrosis (11.2% ± 1.9% tissue area), abscess (8.68 ± 3.1% tissue area),

however, no neoplastic change was observed. In the NDMA group, very low

quantity of inflammation (2.3% ± 0.8%), bile duct hyperplasia (1.0% ± 0.3%),

cholangiofibrosis (1.4% ± 1.3%) were observed (Fig. 9). Inflammation was

significantly higher in the Cs group than that in the Cs+NDMA group (Fig.

9A). Higher level of bile duct hyperplasia, periductal fibrosis, and abscess

were also observed in the Cs group than in the Cs+NDMA group (Fig. 9B,

9C, 9E respectively). Egg granuloma and cholangiofibrosis did not show any

significant difference between the Cs and Cs+NDMA groups (Fig. 9D, 9F

respectively).

(5) Grading of CCA

CCAs originated in the Cs+NDMA group were categorized in well,

moderately, and poorly differentiated types (Fig. 10). In average, CCA was

found in about 46.0% of total tissue area of the Cs+NDMA group. Among

CCAs, well differentiated CCA (WDC) was most prevalent and observed in

21.8% ± 1.5% of total tissue area. Moderately differentiated CCA (MDC) was

found in 13.3% ± 1.3% of total tissue area and poorly differentiated CCA

-23-

(PDC) was detected in 10.8% ± 1.3% of tissues (Fig. 10A). Beside this, one

hamster of the NDMA group showed well and moderately differentiated CCA

restricted in a very limited area (0.5% ± 0.5% and 0.03% ± 0.3%

respectively).

(6) Histopathological changes at cellular level

The metaplastic conversion of bile duct epithelial cells to mucin secreting

cells was not observed in the control group. The Cs and NDMA groups

showed 8.4 ± 3.1 and 9.6 ± 5.6 metaplastic cells respectively while the

Cs+NDMA group showed 56.4 ± 7.9 metaplastic cells per histological tissue

section (Fig. 11A, 11B). Mitotic figures observed in the Cs, NDMA, and

Cs+NDMA groups were 4.3 ± 1.3, 0.3 ± 0.1 and 22.9 ± 2.3 per histological

section respectively (Fig. 11C, 11D). Hepatic cell nuclear/glycogen inclusion

was rare in the normal (2 ± 0.2) and Cs (1.7 ± 0.5) groups, however, it was

15.8 ± 1.4 in the NDMA and 5.2 ± 0.5 in the Cs+NDMA group when

observed in 10 high power fields (HPF) (Fig. 11E, 11F). Bile cell nuclear

inclusion frequently appeared in the Cs+NDMA group (1.7 ± 0.7) compared

to the Cs (0.5 ± 0.3) and NDMA groups (0.03 ± 0.03) (Fig. 11G, 11H).

4. Oncogenesis related genes/proteins expression

Relative expression of mRNA by real-time PCR (Fig. 12) showed that

gankyrin, CDK4, BAX and RB1 genes were overexpressed in the Cs+NDMA

hamster’s liver tumor tissues. Gene p53 was downregulated both in tumor

-24-

(Cs+NDMA-T) and adjacent normal tissues (Cs+NDMA-N) but upregulated

in the NDMA, and remained same in the Cs group. CDK4 inhibitor gene

p16INK4 also showed upregulation in the tumor and adjacent normal tissues

as well as in the Cs group but remained same in the NDMA group. Increase

of p16INK4 in Cs+NDMA group was almost 40 folds which was highly

significant (P < 0.001). Though Akt/PKB showed slight upregulation but it

was not significant (Fig. 13).

In western blot analysis, goat actin, GAPDH, Akt1 and rabbit CDK4, p53,

RB, VEGF and E2F1 primary antibodies cross-reacted with hamster

counterparts (Fig. 14). Both p53 and RB proteins were found underexpressed

in the Cs+NDMA group, however, CDK4 and Akt1 increased. The increase

of CDK4 and decrease of p53 and RB were statistically significant. No

significant changes were observed in E2F1 or VEGF (Fig. 14). Upregulated,

downregulated, and unchanged genes/proteins listed in Fig. 15A. A simplified

signal transduction pathway introduced the interaction of genes/proteins in

Fig. 15B. The present study found that several interactions between proteins

have affected indicated as dotted lines in the diagram (Fig. 15B).

Fig. 3. Abdominal ultrasonography (USG) from 0-16 weeks of infection at every

2 weeks interval. First mass-forming lesion (arrows) found to appear after 6

weeks of infection in Cs+NDMA group. Gall bladder (GB) frequently showed

worms (asterisk). Arrow head indicates complicated cyst and chevron indicates

ductal dilatation.

Ctrl.

6

wee

ks

4

wee

ks

2

wee

ks

0

wee

k

1

6 w

eeks

1

2 w

eeks

10 w

eeks

8 w

eeks

Cs

NDMA

Cs+NDMA

GB GB

GB GB

GB GB

GB GB GB

GB

GB GB

-25-

Fig. 4. Abdominal magnetic resonance imaging (MRI) from 2-16 weeks of

infection at every 2 weeks interval in randomly selected hamsters of different

groups. MRI also detected mass-forming lesion (arrows) and cyst as early as 6

weeks after infection. GB indicates gall bladder; arrow head, cysts and

chevron, ductal dilatations.

Ctrl.

6

wee

ks

4 w

eeks

2

wee

ks

16

wee

ks

12 w

eeks

10

wee

ks

8 w

eeks

Cs

NDMA

Cs+NDMA

Not Done Not Done Not Done

Not Done Not Done Not Done

Not Done

GB

GB

GB GB

GB

GB GB

GB GB

GB GB GB

GB GB

-26-

70

90

110

130

150

170

0 4 8 12 16

Body

wei

ght

(gm

)

Weeks

Control Cs NDMA Cs+NDMA

Fig. 5. Weight and length of different organs of hamster at necropsy. A, Body

weight; B, Liver weight; C, Percentage of liver weight to body weight; D,

Spleen weight; E, Percentage of spleen weight to body weight; F, Spleen

length; and G, Gross spleen (1-4 represents 4 hamster groups respectively; Bar

= 10 mm).

0

5

10

15

Live

r w

eigh

t (g

m)

A

B

D

F

C

E

G

0

5

10

15 %

of l

iver

wei

ght

(gm

) *

0

0.2

0.4

0.6

0.8

Sple

en w

eigh

t (g

m)

* 0

0.1 0.2 0.3 0.4 0.5 0.6

% o

f spl

een

w

eigh

(gm

)

25

35

45

55

Sple

en le

ngth

(mm

) *

1 2 3 4

† †

† † †

†

† †

† †

† †

-27-

Fig. 6. Mass-forming lesion’s (MFL) prevalence, intensity and gross view. A,

Prevalence; B, Intensity; C, Gross view of liver after 16 weeks of infection (1-

4 represents 4 hamster groups respectively); D, Serial section (2-4 mm) of

10% formalin fixed liver showing MFL (arrows); E, MFL observed after

sectioning gross liver which was not visible from outside (Bar = 5 mm).

0

5

10

15

20

No.

of m

ass

form

ing

lesi

on

0

25

50

75

100

Prev

alen

ce o

f MFL

(%)

A †

1 2

3 4

B

C D

E

†

-28-

Fig. 7. H&E staining of the liver sections in different groups of hamsters

(x100). Normal hepatic cells and biliary triad observed in control group,

proliferated bile duct, periductal fibrosis, inflammatory cells observed in Cs

group, NDMA group showed normal biliary triad where as Cs+NDMA group

showed highly proliferated bile cells in a fibrous stroma leading to CCA.

16

wee

ks

12

wee

ks

8 w

eeks

4

wee

ks

Ctrl.

Cs

NDMA

Cs+NDMA

-29-

Fig. 8. Masson’s trichrome, Sirius red and proliferative cell nuclear antigen

(PCNA) staining of liver in different groups of hamsters after 16 weeks of

infection (x100). Control and NDMA liver showed traces of collagen fibers

(blue and red for Masson’s trichrome and Sirius red staining respectively)

around the biliary triad artery, C. sinensis infected group showed collagen

fibers around the bile duct, however, dense collagen fibers observed in

Cs+NDMA group. PCNA was strongly positive for Cs+NDMA group.

Ctrl.

Cs

NDMA

Cs+NDMA

PCN

A

S

iriu

s re

d

M

asso

n’s

tri

chro

me

-30-

Fig. 9. Semiquantitative non-neoplastic histopathological changes in different

groups of hamsters. A, inflammation; B, bile duct hyperplasia; C, periductal

fibrosis; D, egg granuloma; E, abscess; F, cholangiofibrosis. Significantly

higher level of inflammation, bile duct hyperplasia, periductal fibrosis, and

abscess observed in Cs group compared to NDMA and Cs+NDMA groups.

% o

f tot

al ti

ssue

s ar

ea

% o

f tot

al ti

ssue

s ar

ea

% o

f tot

al ti

ssue

s ar

ea

A B

C D

E F

Ctrl. Cs NDMA Cs+NDMA Ctrl. Cs NDMA Cs+NDMA

*

*

† †

† †

†

†

† †

†

-31-

Fig. 10. Semiquantitative neoplastic histopathological changes in different

groups of hamsters (A). WDC, well differentiated CCA; MDC, moderately

differentiated CCA; and PDC, poorly differentiated CCA. All forms of

CCA observed in Cs+NDMA group. Histopathological views of CCA

(x400): B, WDC; C, MDC; and D, PDC. Nuclear polymorphism of bile

cells noted in Fig. B.

% o

f tot

al ti

ssue

s

WDC MDC PDC

A B

C D

-32-

Fig. 11. Cellular changes among the groups of hamsters. A-B, Mucin secreting

cell metaplasia; C-D, mitotic figures; E-F, hepatic cell nuclear/glycogen

inclusion; G-H, bile cell nuclear/glycogen inclusion (histological section’s

original magnification x400). Significant increase of mucin secreting cells and

mitotic figures are noted in Cs+NDMA group. HPF = high power field.

† †

No.

of c

ells

/ se

ctio

n N

o. o

f cel

ls/

sect

ion

No.

of c

ells

/10

HPF

N

o. o

f cel

ls/

10 H

PF B A

D C

F E

H G

† †

†

† † †

†

-33-

A

B

C M N 1 2 3 4 5 6 7

Fig. 12. Real-time PCR using SYBR Green I DNA binding dye. A,

amplification curve with negative RT product; B, melting peak chart of same

amplified sample; and C, agarose gel electrophoresis of same PCR product for

the confirmation of single bands (M = 100 bp molecular DNA marker, N = -

RT negative control, 1-7 samples).

-34-

N

N

Samples

Samples

Fig. 13. Relative expression of oncogenesis related genes by real-time PCR.

Significant changes in the expression of gankyrin, p16INK4, CDK4, p53

genes observed in the tumor tissues (Cs+NDMA-T).

0

1

2

3

0

10

20

30

40

50

0

5

10

15

20

0

1

2

3

Gankyrin p16INK4

CDK4 p53

*

* *

†

*

*

* * *

*

0

1

2

3

4

0

2

4

6

8

0

1

2

3

4

BAX Akt/PKB

RB1

* *

*

*

Fold

cha

nges

of m

RNA

exp

ress

ion

rela

tive

to

GA

PDH

-35-

Fig. 14. Relative expression of oncogenesis related proteins by western blot

analysis. To determine the band density NIH ImageJ software were used. Top

left figure showed the western blot (WB) bands of representative proteins.

0

1

2

3

0

1

2

3

0

1

2

3

0

1

2

3

0

1

2

3

0

1

2

3

CDK4

p53

Akt1

RB

E2F1 VEGF

* * *

†

Rela

tive

expr

essi

on o

f pro

tein

s co

mpa

red

to A

ctin

and

GA

PDH

43

34

62

53

110

42

60

Ctr

l.

Cs

N

DM

A

Cs+

ND

MA

KDa

Actin

CDK4

Akt1

p53

RB

VEGF

E2F1

GAPDH 37

Rela

tive

expr

essi

on o

f pro

tein

s co

mpa

red

to A

ctin

and

GA

PDH

WB bands

-36-

Groups Upregulation Downregulation Unchanged

Cs Gankyrin

p16INK4

RB VEGF

E2F1

NDMA Akt/PKB

p53

BAX

VEGF

E2F1

Cs+NDMA Gankyrin

p16INK4

CDK4

BAX

Akt1

RB

p53

VEGF

E2F1

Regulation of genes in different groups of hamster

relative to the control group

Fig. 15. Relative expression of oncogenesis related genes/proteins by real-time

PCR and/or western blot analysis (A). B, Simplified signal transduction

pathway showing the interaction of proteins (dotted lines has been affected

in the present study).

A

-37-

Gene regulation

Cell proliferation

p53

E2F

CDK4

RB

Gankyrin

Apoptosis

p16

Bad

Akt/PKB

B G

anky

rin

-38-

Discussion

CCA is a malignant disease of the biliary system which is difficult to

diagnose and mechanism little understood. In the present study, USG detected

MFLs as early as the 6th week of infection, which is novel in the CCA animal

model and showed a prevalence rate of 77.3% after 16 weeks. Enhanced MRI

supported the findings of USG. C. sinensis infection with or without NDMA

treatment caused significant weight loss in the animals accompanied with

hepatomegaly and splenomegaly. Whole liver examination through 2-4 mm

slicing detected CCA in all animals of the Cs+NDMA group thus the

prevalence reached as high as 100% which is also a novel finding.

Histopathology observed different kinds of non-neoplastic changes frequently

in the Cs and rarely in the NDMA group. On the other hand, different grades

of CCA were observed in the Cs+NDMA group, and well developed type

composed about 22% of total tissue area. CCA stroma largely consisted of

dense collagen fibers and abundant proliferative cell nuclear antigen (PCNA)

detected by immunohistochemistry. Gene expression analysis revealed a

newly upregulated oncogene gankyrin for CCA. Beside this, downregulation

of p53 gene, RB protein with the upregulation of CDK4 were also evident

from the current study.

In the present study, USG was able to distinguish the Cs and Cs+NDMA

groups from the control just after 2 weeks. After 4 weeks, all of the groups

were identifiable. The 1st MFL appeared at the 6th week in the Cs+NDMA

-39-

group which was confirmed as CCA at the 8th week by histopathology. At 16th

week single or multiple MFLs was observed in 77.3% hamsters of the Cs+

NDMA group. There were no studies in the present moment which detected

the CCA mass as early as the 6th week. A slightly similar study done only by

Plengsuriyakarn et al. (2012) using O. viverrini-NDMA mediated hamster

CCA model. They observed the hamsters after 20 weeks of infection by USG

and found sediments in GB, thickening of GB wall, and hypoechogenicity of

liver parenchyma cells in O. viverrini+NDMA group but MFLs was not

described. Consistently increased size of MFLs (Fig. 3) from the 6th week to

onward suggests the usefulness of USG for the diagnosis, prognosis and

monitoring of CCA. This finding also agrees with the study of Bloom et al.

(1999) which suggested USG for hepatocellular diseases and CCA. Other

findings like thickening and/or sedimentation of the gall bladder (GB) and

dilatation of bile duct were observed both in the Cs and Cs+NDMA groups.

These were more intense in the Cs+NDMA group which agreed with those of

Hong et al. (1994) and Plengsuriyakarn et al. (2012). Moreover, echogenic

debris and cystic changes frequently occurred in the Cs+NDMA group. Thus

USG is useful to determine the synergistic effect of Cs and NDMA in hamster

model.

MRI was used to monitor the progression of CCA and liver cancer both in

humans and animals (Ustundag and Bayraktar, 2008; Manfredi et al., 2004;

Vanderveen and Hussain, 2004; Petre et al., 1996). The current study used

MRI for the better visualization of the MFL and found in agreement with

-40-

USG. MRI detected MFL at the same 6th week, moreover, it has detected a

cyst in the Cs+NDMA group in addition. As time progressed the MFLs took

the lobulated shape which was observed by a number of studies previously

done on humans (Hwang et al., 2012; Maetani et al., 2001; Vilgrain et al.,

1997; Choi et al., 1995). As the CCA grew along the intrahepatic bile duct it

had a tendency to form satellite tumors resulting lobulated shape (Lim, 2003).

Hypointensed areas were observed in T2WI in both Cs and Cs+NDMA

hamsters in the present study. Such hypointensed area reflected the

complexity of fibrosis (Maetani et al., 2001). The difference of hypointensity

may be due to the level of fibrosis around the bile ducts or tumor tissues.

Minimal rim-enhancement of MFL agreed with findings of Hwang et al.

(2012). Therefore the present study suggests use of both USG and MRI for

the detection of cancerous lesions as suggested previously by Kuroki-Suzuki

et al. (2011).

Loss of body weight was measured as an assessment of disease

progression. Among the 4 groups, the highest weight loss was observed

(24.8%) in the Cs+NDMA group. Such weight loss may be related with the

progression of CCA (Nourissat et al., 2010; Chen et al., 2010). The present

study observed moderate hepatomegaly and splenomegaly in the Cs group

and severe in the Cs+NDMA group. In Cs+NDMA group, 88.6% weight of

the liver and 255.2% weight of spleen were increased. Hepatomegaly and

splenomegaly with the infection of the liver fluke was reported in previous

studies as well (Kaewpitoon et al., 2008; Lee et al., 1993). The hepatomegaly

-41-

must have been an outcome of inflammation, collagen deposition, and

neoplasm. The splenomegaly might be caused by hepatomegaly.

The Syrian golden hamster is the only known model of CCA by C.

sinensis. One previous study (Lee et al., 1994) detected CCA in about 73%

hamsters infected with C. sinensis after 13 weeks along with NDMA

administration, however, in present study CCA developed in all hamsters of

Cs+NDMA group after 16 weeks. There are several reasons for this different

finding, most importantly, the duration, dose of NDMA and number of C.

sinensis metacercariae. Lee et al. (1994) treated hamsters for 4 weeks with a

dose of 15 ppm NDMA instead of 8 weeks with 12.5 ppm NDMA. The

author also used a lower dose of metacercariae. In the present investigation,

beside higher dose of metacercariae and longer period of NDMA treatment, a

2-4 mm slicing of the formalin fixed liver had increased the prevalence rate of

CCA. One hamster of the NDMA group developed CCA in a tiny portion of

the liver (0.57 % of total tissue area). Though the average area of CCA is

negligible it suggested that there is a possibility of developing CCA in

NDMA treated group if the 12.5 ppm dose continued for 8 weeks and the

hamsters is kept for 16 weeks or more. The intensity of MFLs in the present

study was 10.92 ± 5.76 in the Cs+NDMA group which was not described in

any earlier studies (Plengsuriyakarn et al., 2012; Songserm et al., 2009; Lee et

al., 1994; Lee et al., 1993). Thus a dose of 30 C. sinensis metacercariae and

12.5 ppm NDMA for 8 weeks can cause 100% CCA in Syrian goldern

hamster.

-42-

Histopathological findings confirmed CCA in all hamsters of Cs+NDMA

group and 1 hamster of NDMA group. Grading of CCA in the present study

revealed well differentiated in 21.8% ± 1.5%, moderately differentiated in

13.3% ± 1.3%, and poorly differentiated type in 10.8% ± 1.3% of total tissue

area of the Cs+NDMA group. The present hamster model is promising to

develop CCA of various differentiations. In the Cs group, C. sinensis caused

inflammation, bile duct hyperplasia, periductal fibrosis, egg granuloma,

metaplasia and cholangiofibrosis. Those findings were compatible with

descriptions of previous studies (Hong and Fang, 2012). The Cs group also

showed papillary biliary hyperplasia with no neoplastic lesion which was

regarded as typical histological feature in C. sinensis infection of humans

(Kim et al., 1999). Papillary biliary hyperplasia was found in 60% surgical

cases by Jung et al. (2008). Inflammation was severe comprising 34.3% ±

3.6% of total tissue area in the Cs group, but it was 4.9% ± 0.5% in the

Cs+NDMA group. Other histopathological aspects such as bile duct

hyperplasia, periductal fibrosis, egg granuloma were also found in less intense

in the Cs+NDMA group than in the Cs group. In the NDMA group, very little

histopathological changes occurred. A similar finding observed in case of O.

viverrini infection with nitrosamine (Boonmars et al., 2009; Kakar and

Burgart, 2005). At earlier stage of infection, both Cs and Cs+NDMA groups

showed such type of pathogenicity almost equally as revealed by imaging and

histopathology. However, due to the synergistic effect of C. sinensis and

NDMA, the hyperplastic and fibrotic portion around the bile duct gradually

-43-

changed into adenocarcinoma like appearance. This type of synergism is

evident from nitrosamine and fluke infections (Thamavit et al., 1987, 1993;

Lee et al., 1993; Flavel and Lucas, 1983). The immuno-suppressive behavior

of neoplastic cells might be responsible for less inflammation around it. This

may be a topic of further study.

Masson’s trichrome staining was used previously to detect metastasis of

colon carcinoma to the liver as well as myofibroma (Ichihara et al., 2010;

Chang and Kessler, 2008). In the present study, abundant collagen fibers were

observed in and around the CCA tissue. Among the collagen fibers, type I

was abundant as revealed by Sirius red staining. Abundance of type I collagen

also observed in squamous cell carcinoma and liver fibrosis (Martins et al.,

2003; Li et al., 2009). This finding suggests that the composition of CCA

stroma largely consists of collagen fibers specially type I.

In the present study, the number of metaplastic cells in the tissue sections

increased about 7 times more in the Cs+NDMA group than in the Cs group

and about 5 times more than in the NDMA group. The mitotic figure is one of

the important characteristics of carcinogenic tissue. In the present study, 22 ±

2.3 mitotic figures were observed per histologic section in the Cs+NDMA

group while it was only 4.3 ± 1.4 per section in the Cs group suggesting the

synergistic nature of Cs and NDMA. Mitotic figures suggest the abundance of

PCNA. Present study observed a strong positive reaction against PCNA

antibody in and around the tumor tissue. This type of strong positivity of

PCNA was also observed in case of hamster buccal pouch cancer (Nagini et

-44-

al., 2009). Thus PCNA may be a candidate marker molecule of CCA in

clonorchiasis patients. It should be evaluate further.

Several studies showed the involvement of several oncogenesis related

genes in O. viverrini and NDMA mediated CCA in hamster model (Wu et al.,

2011; Boonmars et al., 2010; Boonmars et al., 2008; Loilome et al., 2006;

Sithithaworn et al., 2002). In the present study, a novel oncogene for CCA

named gankyrin was upregulated in the Cs+NDMA group tumor tissue,

however, it was unchanged in adjacent normal tissue. The upregulation of

gankyrin is evident from different type of cancer including endometrial

carcinoma, breast cancer and colo-rectal cancer (Zhang et al., 2012; Zhen et

al., 2012; Tang et al., 2010). Apoptosis related genes, Akt/PKB and BAX were

found to be upregulated in early infection with O. viverrini, a closely related

parasite of C. sinensis (Boonmars et al., 2008). However, there were no data

regarding long term infection. The present study showed increased expression

of BAX after 16 weeks of infection. Tumor suppressor genes, RB1 and

p16INK4 were downregulated in earlier studies with O. viverrini (Boonmars

et al., 2009). In contrast, both RB1 and p16INK4 were upregulated in the

Cs+NDMA group of the present study. However, expression of RB protein

was significantly decreased in western blot analysis, which suggested possible

mutation in RB1 gene or break down of RB protein after expression. Such

mutated RB gene can cause overexpression of p16INK4 (Witkiewicz et al.,

2011; Sasaki et al., 2012). Study also suggests association of gankyrin with

the degradation of RB protein (Li et al., 2011). Overexpression of p16INK4

-45-

was also observed in cervical intraepithelial neoplasia (Jentschke et al., 2012).

Gene p53 plays an important role in both tumor suppression and apoptosis.

Previous studies found the more expression of p53 in case of early infection

of O. viverrini (Boonmars et al., 2008; Nagini et al., 2009; Boonmars et al.,

2008). After long term infection with C. sinensis and NDMA treatment, p53

gene was downregulated in this study. Beside p53 gene, cell cycle related

gene CDK4 was upregulated significantly. Western blot analysis of proteins

Akt1, CDK4 and p53 were compatible with mRNA expression by real-time

PCR.

At present it can be concluded that MFLs appear as early as 6 weeks

after infection and combination of USG and MRI is helpful to monitor the

disease progression in the hamster model. C. sinensis alone or with NDMA

causes significant weight loss and hepato-splenomegaly. A slightly higher

dose of C. sinensis and 2-4 mm manual slicing of fixed liver can increase the

rate of CCA in hamster model. Non neoplastic changes caused by C. sinensis

replaced with CCA as time progressed. The CCA stroma mostly characterized

by the presence of collagen fibers, mucin secreting cells, mitotic figures and

PCNA. Upregulated oncogene gankyrin and cell cycle related gene CDK4

with dowregulated tumor suppressor gene p53 and RB protein plays an

important role in the process of cholangiocarcinogenesis. Excessive mRNA

expression of p16INK4 and increased PCNA may be useful marker candidates

for diagnosis or prognosis of CCA in clonorchiasis.

-46-

References

American Cancer Society (2007) Report sees 7.6 million global 2007 cancer

deaths. Reuters. http://www.reuters.com/article/healthNews/idUSN-

16330649 20071217

Bhamarapravati N, Thamavit W, Vajrasthira S (1978) Liver changes in

hamsters infected with a liver fluke of man, Opisthorchis viverrini.

Am Soc Trop Med Hyg 27:787-94

Blaser MJ, Atherton J (2004) Helicobacter pylori persistence: biology and

disease. J Clin Invest 113:321–33

Bloom CM, Langer B, Wilson SR (1999) Role of US in the detection,

characterization, and staging of cholangiocarcinoma. Radiographics

19:1199-218

Boonmars T, Srirach P, Kaewsamut B, Srisawangwong T, Pinlaor S, Pinlaor

P, Yongvanit P, Sithithaworn P (2008) Apoptosis-related gene

expression in hamster opisthorchiasis post praziquantel treatment.

Parasitol Res 102:447–55

Boonmars T, Wu Z, Boonjaruspinyo S, Pinlaor S, Nagano I, Takahashi Y,

Kaewsamut B, Yongvanit P (2009) Alterations of gene expression of

RB pathway in Opisthorchis viverrini infection-induced

cholangiocarcinoma. Parasitol Res 105:1273–81

-47-

Boonmars T, Wu Z, Boonjaruspinyo S, Puapairoj A, Kaewsamut B, Nagano

I, Pinlaor S, Yongvanit P, Wonkchalee O, Juasook A, Sudsarn P,

Srisawangwong T (2011) Involvement of c-Ski oncoprotein in

carcinogenesis of cholangiocacinoma induced by Opisthorchis

viverrini and N-nitrosodimethylamine. Pathol Oncol Res 17:219-27

Bouvard V, Baana R, Straifa K, Grosse Y, Secretan B, El Ghissassi F,

Benbrahim-Tallaa L, Guha N, Freeman C, Galichet L, Cogliano V

(2009) A review of human carcinogens – part B: biological agents.

Lancet Oncol 10:321–2

Butel J (2000) Viral carcinogenesis: revelation of molecular mechanisms and

etiology of human disease. Carcinogenesis 21:405–26

Cancer Research UK (2007) UK cancer incidence statistics by age.

http://info.cancerresearchuk.org/cancerstats/incidence/age/. Retrieved

2007-06-25

Chang JY, Kessler HP. (2008) Masson trichrome stain helps differentiate

myofibroma from smooth muscle lesions in the head and neck

region. J Formos Med Assoc. 107:767-73

Chang KW, Mangold KA, Hubchak S, Laconi S, Scarpelli DG (1994)

Genomic p53 mutation in a chemically induced hamster pancreatic

ductal adenocarcinoma. Cancer Res 54:3878-83

Chen SP, Peng LN, Lin MH, Lai HY, Hwang SJ, Chen LK (2010) Evaluating

probability of cancer among older people with unexplained,

unintentional weight loss. Arch Gerontol Geriatr. 50 Suppl 1:S27-9

http://www.ncbi.nlm.nih.gov/pubmed?term=Chang%20JY%5BAuthor%5D&cauthor=true&cauthor_uid=18926943http://www.ncbi.nlm.nih.gov/pubmed?term=Kessler%20HP%5BAuthor%5D&cauthor=true&cauthor_uid=18926943http://www.ncbi.nlm.nih.gov/pubmed/18926943http://www.ncbi.nlm.nih.gov/pubmed/20171452http://www.ncbi.nlm.nih.gov/pubmed/20171452http://www.ncbi.nlm.nih.gov/pubmed/20171452

-48-

Choi BI, Han JK, Shin YM, Baek SY, Han MC (1995) Peripheral

cholangiocarcinoma: comparison of MRI with CT. Abdom

Imaging 20: 357–60

Choi D, Hong ST, Li S, Chung BS, Lim JH, Lee SH (2004) Bile duct changes

in rats reinfected with Clonorchis sinensis. Korean J Parasitol 42:7-17

Ferlay J, Bray F, Pisani P, Parkin DM, Ferlay J (2001) Globocan 2000:

Cancer Incidence, Mortality and Prevalence Worldwide. IARC

Cancer Base No. 5. Lyon, Fr.: IARC

Flavell DJ, Lucas SB (1983) Promotion of nitrosodimithylamine initiated bile

duct carcinogenesis in the hamster by the human liver fluke,

Opisthorchis viverrini. Carcinogenesis 4:927-30

Hong ST, Fang Y (2012) Clonorchis sinensis and clonorchiasis, an

update. Parasitol Int 61:17-24

Hong ST, Park KH, Seo M, Choi BI, Chai JY, Lee SH (1994) Correlation of

sonographic findings with histopathological changes of the bile ducts

in rabbits infected with Clonorchis sinensis. Korean J

Parasitol 32:223-30

Hwang J, Kim YK, Park MJ, Lee MH, Kim SH, Lee WJ, Rhim HC

(2012) Differentiating combined hepatocellular

and cholangiocarcinoma from mass-forming

intrahepatic cholangiocarcinoma using gadoxetic acid-enhanced

MRI. J Magn Reson Imaging 36:881-9

http://www.ncbi.nlm.nih.gov/pubmed?term=Hong%20ST%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20KH%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Seo%20M%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Choi%20BI%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Chai%20JY%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20SH%5BAuthor%5D&cauthor=true&cauthor_uid=7834239http://www.ncbi.nlm.nih.gov/pubmed/7834239http://www.ncbi.nlm.nih.gov/pubmed/7834239http://www.ncbi.nlm.nih.gov/pubmed?term=Hwang%20J%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20YK%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Park%20MJ%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20MH%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Kim%20SH%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20WJ%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed?term=Rhim%20HC%5BAuthor%5D&cauthor=true&cauthor_uid=22730271http://www.ncbi.nlm.nih.gov/pubmed/22730271

-49-

Ichihara H, Funamoto K, Matsushita T, Matsumoto Y, Ueoka R (2010)

Histological bioanalysis for therapeutic effects of hybrid liposomes

on the hepatic metastasis of colon carcinoma in vivo. Int J

Pharm 394:174-8

Ishak KG, Anthony PP, Sobin LH (1994) Histological typing of tumours of

the liver. In: WHO International Histological Classification of

Tumors. Berlin: Springer Verlag pp37–45

Jemal A, Center MM, DeSantis C, Ward EM (2010) Global patterns of cancer

incidence and mortality rates and trends. Cancer Epidemiol

Biomarkers Prev 19:1893-907

Jentschke M, Lange V, Soergel P, Hillemanns P (2012) Enzyme-linked

immunosorbent assay for p16(INK4a) - a new triage test for the

detection of cervical intraepithelialneoplasia? Acta Obstet Gynecol

Scand. doi: 10.1111/aogs.12032. [Epub ahead of print]

Jung MY, Shin HR, Lee CU, Sul SY, Lee SW, Park BC (1993) A study of

the ratio of hepatocellular carcinoma over cholangiocarcinoma and

their risk factors. J Pusan Med Assoc 29:29-37

Jung KT, Hong SM, Lee KT, Lee JG, Choi SH, Heo JS, Choi DW, Choi D,

Lim JH (2008) Intraductal papillary neoplasm of the bile duct

associated with Clonorchis sinensis infection. Virchows Arch

453:589-98

http://www.ncbi.nlm.nih.gov/pubmed?term=Ichihara%20H%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Funamoto%20K%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Matsushita%20T%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Matsumoto%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Ueoka%20R%5BAuthor%5D&cauthor=true&cauthor_uid=20471463http://www.ncbi.nlm.nih.gov/pubmed/20471463http://www.ncbi.nlm.nih.gov/pubmed/20471463http://www.ncbi.nlm.nih.gov/pubmed?term=Jentschke%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Lange%20V%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Soergel%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed?term=Hillemanns%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23072258http://www.ncbi.nlm.nih.gov/pubmed/23072258http://www.ncbi.nlm.nih.gov/pubmed/23072258

-50-

Kaewpitoon N, Kaewpitoon SJ, Pengsaa P (2008) Opisthorchiasis in

Thailand: review and current status. World J Gastroenterol 14:2297-

302

Kakar S and Burgart LJ (2005) Tumors of the biliary system. Curr Diagn

Pathol 11:34-43

Kim KH, Kim CD, Lee HS, Lee SJ, Jeen YT, Chun HJ, Song CW, Lee SW,

Um SH, Choi JH, Ryu HS, Hyun JH (1999) Biliary papillary

hyperplasia with clonorchiasis resembling cholangiocarcinoma. Am J

Gastroenteron 94:514-7

Kim YJ, Choi MH, Hong ST, Bae YM (2008) Proliferative effect of

excretory/secretory products from Clonorchis sinensis on the human

epithelial cell line HEK293 via regulation of the transcription factor

E2F1. Parasitol Res 102:411-7

Kitahashi T, Tsujiuchi T, Satoh K, Ohtsuki K, Konishi Y and Tsutsumi M

(2004) Aberrant transcription of FHIT gene in intrahepatic

cholangiocellular carcinomas induced by N-nitrosobis(2-

oxopropyl)amine in hamsters. Exp toxicol pathol 56:153-7

Kuroki-Suzuki S, Kuroki Y, Nasu K, Nagashima C, Machida M, Muramatsu

Y, Moriyama N (2011) Pancreatic cancer screening employing

noncontrast magnetic resonance imaging combined with

ultrasonography. Jpn J Radiol 29:265-71

Lee JH, Rim H J, Sell S (1997) Heterogeneity of the ‘oval-cell’ response in

the hamster liver during cholangiocarcinogenesis following

http://www.ncbi.nlm.nih.gov/pubmed?term=Kaewpitoon%20N%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed?term=Kaewpitoon%20SJ%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed?term=Pengsaa%20P%5BAuthor%5D&cauthor=true&cauthor_uid=18416453http://www.ncbi.nlm.nih.gov/pubmed/18416453http://www.ncbi.nlm.nih.gov/pubmed/21607840http://www.ncbi.nlm.nih.gov/pubmed/21607840http://www.ncbi.nlm.nih.gov/pubmed/21607840

-51-

Clonorchis sinensis infection and dimethylnitrosamine treatment. J

Hepatol 26:1313–23

Lee JH, Rim HJ, Bak UB (1993) Effect of Clonorchis sinensis infection and

dimethylnitrosamine administration on the induction of

cholangiocarcinoma in Syrian golden hamsters. Korean J Parasitol

31:21-30

Lee SH, Shim JS, Lee SM, Chi JG (1978b) Studies on pathological changes

of the liver in albino rats infected with Clonorchis sinensis. Korean J

Parasitol 16:148-55

Lee YS, Lee SH, Chi JG (1978a) Ultrastructural changes of the hepatocytes

and biliary epithelia due to Clonorchis sinensis in guinea pigs.

Korean J Parasitol 16:188-102

Lee JH, Yang HM, Bak UB, Rim HJ (1994 ) Promoting role

of Clonorchis sinensis infection on induction of cholangiocarcinoma

during two-step carcinogenesis. Korean J Parasitol 32:13-8

Li J, Knobloch TJ, Kresty LA, Zhang Z, Lang JC, Schuller DE, Weghorst

CM (2011) Gankyrin, a biomarker for epithelial carcinogenesis, is

overexpressed in human oral cancer. Anticancer Res 31:2683-92

Li YL, Wu J, Wei D, Zhang DW, Feng H, Chen ZN, Bian H (2009)

Newcastle disease virus represses the activation of human hepatic

stellate cells and reverses the development of hepatic fibrosis in

mice. Liver Int 29:593-602

http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed/8390293http://www.ncbi.nlm.nih.gov/pubmed?term=Lee%20JH%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20HM%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Bak%20UB%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Rim%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=8167103http://www.ncbi.nlm.nih.gov/pubmed/8167103http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20J%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Knobloch%20TJ%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Kresty%20LA%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20Z%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Lang%20JC%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Schuller%20DE%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Weghorst%20CM%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Weghorst%20CM%5BAuthor%5D&cauthor=true&cauthor_uid=21868508http://www.ncbi.nlm.nih.gov/pubmed/21868508http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20YL%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Wu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Wei%20D%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20DW%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Feng%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Chen%20ZN%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed?term=Bian%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19192169http://www.ncbi.nlm.nih.gov/pubmed/19192169

-52-

Lim JH (2003) Cholangiocarcinoma: morphologic classification according to

growth pattern and imaging findings. Am J Roentgenol 181:819-27

Loilome W, Yongvanit P, Wongkham C, Tepsiri N, Sripa B, Sithithaworn

P, Hanai S, Miwa M (2006) Altered gene expression in Opisthorchis

viverrini-associated cholangiocarcinoma in hamster model. Mol

Carcinog 45:279-87

Maetani Y, Itoh K, Watanabe C, Shibata T, Ametani F, Yamabe H, Konishi

J (2001) MR imaging of intrahepatic cholangiocarcinoma with

pathologic correlation. AJR Am J Roentgenol 176:1499–1507

Manfredi R, Barbaro B, Masselli G, Vecchioli A, Marano P (2004) Magnetic

resonance imaging of cholangiocarcinoma. Semin Liver Dis 24:155-

64

Martins GB, Reis SR, Silva TM (2003) Collagen type I expression in

squamous cell carcinoma of the oral cavity. Pesqui Odontol Bras

17:82-8

Min HK, Han WS (1985) Bile duct changes in albino rats experimentally

infected with Clonorchis sinensis. Ewha Med J 8:111-5

Nagini S, Letchoumy PV, A T, Cr R (2009) Of humans and hamsters: a

comparative evaluation of carcinogen activation, DNA damage, cell

proliferation, apoptosis, invasion, and angiogenesis in oral cancer

patients and hamster buccal pouch carcinomas. Oral Oncol 45:e31-7.

Najm I, Trussell RR (2001) NDMA Formation in Water and

Wastewater. Journal of American Water Works Association 93: 92–9

http://www.ncbi.nlm.nih.gov/pubmed?term=Loilome%20W%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Yongvanit%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Wongkham%20C%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Tepsiri%20N%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sripa%20B%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sithithaworn%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Sithithaworn%20P%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Hanai%20S%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Miwa%20M%5BAuthor%5D&cauthor=true&cauthor_uid=16550611http://www.ncbi.nlm.nih.gov/pubmed/16550611http://www.ncbi.nlm.nih.gov/pubmed/16550611http://www.ncbi.nlm.nih.gov/pubmed?term=Martins%20GB%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Reis%20SR%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Silva%20TM%5BAuthor%5D&cauthor=true&cauthor_uid=12908066http://www.ncbi.nlm.nih.gov/pubmed/12908066http://www.ncbi.nlm.nih.gov/pubmed?term=Nagini%20S%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=Letchoumy%20PV%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=A%20T%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed?term=Cr%20R%5BAuthor%5D&cauthor=true&cauthor_uid=19250857http://www.ncbi.nlm.nih.gov/pubmed/19250857http://apps.awwa.org/WaterLibrary/showabstract.aspx?an=JAW_0053373http://apps.awwa.org/WaterLibrary/showabstract.aspx?an=JAW_0053373

-53-

Nourissat A, Bairati I, Samson E, Fortin A, Gélinas M, Nabid A, Brochet F,

Têtu B, Meyer F (2010) Predictors of weight loss during radiotherapy

in patients with stage I or II head and neck cancer. Cancer 116:2275-

83

Oliviera DE (2007) DNA viruses in human cancer: an integrated overview on

fundamental mechanisms of viral carcinogenesis. Cancer Lett

247:182–96

Olnes MJ, Erlich R (2004) A review and update on cholangiocarcinoma.

Oncology 66:167–79

Parkin DM (2001) Global cancer statistics in the year 2000. Lancet Oncol

2:533–43

Petré C, Ni Y, Marchal G, Yu J, Wevers M, Lauffer RB, Baert AL (1996)

Detection and characterization of primary liver cancer in rats by MS-

264-enhanced MRI. Magn Reson Med 35:532-9

Pisani P, Bray F, Parkin DM (2002) Estimates of the world-wide prevalence

of cancer for 25 sites in the adult population. Int J Cancer 97:72–81

Pisani P, Parkin DM, Bray F, Ferlay J (1999) Estimates of the worldwide

mortality from 25 cancers in 1990. Int J Cancer 83:18–29

Plengsuriyakarn T, Eursitthichai V, Labbunruang N, Na-Bangchang

K, Tesana S, Aumarm W, Pongpradit A, Viyanant V

(2012) Ultrasonography as a tool for monitoring the development and

progression of cholangiocarcinoma in Opisthorchis viverrini/

http://www.ncbi.nlm.nih.gov/pubmed/20187097http://www.ncbi.nlm.nih.gov/pubmed/20187097http://www.ncbi.nlm.nih.gov/pubmed?term=Petr%C3%A9%20C%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Ni%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Marchal%20G%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Yu%20J%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Wevers%20M%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Lauffer%20RB%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Baert%20AL%5BAuthor%5D&cauthor=true&cauthor_uid=8992203http://www.ncbi.nlm.nih.gov/pubmed/8992203http://www.ncbi.nlm.nih.gov/pubmed?term=Plengsuriyakarn%20T%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Eursitthichai%20V%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Labbunruang%20N%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Na-Bangchang%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Na-Bangchang%20K%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Tesana%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Aumarm%20W%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Pongpradit%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Viyanant%20V%5BAuthor%5D&cauthor=true&cauthor_uid=22502719

-54-

dimethylnitrosamine-induced hamsters. Asian Pac J Cancer

Prev 13:87-90

Sandhu DS, Shire AM, Roberts LR (2007) Epigenetic DNA hypermethylation

in cholangiocarcinoma: potential roles in pathogenesis, diagnosis and

identification of treatment targets. Liver Int 28:12-27

Sasaki M, Matsubara T, Yoneda N, Nomoto K, Tsuneyama K, Sato

Y, Nakanuma Y (2012) Overexpression of enhancer of zeste homolog

2 and MUC1 may be related to malignant behaviour in intraductal

papillary neoplasm of the bile duct. Histopathology. doi:

10.1111/his.12016. [Epub ahead of print]

Schottenfeld D, Jennifer L, Beebe-Dimmer (2005) Advances in cancer

epidemiology: Understanding Causal Mechanisms and the Evidence

for Implementing Interventions. Annu Rev Public Health 26:37–60

Shin HR, Lee CU, Park HJ, Seol SY, Chung YM, Choi HC, Ahn YO,

Shigemastu T (1996) Hepatitis B and C Virus, Clonorchis sinensis for

the Risk of Liver Cancer: A Case-Control Study in Pusan, Korea. Int

J Epidemiol 25:933-40

Shin HR, Oh JK, Lim MK, Shin A, Kong HJ, Jung KW, Won YJ, Park S,

Park SJ, Hong ST (2010) Descriptive Epidemiology of

Cholangiocarcinoma and Clonorchiasis in Korea. J Korean Med Sci

25:1011-6

Shin HR, Won YJ, Jung KW, Kong HJ, Yim SH, Lee JK, Noh HI, Lee JK,

Pisani P, Park JG (2005) Nationwide cancer incidence in Korea,

http://www.ncbi.nlm.nih.gov/pubmed/22502719http://www.ncbi.nlm.nih.gov/pubmed/22502719http://www.ncbi.nlm.nih.gov/pubmed?term=Sasaki%20M%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Matsubara%20T%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Yoneda%20N%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Nomoto%20K%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Tsuneyama%20K%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Sato%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Sato%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed?term=Nakanuma%20Y%5BAuthor%5D&cauthor=true&cauthor_uid=23163606http://www.ncbi.nlm.nih.gov/pubmed/23163606

-55-

1999–2001: First resulting using the national cancer incidence

database. Cancer Res Treat 37:325–31

Sithithaworn P, Ando K, Limviroj W, Tesana S, Pairojkul

C, Yutanawiboonchai W, Chinzei Y, Yoshida T, Sakakura T (2002)

Expression of tenascin in bile duct cancer of hamster liver by

combined treatment of dimethylnitrosamine with Opisthorchis

viverrini infections. J Helminthol 76:261-8

Songserm N, Prasongwattana J, Sithithaworn P, Sripa B, Pipitkool V

(2009) Cholangiocarcinoma in experimental hamsters with long-

standing Opisthorchis viverrini infection. Asian Pac J Cancer Prev

10:299-302

Srivatanakul P, Parkin DM, Jiang YZ (1991) The role of infection by

Opislhorchis viverrini. Hepatitis B virus, and aflatoxin exposure in