CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM …399464/s... · CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM SOFT ROT OF GINGER AND EVALUATION OF PYTHIUM OLIGANDRUM AS

CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM

SOFT ROT OF GINGER AND EVALUATION OF PYTHIUM

OLIGANDRUM AS A BIOCONTROL

Duy Phu Le

MSc. Plant Protection, The University of Queensland, Australia

BSc. Crop Science, Can Tho University, Vietnam

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in 2016

School of Agriculture and Food Sciences

ii

Abstract

Amongst the 1,400 species within the Zingiberaceae, ginger (Zingiber officinale Roscoe) is believed

to be the most commonly used spice for cooking, medicine and confectionery purposes. Following

more than a thousand years of domestication and development in the East, ginger is now grown

worldwide throughout the tropics and subtropics. Ginger has drawn great attention from scientists

over the years for its antibacterial and antifungal chemicals; nonetheless, ginger is a host for many

bacteria, fungi, oomycetes and viruses. Among these phytopathogens, Pythium, an oomycete that

causes Pythium soft rot (PSR) disease is of the most concern and is widely distributed throughout

ginger growing regions. Losses due to PSR in pre- and post-harvested ginger are generally from 5-

30%, but losses up to 100% have been recorded in India and Australia. Pythium myriotylum was

believed to be the causal pathogen for the PRS disease outbreaks recorded on the two oldest ginger

farms in Australia in 2007. However, P. myriotylum isolated from ginger exhibited differences in

pathogenicity on ginger compared with P. myriotylum isolated from other crops in Australia. In

addition, from 2007 onwards, PSR was observed on many other farms. A three-year-project (2012

to 2015) was initiated to assess the diversity within P. myriotylum occurring on Australian ginger

farms as well as to study the presence of other Pythium spp. occurring on these ginger farms.

The species status of P. myriotylum recovered from ginger with PSR symptoms in Queensland had

been previously called into question since numerous PSR isolates exhibited morphological features

which had been believed to be unique to P. zingiberis. Although the species status of P. myriotylum

and P. zingiberis has been discussed, no comprehensive and comparative assessment has been made

to date. International reference isolates of these two species, P. myriotylum CBS254.70 and P.

zingiberis NBRC30817 were imported for exclusive re-examination along with samples of P.

myriotylum from the collection of the University of Queensland. Since the reference isolate of P.

zingiberis NBRC30817 showed minor divergence (less than 1%) in gene sequences (20 gene

regions analysed) and very similar morphology, it was proposed to be reunited with the taxon P.

myriotylum. The identification of P. myriotylum as a pathogen of PSR disease of ginger in Australia

was confirmed.

A collection of Pythium spp. (173 isolates) was isolated from diseased ginger rhizomes and soils

collected around diseased ginger. Eleven distinct Pythium spp. were identified based on

morphology and molecular sequences. Pathogenicity assays confirmed that P. myriotytlum isolates

recovered from PSR ginger were pathogenic on ginger rhizomes and plants at a wide temperature

range from 20 - 35 °C. Pythium aphanidermatum was pathogenic on ginger at 30 - 35 °C. Nine

iii

other species assessed were either non-pathogenic or pathogenic on the ginger rhizome only.

Subsequent sequence assessments showed that P. myriotylum isolates from different farms were

genetically uniform and had a host preference to ginger.

Isolates of P. myriotylum derived from different hosts and origins showed differences in

pathogenicity to ginger. Sequence diversity based on single nucleotide polymorphism (SNP) was

investigated for these isolates of P. myriotylum. Overall, within 22 nuclear and mitochondrial genes

studied, a higher number of true and unique SNPs were discovered in P. myriotylum isolates

obtained from PSR ginger in Australia compared with other P. myriotylum isolates. Additionally,

the use of the enzyme HinP1I in a PCR-RFLP of the CoxII gene successfully discriminated P.

myriotylum isolates from PSR ginger from other P. myriotylum and Pythium spp. Using the same

PCR-RFLP of the CoxII gene, P. myriotylum was also detected directly from PSR infected ginger;

thus providing a potential diagnostic tool.

The recovery of Pythium oligandrum, a well-known mycoparasitic oomycete, from soils around

PSR ginger led to an investigation of antagonism and mycoparasitism of P. oligandrum against an

isolate of the PSR pathogen, P. myriotylum Gin1. It was apparent that P. oligandrum did not

produce substances toxic to P. myriotylum Gin1, but it did parasitize and compete against P.

myriotylum Gin1 in vitro assays. Disease indices recorded in pathogenicity assays in Petri plates

containing dual cultures of P. oligandrum and the target pathogen were reduced significantly

compared with those recorded with single cultures of P. myriotylum Gin1. However, subsequent pot

trials with co-inoculation of these two Pythium species showed no significant difference from

control inoculations with P. myriotylum Gin1 only.

The symptoms of soft rot on ginger were not only induced by Pythium, but were also found to be

induced by Pythiogeton (Py.) ramosum, a less studied oomycete. This reports Py. ramosum as a

pathogen of ginger occurred at high temperatures (30 – 35 °C), and is the first record of its

pathogenicity on ginger. It also was confirmed to be pathogenic on excised ginger, carrot and potato

roots/tubers and other tested crop species in Petri plate assays. Py. ramosum also exhibited

intraspecific variation within the ITS and CoxI genes.

iv

Declaration by author

This thesis is composed of my original work, and contains no material previously published or

written by another person except where due reference has been made in the text. I have clearly

stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical

assistance, survey design, data analysis, significant technical procedures, professional editorial

advice, and any other original research work used or reported in my thesis. The content of my thesis

is the result of work I have carried out since the commencement of my research higher degree

candidature and does not include a substantial part of work that has been submitted to qualify for

the award of any other degree or diploma in any university or other tertiary institution. I have

clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and,

subject to the policy and procedures of The University of Queensland, the thesis be made available

for research and study in accordance with the Copyright Act 1968 unless a period of embargo has

been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright

holder(s) of that material. Where appropriate I have obtained copyright permission from the

copyright holder to reproduce material in this thesis.

v

Publications during candidature

Peer reviewed publications:

Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated with soft

rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol.

45, 377-387 DOI 10.1007/s13313-016-0424-5

Le, D.P., Aitken, E.A.B., Smith, M.K., 2015. Comparison of host range and pathogenicity of

isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54

Le, D.P., Smith, M.K., Aitken, E.A.B., 2015. Pythiogeton ramosum, a new pathogen of soft rot

disease of ginger (Zingiber officinale) at high temperatures in Australia. Crop Prot. 77, 9-17.

Le, D.P., Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger: detection and

identification of the causal pathogens, and their control. Crop Prot. 65, 153-167.

Le, D.P, Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia.

Australas. Plant Dis. Notes 9, 1-3.

Conference abstracts:

Le, D.P., Smith, M., Aitken, E., 2015. In vitro interactions between Pythium oligandrum, a

potential biocontrol agent, and Pythium myriotylum, a pathogen of soft rot disease of ginger.

Proceedings of the TropAg 2015, Brisbane, Australia November 2015.

Ishiguro, Y., Le, D.P., Feng, W., Suga, H., Kageyama, K., 2015. Development of LAMP assay for

detection of Pythium spinosum. Kansai Division Meeting of Phytopathological Society of

Japan, September 2015.

Le, D.P., Smith, M., Aitken, E., 2014. Intraspecific variation among isolates of Pythiogeton

ramosum isolated from soft rot disease ginger in Queensland, Australia. Proceedings of the

eighth Australasian Soilborne Diseases Symposium. Hobart, Tasmania November 2014.

Le, D.P., Smith, M., Aitken, E., 2014. Comparison of host range and pathogenicity of isolates of

Pythium myriotylum and Pythium zingiberis. Proceedings of the 29th

International

Horticultural Congress, Brisbane, Australia August 2014.

Le, D.P., Smith, M., Aitken, E., 2013. Pathogenicity of Pythium spp. isolated from ginger fields in

Australia. Proceedings of the 19th

Australasian Plant Pathology Conference. Auckland, New

Zealand 2013.

Other outcomes

Le, D. P., Smith, M., Aitken, E., Teakle, D., 2015. Common names of diseases of ginger (Zingiber

officinale Roscoe). International Society of Plant Pathology. Available for comments and

contributions at: http://www.isppweb.org/names_ginger_common.asp

Aitken, E., Le, D.P., Smith, M., Abbas, R., 2015. Assessment of Pythium diversity in ginger.

RIRDC final report (approved).

http://www.isppweb.org/names_ginger_common.asp

vi

Publications included in this thesis

Le, D.P., Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger: detection and

identification of the causal pathogens, and their control. Crop Prot. 65, 153-167 –

incorporated as Chapter 2.

Contributors Statement of contribution

Duy Phu Le (Candidate) Wrote and edited the paper (70%)

Mike Smith Wrote and edited the paper (10%)

George Hudler Wrote and edited the paper (10%)

Elizabeth Aitken Wrote and edited the paper (10%)

Le, D.P., Aitken, E.A.B., Smith, M.K., 2015. Comparison of host range and pathogenicity of

isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54 –



Duy Phu Le (Candidate) Designed experiments (80%)

Performed experiments (100%)

Wrote and edited the paper (70%)

Mike Smith Designed experiments (10%)


Elizabeth Aitken Designed experiments (10%)


Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated with soft

rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol.

45, 377-387 - incorporated as Chapter 4.









vii

Le, D.P, Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia.

Australas. Plant Dis. Notes 9, 1-3 – incorporated as Chapter 7.









Le, D.P., Smith, M.K., Aitken, E.A.B., 2015. Pythiogeton ramosum, a new pathogen of soft rot

disease of ginger (Zingiber officinale) at high temperatures in Australia. Crop Prot. 77, 9-17–





Wrote and edited the papers (70%)





viii

Contributions by others to the thesis

“No contributions by others.”

Statement of parts of the thesis submitted to qualify for the award of another degree

“None”.

ix

Acknowledgements

First and foremost, I am sincerely thankful to my super friendly, super supportive and super talented

supervisors Plant Pathologist, A/Prof. Elizabeth Aitken from School of Agriculture and Food

Sciences (SAFS), and ginger Agronomist and Physiologist, Dr. Mike Smith from Maroochy

Research Station, Queensland DAF. I have found myself very very lucky to have such a wonderful

opportunity to know and work with you two. Without your help and support, sitting here and

writing down these words would never have happened.

All the research results contained in this thesis were financially funded and supported by Rural

Industries Research and Development Corporation (PRJ-008410) in a conjunction with the

Australian Ginger Industry Association. Without this funding source and support, this thesis would

still be in the middle of nowhere now. Hence, all the funding and support have been greatly

appreciated. I am also very grateful for the PhD sponsorship from Endeavour Awards which gave

me a wonderful chance to be back to Australia to experience the life and complete my PhD. Thanks

are also sent to SAFS travel awards for financial support to present at conferences in New Zealand

in 2013 and Tasmania in 2014, and also to Australasian Plant Pathology Society and

Phytopathological Society of Japan for fully supporting my internship to Japan in 2014.

I also want to have special thanks to: Mr. Rob Abbas from Rob Abbas Consulting Pty. Ltd. for his

kindness in providing clean ginger materials and sampling diseased ginger; Dr. Sharon Hamill from

Queensland DAF for providing primary stocks of tissue culture ginger; Prof. George Hudler from

Cornell University, USA; Dr. David Teakle (retired) and Dr. Roger Shivas from Queensland Plant

Pathology Herbarium for critically reading some of my manuscripts; Dr. Jin-hsing Huang from

Plant Pathology Division, Taiwan Agricultural Research Institute for technical consultation for

working with Pythiogeton; Prof. Koji Kageyama from Gifu University, Japan for hosting my

internship and providing Pythium DNA; Prof. André Lévesque from Agriculture and Agri-Food

Canada for providing Pythium DNA; Ms. Elizabeth Czislowski for help with whole genome

sequencing; Dr. Andy Chen for help with RFLP; and Ms. Kerry Vinall from SAFS for help

arranging growth cabinets used in pot trials.

Last but not least, I want to thank my mum (Kiem), my sister (Linh) and my girlfriend (Thao) for

their unconditional love and support. Also thanks to all other friends, labmates, St Lucia community

(my little party community ^.^), you all have painted my PhD life colourfully and beautifully. For

certain, I am going to miss you all and I will keep my finger crossed to catch you up (face-to-face,

do not count on Facebook ^.^) again some time in this ‘small world’.

http://www.rirdc.gov.au/


x

Keywords

Zingiber officinale, Pythium soft rot (PSR), Pythium myriotylum, Pythium zingiberis, Pythium

oligandrum, Pythiogeton ramosum, pathogenicity, host range, interactions

Australian and New Zealand Standard Research Classifications (ANZSRC)

ANZSRC code: 060704, Plant Pathology, 70%

ANZSRC code: 060505 Mycology, 30%

Fields of Research (FoR) Classification

FoR code: 0607 Plant Biology, 70%

FoR code: 0605 Microbiology, 30%

xi

TABLE OF CONTENTS

CHAPTER 1 : GENERAL INTRODUCTION ............................................................................... 1

1.1. OVERVIEW .................................................................................................................................. 1

1.2. OBJECTIVES ................................................................................................................................ 2

CHAPTER 2 : LITERATURE REVIEW ........................................................................................ 3

2.1. INTRODUCTION ........................................................................................................................... 3

2.2. IMPACTS OF PYTHIUM SOFT ROT ON GINGER PRODUCTION .......................................................... 5

2.2.1. Economic impacts ............................................................................................................... 5

2.2.2. Ecological impacts .............................................................................................................. 6

2.3. SOFT ROT SYMPTOMS .................................................................................................................. 7

2.4. PYTHIUM SPP.– CAUSAL AGENTS OF THE SOFT ROT DISEASE ....................................................... 8

2.5. PATHOGENICITY ....................................................................................................................... 10

2.6. PYTHIUM ISOLATION ................................................................................................................. 14

2.7. PYTHIUM QUANTIFICATION ....................................................................................................... 15

2.8. PYTHIUM IDENTIFICATION AND ITS ADVANCES .......................................................................... 17

2.8.1. Morphology ....................................................................................................................... 17

2.8.2. Molecular and monoclonal antibody approaches ............................................................ 19

2.9. CONTROL STRATEGIES .............................................................................................................. 22

2.9.1. Chemical ........................................................................................................................... 22

2.9.2. Biological agents .............................................................................................................. 23

2.9.3. Cultural practices ............................................................................................................. 24

2.9.4. Host plant resistance ........................................................................................................ 27

2.9.5. Induced resistance ............................................................................................................ 28

2.10. CONCLUDING REMARKS .......................................................................................................... 29

CHAPTER 3 : COMPARISON OF MORPHOLOGY, GENETIC AND PATHOGENICITY

OF ISOLATES OF PYTHIUM MYRIOTYLUM AND PYTHIUM ZINGIBERIS ...................... 31

3.1. INTRODUCTION ......................................................................................................................... 31

3.2. MATERIALS AND METHODS....................................................................................................... 33

3.2.1. Pythium spp. cultures ........................................................................................................ 33

3.2.2. Hyphal growth rate ........................................................................................................... 33

3.2.3. Morphology ....................................................................................................................... 33

3.2.4. Sequencing ........................................................................................................................ 34

3.2.5. In vitro test of virulence on excised roots/tubers .............................................................. 34

3.2.6. In vitro pre-emerging damping off ................................................................................... 35

3.3. RESULTS ................................................................................................................................... 35

xii

3.3.1. Radial growth rate ............................................................................................................ 35

3.3.3. Sequence analysis ............................................................................................................. 39

3.3.4. In vitro test of virulence on excised roots/tubers .............................................................. 44

3.3.5. In vitro pre-emerging damping off ................................................................................... 44

3.4. DISCUSSION .............................................................................................................................. 45

CHAPTER 4 : CHARACTERISATION OF PYTHIUM SPP. ASSOCIATED WITH SOFT

ROT DISEASE OF GINGER (ZINGIBER OFFICINALE) IN QUEENSLAND, AUSTRALIA

............................................................................................................................................................ 50

4.1. INTRODUCTION ......................................................................................................................... 50


4.2.1. Pythium isolation and cultures ......................................................................................... 51

4.2.2. Hyphal growth rate ........................................................................................................... 52

4.2.3. Morphology ....................................................................................................................... 53

4.2.4. DNA extraction and amplification .................................................................................... 53

4.2.5. Sequencing and analysing sequences ............................................................................... 54

4.2.6. Pathogenicity tests ............................................................................................................ 54

4.3. RESULTS ................................................................................................................................... 56

4.3.1. Isolation and identification ............................................................................................... 56

4.3.2. Pathogenicity assays ......................................................................................................... 60

4.4. DISCUSSION .............................................................................................................................. 64

CHAPTER 5 : COMPARISON OF SNPS AND DEVELOPMENT OF PCR-RFLP FOR

DETECTION TOOL FOR PYTHIUM MYRIOTYLUM ISOLATES RECOVERED FROM

PYTHIUM SOFT ROT GINGER .................................................................................................. 68

5.1. INTRODUCTION ......................................................................................................................... 68


5.2.1. Pythium and fungal cultures ............................................................................................. 70

5.2.2. Sequence diversity based on SNP analysis ....................................................................... 72

5.2.3. PCR-RFLP for CoxII region ............................................................................................. 72

5.3. RESULTS ................................................................................................................................... 73

5.3.1. Sequence diversity based on SNP typing .......................................................................... 73

5.3.2. PCR-RFLP analysis .......................................................................................................... 77

5.4. DISCUSSION .............................................................................................................................. 78

CHAPTER 6 : INTERACTIONS BETWEEN MYCOPARASITIC PYTHIUM

OLIGANDRUM ISOLATED FROM GINGER FIELDS AND PATHOGENIC PYTHIUM

MYRIOTYLUM ................................................................................................................................. 81

xiii

6.1. INTRODUCTION ......................................................................................................................... 81

6.2. MATERIALS AND METHODS ...................................................................................................... 83

6.2.1. Pythium spp. cultures ........................................................................................................ 83

6.2.2. Mycoparasitism of P. oligandrum .................................................................................... 84

6.2.3. Growth competition of P. oligandrum .............................................................................. 84

6.2.4. Effect of volatile compounds of P. oligandrum on growth of the targets ......................... 85

6.2.5. Effect of non-volatiles compounds of P. oligandrum on growth of the targets ................ 85

6.2.6. In vitro pre-emerging damping off suppression ............................................................... 86

6.2.7. Pot trial suppression of P. myriotylum on ginger plants .................................................. 87

6.3. RESULTS ................................................................................................................................... 87

6.3.1. Mycoparasitism and growth competition of P. oligandrum against the targets .............. 87

6.3.2. Effects of volatiles and non-volatiles produced by P. oligandrum on growth of the targets

.................................................................................................................................................... 88

6.3.3. In vitro suppression .......................................................................................................... 90

6.3.4. Pot trial suppression ......................................................................................................... 91

6.4. DISCUSSION .............................................................................................................................. 93

CHAPTER 7 : PYTHIOGETON RAMOSUM ASSOCIATED WITH SOFT ROT DISEASE

OF GINGER (ZINGIBER OFFICINALE) IN AUSTRALIA ...................................................... 97

7.1. INTRODUCTION ......................................................................................................................... 97


7.2.1 Py. ramosum isolation ....................................................................................................... 99

7.2.2 Growth and morphology .................................................................................................. 101

7.2.4. Sequencing and analysing sequences ............................................................................. 102

7.2.6. Pathogenicity tests .......................................................................................................... 102

7.3. RESULTS ................................................................................................................................. 103

7.3.1. Growth rate and morphological characteristics ............................................................ 103

7.3.2. DNA sequences ............................................................................................................... 106

7.3.3. Pathogenicity tests .......................................................................................................... 108

7.4. DISCUSSION ............................................................................................................................ 112

CHAPTER 8 : GENERAL CONCLUSIONS AND DISCUSSION .......................................... 115

8.1. SUMMARY OF FINDINGS .......................................................................................................... 115

8.2. DISCUSSION ............................................................................................................................ 117

8.3. RECOMMENDATIONS .............................................................................................................. 119

xiv

LIST OF FIGURES

Fig 2.1: Ginger crop in Australia with symptoms of PSR. The disease progressed quickly down the

row in saturated soils after a prolonged, heavy rainfall event. .............................................. 6

Fig 2.2: Early symptoms of PSR in the form of water-soaked and brown coloured area on sheath

collar (top left), whole dead infected plant (left plant top right) with stem still standing but

easily pulled out of the ground. A healthy rhizome (bottom left) and diseased rhizome

(bottom right), the latter with soft, dark brown lesions at the buds (Le, 2010). .................... 8

Fig 2.3: Morphology of Pythium spp. associated with PSR of ginger: P. myriotylum (1, finger

shaped appressoria and appressoria usually formed in cluster; 2-3, zoospore released from

vesicle; 4, smooth, aplerotic oospore; 5 filamentous inflated sporangia), P. splendens (6,

globese, smooth, terminal hyphal swelling), P. deliense (7, single antheridium applied to

an oogonium and an oogonialphore winding towards the antheridium), P. zingiberis (8,

oogonia formed in cluster and typical coiling antheridial stalks around oogonial stalks), P.

aphanidermatum (9, single broad antheridium applied to an oogonium), P. ultimum (10, a

smooth, terminal oogonium with single antheridium appearing from just right beneath the

oogonium), P. spinosum (11, spiky intercalary oogonia). ................................................... 18

Fig 2.4: Ginger fields showing good drainage practice, a method which helps to minimize PSR

spread to adjacent paddocks. Drain breaks (arrow) helped stop the spread of P. myriotylum

within a ginger field leaving the bed with early PSR infection free of ginger allowing the

rest of the paddock to still produce a viable crop. [Photos courtesy of Rob Abbas,

Consulting Pty. Ltd.] ............................................................................................................ 27

Fig 3.1: Radial growth rate (mm) on PDA of P. myriotylum CBS254.70, P. zingiberis NBRC 30817

and two putative isolates of P. zingiberis recovered from PSR ginger at 5 °C intervals from

5 to 40 °C. Bars represent standard deviations of four means, P = 0.05 as determined by

Tukey’s test. ......................................................................................................................... 36

Fig 3.2: Morphological comparisons of putative P. zingiberis Gin1 isolated from PSR ginger in

Australia and reference isolates: P. zingiberis NBRC30817 and P. myriotylum CBS254.70

(Bar = 20 µm). ..................................................................................................................... 38

Fig 3.3: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. using

DNA sequences encoded from the small and large subunits and the ITS region of nuclear

genome (length above 4000 bp). The numbers at the nodes are the percentage of the trees

from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are

displayed). All sequence data were retrieved from Genbank, except for the sequence data

of P. myriotylum and P. zingiberis with asterisk which were obtained from whole genome

data in this study. ................................................................................................................. 43

xv

Fig 4.1: A maximum likelihood tree showed phylogenetic relationships among Pythium species

(only representatives presented) recovered from commercial ginger fields in Australia

using DNA sequences encoded from ITS gene. The numbers at the nodes are the

percentage of the trees from bootstrap analysis (1,000 replications). ................................. 59

Fig 4.2: Aggressiveness of selected Pythium spp. assessed based on mean colonization and

recovery of Pythium spp. on 1 cm segments excised from 5.5 cm long ginger sticks at 27 ±

2 °C at 2 DAI (bars represent standard deviations, n = 6). Means were combined from two

independent assays due to no significant difference between the two repetitions (P = 0.05).

............................................................................................................................................. 60

Fig 4.3: Disease severity (0-3) which was recorded on ginger plants inoculated with selected

Pythium spp. at 21DAI at two temperature ranges 20/25 °C and 30/35 °C with 10 h of

photoperiods (bars represent standard errors, n = 6). Data presented the combination of two

pot trials due to no significant difference in disease severity recorded on the two ginger

cultivars tested (P = 0.05). ................................................................................................... 63

Fig 5.1: HinP1I restriction banding patterns of the partly amplified CoxII gene of P. myriotylum

isolates obtained from different hosts and origins: Lane 1, 100 bp ladder marker; lanes 2-

15, DNA templates of P. myriotylum isolates obtained from PSR ginger (except for lane 9,

amplification failed); lanes 16-20, DNA templates of P. myriotylum extracted directly from

pot trial PSR ginger; lane 21-26, DNA templates of P. myriotylum isolates obtained from

Japan; lanes 27-28, DNA templates of P. myriotylum isolates obtained from capsicum wilt;

lane 29, P. myriotylum CBS254.70; lane 30, P. myriotylum NBRC30817 ......................... 77

Fig 6.1: Effects of volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in

potato broth on growth of P. myriotylum and P. ultimum as assessed by linear growth on a

Petri plate. Negative values indicate growth promotion in media putatively infused with

non-volatiles from P. oligandrum. Bars represent standard deviation of four replicates. ... 89

Fig 6.2: Effects of non-volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and

in potato broth on growth of P. myriotylum and P. ultimum. Negative values indicate

growth promotion of non-volatiles. Bars represent standard deviation of four replicates. . 90

Fig 6.3: Disease index (0-1) recorded for millet, rye and wheat seeds/seedlings grown on single and

dual cultures of Pythium. Bars represent standard deviation of four replicates. ................. 91

Fig 6.4: Disease severity recorded on ginger plants inoculated with either P. oligandrum or P.

myriotylum or both at 7, 14 and 21DAI 25/30 °C with 10 h of photoperiods (bars represent

standard errors, n = 8). Data presented is for the combination of two pot trials as no

significant difference in disease severity was recorded on the two trials tested (P = 0.05).

Disease severity rates from: 0 = healthy plants; 1 = discoloured sheath collar and yellow

xvi

lower leaves; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all shoots

dead. ..................................................................................................................................... 92

Fig 7.1: Typical sickle-shape appressoria and short branch hyphae at right angles with main hyphae

(A), a typical terminal long bursiform sporangium observed on a mature culture (B) (bar =

20 µm) ................................................................................................................................ 104

Fig 7.2: Sporangia of Py. ramosum on one-week-old cultures: an admixture of globose, eclipsoid

and bursiform sporangia observed on cultures of Group I isolates (A); only globose

sporangia observed on cultures of Group II isolates (B) (bar = 20 µm) ............................ 104

Fig 7.3: Growth rate comparison between four isolates of Py. ramosum on PDA at different

temperatures (P<0.01). A bar is representing for a standard deviation of three means. .... 106

Fig 7.4: A maximum likelihood tree showing phylogenetic relationships among Pythiogeton

species using DNA sequences encoded from the ITS gene. The numbers at the nodes are

the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be

found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access-

code=d72e813919072ae4f8d28bd1665f0b31&format=html ............................................ 107


species using DNA sequences encoded from the CoxI gene. The numbers at the nodes are

the percentage of trees from bootstrap analysis (2000 replications). Access to trees can be

found at http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access-

code=d72e813919072ae4f8d28bd1665f0b31&format=html ............................................ 108

Fig 7.6: Mean colonization of Py. ramosum and P. deliense UQ6021 based on recovery of 1 cm

segments from 5.5 cm long ginger pieces onto culture plates at 3 days after inoculation at

25, 30 and 35 °C in dark (bars represent standard errors, n = 4). ...................................... 109

Fig 7.7: Disease severity levels (0-3) recorded on ginger infected with Py. ramosum and P. deliense

UQ6021 at 30/35 °C (night/day) (bars represent standard errors, n = 6)........................... 109

Fig 7.8: Cauliflower seedlings were attacked by Py. ramosum turning brown and rotten (left) in

comparison to white and healthy seedlings in the control (right). ..................................... 110

xvii

LIST OF TABLES

Table 2.1: Common Pythium spp. that are well-identified based on either morphology or molecular

techniques and highly virulent on ginger ............................................................................ 9

Table 2.2: Pythium spp. that need to be re-examined for either their species statuses or

pathogenicity on ginger ..................................................................................................... 10

Table 2.3: Some common selective media for Pythium isolation with recent modifications ........... 16

Table 3.1: Morphologicala comparisons of sexual and asexual structures of P. myriotylum

CBS254.70, P. zingiberis NBRC 30817 and two putative isolates of P. zingiberis

recovered from PSR ginger. .............................................................................................. 37

Table 3.2: Pairwise comparisons for level of identity (%) among four isolates of Pythium;

sequences of nuclear and mitochondrial genes were extracted from whole genome data.39

Table 3.3: Virulencea at 3 days after inoculation of four Pythium isolates colonising on excised

tubers/roots of five crop species ........................................................................................ 44

Table 3.4: Disease indices (0-1) showing the virulence of four Pythium isolates on different crops

........................................................................................................................................... 45

Table 4.1: Species of Pythium and Pythiogeton recovered from ginger rhizomes and soil samples

collected from commercial ginger fields in Queensland, Australia. ................................. 57

Table 4.2: Morphological characteristicsa and growth rate of 10 species of Pythium recovered

ginger rhizomes with PSR or from soil surrounding PSR ginger plants from commercial

ginger fields in Queensland, Australia. ............................................................................. 58

Table 4.3: Comparisons of disease indices (0-1) recorded on flower, vegetable and common crops

used in rotation with ginger in Australia, which were inoculated with Pythium spp.a ...... 62

Table 5.1: Pythium and fungal isolates used in this study ................................................................ 70

Table 5.2: Genetic diversity compared among the five P. myriotylum and P. zingiberis isolates

based on a summary of SNP information including sequence length, number of

SNPs/gene, number of SNPs/kb and number of non-synonymous SNPs ......................... 74

Table 5.3: Characteristics of non-synonymous SNPs in five P. myriotylum and P. zingiberis

isolates; loci without non-synonymous SNPs were excluded in this table. ...................... 75

Table 6.1: Mycoparasitism based on the extent of hyphal coiling (Type 0-4, see text for

descriptions) and growth competition (0-7) based on the extent of colonisation in cm

measured by the occurrence of oogonial formation of P. oligandrum against P.

myriotylum and P. ultimum (n = 4) .................................................................................... 88

Table 6.2: Percentage of carrot baits colonised by P. oligandrum, P. myriotylum or both following

exposure to soil used in the pot trials as shown in Fig 4 (n = 8, combining data from two

replicate pot trials) ............................................................................................................. 92

xviii

Table 7.1: List of Pythiogeton spp. used in this study, isolates with BRIP numbers were used for

morphological comparisons, growth rate and pathogenicity. ............................................ 99

Table 7.2: Morphological comparison between two groups of Py. ramosum isolated from ginger in

this study .......................................................................................................................... 105

Table 7.3: Comparisons of disease indices (0-1) for eight vegetable and five common rotation crops

in ginger fields inoculated with P. deliense UQ6021 and Py. ramosum ......................... 111

xix

LIST OF ABBRIVIATIONS USED IN THIS THESIS

AFLP – Amplified Fragment Length Polymorphism

ANOVA – Analysis of variance

BABA – DL-β-aminobutyric acid

BCA – Biological Control Agents

BLAST – Basic Local Alignment Search Tool

BTH – 2,1,3 benzothiadiazole

CA – Carrot agar

CFU – Colony Forming Unit

CMA – Corn meal agar

CoxI – Cytochrome c oxidase subunit 1

CoxII – Cytochrome c oxidase subunit 2

DNA – Deoxyribonucleic acid

dNTP - Nucleoside triphosphate

DW – Distilled water

ELISA – Enzyme-Linked Immunosorbent Assay

ET – Ethylene

FAO – Food and Agriculture Organization of the United Nations

ITS – Internal Transcribed Spacer

JA – Jasmonic Acid

LAMP – Loop-Mediated Isothermal Amplification

LSD – Least significant difference

LSU – Large subunit

M – Morphology

MPVM – Pythium selective medium, including 5 ppm pimaricin, 100 ppm PCNB, 10 ppm rose

bengal and 300 ppm vamcomycin

MT – Molecular technique

NADH – Dehydrogenase subunit 1

NARM – Pythium selective medium, including 10 ppm nystatin, 250 ppm ampicillin, 10 ppm

rifampicin and 1 ppm miconazole

P – Pathogenicity

P10VP – Pythium selective medium, including 10 ppm pimaricin, 200 ppm vancomycin and 100

ppm PCNB

P5ARP – Pythium selective medium, including 5 ppm pimaricin, 250 ppm ampicillin, 10 ppm

rifampicin and 100 ppm PCNB

http://www.fao.org/home/en/

xx

PARPH – Pythium selective medium, including 5 ppm pimaricin, 250 ppm ampicillin, 10 ppm

rifampicin and 100 ppm PCNB, 50 ppm hymexazol

PCNB – Pentachloronitrobenzene

PCR – Polymerase chain reaction

PDA – Potato dextrose agar

PSR – Pythium soft rot

q-PCR – Quantitative PCR

RAPD – Random Amplified Polymorphic DNA

rDNA – Ribosomal DNA

RFLP – Restriction Fragment Length Polymorphism

RGC – Resistant Gene Candidates

RIRDC – Rural Industries Research and Development Corporation

SA – Salicylic Acid

SDS-PAGE – Sodium Dodecyl Sulfate-Polyacrylamide Gel Electrophoresis

SSR – Simple Sequence Repeats, also known as microsatellites

SSU – Small subunit

TIR NBS-LRR – Non-toll-interleukin receptor nucleotide binding site leucine rich repeat

UPGMA – Unweighted Pair Group Method with Arithmetic mean

V8 – V8 juice medium

VP3 – Pythium selective medium, including 75 ppm vancomycin, 100 ppm PCNB, 50 ppm

penicillin and 5 ppm pimaricin

WA – Water agar


https://en.wikipedia.org/wiki/Sodium_dodecyl_sulfate

Chapter 1 │General introduction

1

Chapter 1 : GENERAL INTRODUCTION

1.1. Overview

Ginger (Zingiber officinale Rosc.) is a perennial monocot herb that belongs to the family

Zingiberaceae with 47 genera and 1,400 species (Hogarth, 2000). Within the family, ginger is

considered the most common spice. It has been grown in China and India for over a thousand years

and today it is cultivated widely throughout tropical and subtropical regions (Kavitha and Thomas,

2008). Currently, India and China are the world’s largest ginger producers, while the United States

of America and Japan are the biggest importers (De_Guzman and Siemonsma, 1999). Fijian and

Jamaican farmers produce the highest yield and the best quality ginger based on its chemical

components, respectively (FAO, 2012; Glover, 2007). The edible part of the plant is the

underground stem or rhizome which can be consumed either fresh from local markets or as an

imported processed product (Kizhakkayil and Sasikumar, 2011). In addition, people have for

centuries used ginger as a medicine for treating headache, nausea, colds, stomach upset and

diarrhoea (Shukla and Singh, 2007). Recently, ginger has shown promise in trials to treat cancers,

diabetes, and high blood pressure (Anonymous, 2010; Hamilton, 2011; Krell and Stebbing, 2012;

Langner et al., 1998; Nicoll and Henein, 2009; Shukla and Singh, 2007; Zachariah, 2008).

Ginger was introduced into Australia as a crop in the early 20th

century and has been cultivated on

the Sunshine Coast, Queensland since 1916 (Hogarth, 2000). Presently, it is mainly produced under

irrigation and on suitable friable soils from Bundaberg to Gatton in Southeast Queensland. The

Australian ginger industry is quite small (less than 1% contribution to global share) with an

involvement of around 30 full time growers, who produce approximately AUD 15.6 million at farm

gate value per year (Camacho and Brescia, 2009). The annual production of the whole Australian

ginger industry is estimated at about 8,000 tonnes with almost half of this delivered to the domestic

fresh market and the remainder going for the processing industry inside the world’s largest ginger

factory, Buderim Ginger Ltd. (Camacho and Brescia, 2009).

Despite the antibacterial and antifungal properties of ginger (Atai et al., 2009; Park et al., 2008;

Shaista et al., 2010), it is still a host of at least 24 known plant pathogens (Dake, 1995). Among

these pathogens, Pythium spp. which cause Pythium soft rot (PSR) disease are of the most concern

around ginger growing areas throughout the world (Dohroo, 2005). The disease can be very

destructive leading to crop failure and the pathogens which are very aggressive can induce visual

symptoms within a week of artificial inoculation (Stirling et al., 2009). Pythium spp. can attack

ginger plants at any growth stage in the field as well as at the postharvest stage, and result in losses

Chapter 1 │General introduction

2

up to 100% and 90%, respectively (Dohroo, 2005; Stirling et al., 2009). Moreover, because Pythium

spp. can survive in air dried soil for up to 12 years (Hoppe, 1966), fields infested with Pythium spp.

can continue to be at risk for disease outbreaks for many years. According to Dohroo (2005), twelve

Pythium species have been shown to cause PSR of ginger around the world. In Australia, P.

graminicola Subram and P. myriotylum Drechsl were isolated and reported as early as 1962

(C.M.I., 1966; Teakle, 1962). However, in 2007 a severe PSR outbreak on ginger was observed and

P. myriotylum was reported as a causal agent of the disease (Stirling et al., 2009). Several lines of

research have been carried out to control the disease including modifying farming practices, and

targeted use of chemical and biological agents. These approaches alone or in combination have

shown promise, however when conditions are conducive for P. myriotylum development, losses can

still be high (Smith et al., 2011; Smith and Abbas, 2011; Stirling et al., 2012). Unfortunately, since

the first report of PSR outbreak on ginger in 2009 on the two oldest farms in Sunshine Coast, the

disease has also been observed on many other farms and has continued to spread. Additionally,

following initial research it was proposed that there may be more than one Pythium species

involved in the soft rot disease in Australia. Therefore, a project funded by the Australian ginger

industry and the Rural Industries Research and Development Corporation was initiated to assess

Pythium diversity in ginger fields in Queensland, Australia.

1.2. Objectives

The general objective of this study was to assess the diversity of Pythium spp. causing PSR on

ginger and to investigate potential mechanisms of control through diagnostics and biocontrol

options. For this purpose the thesis has been divided into five research chapters as follows.

(1) Re-assessent of the species status of P. myriotylum recovered from PSR ginger (chapter 3)

given it is morphological similar to Pythium zingiberis. For this comprehensive comparison and

confirmation, international reference isolates of P. myriotylum and P. zingiberis were imported for

the study.

(2) Assessment of the diversity of Pythium spp. recovered from PSR ginger and soils around

diseased ginger (chapter 4); these data are important for field consultants and farmers to develop

appropriate control approaches since different Pythium spp. responsed differently to environmental

changes.

(3) A method for the rapid detection and accurate identification of pathogenic species of

Pythium that did not rely on morphological and sequencing work was developed (chapter 5).

(4) Examination of the interaction between pathogenic and non-pathogenic Pythium spp. as a

potential tool for PSR disease control (chapter 6).

(5) Report of Pythiogeton ramosum an under studied oomycete, as a new pathogen of soft rot

disease on ginger in Australia (chapter 7).

Chapter 2 │Literature review

3

Chapter 2 : LITERATURE REVIEW1

Abstract

The aim of this chapter is to provide a comprehensive overview of Pythium soft rot (PSR) disease

as well as the causal pathogens of the PSR recorded around the world. Additionally, discussion

about past, present and future approaches for working with, detecting and identifying Pythium spp.

have been taken into account in this literature review. A summary of all feasible and practical

control methods of the PSR has also been included and finally recommendations for future research

directions have been suggested. An ultimate goal of this review was to build up background

knowledge to allow the candidate to address the research questions presented in this thesis.

2.1. Introduction

Ginger (Zingiber officinale Rosc.) is a perennial monocotyledonous herb belonging to the

Zingiberaceae, a family comprised of 47 genera and 1,400 species (Hogarth, 2000). Other important

spices in the family include turmeric (Curcuma longa), cardamom (Elettaria sp.), mioga (Zingiber

mioga), and galangal (Alpinia galanga). The entire family, including ginger, is presumed to be

native to either Asia in general (Singletary, 2010) or specifically to India; however its exact origin

is still unclear (Zachariah, 2008). Today ginger is cultivated worldwide throughout the subtropics

and tropics where it plays an important role in agricultural economic systems in these regions

(Kavitha and Thomas, 2008b). The usable part of the plant is the underground stem or rhizome

which can be consumed either fresh for culinary purposes or as a processed product where it may be

salted, dried, and/or powdered, used as a paste, or extracted as ginger oil or oleoresin (Kizhakkayil

and Sasikumar, 2011). Ginger is planted and traded mainly in the form of fresh rhizomes in India,

China, Indonesia and in other countries where it is grown. When imported into the United States,

the European Union and Japan it is usually marketed in a processed form (De-Guzman and

Siemonsma, 1999).

Flavour and pungency can vary considerably but it is not just cultivar, that contributes to this as

environmental factors such as soil type, season, climate, cultivation practice, location, maturity and

1 This chapter was published as: Le, D.P, Smith, M., Hudler, G.W., Aitken, E., 2014. Pythium soft rot of ginger:

detection and identification of the causal pathogens, and their control. Crop Prot. 65, 153-167.

http://dx.doi.org/10.1016/j.croppro.2014.07.021. The manuscript was modified to keep the format consistent through

out the thesis.

http://en.wikipedia.org/wiki/Alpinia_galanga

http://dx.doi.org/10.1016/j.croppro.2014.07.021


4

postharvest processes have also been shown to contribute to differences in these properties

(Singletary, 2010; Vasala, 2010; Zachariah, 2008). In general the genetic diversity within Zingiber

officinale is actually considered to be limited. Sasikumar et al. (2000) found this to be the case

when they evaluated 14 ginger accessions in India, looking for differences in relative quantities of

polyphenol oxidase, super oxidase dismutase and peroxidase. Similarly, Wahyuni et al. (2003)

found a relatively close genetic relationship of 28 apparently diverse accessions of big, small and

red ginger cultivars in Indonesia based on AFLP (amplified fragment length polymorphism)

analysis of their respective DNA. Many other types of molecular markers have been used to assess

levels of polymorphism in ginger, and in general the results show only low to moderate variation

with just a few exceptions (Kizhakkayil and Sasikumar 2011).

The ginger rhizome contains carbohydrates, proteins, fats, fibre, water, and essential oils. In

addition to its nutritional and flavour aspects, it has long been considered to have potential for

multiple health benefits as illustrated by its use as a traditional medicine against headache, nausea,

colds, and arthritis for as long as a thousand years by traditional people in Asia. More recent

assessments by health scientists have shown that ginger may have a role in reducing certain cancers,

diabetes, and high blood pressure and also have anti-inflammatory properties (Anonymous, 2010;

Hamilton, 2011; Krell and Stebbing, 2012; Langner et al., 1998; Nicoll and Henein, 2009; Shukla

and Singh, 2007; Vasala, 2010; Wright, 2011; Zachariah, 2008). However, there are still a few,

albeit uncommon, minor adverse effects resulting from the consumption of ginger; these include

slight gastrointestinal distress, heartburn, and oral irritation.

Properties of note associated with ginger are its antimicrobial aspects. It has been shown to act as an

antibacterial agent (Park et al., 2008; Shaista et al., 2010) where it has been shown to inhibit growth

of Escherichia coli, Proteus spp., Staphylococci, and Salmonella in vitro assays (Bhatia and

Sharma, 2012; Janes et al., 1999; Stoilova et al., 2007; Voravuthikunchai et al., 2006). It has also

been shown to have antifungal properties, inhibiting growth of Aspergillus spp., Saccharomyces

spp., Mycoderma spp., and Candida spp. (Atai et al., 2009). Despite its antimicrobial properties,

ginger is still a host of at least 24 known plant pathogens (Dake, 1995) including viruses (Nambiar

and Sarma, 1974; Nishino et al., 1984; Suryanarayana and Pant, 2008), bacteria (Kumar and Sarma,

2004; Nishijima et al., 2004; Stirling, 2002), oomycete (Sharma and Jain, 1977; Stirling et al., 2009;

Wang et al., 2003) and fungi (Gao et al., 2006; Overy and Frisvad, 2005; Rai, 1993; Sharma and

Jain, 1977; Stirling, 2004).

http://uq.summon.serialssolutions.com/link/0/eLvHCXMwY2BQSDY2TU1NtUwxSzO0TAU2CFITk0zT0oBtCZMUi-SkZEuUsQ4eROHkJsoQ6uYa4uyhC70HQDcZqMdc1zDR3Dgt1dQ0Mc0wLcUkLQlU56eapgGxgalpiqmZeQqwDW-UkphqYWiYCqz_jc0SgfkwKS0tJc3A0iDRwFCMgTcRtF48rwS8ryyFzyY5tSPhhzfznr_9kQ7_ti8GAOApMrQ


5

The aims of this review chapter are to provide an overview of one particular problematic disease of

cultivated ginger that occurs wherever ginger is grown. The disease is commonly known as “soft

rot” and although the name suggests involvement of just one pathogen, it is actually caused by

several species in the genus Pythium (Stramenopila: Oomycete). Historical and contemporary

information on the biology and management of the respective pathogens will be discussed.

2.2. Impacts of Pythium soft rot on ginger production

2.2.1. Economic impacts

Pythium soft rot of ginger is also known as soft rot or rhizome rot of ginger. Hereafter, the name

Pythium soft rot (PSR) will be used to refer to the disease in question in order to avoid confusion

with other common ginger diseases caused by Fusarium spp. and Ralstonia spp. where a rot is

involved.

PSR was recorded in scientific literature for the first time when it was found in India more than a

hundred years ago (Butler, 1907). Presently, PSR occurs in ginger growing countries throughout the

world (Dohroo, 2005). The pathogens responsible for PSR can infect host plants at any stages of

growth and even during postharvest storage when growth from latent infections can cause severe

losses. Most Pythium spp. recorded on ginger flourish in the field when the soil temperature is high

(26-300C) and soil moisture is near or at saturation (Lin et al., 1971; Sarma, 1994; Stirling et al.,

2009). Such conditions occurred in the ginger growing region of Queensland, Australia during the

summer of 2007-08 and resulted in 5-30% losses of immature ginger in some infested fields

(Stirling et al., 2009). This was the first formal report of PSR in Australia, and the relatively high

losses caused alarm among growers. However, consistently higher field losses have been reported

in other countries; for example losses of 5-30% in Japan (Ichitani and Goto, 1982), 18-54% in

Korea (Kim et al., 1996), 25% in Nepal (Nepali et al., 2000), 70% in Taiwan Lin et al (1971), 90%

in India (Rajan and Agnihotri, 1989) and 100% in some fields in Fiji (Fullerton and Harris, 1998;

Stirling et al., 2009). Stirling et al. (2009) also reported more than 50% loss of plants used for seed

ginger production in Australia. In most cases these heavy losses have occurred in years when

weather conditions were favourable for pathogen growth (Fig. 2.1). The impact of Pythium spp. can

also be high in storage; losses ranging from 24-50% have been reported with rates occasionally

exceeding 90% in India (Dohroo, 2005; Nepali et al., 2000).


6

2.2.2. Ecological impacts

Pythium spp. are able to persist in soil for long periods and the assumptions have been that this is

mostly by means of encysted zoospores, oospores and sporangia (Hendrix and Campell, 1973;

Madsen et al., 1995). Evidence for this has been shown by Stanghellini (1971) who found that

sporangia of P. ultimum can remain viable in air dried soil for a year without reduction in

germination. Hoppe (1966) also reported that some Pythium spp. survived in air dried soil for up to

12 years and Garren (1971) reported that P. myriotylum remained infectious for approximately a

year when it was held in soil enclosed in a plastic bag at room temperature. Persistence is also

influenced by survival on host tissue. For example, P. zingiberis oospores lost capability to

germinate within 70 days after burying in soil in the absence of susceptible hosts (Samejima and

Ichitani, 1988). Pythium spp. in general have quite a wide host range, so they can survive long

periods of time in the field on alternative hosts including weeds. Consequently, susceptible crops

may still be affected if replanted into an infested field years after fallows or rotations. Certainly, Lin

et al. (1971) in Taiwan observed that ginger yields were still not acceptable in the year following a

serious disease outbreak caused by P. myriotylum. In Australia, yields were still impacted up to 7

years after a serious outbreak of PSR. In Japan, Ichitani and Goto (1982) found that P. zingiberis

was still detectable from previously infested soils 4-5 years after rotations with non-host crops and

consequently PSR developed when ginger was re-introduced to these fields.

Fig 2.1: Ginger crop in Australia with symptoms of PSR. The disease progressed quickly down the

row in saturated soils after a prolonged, heavy rainfall event.


7

2.3. Soft rot symptoms

Early detection of PSR is essential in order for action to be taken in time to reduce crop losses. For

farmers, the disease is mainly identified by above ground symptoms such as wilting and yellowing.

Symptoms of PSR first appear on above ground parts at the rhizome-stem intersection or “collar” in

the form of watery, brown lesions. These lesions then enlarge and coalesce, causing the stem to rot

and collapse (Dohroo, 2005). On the leaves, the initial symptoms caused by the basal infection

appear as yellowing of the tips of older leaves first then gradual extension of the yellow down along

the margin to so that the rest of the leaf blade and, eventually, the sheath become chlorotic. As older

leaves wilt and become necrotic, the younger leaves start to develop a similar symptom progression

until the entire plant dies (ISPS, 2005) (Fig. 2.2). Once that happens, diseased stems can be easily

dislodged because there is so little structural integrity left connecting it to the rhizomes (Dohroo,

2005). However, if the infection is not severe the ginger plants may survive, but they will be less

vigorous and stunted (Liu, 1977a). Rhizomes from diseased plants appear brown, water soaked, soft

and rotten, and decay gradually (Dohroo, 2005; Haware and Joshi, 1974).

If a diagnosis of the disease is just simply based on the above ground symptoms, it could be

mistaken for symptoms of either Fusarium yellows caused by Fusarium oxysporum f. sp. zingiberi

or bacterial wilt caused by Ralstonia solanacearum. However, closer inspection of symptoms

should enable differentiation of the three diseases. For Fusarium yellows, symptoms are an initial

yellowing at leaf margins on lower leaves with yellowing eventually extending to entire leaves and

then wilting and drying of plants generally in patches within a field (Dohroo, 2005; Pegg and

Stirling, 1994). For Ralstonia wilt, infected plants show curling of the leaves, initially outwards,

followed by yellowing and wilting (Pegg and Stirling, 1994). Traditionally, diagnoses would be

based on disease symptoms followed up with cultural techniques where diagnosis would be based

on fungal/bacterial morphology. However, the deployment of molecular techniques can lead to

more rapid identification but also has the capacity to allow soil testing for presence of the pathogen.


8

Fig 2.2: Early symptoms of PSR in the form of water-soaked and brown coloured area on sheath

collar (top left), whole dead infected plant (left plant top right) with stem still standing but easily

pulled out of the ground. A healthy rhizome (bottom left) and diseased rhizome (bottom right), the

latter with soft, dark brown lesions at the buds (Le, 2010).

2.4. Pythium spp.– causal agents of the soft rot disease

Pythium spp. are fungal-like microorganisms belonging to the family of Pythiaceae in the order

Peronosporales of the phylum Oomycete, a member of the kingdom Stramenopila (Webster and

Weber, 2007). Stramenopila differ from true fungi in many ways, foremost of which are: (1)

production of biflagellate zoospores; (2) a thallus comprised of aseptate hyphae with cell walls

predominantly comprised of β-glucans and cellulose; and (3) a diploid vegetative state (Agrios,

2005; Ho, 2009; Schroeder et al., 2013). Pythium spp. can reproduce sexually via fusion of two

morphologically distinct gametangia to yield oospores or asexually via zoospores which are

produced within spherical sporangia. Sexual reproduction in some species is homothallic

(gametangia originating from the same hypha) whereas in others it is heterothallic with gametangia

originating from each of two compatible mating types. Nourishment comes from necrotrophic or

saprophytic action and many species within the genus are parasitic on plants or animals (Plaats-

Niterink, 1981). Historically, workers have described just over 120 species of Pythium based on

sexual and asexual structures (Dick, 1990) but with increased use of DNA sequencing to delineate

species, there are now more than 300 Pythium spp. recorded on MycoBank (www.mycobank.org).

However, a number of synonymous and doubtful species listed in the MycoBank database should

be carefully reviewed when describing and recording new and available species.


9

According to Ho (2009), Pythium species are distributed worldwide, ranging from tropical to

temperate sites and even in the Arctic and Antarctic regions. Many species of the genus are

common and important pathogens of fruit, vegetable and ornamental crops where they may cause

seed rot, seedling damping off and root rot or any combination thereof (Agrios, 2005). On ginger,

there are many Pythium spp. associated with soft rot disease (Sharma and Jain, 1977; Dohroo,

2005). Some of these have been well-documented for their identities and pathogenicity on ginger

(Table 2.1), whereas some reports do need further investigations as pathogenicity tests were not

necessarily carried out or identifications not confirmed or taxonomical descriptions have been

reassessed following molecular analysis (Table 2.2).

Table 2.1: Common Pythium spp. that are well-identified based on either morphology or molecular

techniques and highly virulent on ginger

Species Countries

recorded

Species

identified bya

References

Pythium

aphanidermatum

(Edson) Fitz

Bangladesh M, MT, P Chowdhury et al. (2009)

China M, MT, P Li et al. (2014)

India M, MT, P Butler (1907), Philip (2005), Shahare and

Asthana (1962)

Japan M, P Ichitani and Shinsu (1980)

P. deliense Meurs India M, MT, P Haware and Joshi (1974), Jooju (2005)

P. graminicola Subram Australia M, P Teakle (1962)

China M, MT, P Yuan et al. (2013)

Fiji M, MT Lomavatu et al. (2009)

Hawaii M, P Trujillo (1964)

India M, P Anonymous (1963), Park (1935)

P. myriotylum

Drechsler

Australia M, MT, P C.M.I. (1966), Stirling et al. (2009)

Fiji M, MT, P Stirling et al. (2009)

India M, MT, P Kumar et al. (2008), Philip (2005)

Korea M, P Kim et al. (1997a)

Taiwan M, P Lin et al. (1971), Tsai (1991)

P. spinosum Sawada Australia M, P Teakle (1960)



10

P. splendens Braun India M, MT, P Shanmugam et al. (2010)

Malaysia M, P Liu (1977b)

P. ultimum Trow India M, MT, P Dohroo (1987, 2001)


P. vexans de Bary Fiji M, MT Lomavatu et al. (2009)

India M, MT, P Philip (2005), Ramakrishnan (1949)

P. zingiberis

Takahashi

Japan M, P Takahashi (1954b)

Korea M, P Yang et al. (1988)

a M: Morphology, MT: Molecular technique, P: Pathogenicity confirmed by Koch’s postulates

Table 2.2: Pythium spp. that need to be re-examined for either their species statuses or

pathogenicity on ginger

Species Countries recorded References

P. butleri Subram India Thomas (1938)

P. complectens Braun India Park (1937)

P. gracile (de Bary) Schrenk Bangladesh

Fiji

India

McRae (1911)

Graham (1971)

Butler (1907)

P. monospermum Pringsh India Butler and Bisby (1960)

P. pleroticum T. Ito India Dohroo and Sharma (1985)

P. volutum Vanterpool &

Truscott

Japan Plaats-Niterink (1981)

Pythium spp. China

Nepal

Uganda

Yuan et al. (2011)

GRP (2009)

Sonko et al. (2005)

2.5. Pathogenicity

PSR on ginger was first observed in India with the description of the causal agent being P. gracile.

Since 1907, numerous other Pythium species have been described as being associated with PSR

although some species may, in fact, be synonyms of others. The following discussion will focus on

Pythium spp. involved in PSR on ginger only and their pathogenicity. It is interesting to note that

PSR has been recorded in all ginger growing countries, especially in India where most of different

Pythium spp. have been recorded as causal agents of PSR.


11

P. gracile was originally recorded by Schenk (1859) on algae and was described based only on

filamentous and non-swollen sporangia. Butler (1907) was first to report P. gracile causing PSR on

ginger in India. With incomplete descriptions, P. gracile was later renamed P. monospermum

Pringsh, a species which forms only filamentous sporangia according to the keys of Plaats-Niterink

(1981) but later it was excluded by Dick (1990). This species had also been recorded as the causal

agent of a disease called phycomycosis in horses in Australia and Japan (Hutchins and Johnston,

1972; Ichitani and Amemiya, 1980) and dogs in Australia (English and Frost, 1984). In 1987, the

species that had originally been described as P.gracile was formally described as P. insidiosum by

De Cock et al. (1987). However, in a review by Dohroo (2005) P. gracile was still considered as a

synonym for P. aphanidermatum. This classification clearly has some contradictions and should be

revisited, ideally with a thorough examination of the original type specimens of P. gracile and P.

monospermum. The latter species was originally recovered from dead insects in water in Germany;

then later recorded around the world (Plaats-Niterink, 1981) including as an endozoic parasite on

nonstylet-bearing nematodes (Tzean and Estey, 1981). In addition to its record on ginger, P.

monospermum has been reported on rice seedlings (Ito and Tokunaga, 1933) and sugarcane (Rands

and Dopp, 1938).

A second species associated with PSR that is also in need of re-examination is P. butleri. P. butleri

was originally considered as a separate taxon although based on its morphology it is quite similar to

P. aphanidermatum (Drechsler, 1934). On ginger, P. aphanidermatum was recorded in China, India

and Japan, but when assessed for pathogenicity on ginger in Japan in a pot trial, PSR symptoms

were not observed (Ichitani and Shinsu, 1980). According to Drechsler (1934), P. butleri had a

faster growth rate on media and produced larger oogonia than P. aphanidermatum. However,

Krywienczyk and Dorworth (1980), following a serological assay, consolidated the two species

under the name of P. aphanidermatum. Further morphological comparisons of a number of isolates

identified as P. butleri and P. aphanidermatum carried out by Plaats-Niterink (1981) failed to

identify characters that would reliably distinguish the two species. The consolidation of these two

species was further confirmed by PCR-RFLP (restriction fragment length polymorphism) analysis

of the ITS (internal transcribed spacer) regions (Wang and White, 1997). The technique consisted of

PCR (polymerase chain reaction) amplification of the complete ITS gene including the 5.8S region

of rDNA followed by digestion of the PCR product with four restriction enzymes: CfoI, HinfI,

MboI, and TaqI (Wang and White, 1997). This will be discussed in more detail in another section of

this review.


12

P. complectens, which has been recorded on ginger in India (Park, 1937) was first described and

recorded as the causal agent of geranium stem rot by Braun (1924). Based on morphology, P.

complectens was then considered to be P. vexans (Drechsler, 1946; Plaats-Niterink, 1981). Under

the name of P. vexans, the species was recorded on many different host plants (Lévesque and De

Cock, 2004; Plaats-Niterink, 1981). With recent advances in sequencing technology of specific loci,

P. vexans and other species in clade K as categorised by Lévesque and de Cock (2004) were placed

under two new genera, either Phytopythium (Bala et al., 2010) or Ovatisporangium (Uzuhashi et al.,

2010). However, the latter was rejected by Schroeder et al. (2013) as the name Phytopythium was

officially introduced first. The genus Phytopythium based on morphologic and phylogenetic

analyses is placed between Pythium and Phytophthora (Bala et al., 2010; De Cock et al., 2010).

Pythium pleroticum was first isolated and described by Ito (1944) from water in Japan. Jacobs

(1982) later isolated P. pleroticum from decaying leaves of Nymphoides peltata submerged under

water and confirmed the species descriptions of Ito (1944). On ginger, P. pleroticum was reported

causing PSR by Dohroo and Sharma (1985) and it has also been recorded as pathogenic on corn

seedlings (Olaya et al., 2006). Plaats-Ninterink (1981) grouped P. pleroticum with other Pythium

spp. producing globose hyphal swelling and plerotic oospores; however, the status of P. pleroticum

remains uncertain and should perhaps be renamed.

The only heterothallic Pythium on the list of species associated with PSR is P. splendens. This

species is known to produce abundant globe-shaped hyphal swellings in culture (Plaats-Niterink,

1981). Its pathogenicity on numerous plants has also been reported (Al-Sa'di et al., 2008a; Fu et al.,

2005; Ploetz, 2004; Tojo et al., 2004). Unlike species which grow well at high temperatures (such

as P. myriotylum, P. aphanidermatum, P. diliense, and P. graminicola) P. splendens causes root rot

on host plants generally at 15-200C, far below the optimal growing temperature of 30

0C of these

other species (Ploetz, 2004).

P. graminicola was first isolated and described from wheat roots in India and this Pythium species

is believed to be pathogenic only on graminaceous plants by Chen and Hoy (1993), Martin (2008)

and Plaats-Niterink (1981). However, others have described it as a causal agent of PSR on ginger in

Fiji and India (Lomavatu et al., 2009; Philip, 2005; Ramakrishnan, 1949).

P. zingiberis which was first reported to cause PSR in Japan, has so far only been reported in one

other country causing PSR on ginger, that being Korea. Although the pathogen supposedly has a


13

narrow host range limited to ginger and its close relatives (Samejima and Ichitani, 1988), it was also

found to cause damping off on cabbage seedlings in Japan (Kubota and Abiko, 2000) and,

interestingly, it was also recorded on leeches (Hirudinea) in Poland (Czeczuga et al., 2003). The

record of P. zingiberis on leeches was based solely on morphological comparisons to the species as

it appears in Dick’s (1990) key and so perhaps should be accepted with caution. Hopefully

additional discoveries of this unique host/pathogen interaction will allow for more complete

analysis via contemporary phylogenetics.

P. myriotylum, which was first isolated from tomato, is very similar to P. zingiberis in terms of

morphology and some gene sequences (Lévesque and De Cock, 2004; Matsumoto et al., 1999). It is

however known to have a worldwide distribution and attacks numerous hosts (Plaats-Niterink,

1981). Stirling et al. (2004; 2009) observed that disease severity caused by P. myritotylum on ginger

was more strongly influenced by temperature rather than soil moisture. The pathogen was also very

aggressive on ginger showing symptoms on aboveground parts of plants within a week of

inoculation (Wang et al., 2003; Stirling et al., 2009). Additionally, another species called P. volutum

was also considered to be synonymous with P. zingiberis by Plaats-Niterink (1981), but it is in fact

quite distinct based on the cardinal temperature and oospore size according to Dick (1990) and

Takahashi (1954a).

P. aphanidermatum and P. diliense are both common pathogens on many crops in warm regions.

Morphologically they are similar in their production of inflated sporangia, in their antheridial mode

and size of the oogonium (Dick, 1990; Plaats-Niterink, 1981), and they differ only by 3% within

their ITS sequences (Lévesque and De Cock, 2004). Nonetheless, with slight differences in optimal

growing temperature and a morphology characterized by a consistent bending of the oogonialphore

towards the antheridium by P. diliense, the two species remain as two separate taxa (Dick, 1990;

Herrero and Klemsdal, 1998; Plaats-Niterink, 1981). Both P. aphanidermatum and P. diliense can

be distinguished by either RAPD (random amplified polymorphic DNA) analysis (Herrero and

Klemsdal, 1998) or with multiplex PCR with specific primer sets (Arif et al., 2011).

P. spinosum has been recovered from rotten ginger rhizomes collected in Australia and Japan

(Table 2.1), but when pathogenicity was tested on living ginger plants, no symptoms developed (Le

et al., 2010). However, when P. spinosum was inoculated onto excised sections of ginger rhizome it

fully colonised the tissue within 3 days when incubated at 27 °C. Only P. myriotylum colonised

excised ginger rhizome more rapidly under these conditions (Le et al., 2010). Hence, it is assumed


14

that P. spinosum is either opportunistic or a postharvest pathogen of ginger. Similarly, P. ultimum

was also isolated from ginger rhizomes in India and Japan, but efforts to fulfil Koch’s postulates of

the Japanese isolate showed that P. ultimum was non-pathogenic on ginger (Ichitani and Shinsu,

1980). This is despite the fact that the host range of P. ultimum includes many plants in many

genera and the pathogen is known to be quite aggressive on seedlings of some other hosts such as

cabbage (Kubota et al., 2006a, b), maize (Da Silva and Munkvold, 2010), chingensai (Tanina et al.,

2004), common bean (Lucas and Griffiths, 2004), okra (Priekule, 2007), geranium (Chagnon and

Belanger, 1991) and lucerne (Denman et al., 1995). Dohroo (2001) confirmed that P. ultimum was a

causal agent of PSR on ginger under postharvest storage conditions.

Regardless of the reports of many different Pythium spp. being the pathogens associated with PSR,

interactions between species with regard to infection, disease development, and/or severity have

been poorly documented in contemporary literature. This is despite it being known that PSR of

ginger is more serious when it occurs in association with either Fusarium spp. or Meloidogyne spp.

or Ralstonia sp. (Dohroo, 2001; Gupta et al., 2010; Mathur et al., 2002; Rajan et al., 2002). Further

work is needed to confirm whether PSR on ginger is a disease complex, as is the case with other

crops such as snap bean (Kobriger and Hagedorn, 1984), sugarcane (Lee and Hoy, 1992) and carrot

(Suffert and Guibert, 2007), where disease is associated with many Pythium spp. It is proposed that

PSR of ginger is caused by a complex of Pythium spp., so more research on this will be of interest.

It is also important to establish that identification of the causal agent is accurate. The use of

molecular identification along with accurate detailed morphological assessment verified by type

specimen is essential.

2.6. Pythium isolation

Pythium spp. can be recovered directly from infested tissue by plating onto media such as water

agar, potato dextrose agar, corn meal agar or selective media with antibiotic amendments. Pythium

spp. can also be recovered by soil dilution plating (see next section) or baiting methods (Martin,

1992). Baiting with cucumber seeds and excised potato tubers has been shown to be successful in

recovering P. aphanidermatum from soil (Stanghellini and Kronland, 1985; Watanabe, 1984). A

test of ten different plants as candidate baiting materials by Sánchez et al. (2000) showed that

orange tree leaves and hemp seed cotyledons were the most successful for retrieving P.

aphanidermatum and P. irregulare, the latter of which only produces filamentous, non-inflated

sporangia. Likewise, Watanabe et al. (2008) concluded that seeds of hemp, perilla, and radish and

leaves of bentgrass and rose were highly effective in attracting zoospores of P. helicoides, P.

http://en.wikipedia.org/wiki/Opportunistic_infection


15

myriotylum and P. aphanidermatum and consequently these were employed to “catch” those species

from hydroponic solutions. Other successful methods have included the use of rhododendron leaf

discs and Douglas-fir needle segments in obtaining Pythium spp. from forest soils (Weiland, 2011)

and soybean leaf discs from soybean fields (Jiang et al., 2012). Thanks to the effectiveness of

various methods, baiting is believed to be a useful tool for monitoring Pythium populations and

forecasting disease occurrence under field conditions (Sánchez et al., 2000; Stanghellini and

Kronland, 1985; Watanabe et al., 2008).

2.7. Pythium quantification

Although a soil dilution plating method is considered to be a time-consuming and labour-intensive

technique, it is still considered useful by some in quantifying Pythium spp. populations in soil in

order to forecast a risk of disease outbreaks (Kernaghan et al., 2008; Stanghellini and Kronland,

1985). There are at least 15 different selective media developed for the isolation and quantification

Pythium spp. directly from soil by dilution plating techniques (Mircetich and Kraft, 1973). From

these 15 media, MPVM medium was evaluated and selected by Mircetich and Kraft (1973) as the

most effective one. The MPVM medium was then modified by Ali-Shtayeh et al. (1986) to what

was then described as VP3 medium making it less expensive by reducing the amount of vancomycin

used (Table 2.3). Likewise, P5ARP was adapted from P10VP to make the medium still less

expensive in preparation. The P5ARP medium has proved to be as effective as P10VP in Pythium

spp. recovery from soil and mycelial growth (Jeffers and Martin, 1986). Recently, Morita and Tojo

(2007) modified P5ARP medium in order to create a medium referred to as NARM which does not

require PCNB to recover and enumerate Pythium spp. According to Morita and Tojo (2007), the

NARM medium was as effective as P5ARP in inhibiting non-pythiaceous microorganisms;

however, it yielded much better mycelial growth of tested Pythium spp. Another method which

involves baiting with cucumber seeds and fresh potato tuber discs has been developed by

Stanghellini and Kronland, (1985) and Watanabe (1984) to estimate the number of P.

aphanidermatum propagules in soil.


16

Table 2.3: Some common selective media for Pythium isolation with recent modifications

Original media Modified media

MPVM: 5 ppm pimaricin, 100 ppm PCNB, 10

ppm rose bengal and 300 ppm vamcomycin

(Mircetich and Kraft, 1973)

VP3: 75 ppm vancomycin, 100 ppm PCNB, 50

ppm penicillin and 5 ppm pimaricin (Ali-

Shtayeh et al., 1986)

P10VP: 10 ppm pimaricin, 200 ppm vancomycin

and 100 ppm PCNB (Tsao and Ocana, 1969)

P5ARP: 5 ppm pimaricin, 250 ppm ampicillin,

10 ppm rifampicin and 100 ppm PCNB (Jeffers

and Martin, 1986)

P5ARP: 5 ppm pimaricin, 250 ppm ampicillin, 10

ppm rifampicin and 100 ppm PCNB (Jeffers and

Martin, 1986)

NARM: 10 ppm nystatin, 250 ppm ampicillin,

10 ppm rifampicin and 1 ppm miconazole

(Morita and Tojo, 2007)

PCNB: Pentachloronitrobenzene

Pythium inoculum potential in the soil may be critical for forecasting disease occurrence. Ikeda and

Ichitani (1985) estimated that P. zingiberis at a density of between 10-1,000 oospores/g oven dried

soil could induce disease on Chenopodium quinoa, a highly susceptible host to P. zingiberis, in

controlled experiments. However, in the field they considered that the actual density of P. zingiberis

required to cause PSR of ginger may be lower. In fact, Ichitani and Goto (1982) observed that

although there was no P. zingiberis detected in soil after 6 years of rotation of non-host crops, PSR

was still observed once ginger was replanted in that soil. It could not be determined whether P.

zingiberis was reintroduced from seed ginger at planting or dilution plating was not sensitive

enough to detect extremely low populations of P. zingiberis in the field. Alternatively, it could be

theorized that even a very low initial inoculum density of Pythium spp. could result in disease,

provided that favourable conditions for Pythium spp. development have been met. It is also well-

known that the effectiveness of plating techniques is also dependent on the particular pathogenic

Pythium sp. For example, the plating technique was sensitive enough to detect low populations of P.

aphanidermatum at 2-4 cfu/1,000 L of hydroponic solution (Fukata et al., 2013). However, for other

species such as P. myriotylum, a dilution plating method was more difficult, so that estimation of

the population of P. myriotylum using this method before the growing season was not possible

(Lumsden et al., 1975; Wang and Chang, 2003).

Though there have been numerous drawbacks to using selective media in recovery and

quantification of Pythium spp., this method is still universally employed. In recent years, selective

media have usually been used in conjunction with other approaches such as real time or quantitative


17

PCR for faster identification and quantification of Pythium spp. from soil, water and plant samples

(Kernaghan et al., 2008; Schroeder et al., 2006; Schroeder and Paulitz, 2006). By monitoring either

directly amplified PCR products bound with a fluorescent dye or complementary probe, or

indirectly generated fluorescence applying the exonuclease activity of Taq polymerase, proportions

of the PCR products or fluorescence could be determined directly (Okubara et al., 2005). Schroeder

et al. (2006) successfully designed specific primers to amplify ITS regions in the DNA of P.

ultimum, P. abappressorium, P. attrantheridium, P. hetorothallicum, P. rostratifingens, P

sylvaticum and P. irregulare recovered from wheat field soils. Similarly, Kernaghan et al. (2008)

also fully amplified ITS regions of P. ultimum and P. irregulare group I and IV in American

ginseng field soil samples by using specifically designed primers. Additionally, qPCR was

implemented to identify and quantify P. vexans based on the small subunit (SSU) and ITS region of

the genome (Bent et al., 2009; Spies et al., 2011b). There are more than 20 different primer sets

working specifically on a broad range of Pythium spp. that have been designed (Schroeder et al.,

2013). Besides qPCR, Yuen et al. (1998) and Kyuchukova et al. (2006) have successfully employed

indirect enzyme-linked immunosorbent assay (ELISA) in order to enumerate the number of

propagules of P. ultimum and P. aphanidermatum in a sample. This technique has proven to be

sensitive enough to detect P. ultimum at 1:5,000,000 culture dilution rate (Yuen et al., 1998) or at a

level of 0.05 g mycelium of P. aphanidermatum per litre of nutrient solution (Kyuchukova et al.,

2006). Recently, Fukuta et al. (2013, 2014) successfully developed a highly sensitive, quick and

easy detection method, called LAMP (loop-mediated isothermal amplification) to monitor P.

aphanidermatum and P. myriotylum from hydroponic solutions (this will be discussed in a next

section). Together with conventional plating techniques, advanced molecular and monoclonal

antibody technologies allow monitoring populations of Pythium spp. more easily and accurately.

2.8. Pythium identification and its advances

2.8.1. Morphology

Pythium identification has conventionally been done by examining morphological characteristics in

conjunction with the keys developed by either Plaats-Ninterink (1981) or Dick (1990). For specific

countries, researchers can refer to keys of Robertson (1980) for species in New Zealand, Ali-

Shtayeh (1986) for species in Israel, Watanabe (2010) for species recorded in Japan or Ho (2011)

for species recorded in Taiwan. Although Pythium spp. can be identified to species level by

experienced taxonomists based on morphology (Fig 2.3), it is considered not to be an easy task for

those lacking experience with this genus (Lévesque and De Cock, 2004). In addition, procedures

used for identification are often time-consuming and sometimes not sensitive enough to distinguish


18

closely related species (Ward et al., 2004). Due to these disadvantages, great efforts have been

given to developing complimentary methods based on use of molecular tools.

Fig 2.3: Morphology of Pythium spp. associated with PSR of ginger: P. myriotylum (1, finger

shaped appressoria and appressoria usually formed in cluster; 2-3, zoospore released from vesicle;

4, smooth, aplerotic oospore; 5 filamentous inflated sporangia), P. splendens (6, globese, smooth,

terminal hyphal swelling), P. deliense (7, single antheridium applied to an oogonium and an

oogonialphore winding towards the antheridium), P. zingiberis (8, oogonia formed in cluster and

typical coiling antheridial stalks around oogonial stalks), P. aphanidermatum (9, single broad

antheridium applied to an oogonium), P. ultimum (10, a smooth, terminal oogonium with single

antheridium appearing from just right beneath the oogonium), P. spinosum (11, spiky intercalary

oogonia).

3

3

5

1 2

4

6 7

8

9

10 11


19

2.8.2. Molecular and monoclonal antibody approaches

White et al. (1990) developed numerous universal primers to amplify non-coding ITS regions

including the 5.8S gene of rDNA of all fungal and fungal-like taxa including Oomycete. Following

this, many workers have designed different and more specific primers for targeting Pythium spp.

(Schroeder et al., 2013). A large number of ITS sequences have already been deposited and made

available for public access on the Genbank database. This has allowed the ITS region to become

commonly used for quick and accurate identification of Pythium spp. to species levels by doing a

BLAST (basic local alignment search tool) search (Lévesque and De Cock, 2004; Matsumoto et al.,

1999; McLeod et al., 2009; Schroeder et al., 2013). Furthermore, many specific primer sets based

on the ITS region designed for single Pythium species - including P. myriotylum, which can cause

soft rot on ginger - have been reported (Schroeder et al., 2013; Wang et al., 2003). Nonetheless, ITS

sequences sometimes show low divergence between some closely related species such as P.

myriotylum and P. zingiberis (Lévesque and De Cock, 2004; Matsumoto et al., 1999), P.

aphanidermatum and P. diliense (Herrero and Klemsdal, 1998) and P. attrantheridium and P.

intermedium (Allain-Boulé et al., 2004) or intraspecific variation within species like P. myriotylum

(Kageyama et al., 2005; Perneel et al., 2006), P. arrhenomanes (Chen and Hoy, 1993) and P.

mercurial sp. nov. (Belbahri et al., 2008). Because sequences of the ITS gene may be difficult for

species differentiation among Pythium spp. (Schroeder et al., 2013), sequencing alternative genes

has been deployed. These include nuclear encoded β-tubulin, SSU (small subunit) and LSU (large

subunit) (Belbahri et al., 2008; Kumar and Shukla, 2006; Lévesque and De Cock, 2004; Liu et al.,

2012; Moralejo et al., 2008; Mu et al., 1999; Spies et al., 2011a; Tao et al., 2011), CoxI

(cytochrome c oxidase subunit 1) (Kroon et al., 2004; Robideau et al., 2011), CoxII (Garzón et al.,

2005b; Kageyama et al., 2005; Kammarnjesadakul et al., 2011; Martin, 2000; Nechwatal et al.,

2005; Spies et al., 2011a; Villa et al., 2006) and NADH (dehydrogenase subunit 1) (Kroon et al.,

2004; Moralejo et al., 2008).

ELISA has been applied for detection of viral plant diseases since the 1970s. Such assays can be

quantitative and are relatively user-friendly (Martin et al., 2000). With the development of specific

monoclonal antibodies, ELISA could be carried out to detect Pythium to species level (Bailey et al.,

2002; Kageyama et al., 2002). Kageyama et al. (2002) were successful in using monoclonal

antibodies (MAbs) in order to differentiate between P. sulcatum and P. myriotylum or P. zingiberis

from infected tissues or soil. MAb E5 was developed to recognise P. ultimum in diseased roots of

bean, cabbage and sugar beet by double-antibody sandwich ELISA (Yuen et al., 1998).

Furthermore, ELISA conducted in combination with PCR amplification of the ITS1 region allowed


20

workers to differentiate ten species of Pythium and eight Phytophthora spp. The method also

enabled staff to rapidly process numerous samples with a high level of confidence in identification

(Bailey et al., 2002).

Protein electrophoresis analysis has been considered a useful approach for research of fungal

taxonomy. Gill (1978) was successful in employing the method to separate Phytophthora (Ph)

cinnamomi and Ph. cactorum based on the different protein electrophoretic patterns on a

polyacrylamide gel. However, results from Chen et al. (1991) suggested that the reliability of the

method was under question. Chen (1991) conducted SDS-polyacrylamide gel electrophoresis of

soluble proteins to identify seven homothallic Pythium species (P. aphanidermantum, P.

arrhenomanes, P. deliense, P. graminicola, P. irregulare, P. paroecandrum, and P. ultimum).

Again the results were not convincing because protein banding patterns of P. aphanidermantum and

P. deliense, P. graminicola and P. arrhenomanes had no distinguishable differences.

RAPD is a useful approach in genetic mapping and diagnosis as well as in studies for taxonomy and

evolution (Williams et al., 1990) and it has been applied to detect Pythium spp. in some cases

(Herrero and Klemsdal, 1998; Sagar et al., 2009). For instance, when three different primers OPA-

03 (5’-AGTCAGCCAC), OPA-15 (TTCCGACCC), and OPB-08 (GTCCACACGG) were used by

Herrero and Klemsdal (1998), they were able to differentiate P. aphanidermantum isolated from

cucumber from other species such as P. irreglare, P. ultimum, P. diliense and P. paroecandrum.

The method was again used by Sagar et al. (2009) to check for variability in P. aphanidermatum

recovered from ginger. The assay also showed the possibility of using RAPDs to detect P.

aphanidermaum directly from plant material or soil (Sagar et al., 2009). However, the technique

has poor reproducibility between labs (Schroeder et al., 2013). Like RAPD, AFLP is a useful

technique in mapping and genetic studies (Al-Sa'di et al., 2008b; Lee et al., 2010). Moreover, AFLP

was successfully used to identify 25 known Pythium isolates out of 48 blind samples without

misidentification by double-digesting genomic DNA with two restriction enzymes: EcoRI and MseI

(Garzón et al., 2005a). Compared to RAPD and AFLP, SSR (simple sequence repeats, also known

as microsatellites) are more reproducible and co-dominant markers used in SSR are more

informative, so this is considered a better approach for studying genetic diversity of Pythium (Lee

et al., 2010; Lee and Moorman, 2008; Schroeder et al., 2013). SSR was employed to distinguish

Pythium spp. within group F (Vasseur et al., 2005). Furthermore, Lee and Moorman (2008) found

five out of 57 SSR markers could be transferable across labs and yielded specific PCR products for

22 different Pythium spp.


21

RFLP could also be applied to differentiate Pythium spp. to species level by comparing specific

DNA patterns obtained by digesting their DNA with restriction enzymes although this is commonly

used to examine polymorphism within species of Pythium (Schroeder et al., 2013; Wang and White,

1997). Hence, Schroeder et al. (2013) emphasised that phylogenetic relationship of closely related

species should be taken into account when the application of RFLPs is implemented for accurate

species identification. Additionally, compared to sequencing, RFLP for species identification may

be less sensitive. RFLP is often conducted in conjunction with PCR amplification of specific loci

such as ITS, CoxI, CoxII, SSU, or LSU with the PCR amplicon being digested with restriction

enzymes. For instance, PCR products of SSU and ITS regions were digested with Mbo I, Hinf I and

Taq I, but resulted in bands that did not show any difference between P. graminicola and P.

arrhenomanes and on this molecular evidence, Chen et al. (1992) suggested the consolidation of

these two species. However, Chen and Hoy (1993) were successful in applying two enzyme sets:

Cfo I, Hinf I, Mbo I, Taq I and Cfo I, Hinf I, Msp I, TaqI to cleave amplified genes of ITS and LSU

respectively. The banding patterns strongly indicated the separation of four closely related species

of Pythium: P. graminicola, P. arrhenomanes, P. aphanidermatum and P. myriotylum. Likewise,

Wang and White (1997) concluded that the PCR-RFLP assays were reliable in Pythium

identification by using four enzymes Cfo I, Hinf I, Mbo I and Taq I in order to digest PCR

amplicons of the ITS gene of 36 plant pathogenic Pythium spp. Convincing species recognition was

also obtained from digestion of either the ITS locus alone (Gómez‐Alpízar et al., 2011; Matsumoto

et al., 2000; Watanabe et al., 2007), the CoxI gene alone (Martin, 1990; Martin and Kistler, 1990) or

in conjunction with the CoxII gene (Kageyama et al., 2005).

Fukuta et al. (2013, 2014) successfully developed a set of six primers, including two loop primers,

to specifically detect P. aphanidermatum and P. myriotylum using LAMP. This novel technique

was developed by Notomi et al. (2000). LAMP allows DNA amplification to occur under a single

constant temperature condition specifically, efficiently and rapidly (Nagamine et al., 2002; Notomi

et al., 2000). Additionally, LAMP does not require an expensive PCR thermal cycler, so it is much

cheaper and easier to carry out in comparison to conventional PCR or q-PCR (Fu et al., 2011).

Another advantage of LAMP is that it does not require pure DNA templates for amplification. Dai

et al. (2012) and Fukuta et al. (2013, 2014) reported that LAMP is ten times more sensitive than

PCR, and LAMP can also amplify target DNA directly from crude tissue extracts. Consequently,

this method appears very promising for development of a kit for field use (Fukuta et al., 2013,

2014).


22

2.9. Control strategies

2.9.1. Chemical

Recently a great deal of effort around the world has been directed toward control strategies for PSR

of ginger. Control of PSR is difficult because Pythium spp. can persist in the soil for years once

introduced (Hoppe, 1966), and it seems that a single approach does not work effectively to suppress

the pathogens under field conditions (Mathur et al., 2002; Smith and Abbas, 2011). Smith and

Abbas (2011) suggested an integrated program which was mainly based on cultural practices and a

strict quarantine procedure to manage the disease. Mathur et al. (2002) found that combined

application of soil solarisation and fungicides could effectively minimize PSR occurrence caused by

P. myriotylum. Seed ginger (a section of the rhizome used as planting material) treatments with

Ridomil® MZ (metalaxyl + mancozeb) at 6.25 g/L in addition to soil drench with Thimet (Phorate)

and Ridomil MZ at 10 L/3 m2 plot at 60 days after sowing gave the best control of P. myriotylum on

an experimental ginger field in southern Rajasthan, India. The treatments performed even better in

solarized plots achieved by using a thick transparent polythene film over the soil surface for 20 days

(Mathur et al., 2002). Another experiment conducted on a field naturally infested with P.

aphanidermatum in Raigarh, India, showed that seed dipping applications with Ridomil MZ at a

rate of 1.25 g/L could increase survival of rhizomes by about 30% in comparison to hot water

treatment at 51 °C for 30 minutes (Singh, 2011). Interestingly, seed coating with Fytolan (copper

oxychloride) 0.2% + Ridomil 500 ppm + Bavistin (carbendazim) 0.2% + Thimet could keep ginger

rhizomes free from PSR in a pot trial (Rajan et al., 2002). Likewise, Smith and Abbas (2011) found

that fungicides such as Metalaxyl, Ridomil, Maxim® XL (fludioxonil) and Proplant

® (propyl

carbamate hydrochloride) applied as a seed treatment gave significantly better control of PSR

caused by P. myriotylum than Carbendzim seed treatment (considered as a standard seed dip in

Australia) in a pot trial. A synergistic effect on control of PSR was also noted on the treatment of

seed with both Metalaxyl and Phospot® (phosphorous acid). Unfortunately, it is now believed that

large scale seed dipping to control PSR can lead to cross contamination of seed pieces causing

further spread of Pythium spp. to new fields when the treated seeds are used. Therefore, farmers in

Australia are now advised to use Pythium-free certified seed ginger that is allowed to air dry until

the cut surfaces are fully suberized. Instead of dipping, Lokesh et al. (2012) suggested that seed

ginger can be solarized at 47 °C under 200 µm polyethylene sheets for 30 min for Pythium spp.

disinfestation. However, this method alone was not effective in reducing PSR occurrence (Lokesh

et al., 2012). In addition, a long period (up to 4 weeks) of soil solarisation resulted in a significant

decline in Pythium spp. populations and a lower disease incidence in solarized plots (Christensen


23

and Thinggaard, 1999; Deadman et al., 2006). Until more effective and efficient alternative

approaches are developed to manage PSR, chemical applications still remain the most important

tool in the control of PSR of ginger, despite the fact that chemical usages are associated with

problems such as high cost, environmental pollution and side effects to beneficial microorganisms

(Agrios, 2005). In recent years, numerous environmentally friendly control measures against PSR

have been investigated.

2.9.2. Biological agents

Trichoderma spp. are the most widely used biological control agents (BCAs) in control of PSR of

ginger. Rathore et al. (1992) confirmed that non-volatile and volatile compounds produced by T.

viride could inhibit the growth of P. myriotylum recovered from infected ginger by 70 and 100%,

respectively when assessed in Petri plates. P. myriotylum treated with these compounds formed few

oogonia. In addition, T. harzianum and T. saturnisporum also showed strong antagonism against P.

splendens in vitro (Shanmugam et al., 2013). Along with Trichoderma spp., several rhizobacteria

were also antagonistic and showed significant inhibition of P. myriotytlum growth in dual culture

assays (Bhai et al., 2005).

By applying what is known as the “poisoned food technique”, Dohroo et al. (2012) found that

growth of P. aphanidermatum on PDA amended with onion and garlic extracts at 5% and 7.5%

(v/v), respectively, was completely inhibited. Unusually, using a similar technique, fresh and stored

cow urine were assessed and found to strongly inhibit the growth of P. aphanidermatum at a

concentration of ≥ 20% (v/v) (Rakesh et al., 2013).

Pot trials with the above BCAs have also given some promising control of PSR of ginger. For

example, soil inoculation with T. harzianum colonized wheat grains (9.9 x 108 CFU/g) at the time

of planting resulted in suppression of Pythium sp., and disease severity were reduced to just 3%

compared to a control treatment without T. harzianum at 81% (Rajan et al., 2002). Ram et al. (2000)

coated seed ginger with a Trichoderma spp. slurry2 and found that the percentage of PSR incidence

on Trichoderma spp. coated ginger was 2-3 times less than that of the control coated seed ginger

without Trichoderma spp. Suppression of PSR was even better, reducing PSR incidence up to four

times, when seed ginger was first surface disinfested in 1% HOCl for 5 min, soaked in a suspension

of Trichoderma spp. talc-based formulation (6 x 107 CFU/L) and followed up with three

2 Slurry contains 30 g cultures of Trichoderma spp. + 30 g autoclaved fine clay + 50 mL sterile water to make a final

concentration of 2.3-3.1 x 104 CFU/g.


24

applications of talc-based formulation (3 x 106 CFU/g) to the soil at 15-day-intervals from time of

planting (Shanmugam et al., 2013). According to Gupta et al. (2010), by providing a combination of

different modes of action by antagonists, the level and consistency of disease suppression was

enhanced. An application of T. harzianum + Glomus mosseae + fluorescent Pseudomonad strain G4

limited infection by P. splendens to 10% compared with 30, 43, and 50% infection in treatments

with T. harzianum, G. mosseae, and G4 as single treatments, respectively. Interestingly, seed

dipping in a suspension of P. fluorescens or Bacillus sp. (108 CFU/ml) for 1 h combined with

inoculation with Glomus sp. at time of planting showed absolute suppression of PSR (Bhai et al.,

2005). Moreover, it is well-known that antagonists may also play a role as plant growth promoters.

In fact, compared to soil free of biocontrol agents, growth and yield of ginger growing in soil with

antagonistic agents were better (Bhai et al., 2005; Gupta et al., 2010; Shanmugam et al., 2013).

Although BCAs have performed impressively in pot trials for the control of PSR, the efficacies of

these agents in the field are usually variable and inconsistent. The performance of T. harzianum in

controlling PSR incidence in fields with a history of the disease was just around half of that in the

pot, and continue to decline by nearly 1.5 times after three seasons of the applications (Singh,

2011). However, Singh (2011) reported that T. harzianum was able to suppress PSR to the same

level as Ridomil® MZ. Shanmugam et al. (2013) also reported that though the efficacies of BCAs

were lower in fields, better control was achieved when several BCAs were applied together.

Additionally, PSR on field-grown ginger may usually be associated with the occurrence of other

diseases such as bacterial wilt and Fusarium yellows, so the efficacies of BCAs can be difficult to

determine. In fact, control of PSR by T. harzianum was greatly reduced in the presence of

F.oxysporum f.sp. zingiberis because the fungus exacerbated PSR of ginger (Rajan et al., 2002). It

is evident from these reports that the efficacies of BCAs greatly depends on methods and frequency

of application and inoculum concentrations and relied on their ecological competence in native

soils, as well as microbiological competition (Papavizas, 1985). Although biological agents for the

control of PSR are seen as eco-friendly, many of the commercial products have yet to demonstrate

their economic value for controlling PSR of ginger in the field.

2.9.3. Cultural practices

Cultural practices including crop rotation, tillage, organic amendment, drainage, and quarantine are

commonly employed on ginger fields to control PSR and limit the spread of Pythium spp. to fields

that are unaffected. These practices have been designed to: 1) improve soil health by enriching

organic matter thereby creating a more diverse and disease suppressive soil biota; and 2) contain


25

Pythium spp. within the infested area and limit spread to other areas that are free of disease. Most of

the Pythium spp. that have been recorded on ginger are also pathogenic on a wide host range, so

crop rotation may not be necessarily a useful approach to control Pythium spp. on ginger. However,

Harvey and Lawrence (2008) suggested that crop rotations could change the prevalence of Pythium

spp. populations within a field, such that each crop would be associated with a particular Pythium

species and therefore potential inocula could be reduced in annual rotation fields. Urrea et al. (2013)

found that diversity of Pythium spp. greatly depends on rotation of susceptible host crops and the

diversity was poor in mono-culture systems. Similarly, Pankhurst et al. (1995) found pathogenic

Pythium spp. increased and became dominant in mono-cropping regimes. Rames et al. (2013) also

concluded that species richness of fungal and bacterial soil populations were significantly greater in

plots with a 4-year program of summer and winter crop rotations compared with plots treated with

fumigant or left as bare fallow. A field with continuous growth of pasture grass (Digitaria eriantha

subsp. pentzii), where all the green biomass was returned to the field before the ginger was grown

also showed a higher diversity of soil biota compared with the fallowed field (Rames et al., 2013).

Along with crop rotations, amendment of organic matter, including poultry manure and sawdust

(200t/ha) enriched diversity of soil microbial communities in these ginger fields (Rames et al.,

2013). These practices also increased soil carbon levels and water infiltration rates which supported

growth and yield of ginger and helped suppress PSR on ginger (Smith et al., 2011; Stirling et al.,

2012). The role of soil microorganisms in suppressing PSR was confirmed in pot trials where soils

from two farms were either fumigated with 1,3 dichloropropene (Telone®

) or irradiated at 25 kGy

in order to eradicate soil biota. Consequently, PSR in the treated soils was significantly higher than

that in control soils without fumigation or irradiation (Stirling et al., 2010). However, Stirling et al.

(2012) indicated that once conditions for P. myriotytlum development are ideal, such as high

temperature and saturated soils, approaches to retain the presence of antagonist soil microorganisms

were not as effective at controlling the pathogen. Stirling et al. (2012) showed that one application

of organic manure was not sufficient to allow maintenance of soil C levels after three years

cultivation, indicating that total C dropped from 54 g/kg to 39 g/kg which was not significantly

different from that found in a bare fallow field. Thus, regular applications of green biomass and

organic amendments to the soil are required to maintain the soil C content (Kibblewhite et al., 2008;

Smith et al., 2011). Sharma et al. (2010) found a significant negative relationship between organic

carbon content and PSR incidence and indicated where soil had an organic carbon content greater

than 2.25%, the incidence of PSR was less than 15%.


26

Tillage practices that reduce soil disturbance should also be taken into account for good ginger

farming and control of PSR. Rames et al. (2013) found that minimum tillage led to soils with higher

microbial populations compared to conventional tillage practice. However, the soils in minimum till

fields also tended to set hard, subsequently, ginger establishment and growth was poor following

direct mechanical drilling of the seed (Smith et al., 2011). To overcome this problem, Smith et al.

(2011) proposed that beds under minimum tillage with rotation crops should be rotary-hoed before

planting seed ginger to create better till for germination and growth of the crop.

Interestingly, integration of neem (Azadirachta indica) seed powder and punarnava (Boerhavia

diffusa) leaves, instead of poultry manure, into soil at the time of land preparation also reduced PSR

intensity in ginger by up to 89% in comparison to the untreated control (Gupta et al., 2013).

Application of neem seed in the form of neem cake at 0.5% mass/mass soil was found to suppress

P. aphanidermatum. However, neem cake did not directly inhibit P. aphanidermatum, but increased

the number of beneficial microorganisms that suppressed disease (Abbasi et al., 2005). Farmers in

some regions in India mulch ginger beds with local green leaves instead of saw-dust or woodchip as

is the practice in Australia. The mulching materials included Artemisia vulgaris, Schima wallichii,

Eupatorium odoratum, Alnus nepalensis and Datura spp. which have some anti-microbial activities

and could be playing a role in disease suppression (Kumar et al., 2012). Kumar et al. (2012)

reported that S. wallichii and Datura spp. were the best mulches with regard to suppressing PSR

caused by P. aphanidermatum with disease incidence at 12 and 14%, respectively compared to 48%

in a control, non-mulched treatment.

Because Pythium spp. produce zoospores which are able to swim and spread in free water, Smith

and Abbas (2011) suggested that good water drainage is important in PSR control. Drain breaks that

are strategically placed across the field can intercept zoospores in surface water moving along beds

and interrows and save the field downslope from further infestation. The drain breaks have proven

to minimise losses to PSR (Fig. 2.4). Kim et al. (1998) also showed that PSR incidence was reduced

by around 70% in fields with narrow ridge cultivation, in comparison to a control, unridged field.

However, this practice was considered impractical since yield of the narrow ridge cultivated ginger

was half that of the control, unridged field. In addition to zoospore movement in water, Pythium

spp. can also be spread in soil adhering to vehicles, farm machinery, tools and footwear. Hence, it is

strictly required that all equipment subjected to Pythium spp. contamination must be disinfested

before entering and leaving a field to contain the spread of the pathogens responsible for PSR.


27

Fig 2.4: Ginger fields showing good drainage practice, a method which helps to minimize PSR

spread to adjacent paddocks. Drain breaks (arrow) helped stop the spread of P. myriotylum within a

ginger field leaving the bed with early PSR infection free of ginger allowing the rest of the paddock

to still produce a viable crop. [Photos courtesy of Rob Abbas, Consulting Pty. Ltd.]

2.9.4. Host plant resistance

Though, to some extent, PSR of ginger can be suppressed by chemical, biological and cultural

practices, the pathogens responsible for PSR can still lead to plant death or at the least yield losses.

While developing a Pythium resistant variety would be ideal, none of the available edible ginger

varieties are resistant to the causal agents (Nair and Thomas, 2013). Senapati and Sugata (2005)

screened of 134 ginger varieties available in Koraput, India and found one P. aphanidermatum

resistant cultivar and eight others with moderate resistance. However, these data were not supported

by other researchers around the country and it was reasoned that the resistant cultivar in this case

probably had a regional specific reaction against P. aphanidermatum. Thus, the search for a ginger

cultivar resistant to PSR continues.

Sterility and obligatory vegetative propagation of ginger (Nair and Thomas, 2013) continue to

hinder breeding efforts and edible ginger (Zingiber officinale) remains a monomorphic crop even in

the assumed centre of origin, India (Kizhakkayil and Sasikumar, 2011; Nair and Thomas, 2012). On

the other hand, wild Zingiber species exhibit both sexual and asexual reproduction, and therefore

offer the potential of introducing variability into the cultivated crop including potential resistance

traits (Kavitha and Thomas, 2008c). For example, Nair and Thomas (2007) indentified 42 resistant

gene candidates (RGC) belonging to non-toll-interleukin receptor nucleotide binding site leucine

rich repeat (TIR NBS-LRR) from ginger and wild Zingiber spp. More specifically in Z. zerumbet, a

putative soft rot resistant species, a pool of RGCs have been investigated by implementing mRNA


28

differential display analysis (Kavitha and Thomas, 2008a). However, as yet none of the

characterised R-genes from Z. zerumbet, have been able to improve resistance in edible ginger

cultivars by conventional breeding (Nair and Thomas, 2013). Nevertheless, ZzR1 gene involvement

in Z. zerumbet defence against PSR is believed to a valuable genomic resource for future Pythium

resistant ginger genetic improvement programs. Genetic transformation of ginger therefore offers

another area of research worth exploring.

2.9.5. Induced resistance

In the absence of genetic resistance to PSR, it may still be possible to offer effective control by

upregulating induced resistance mechanisms. Applications of certain chemicals or plant extracts

have been shown to activate a systemic resistance in susceptible plants (Agrios, 2005). Various

chemicals are implicated in this response including salicylic acid (SA) and Karmakar et al. (2003)

demontrated that treating seed ginger of a range ginger cultivars with SA and its analogs DL-β-

aminobutyric acid (BABA), and 2,1,3 benzothiadiazole (BTH) resulted in significant reduction in

subsequent PSR. This induction was associated with the upregulation of 3-5 induced resistant

proteins even 8 weeks after the SA treatments. Similarly, Kavitha and Thomas (2008b) found that

the highly susceptible ginger cultivar ‘Varada’ reacted positively to signalling chemicals including

SA, jasmonic acid (JA) and ethylene (ET) that resulted in induced resistance against P.

aphanidermatum. Interestingly, the non-susceptible Z. zerumbet showed no difference in the

response to these signalling molecules when treated (Kavitha and Thomas, 2008b). On the other

hand, genes responsible for a hypersensitive response and JA, SA, and ET biosynthesis were

themselves markedly upregulated in Z. zerumbet when it was inoculated with P. myriotylum, while

down regulation of these genes appeared in Z. officinale (Kiran et al., 2012).

In addition to chemical compounds, non-pathogenic strains of Pythium spp. and also herbal extracts

have been used to induce systemic resistance in ginger. Ghosh et al. (2006) observed that ginger

plants pre-inoculated with avirulent strains of P. aphanidermatum had reduced disease severity

when later challenged with a pathogenic strain; this reduction in PSR was shown to correlate with

an increase in expression of five particular defence proteins. Ghosh and Purkayastha (2003)

observed a similar increase in resistance to P. aphanidermatum when ginger rhizomes were pre-

treated with a dip comprised of six plant extracts. They concluded that 10% leaf extract of Acalypha

indica applied as a seed rhizome dip was effective protecting plants against PSR, as was treatment

with JA. Furthermore, seed ginger treated with 10% root extract of Boerhaavia diffusa followed by


29

three foliar sprays of the suspension at weekly intervals were found to lower PSR incidence

(Pandey et al., 2010).

2.10. Concluding remarks

There is no doubt that ginger plays an important economic role in many countries around the world

and its medicinal properties have increasingly drawn great attention. The plant is also host to more

than 20 different pathogens and among them Pythium spp. that cause PSR are the most troublesome

worldwide. Although fifteen Pythium spp. have been reported as ginger pathogens, some of them

may be synonymous with others. Therefore, species status and pathogenicity of some Pythium spp.

on ginger need to be re-examined. Although PSR in some countries is commonly associated with

bacterial wilt and Fusarium yellows and thus considered a disease complex, it seems that certain

species of Pythium by themselves are responsible for PSR of ginger. PSR of ginger can be complex,

so further work is necessary to determine interactions among Pythium spp. that cause PSR together

with other soilborne pathogens and pests of ginger. The diversity of Pythium spp. has made species

identification extremely difficult, especially with regard to morphological identification. Thanks to

advanced technologies, identification of Pythium spp. can be more accurate and reliable by

sequencing various gene loci such as ITS, LSU, SSU, CoxI, CoxII and β-tubulin. Other approaches,

namely RFLP, RAPD, SSR, q-PCR, ELISA and SDS-PAGE have been well proven as diagnostic

tools in identifying Pythium spp. With the recent development of LAMP for P. aphanidermatum

and P. myriotylum, this technique gives new hope for a quick and accurate means to detect

pathogenic species of Pythium in the field for farmers without the need to return the samples to a

lab. Unfortunately, current available reference sequences and the above techniques have not been

able to separate closely related species affecting ginger such as P. myriotylum and P. zingiberis.

With the new era of sequencing technology (next generation sequencing), the whole genome

sequence of single species can be easily and accurately obtained. Currently, several Pythium spp.

have been fully sequenced and deposited in Genbank. Hopefully, these freely available valuable

resources will be useful in finding a better gene region for differentiation of closely related species

or pathotypes. Many strategies including chemical, biological, cultural and induced resistance have

been proven to be promising in controlling PSR. However, the effectiveness of each of these

strategies by itself has not achieved effective levels of control in the field. Therefore, in order to

minimize losses caused by PSR in the field, it is necessary to integrate all applicable approaches.

Improving soil health by applications of BCAs, organic matter, minimum tillage, and the use of

suitable crop rotations should reduce the inoculum densities of pathogenic Pythium spp. as well as

lead to their suppression by increasing competition through enrichment in numbers and diversity of


30

beneficial microorganisms in the soil. At the same time such healthy soils should promote ginger

growth allowing the plant to cope better with both biotic and abiotic stress.

It will also be important to use certified clean seed and strategic applications of chemicals or plant

extracts to control PSR as part of an integrated program. Where PSR is observed in the field, spot

drenches can be helpful and subsequent good quarantine practice should avoid cross infections.

PSR can be controlled; however, the ultimate goal would be the development of PSR resistant

ginger cultivars and with recent success in R-gene isolation from a donor species Z. zerumbet, a

PSR resistant variety will hopefully be released in the near future.

Chapter 3 │Re-appraisal of P. zingiberis

31

Chapter 3 : COMPARISON OF MORPHOLOGY, GENETIC AND PATHOGENICITY OF

ISOLATES OF PYTHIUM MYRIOTYLUM AND PYTHIUM ZINGIBERIS 3

Abstract

Pythium myriotylum and P. zingiberis have both been implicated in soft rot of ginger (Zingiber

spp.). The status of these two taxa as distinct species follows original descriptions of physiology,

morphology and pathogenicity. However, their status has been questioned by phylogenetic analyses.

In this study, putative P. zingiberis isolates recovered from edible ginger (Zingiber officinale)

rhizomes with Pythium soft rot (PSR) disease sampled from Yandina, Sunshine Coast, Australia,

were compared with reference isolates of P. myriotylum from peanut in Israel (CBS254.70) and P.

zingiberis from ginger in Japan (NBRC30817). All isolates differed slightly in temperature optima

for growth and produced similar sizes of oogonia and oospores. Sequence homology of 20 gene

fragments retrieved from nuclear and mitochondrial genomes ranges from over 99 to 100% to each

other. In vitro pathogenicity assays were conducted on excised carrot, ginger, potato, radish, and

sweet potato tuber/root sections and on seeds and seedlings of cucumber, cauliflower, millet, rye,

sweet corn, tomato and wheat with each of the isolate. The reference isolate P. zingiberis

NBRC30817, which previously was believed to have a narrow host range, was pathogenic on a

number of tested plant species. Analysis of this comprehensive set of data allowed us to assign all

tested isolates, including the isolate P. zingiberis NBRC30817, to the taxon P. myriotylum thus

confirming that the causal pathogen of PSR disease of ginger in Australia is P. myriotylum.

Keywords: oomycete, morphology, molecular, Pythium soft rot, pathogenicity

3.1. Introduction

The genus Pythium belongs to the Phylum Oomycete (Webster and Weber, 2007) and contains over

300 species (www.mycobank.org). Identification and classification of Pythium spp. were

traditionally based on distinctive features of their sexual and asexual morphology (Dick, 1990;

Plaats-Niterink, 1981). However, it is well known that many Pythium spp. could not be

differentiated due to their close similarities in morphology (Moralejo et al. 2008). Moreover, the

same Pythium sp. may exhibit morphological differences due to difference in geography and host

3 This chapter was partly published as: Le, D.P., Aitken, E.A.B. and Smith, M.K., 2015. Comparison of host range and

pathogenicity of isolates of Pythium myriotylum and Pythium zingiberis, Acta Hortic. 1105, 47-54. DOI

10.1766/ActaHortic.2015.1105.1. The manuscript was modified to keep the format consistent through out the thesis.

http://www.mycobank.org/


32

range (Perneel et al. 2006). Consequently, Plaats-Niterink (1981) consolidated and questioned

species status of a number of Pythium spp. in her publication. More recently, with additonal aids of

freely available ITS (internal transcribed spacer) and CoxI (cytochrome c oxidase subunit 1)

sequences on Genbank, species boundaries of many closely related Pythium spp. have been

revealed. However, there are still a number of other species disignations that remain questionable

(Lévesque and De Cock, 2004; Robideau et al., 2011).

Species of interest within this study are P. myriotylum and P. zingiberis. P. myriotylum was

identified as a causal pathogen responsible for the Pythium soft rot (PSR) disease outbreaks within

the ginger industry in Queensland, Australia (Stirling et al., 2009). Nonetheless, the species status

of this P. myriotylum has been questioned since isolates of the P. myriotylum associated with the

PSR on ginger had a number of characters that were believed to be unique for P. zingiberis.

Although P. myriotylum and P. zingiberis have been accepted as two taxa (Dick, 1990; Ichitani and

Shinsu, 1980; Uzuhashi et al., 2010; Takahashi, 1954; Watanabe, 2010), their status as two

distinctive species needs a re-appraisal. P. myriotylum was first described in 1943 on tomato in the

USA, but has since been reported as having a wide host range worldwide (Plaats-Niterink, 1981).

Whereas P. zingiberis, originally reported from Zingiber mioga in Japan in 1954, has been recorded

as a pathogen on only a few host species (mioga, ginger and quiona) and restricted to Japan and

Korea (Takahashi, 1954; Yang et al., 1988).

Descriptions of P. myrtiotylum and P. zingiberis were originally based solely on morphological

differences, but recent DNA sequence analysis of the ITS region of the ribosomal gene complex and

the CoxI gene have shown these two species to be indistinguishable (Lévesque and De Cock, 2004;

Matsumoto et al., 1999; Robideau et al., 2011). However, to date there has not been a

comprehensive comparison of the morphology, physiology, molecular sequence and pathogenicity

of these two Pythium spp. In this study, we have re-examined international specimens of P.

myriotylum and P. zingiberis for their species status. In addition, we compared putative P.

zingiberis recovered from ginger in Australia with the international isolates of P. myriotylum and P.

zingiberis.


33

3.2. Materials and methods

3.2.1. Pythium spp. cultures

A reference culture of P. myriotylum CBS254.70 used in the monograph of Plaats-Niterink (1981)

(referred to as CBS254.70 here-after) were obtained from CBS-KNAW Fungal Biodiversity Centre,

The Netherlands. A reference isolate of P. zingiberis NBRC30817 (NBRC30817) which was

morphological confirmed by Ichitani and Shinsu (1980) was imported from the Biological Resource

Centre (NBRC), Japan. The isolates were imported into Australia under the permit number

IP13012598 issued by Department of Agriculture and Fisheries, Australia. Representative

Australian isolates include: putative P. zingiberis Gin1 (UQ5980) isolated from PSR ginger

sampled from Templeton farm in 2007 and P. zingiberis Gin2 (UQ6152) isolated from PSR ginger

sampled from Eumundi farm in 2013 in Queensland, Australia. All isolates were maintained on

PDA (Difco) for fresh working cultures. For long term storage, the cultures were placed on half

strength corn meal agar (CMA) prepared from maize meal (polenta), based on the protocol of

Dhingra and Sinclair (1995). The culture on the CMA was then submerged in autoclaved distilled

water (DW) and stored at room temperature.

3.2.2. Hyphal growth rate

The effect of temperature on daily hyphal growth rate of the five isolates was assessed on 9 cm Petri

plates at 5 °C intervals from 5 to 40 °C. Plugs (0.5 cm2) of actively growing one-week-old culture

were transferred onto PDA plates, using four plates per isolate. Plates were left at room temperature

for at least 8 hours for initial growth. The edge of the colony was marked, and then incubated at

each designated temperature for 24 hours. After 24 hours, the growing margins of the colonies

again were marked. The radius of the colony in mm from the first mark to the second mark was

measured at four locations and a mean radius calculated as the daily radial growth of for each

isolate.

3.2.3. Morphology

To observe morphological characteristics of each isolate, the grass leaf technique was deployed. For

this, a soil extract solution was prepared by soaking 20 g of air dried sandy soil in 1 L DW

overnight. The solution was filtered through 150 mm Whatman filter paper (No. 1), the filtrate was

made up to a volume of 1 L and autoclaved at 121 °C for 20 min (McLeod et al., 2009). Plugs of

each culture growing on PDA were submerged in a plate containing autoclaved soil extract to which

two pieces (1 cm2) of autoclaved grass leaves (Pennisetum setaceum) were added. The plates were

initially incubated at 27 °C for 2 days and then checked daily for the presence/absence of


34

sexual/asexual structures. The resultant mycelial mats also were mounted on microscopic slides,

stained with cotton blue, and observed under a BH2 (Olympus) microscope where measurements

were recorded of morphological structures at 400x magnification. For each isolate, 20 of each

morphological structure were arbitrarily selected and measured.

3.2.4. Sequencing

Each isolate was grown in potato broth for approximately one week when mycelial mats were

harvested for genomic DNA extraction using the CTAB protocol (Doyle and Doyle, 1990). The

DNA was sequenced using Illumina platform for whole genome sequences. Geneious 7.1.4 was

used to analyse the sequences. A reference annotated mitochondrial genome of P. ultimum BR114

was used as a template to identify conserved regions which were then retrieved and aligned for

sequence homogeny.

3.2.5. In vitro test of virulence on excised roots/tubers

The experiment was conducted based on descriptions of Le et al. (2010) with some modifications to

test how rapidly each isolates colonised and grew along ginger pieces at 27 °C. Fresh market ginger

rhizome, carrot root, radish, sweet potato and potato tubers were peeled and chopped into sticks (5.5

cm long x 1 cm wide x 1 cm high). These sticks were surface sterilized using 25% bleach (1%

HOCl) for 1 min, washed twice again with autoclaved DW for 1 min, and blotted dry on autoclaved

paper towels. Three sticks, representing three replications, were placed on moist sterile filter paper

in 9 cm Petri plates. Small squares, approximately 5 mm2 of 7-day-old cultures from the tested

isolates growing on PDA were excised and transferred to one end of each stick. After incubation for

3 days, each stick was cut up, the first 0.5 cm segment in contact with culture plug as removed, the

the remaining cut into five smaller pieces (1 x 1 x 1 cm) in sterile and the piece on which the

inoculum had been placed was removed. The remaining four pieces were plated on CMA + 3P

(50µg/ml Penicillin, 50µg/ml Polymyxin, 25µg/ml Pirmaricin) in order of distance from the

inoculated end of the sticks. Plates were incubated at the same temperature in the dark for 24 hours

and then observed for growth of the isolate from each piece was recorded. A negative control

treatment was conducted with the same procedure but with sterile PDA squares (no culture). The

data were recorded as the extent of Pythium spp. colonisation, indicating virulence of tested

Pythium spp. on the sticks from 0 (no colonisation corresponding to no virulence) to 5 (all 5 pieces

colonised corresponding to most virulent).


35

3.2.6. In vitro pre-emerging damping off

One-week-old cultures of each isolate growing on PDA were transferred onto 1.5% water agar

(WA) medium, with three 9 cm Petri plates for each isolate representing three replicates and kept in

an incubator set at 27 °C for a week. A negative control was also carried out with the same

procedure using non-colonized PDA. Seeds of common rotation crops grown in ginger fields such

as rye (Secale cereale), white millet (Panicum miliaceum), wheat (Triticum sp.) as well as vegetable

crops including cauliflower (Brassica oleracea botrytis), cucumber (Cucumis sativus), sweet corn

(Zea mays) and tomato (Solanum lycopersicum) were placed onto the WA plates (10 seeds/plate).

The seeds were washed under running tap water for a 2 min, soaked in distilled water for an hour,

surface sterilised with 25% bleach for 2 min, rinsed twice with autoclaved DW and then blotted dry

with autoclaved paper towels. The plates were incubated at 27° C for 5 days before rating for

disease. The disease index was calculated according to the formulation of Zhang and Yang (2000).

DI =∑ 𝑋𝑖/4010𝑖=1

DI is disease index scaling from 0 (all seedlings healthy after germination) to 1 (all seeds

dead before germination). DI indicates degree of virulence of Pythium on tested crops. DI =

0 corresponds to no virulence; DI = 1 corresponds to most virulent.

Xi is disease rating of the ith seed (from 1 to 10)

Number 40 is equal to the number of seeds multiplied with the highest rating scale (from 0

to 4).

Rating scale used in the experiment was: 0 = seed germinated and seedlings having no

visible symptoms; 1 = seed germinated with light browning on roots; 2 = seed germinated

with short and enlarging brown lesion on roots; 3 = seedlings died after germination; 4 =

seed not germinated.

All data were subjected to analysis of variance (ANOVA) using Minitab 16 program. Separation of

means was determined by Tukey’s least significant test (P ≤ 0.05).

3.3. Results

3.3.1. Radial growth rate

There was no growth for any isolate at 5 °C and all isolates grew best at temperatures from 25-35

°C. The optimal growth temperature for CBS254.70, NBRC30817, Gin1 and Gin2 were 25, 30, 35

and 35 °C respectively. Daily growth rate at 25 °C of CBS254.70, NBRC30817, Gin1 and Gin2

were 30.96, 25.03, 22.48 and 26.14 mm respectively. All isolates showed little growth at 40 °C

(Fig. 3.1), and stopped growth if kept at 40 °C for longer than 48 h.


36

Fig 3.1: Radial growth rate (mm) on PDA of P. myriotylum CBS254.70, P. zingiberis NBRC 30817

and two putative isolates of P. zingiberis recovered from PSR ginger at 5 °C intervals from 5 to 40

°C. Bars represent standard deviations of four means, P = 0.05 as determined by Tukey’s test.

3.3.2. Morphology

All cultures grew well on PDA and formed cottony colonies within a week at 25 °C. Hyphae were

hyaline, aseptae and up to 8 µm wide (Table 3.1). Finger-like appressoria formed abundantly in

singles or clusters in water cultures. Sporangia were filamentous inflated and up to 12 µm wide. All

isolates were homothallic; sexual structures formed abundantly on agar and water cultures. Smooth-

walled oogonia varied in size, ranging from 20 to 39 µm diam; however, the data were not

significantly different between isolates (P > 0.05). Gin1 produced the largest oogonia on average

(32.25 µm diam), while CBS254.70 produced the smallest ones on average (30.01 µm diam). Based

on the classical definition, oospores were mostly aplerotic, but occasionally, plerotic oospores were

also observed (Fig. 3.2). The largest oospores observed were the Gin2 culture, but on average

CBS254.70 produced larger oospores (26.06 µm diam) than NBRC30817 (22.15 µm diam). On old

cultures (> 2-week-old) of NBRC30817, Gin1 and Gin2, most oogonia were empty.

Antheridia were crook-necked and showed apical contact with oogonia. Two to six antheridia

wrapped around and attached to each oogonium. In some observations, the number of

antheridia/oogonium on Gin1 and Gin2 cultures could not be counted due to the complexity of

antheridia wrapping around an oogonium.

0.00

9.00

18.00

27.00

36.00

45.00

5 10 15 20 25 30 35 40

Gro

wth

ra

te (

mm

/da

y)

Temperature °C

CBS254.70 NBRC30817

Gin1 Gin2


37

Table 3.1: Morphologicala comparisons of sexual and asexual structures of P. myriotylum CBS254.70, P. zingiberis NBRC 30817 and two putative

isolates of P. zingiberis recovered from PSR ginger.

Isolates Hyphal width (µm)

Sporangiab

Oogonia

Antheridiac

Oosporesd

Characteristic Width (µm) Characteristic

Diameter

(µm) Characteristic

No. per

oogonium Characteristic Diameter (µm)

CBS254.70 2-8 (av. 5.4 ± 2.2) F, I 4-12 (av. 7.7

± 2.7)

Smooth 24-36 (av.

30.0 ± 4.0)

D, M (occ.) 3-6 (av. 4.4 ±

1.2)

A, P (occ.) 20-29 (av.

26.1 ± 3.6)

NBRC30817 2-8 (av. 4.5 ± 2.0) F, I 4-12 (av. 8.1

± 2.3)

Smooth 20-38 (av.

31.2 ± 5.7)

D, M (occ.) 2-6 (av. 3.9 ±

1.3)

A, P (occ.) 16-28 (av.

22.2 ± 5.0)

Gin1 2-8 (av. 4.8 ± 1.8) F, I 4-12 (av. 8.0

± 2.6)

Smooth 24-39 (av.

32.3 ± 4.0)

D, M (occ.) 2-8 (av. 4.2 ±

1.8)

A, P (occ.) 21-30 (av.

25.7 ± 3.7)

Gin2 2-8 (av. 5.4 ± 2.1) F, I 4-10 (av.

7.8 ± 2.8)

Smooth 20-36 (av.

31.4 ± 6.9)

D, M (occ.) 2-8 (av. 4.3 ±

1.8)

A, P (occ.) 18-32 (av.

24.5 ± 5.4)

a Each of the morphological characters presented here includes max, min and averaged (av.) values of 20 arbitrarily selected.

b Sporangia were assessed for their characteristics: filamentous (F), inflated (I), and the width.

c Antheridia were assessed for their characteristics: monoclinous (M), diclinous (D) (occ: occasionally), and the diameter.

d Oospores were assessed for their characteristics: aplerotic (A), plerotic (P) (occ: occasionally), and the diameter.


38

Putative P.

zingiberis Gin1

P. zingiberis

NBRC30817

P. myriotylum

CBS254.70

Clusters of

appressoria

Filamentous and

slightly inflated

sporangia

One or more coils

of antheridial

stalks around

oogonial stalks

Aplerotic oospores

Less occasionally

plerotic oospores

Fig 3.2: Morphological comparisons of putative P. zingiberis Gin1 isolated from PSR ginger in

Australia and reference isolates: P. zingiberis NBRC30817 and P. myriotylum CBS254.70 (Bar =

20 µm).


39

3.3.3. Sequence analysis

Twenty individual conserved loci within nuclear and mitochondrial genes were retrieved from

whole genome data for sequence alignments and comparisons. Sequence lengths varied from 389 bp

for the mitochondrial gene ATP synthase F0 subunit 8 (ATP8) to 3,778 bp for 28S rDNA (LSU), a

nuclear gene (data not presented). Pairwise comparisons of the loci revealed that sequence identity

among four isolates ranged from 99.24 to 100%, while sequence divergence based on Kimura 2-

parameter correction method ranged from 0 to 0.76% substitutions among the isolates regardless of

original identification of each isolates (Table 3.2). Sequences of CBS254.70 and NBRC30817

showed a high level of homology, ranging from 99.4 to 100% identity. All sequences of Gin1 and

Gin2, except for the actin locus isolates were 100% identical to each other.

A maximum likelihood tree constructed based on sequences of partly sequenced small and large

subunits and completely sequenced ITS genes of the isolates sequenced in this study and Genbank

sequence data of 24 Pythium spp. enabled separation P. myriotylum and P. zingiberis, which were

grouped together due to a high degree of genetic uniformity, from other lineages (Fig 3.3). A

similar well supported group of P. myriotylum and P. zingiberis isolates was also observed on ML

tree constructed from all aforementioned genes of these four isolates plus Genbank data combined

(Appendix 1).

Table 3.2: Pairwise comparisons for level of identity (%) among four isolates of Pythium;

sequences of nuclear and mitochondrial genes were extracted from whole genome data.

Genes Isolates CBS254.70 NBRC30817 Gin1 Gin2

Nucleara

SSU+ITS+LSU CBS254.70 99.94 99.92 99.92

NBRC30817 99.94

99.86 99.86

Gin1 99.92 99.86

100.00

Gin2 99.92 99.86 100.00

Actin CBS254.70 99.60 99.55 99.55

NBRC30817 99.60

99.72 99.72

Gin1 99.55 99.60

99.77

Gin2 99.55 99.60 99.77

Beta tubulin CBS254.70 99.67 99.67 99.67


40

NBRC30817 99.67

100.00 100.00

Gin1 99.67 100.00

100.00

Gin2 99.67 100.00 100.00

CoxI CBS254.70 99.87 99.40 99.40

NBRC30817 99.87

99.49 99.49

Gin1 99.40 99.49

100.00

Gin2 99.40 99.49 100.00

CoxII CBS254.70 99.74 99.31 99.31

Mitochondrialb

NBRC30817 99.74

99.57 99.57

Gin1 99.31 99.57

100.00

Gin2 99.31 99.57 100.00

CoxIII CBS254.70 99.87 99.54 99.54

NBRC30817 99.87

99.54 99.54

Gin1 99.54 99.54

100.00

Gin2 99.54 99.54 100.00

NAD1 CBS254.70 99.91 99.82 99.82

NBRC30817 99.91

99.72 99.72

Gin1 99.81 99.72

100.00

Gin2 99.81 99.72 100.00

NAD4L CBS254.70 99.44 99.43 99.43

NBRC30817 99.44

99.44 99.44

Gin1 99.43 99.44

100.00

Gin2 99.43 99.44 100.00

mtSSU CBS254.70 99.66 99.54 99.54

NBRC30817 99.66

99.43 99.43

Gin1 99.54 99.43

100.00

Gin2 99.54 99.43 100.00


41

mtLSU CBS254.70 99.78 99.67 99.67

NBRC30817 99.78

99.67 99.67

Gin1 99.67 99.67

100.00

Gin2 99.67 99.67 100.00

ATP1 CBS254.70 99.82 99.51 99.51

NBRC30817 99.82

99.45 99.45

Gin1 99.51 99.45

100.00

Gin2 99.51 99.45 100.00

ATP8 CBS254.70 100.00 100.00 100.00

NBRC30817 100.00

100.00 100.00

Gin1 100.00 100.00

100.00

Gin2 100.00 100.00 100.00

NAD5 CBS254.70 99.76 99.58 99.58

NBRC30817 99.76

99.58 99.58

Gin1 99.58 99.58

100.00

Gin2 99.58 99.58 100.00

NAD6 CBS254.70 99.73 99.87 99.87

NBRC30817 99.73

99.87 99.87

Gin1 99.87 99.87

100.00

Gin2 99.87 99.87 100.00

RPS2 CBS254.70 99.55 99.89 99.89

NBRC30817 99.55

99.44 99.44

Gin1 99.89 99.49

100.00

Gin2 99.89 99.49 100.00

RPS16 CBS254.70 99.79 99.79 99.79

NBRC30817 99.79

99.59 99.59

Gin1 99.79 99.59

100.00


42

Gin2 99.79 99.59 100.00

RPS14 CBS254.70 100.00 100.00 100.00

NBRC30817 100.00

100.00 100.00

Gin1 100.00 100.00

100.00

Gin2 100.00 100.00 100.00

RPS4 CBS254.70 99.43 99.24 99.24

NBRC30817 99.43

99.43 99.43

Gin1 99.24 99.43

100.00

Gin2 99.24 99.43 100.00

a Nuclear gene includes: small (SSU) and large subunit (SLU) of rDNA.

b Mitochondrial gene includes: cytochrome c subunit (Cox), NADH dehydrogenase subunit (NAD),

ATP synthase subunit (ATP), ribosomal protein (RPL or RPS).


43

Fig 3.3: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. using

DNA sequences encoded from the small and large subunits and the ITS region of nuclear genome

(length above 4000 bp). The numbers at the nodes are the percentage of the trees from bootstrap

analysis (1,000 replications) (only bootstrap values greater than 50% are displayed). All sequence

data were retrieved from Genbank, except for the sequence data of P. myriotylum and P. zingiberis

with asterisk which were obtained from whole genome data in this study.


44

3.3.4. In vitro test of virulence on excised roots/tubers

In general, isolates Gin1 and Gin2 were more virulent, colonized more of host tissue in 3 days, than

NBRC30817 and CBS254.70 (Table 3.3). Moreover, ginger and carrot tissue were most susceptible

to colonization by Gin1 and Gin 2, followed by potato and then sweet potato. Radish was not

colonized by Gin 1, Gin 2 or CBS254.70.

Table 3.3: Virulencea at 3 days after inoculation of four Pythium isolates colonising on excised

tubers/roots of five crop species

Pythium isolates Ginger Carrot Radish Sweet potato Potato

CBS254.70 1.0 b 0.7 c 0.0 b 0.0 b 2.7 a

NBRC30817 5.0 a 3.3 b 1.7 a 0.0 b 2.0 ab

Gin1 5.0 a 5.0 a 0.0 b 3.7 a 3.7 a

Gin2 5.0 a 5.0 a 0.0 b 3.0 a 3.7 a

Control 0.0 c 0.0 c 0.0 b 0.0 b 0.0 b

Values followed by different letters within a column show a statistically significant difference at the

5% - levels as determined by Tukey’s test.

a Virulence of the four Pythium isolates was assessed based on the number of excised tubers/roots of

five crops species colonised in 3 DAI. It rated from 0 = no colonisation corresponding to no

virulence to 5 = all five excised pieces colonised corresponding to most virulent.

The NBRC30817 isolate was highly virulent on ginger sticks, which were colonized fully by

NBRC30817 within 3 DAI. It was also quite aggressive on other plant tissue too, except for sweet

potato. Interestingly, NBRC30817 was the only isolate which was able to colonize radish sticks

although it was just mildly pathogenic, colonizing 1.67 cm of 5.5 cm long sticks within the 3-day-

period. The CBS254.70 isolate was not able to colonise radish and sweet potato sticks and slowly

colonised ginger and carrot sticks. Potato was the only susceptible tested material to CBS254.70

colonisation.

3.3.5. In vitro pre-emerging damping off

Although the disease indices in the non-inoculated controls were greater than zero, an indication

that germination was not 100%, they were significantly different from other treatments (P ≤ 0.05)

(Table 3.4). For those germinated, the seedlings grew normally showing no obvious lesions or

discolourations recorded in the control. The results in this assay again showed that the Gin1, Gin2

and NBRC30817 isolates were highly virulent (disease index > 0.5) on all tested plant species,


45

while the CBS254.70 isolate was highly virulent on only wheat and rye. The Gin1 and Gin2 isolates

were the most virulent on the tested plant species (disease index > 0.75) and were significantly

different from the least virulent, the CBS254.70 isolate. The NBRC30817 isolate was pathogenic on

all seeds and seedlings of tested plant species, except for cucumber.

Table 3.4: Disease indices (0-1) showing the virulence of four Pythium isolates on different crops

Pythium isolates Wheat Millet Rye Cucumber Tomato Cauliflower Sweet corn

CBS254.70 0.5 b 0.3 b 0.6 b 0.1 c 0.4 b 0.2 b 0.2 ab

NBRC30817 0.8 ab 0.7 a 0.7 ab 0.5 b 0.8 a 0.4 ab 0.3 a

Gin1 0.9 a 0.9 a 0.9 a 0.9 a 0.8 a 0.7 ab NT

Gin2 0.9 a 1.0 a 0.9 a 0.9 a 0.9 a 0.8 a NT

Control 0.1 c 0.0 c 0.1 c 0.0 c 0.1 b 0.1 b 0.1 b


5% - levels as determined by Tukey’s test.

3.4. Discussion

Since 2007 P. myriotylum isolates have been collected from different ginger farms in Queensland,

Australia where PSR has been reported, these isolates have exhibited various sizes of oogonia,

oospores and temperature responses. This variation resulted in doubts about the species status of P.

myriotylum reported by Stirling et al. (2009). Following studies by this author and myself on P.

myriotylum isolates recovered from PSR infected rhizomes on ginger farms in Australia was

reconsidered to be P. zingiberis according to the descriptions of Takahashi (1954) and the key of

Dick (1990). Plaats-Niterink (1981) had considered P. zingiberis as a synonymous species with P.

volutum, but in fact according to the descriptions of these two species, they are distinct in oogonial

size and temperature response (Dick, 1990; Takahashi, 1954). Additionally, ITS sequences were

clearly different between P. zingiberis and P. volutum (Lévesque and De Cock, 2004; Matsumoto et

al., 1999). Lévesque and De Cock (2004) and Matsumoto et al. (1999) found that P. myriotylum

was more similar to P. zingiberis than P. volutum based on the ITS sequence. Recently, Robideau et

al. (2011) have sequenced the CoxI locus and showed that the locus allowed separation of closely

related Pythium spp. such as P. catenulatum and P. rhizo-oryzae, as well as P. graminicola, P.

perrilum and P. tardicrescens, all of which could not be differentiated by ITS sequence analysis.

However, the CoxI locus was not able to be used to distinguish between P. myriotylum and P.

zingiberis (Robideau et al. 2011). This is the first study to comprehensively compare of the

morphology, physiology, molecular sequences and pathogenicity of the species P. myriotylum and


46

P. zingiberis (Uzuhashi et al., 2010; Watanabe, 2010). This study has re-examined the reference

isolates of P. myriotylum CBS254.70 and P. zingiberis NBRC30817 and included two putative P.

zingiberis isolates recovered from PSR infected rhizomes in Australia.

Comparisons of original descriptions of Drechsler (1930) and Dick (1990) for P. myriotylum and

Takahashi (1954) for P. zingiberis reported that P. myriotylum produces smaller oogonia and

oospores than those of P. zingiberis. However, Wantanabe (2010) reported oogonia and oospores of

P. myrioytlum were larger than those of P. zingiberis. In our study, we observed that P. myriotylum

CBS254.70 had slightly smaller oogonia, but produced larger oospores than those of P. zingiberis

NBRC30817. For putative P. zingiberis Gin1 and Gin2 collected from the field in this study,

smaller oospores and bigger oogonia than those of the reference isolates were observed. P.

myriotylum and P. zingiberis were reported to have aplerotic and plerotic oospores, respectively, but

Ho (2011) also observed plerotic oospores on P. myriotylum and similarly, Wantanabe (2010)

observed aplerotic oospores on P. zingiberis. Interestingly, in most cases the presence of aplerotic

oospores, which is based on a classic definition that oospores do not completely fill oogonia, was

recorded in our observations, but occasionally the presence of plerotic oospores was also noticed for

both reference species and our isolates. Broom-like appressoria, which were believed to be typical

for P. myriotylum, were also observed in the reference P. zingiberis NBRC30817 as well as in our

putative P. zingiberis isolates although the appressorial cluster sizes were slightly different (data not

presented). Likewise, coiling stalks of antheridia around oogonial hyphae, which were reported only

on P. zingiberis, were occasionally recorded on both of the reference isolates and our isolates. Other

taxonomic characters, including filamentous, lobulated sporangia and number of antheridia/oogonia

were very similar in all the isolates.

Both P. myriotylum and P. zingiberis were reported to grow best at temperatures above 30 °C

(Drechsler, 1930; Takahashi, 1954; Plaats-Niterink, 1981). P. myriotylum CBS254.70 was reported

to grow best at its optimal temperature, 37 °C (Plaats-Niterink, 1981), but in this study, the

optimum growth rate occurred at 25 °C, and the growth rate dropped significantly once the

temperature was increased. This may have been due to the long term storage of the reference

specimen. P. zingiberis NBRC30817 had a reported temperature optimum at near 34 °C (Ichitani

and Shinsu, 1980), but in this study it exhibited fastest growth at 30 °C. The putative P. zingiberis

isolates obtained from PSR ginger in this study grew particularly well at high temperature and

exhibited best growth at 35 °C. Although temperature responses were considered a good additional

taxonomic criterion for Pythium identification (Gilbert et al., 1995), it has been argued that this


47

taxonomic feature is not very reliable for species separation in the Pythium genus (Matsumoto et al.,

2000; Perneel et al., 2006).

Although there were some variations in morphology and physiology of P. myriotylum and P.

zingiberis, the two species shared a continuum of most taxonomic characteristics. Interestingly,

morphological and physiological differences were also noticed within a species of P. ultimum (Al-

Sheikh and Abdelzaher, 2010; Barr et al., 1996; Tojo et al., 1998) and P. irregulare (Barr et al.,

1997; Spies et al., 2011). Historically, taxonomists described and identified new species based

solely on physiological and morphological differences, but it is without doubt that there are many

limitations with this conventional classification method, including external conditions used for

producing morphological characters, requirements of time, expertise knowledge and proper data

access and assessments. De Cock et al. (1987) officially renamed P. gracile as P. insidiosum after a

thorough re-examination of isolates of P. gracile and P. insidiosum. Similarly, P. jasmonium was

re-identified as P. brassicum by Stanghellini et al. (2014) through studies of morphology, genetic

and pathogenecity. Use of molecular technologies along with morphological and physiological data

have enables a more thorough understanding of Pythium species.

In most cases Pythium spp. can be identified by their morphology and the ITS sequences.

Unfortunately, it was difficult for us to differentiate reference isolates of P. myriotylum, P.

zingiberis and our isolates of putative P. zingiberis using ITS sequence analysis due to their high

degree of genetic similarities (99.88-100% identity). Although the ITS sequence analysis is now

used worldwide for Pythium identification, but in many cases, species boundaries have not been

revealed by the ITS locus solely (Lévesque and De Cock, 2004; Robideau et al., 2011). Twenty

additional loci of nuclear and mitochondrial genes extracted from the whole genomic DNA

sequences were above 99 to 100% homology among all isolates, suggesting that among the studied

isolates of P. myriotylum and P. zingiberis there were either fine or no polymorphisms that might be

present in the analyzed loci. Martin (2000) found that sequence divergence among isolates within a

single Pythium species generally varied from 0% to 0.88% substitutions, but in some species, a

higher degree of nucleotide substitution occurred. Sequences of multiple DNA loci provide strong

evidence to confirm species status of very closely related Pythium spp., for example P.

cryptoirregulare from P. irregulare (Garzón et al., 2007), P. recalcitrans from P. sylvaticum

(Moralejo et al., 2008), and P. phragmiticola from P. phragmitis (Nechwatal and Lebecka, 2014).

In addition to morphology and physiology, the additional molecular evidence from this research

justifies our reason to combine P. myriotylum and P. zingiberis into one taxon. The P. myriotylum


48

taxon should be retained since P. myriotylum was first officially described in 1930 by Drechsler

(1930), while P. zingiberis was described later in 1954 by Takahashi (1954). Like many other

oomycetes such as Phytopythium (Pp.) helicoides, Pp. mercuriale and Ph. citrophthora (Belbahri et

al., 2008; Kageyama et al., 2007; Spies et al., 2014), Pythium myriotylum should be considered to

be a single phylogenetic species. From the evidence provided here we recommended that P.

zingiberis NBRC30817 should be re-assigned to P. myriotylum taxon. Additionally, the putative P.

zingiberis isolates recovered from PSR ginger in Australia should be identified as P. myriotylum. It

is obvious that Pythium is a taxonomical complex and with recent evidence supporting the

occurrence of natural outcrossing in Pythium spp. (Francis and St Clair, 1993; Harvey et al., 2001;

Nechwatal and Lekecka, 2014), it might pose a new challenge to taxonomic issues due to genetic

exchanges resulting in possible divergent phyto-, patho- and eco-types (Nechwatal and Lekecka,

2014). Therefore, apart from thorough analyses of morphology and molecular phylogenetics,

ecology and pathogenicity should also be exclusively assessed for species assignations in Pythium.

In this study, the species identification and consolidation reported are also supported by the in vitro

host range assays on both excised materials and seedlings. Although the P. myriotylum isolate

CBS254.70 appears to have lost some of its virulence, the wide host range of P. myriotylum has

previously been recorded worldwide (Plaats-Niterink, 1981). NBRC30817, Gin1 and Gin2 were

pathogenic to almost all tested materials, indicating that these isolates had a wide host range

spectrum as has been reported previously for P. myriotylum. In this study, we did not attempt to find

relationship between in vitro tests and pot trials due to limitations of working with quarantined

isolates. However, Pettitt et al. (2011) found a close correlation between the pathogenicity of

Pythium spp. on a detached leaf assay and root rot of chrysanthemum in a pot trial. Similarly, Zhang

and Yang (2000) found a significantly positive correlation in the disease index between the Petri

plate assays and the pot trials. Thus, the results in this study will provide good indicators for future

assays.

In conclusion, P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were consolidated under

the name of P. myriotylum resulting based on data from our morphology, molecular sequences and

pathogenicity studies. Subsequently, the doubtful status of P. myriotylum isolates recovered from

PSR ginger in Australia was also addressed by exclusive comparisons with the international

reference isolates. Although there were limited numbers of reference isolates involved in this study,

these appeared to be the most reliable cultures alive for species identification. To some extent,

minor differences in temperature responses and certain analysed loci of Australian isolates


49

compared to reference ones could account for different levels of aggressiveness and pathogenicity

to ginger plants; therefore, further pot trials for Australian isolates under various tested regimes will

be warranted. Additionally, based on subtle changes of some loci, either applying current available

detection techniques or developing new ones for fast and accurate detection will be worth pursuing

to monitor the PSR pathogen. Since the first report in 2009, PSR of ginger has remained a major

constraint for Australian ginger production. It is also necessary to have an assessment for Pythium

spp. diversity on Australian ginger farms as to determine if other Pythium spp. might be involved in

PSR on ginger in Australia.

Chapter 4 │Pythium spp. associated with PSR ginger

50

Chapter 4 : CHARACTERISATION OF PYTHIUM SPP. ASSOCIATED WITH SOFT ROT

DISEASE OF GINGER (ZINGIBER OFFICINALE) IN QUEENSLAND,

AUSTRALIA4

Abstract

In Australia, Pythium soft rot (PSR) outbreaks caused by P. myriotylum were reported in 2009 and

since then this disease has remained as a major concern for the ginger industry. From 2012 to 2015,

a number of Pythium spp. was isolated from ginger rhizomes and soil from farms affected by PSR

disease and assessed for their pathogenicity on ginger. In this study, 11 distinct Pythium spp. were

recovered from ginger farms in Yandina, Sunshine Coast, Australia and species identification and

confirmation were based on morphology, growth rate and ITS sequences. These Pythium spp. when

tested showed different levels of aggressiveness on excised ginger rhizome. P. aphanidemartum, P.

deliense, P. myriotylum, P. splendens, P. spinosum and P. ultimum were the most pathogenic when

assessed in vitro on an array of plant species. However, P. myriotylum was the only pathogen,

which was capable of inducing PSR symptoms on ginger at a temperature range from 20 to 35 °C.

Whereas, P. aphanidermatum only attacked and induced PSR on ginger in pot trials at the high

temperature range of 30 to 35 °C. This is the first report of P. aphanidermatum inducing PSR of

ginger in Australia at high temperatures. Only P. oligandrum and P. perplexum, which had been

recovered from soils and not plant tissue, appeared non-pathogenic in all assays.

Key words: Zingiber officinale, oomycete, Pythium soft rot, PSR, ginger rhizome, host range

4.1. Introduction

Ginger (Zingiber officinale Rosc.), belonging to the Zingiberaceae, is a cash crop for many growers

in various countries including China, India, Indonesia, Fiji and Australia (Kavitha and Thomas,

2008). In Australia, ginger was introduced as a crop in the early 20th

Century and has been

cultivated on the Sunshine Coast, Queensland since 1916 (Hogarth, 2000). Presently, production

extends from Gatton to Bundaberg in southeast Queensland, but the Australian ginger industry is

relatively small (less than 1% contribution to global share) with an involvement of around 30 full

time growers. Nevertheless, it was worth AUD 15.6 million at the farm gate in 2009 (Camacho and

4 This chapter was published as Le, D.P., Smith, M.K., Aitken, E.A.B., 2016. An assessment of Pythium spp. associated

with soft rot disease of ginger (Zingiber officinale) in Queensland, Australia. Australas. Plant Pathol.

DOI 10.1007/s13313-016-0424-5. The manuscript was modified to keep the format consistent through out the thesis.


51

Brescia, 2009) with an annual production estimated at about 8,000 tonnes. Almost half of this

production is delivered to the domestic fresh market with the remainder going for processing inside

the world’s largest ginger factory, Buderim Ginger Ltd. (Camacho and Brescia, 2009).

Pythium soft rot (PSR) of ginger was first reported around a century ago in India by Butler (1907)

and has since been problematic in most ginger growing regions worldwide (Dohroo, 2005). The

disease caused by any one of a number of Pythium spp. (Dohroo, 2005) is of most concern due to

the destructiveness and aggressiveness of the pathogens on ginger. Losses generally vary from 5-

30%, but in some cases they can be up to 100% in fields where conditions conducive for disease

development, such as water logging and high temperatures, are reached (Stirling et al., 2009). Once

ginger fields have been infested with Pythium spp., the persistence of the pathogens leads to PSR in

subsequent replanting of ginger in these fields, as reviewed in chapter 2.

In Australia, Pythium spinosum was recorded on ginger as early as 1962 by Teakle (1962), but it

was considered a secondary pathogen to Fusarium oxysporum, the causal agent of Fusarium

yellows. During 2007, a PSR disease outbreak on ginger in the Sunshine Coast of Australia was

attributed to Pythium myriotylum (Stirling et al., 2009) which at the time was considered to be a

ubiquitous pathogen with a wide host range and consequently the relevance of the PSR outbreak

may have been underestimated. However, PSR has since then continued to be a major constraint for

the Australian ginger industry with up to 70% of the surveyed growers in 2015 admitting to have

PSR infestation on their farms (T. Pattison pers. comm.). Therefore, it was questioned if there was

possibly more than one Pythium species/strains associated with PSR on ginger in Australia.

Following the first report of PSR on two of the oldest ginger farms in in Australia (Stirling et al.,

2009), PSR disease was observed on at least 11 other nearby farms. Consequently, questions

regarding to dispersal of the pathogen were also raised if the pathogen has been spread from the

original infested farms. In this study, PSR ginger rhizome samples and soil samples from around

infected ginger plants were collected from 13 infested farms in Queensland, Australia for Pythium

isolation, and the phenotypic and genotypic diversity among isolates was compared.


4.2.1. Pythium isolation and cultures

Diseased ginger rhizomes were sampled from 13 farms in Yandina, Sunshine Coast. Isolations were

undertaken by excising sections (5 mm2) of rhizome containing both healthy-looking and PSR


52

symptom tissue, quickly surface decontaminating (around 10 seconds) with 25% bleach (1%

HOCl), then washing twice with sterilized distilled water (DW), and blotted dry with autoclaved

paper towel. The sections were then transferred on to Petri plates with corn meal agar with an

amendment of 50µg/mL Penicillin, 50µg/mL Polymyxin, and 25µg/mL Pirmaricin (CMA + 3P).

The Petri plates were incubated in the dark overnight at 27 °C, then sections taken from the growing

edge of the colonies were transferred onto 1.5% water agar (WA), incubated again under the same

conditions for another night, after which hyphal tips of each of the isolates were excised out under

an inverted compound microscope (Leica) and placed onto full strength potato dextrose agar (PDA,

Difco).

In addition, a baiting technique based on Stanghellini and Kronland (1985) was used to recover

Pythium spp. from the bulk soil samples collected from around ginger that was showing symptoms

of PSR. Briefly, a total 10 grams of putatively infested soil in a 9 cm Petri plate was saturated with

DW. Excised pieces (2 cm2) of apparent healthy ginger rhizomes were immersed in 25% bleach for

1 min, rinsed twice with autoclaved DW, and blotted dry with autoclaved paper towels. Ten of these

excised ginger pieces were then placed onto the soil sample in each plate. On the top of each ginger

piece, a plug (5 mm2) of WA was placed. The plates were incubated at 27 °C for 2-4 days. The WA

plugs were then transferred onto 1.5% WA for single hyphal tip isolation.

In addition to representative isolates of each of Pythium spp. recovered in this study, reference

specimens of P. myriotylum CBS254.70 and P. zingiberis NBRC30817, as well as P. myriotylum

UQ5993 recovered from sudden wilt capsicum in Australia were also included in this study for the

pot trial assay only. Work with the reference isolates was undertaken in quarantine approved

premises as required by quarantine law for the overseas cultures. For storage, all cultures were

placed on half strength corn meal agar (CMA) prepared from maize meal (polenta), based on the

protocol of Dhingra and Sinclair (1995). The culture on the CMA was then submerged in

autoclaved DW and stored at room temperature for future use.

4.2.2. Hyphal growth rate

For each Pythium spp., daily mycelial growth rate at 5 °C intervals under a temperature range from

5 to 45 °C was assessed on 9 cm Petri plates as described by Le (2010). Briefly, 0.5 cm2 plugs of

tested cultures (one-week-old) were subcultured onto PDA contained in Petri plates. Two plates

were used for isolate, representing two replicates. After subculturing, initial growth of the cultures

were standardised by leaving the plates at room temperature for at least 8 h. The initial growing


53

edges were marked and the marked plates were incubated at each designated temperature for 24

hours. After 24 h of incubation, the second growing edges were marked; radial growth of the

colonies was measured at four points in mm using two transecting lines from the first mark to the

next. Daily growth rate was calculated as a mean of the four measurements. The growth rates were

assessed at each of the designated temperature twice.

4.2.3. Morphology

Sexual and asexual structures of Pythium spp. were produced in soil extract cultures amended with

two pieces (1 cm2) of grass leaves (Pennisetum setaceum). To make the soil extract, 20 g of air-

dried sandy soil was soaked in 1 L DW overnight. The suspension was filtered through 150 mm

Whatman filter paper (No. 1), and the filtrate was made up to a volume of 1 L with DW and

autoclaved at 121 °C for 20 min (McLeod et al., 2009). Active growing cultures of Pythium spp. on

PDA were excised and the plugs (0.5 cm2) were submerged into the soil extract cultures contained

in Petri plates. The plates were kept at 27 °C and checked daily for development of taxonomic

characteristics. The resultant mycelial mats were mounted on microscopic slides, stained with

cotton blue, and observed under a BH2 (Olympus) microscope where measurements were recorded

of morphological structures at 400x magnification. For each isolate, 20 arbitrarily selected

structures were measured.

4.2.4. DNA extraction and amplification

The CTAB protocol of Doyle and Doyle (1990) was employed to extract DNA from mycelia mats

growing in potato dextrose broth. The ITS regions including the 5.8S rRNA subunit were amplified

in a Mastercycler by using two primers: ITS 1 (5’-TCCGTAGGTGAACCTGCGG-3’) and ITS 4

(5’-TCCTCCGCTTATTGATATGC-3’) (White et al., 1990). In every 20 µL PCR reaction, there

was 1 µL of DNA template (25 ng/µL) and 19 µL of master mix, the latter which included 0.18 µL

of Taq DNA polymerase (5 u/µL), 1 µL of primer ITS1 and primer ITS4 each (10 µM), 2.83 µL of

5X Green GoTaq flexi buffer, 0.72 µL of 25 mM MgCl2, 1.05 µL of 10 mM dNTPs and 13.2 µL of

dH2O. The reaction cycle was denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for

30 s, 55 °C for 30 s, and 72 °C for 90 s. The reaction was finally extended for 10 min at 68 °C.

The CoxI gene was amplified by using a primer set of OomCoxILevup (5’-

TCAWCWMGATGGCTTTTTTCAAC-3’) and Fm85mod (5’-

RRHWACKTGACTDATRATACCAAA-3’) (Robideau et al., 2011). The reaction cycle for CoxI


54

included a first step at 95 °C for 2 min, followed by 35 cycles of 95 °C for 1 min, 55 °C for 1 min,

72 °C for 1 min The reaction was finally extended for 10 min at 72 °C.

The CoxII gene was amplified by using two primers: FM66 (5’ TAGGATTTCAAGATCCTGC 3’)

and FM58 (5’ CCACAAATTTCACTACATTGA 3’) (Martin, 2000). The reaction cycle was

denaturation for 5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C

for 90 s. The reaction was finally extended for 10 min at 68 °C.

To amplify the β-tubulin gene, two primers TUBUF2 (5′ CGGTAACAACTGGGCCAAGG 3

′) and

TUBUR1 (5′ CCTGGTACTGCTGGTACTCAG 3

′) were used (Kroon et al., 2004). The cycling

program was based on descriptions of Mu et al. (1999) with some modifications. The reaction cycle

was first denatured for 5 min at 94 °C, followed by eight cycles of 94 °C for 1 min, 52 °C for 1 min,

and 72 °C for 2 min. The reaction was then continued with another 22 cycles of 94 °C for 1 min, 62

°C for 1 min, 72 °C for 2 min. The program was completed with a 7 min step at 72 °C. All PCR

products were run at 110 V in a 1.5% agarose gel for 40 min to confirm the presence of an

amplified product.

4.2.5. Sequencing and analysing sequences

Both forward and reverse directions were sequenced directly from PCR products by Macrogen

(Korea) and the consensus sequences were created after manual alignment and comparison using

Clustal 2.0.2. Geneious 7.1.4 was used to align the sequences of the Pythium isolates collected from

ginger fields. Comparisons were made among the sequences in this study with those of deposited

sequences in Genbank to confirm species identification and determine whether there were any

genetic variations. A maximum likelihood (ML) tree of the ITS region was drawn to assess the

phylogenetic relationship among the isolates and species. Additional ML trees of the CoxI, CoxII

and β-tubulin were also constructed for genotypic studies.

4.2.6. Pathogenicity tests

In vitro pathogenicity test on excised ginger sticks

The experiment was adapted from methods described in chapter 3 to test for colonization and

aggressiveness of Pythium spp. on ginger pieces at 27 ± 2 °C. Briefly, disease free ginger rhizomes

were cut into sticks (5.5 cm long x 1 cm wide x 1 cm high), which were surface disinfected in 25%

bleach (% HOCl) for 1 min, washed twice again with autoclaved DW for another min, and blotted

dry on autoclaved paper towels. Three replicate sticks were prepared for each isolate by plating


55

together in 9 cm Petri plates containing wet autoclaved filter paper. The sticks were inoculated by

placing small squares (0.5 cm2) of active growing Pythium cultures on PDA at one end of each

ginger stick. Three days after incubation, each stick was chopped up into five smaller pieces (1 x 1

x 1 cm) under sterile conditions which were then plated (except for the one end containing the

culture) onto PDA in a Petri plate in order of distance from the inoculated end of the ginger sticks.

These plates were then incubated at the same temperature in the dark for 24 h and observed for

recovery of Pythium spp. from each excised piece. The negative control treatment included the

same procedure but with uninoculated PDA squares (non-cultured). The data were recorded

determining the colonization of Pythium spp. to 1, 2, 3, 4 or 5 cm sections on the ginger sticks,

which corresponds to the virulence of Pythium isolates. The assay was independently repeated.

In vitro pre-emerging damping off test

The pathogenicity of the Pythium spp. was assessed by screening seedlings of 13 plant species in

Petri plates against cultures of each isolate. For each isolate-plant species interaction assessed, a

one-week-old culture that had been grown on PDA was sub-cultured onto three replicate 9 cm Petri

plates of 1.5% WA, and kept in an incubator set at 27 °C for a week. On each WA plate, ten surface

disinfected seeds were placed one of the following 13 plant species: rye (Secalecereale), wheat

(Triticum sp.), millet (Panicum miliaceum), barley (Hordeum vulgare), buck wheat (Fagopyrum

esculentum), beet-root (Beta vulgaris), spring onion (Allium fistulosum), carrot (Daucus carota),

cauliflower (Brassica oleracea botrytis), cucumber (Cucumis sativus), eggplant (Solanum

melongena), lettuce (Lactuca sativa), and gypsophila (Gypsophila elegans). The plates were then

incubated at 27 °C for 7 days before assessing disease indices. The disease index was calculated

using the equation of Zhang and Yang (2000).

DI =∑ 𝑋𝑖/4010𝑖=1

- DI is disease index rating from 0 (all seedlings healthy after germination) to 1 (all seeds

dead before germination). DI indicates degree of virulence of Pythium on tested crops. DI =

0 corresponds to no virulence; DI = 1 corresponds to most virulent.

- Xi is disease rating of the ith

seeds (from 1 to 10).

- 40 is equal to the number of seeds multiplying with the highest rating scale (from 0 to 4).

- The rating scale used was as follows: 0 = seed germinated and healthy seedlings with no

obvious symptoms; 1 = seed germinated and seedlings with light brown lesion on roots; 2 =


56

seed germinated and seedlings with short and enlarging brown lesion on roots; 3 = seedlings

died after germination; 4 = seed died with no apparent germination.

Glasshouse pathogenicity test on ginger plants

Ginger (cv ‘Queensland’) plants derived from tissue culture were used in pot trials to assess their

reaction to a subset of Pythium spp. isolates. Inoculum for pot trials was prepared using sorghum

seeds that had been soaked in water for 24 h in the dark and autoclaved twice at 121 °C for 20 min.

The sorghum seeds were then plated onto 1 to 2-day-old Pythium cultures grown on PDA in Petri

plates and kept at 27 °C for a week or until the seeds were fully covered with mycelia of Pythium.

For each isolate of Pythium spp. tested, ginger plants (50 cm high or more) that had been grown in

140 mL pots were inoculated with two sorghum seeds, which were fully colonized with Pythium

spp. The pots of inoculated ginger were kept saturated with water from time of inoculation onwards

by placing on saucers where the water was maintained. Plants were monitored daily for disease

development based on aboveground symptoms applying the following scale: 0 = plants remain

green and healthy; 1 = leaf sheath collar discoloured and lower leaves turned yellow; 2 = plants

alive, but shoots either totally yellow or dead; and 3 = all shoots dead (Stirling et al., 2009).

Attempts were made to re-isolate the Pythium spp. either from diseased rhizomes or from soil, in

the latter case by baiting with carrot pieces placed on the soil. The pathogenicity assays were

conducted in growth cabinets, which were assigned two temperature ranges 20/25 °C and 30/35 °C

(night/day) both with 10 h photoperiod under fluorescent light. The assays were repeated although

cv ‘Canton’ was used due to the shortage of cv ‘Queensland’.

All data from pathogenicity assays and the growth rate experiments were subjected to analysis of

variance (ANOVA) and the separation of means was determined using Tukey’s least significant

difference (LSD) test (P ≤ 0.05). Where stated, data from repeated assays were pooled and analyzed

together if there were no significant different between the two repetitions. The ANOVA and

comparisons of means were performed with Minitab 16.

4.3. Results

4.3.1. Isolation and identification

A total of 173 isolates of Pythium spp. and 15 of Pythiogeton ramosum isolates were obtained either

directly from PSR ginger or from baiting of soil from around infected ginger. Eleven species were

initially identified based on morphological characteristics by using the keys of Plaat-Niterink (1981)

and Dick (1990). Of these 11 Pythium spp., only three of the Pythium spp. as well as the


57

Pythiogeton ramosum were recovered directly from PSR ginger tissue (Table 4.1). Only one species

of Pythium was ever recovered from rhizomes with symptoms of PSR. When using ginger as bait

from the soil, P. spinosum and P. splendens were recovered most frequently followed by P.

aphanidermatum, P. deliense, P. heterothallicum, P. oligandrum, P. perplexum, P. torulosum, and

P. ultimum. However, using ginger baits from the soil failed to retrieve either P. graminicola or P.

myriotylum.

Table 4.1: Species of Pythium and Pythiogeton recovered from ginger rhizomes and soil samples

collected from commercial ginger fields in Queensland, Australia.

Speciesa

Number of isolates

obtained

Number of farms Recovered from

P. aphanidermatum 2 1 Soil

P. deliense 1 1 Soil

P. graminicola 3 1 Ginger rhizome

P. heterothallicum 2 1 Soil

P. myriotylum 79 10 Ginger rhizome

P. oligandrum 3 1 Soil

P. perplexum 1 1 Soil

P. spinosum 51 4 Soil

P. spinosum 12 2 Ginger rhizome

P. splendens 27 4 Soil

P. torulosum 1 1 Soil

P. ultimum 1 1 Soil

Pythiogeton ramosumb

15 2 Ginger rhizome

a Species as determined by morphology and DNA sequence base similarity

b Pythiogeton ramosum is be excluded in this chapter from now onwards, but full details will be

presented in chapter 7.

All of the species recovered grew well at temperature ranges above 5 °C and below 40 °C, except

for P. graminicola which grew poorly below 10 °C. P. aphanidermatum was the exception, which

grew normally even at 40 °C and above (Table 4.2).

All isolates were stored and kept in a collection at Plant Pathology lab, School of Agriculture and

Food Sciences, The University of Queensland.


58

Table 4.2: Morphological characteristicsa and growth rate of 10 species of Pythium recovered ginger rhizomes with PSR or from soil surrounding PSR

ginger plants from commercial ginger fields in Queensland, Australia.

Pythium species

Colony

appearance

on PDA

Hyphal

width (µm)

Sporangiab

(µm)

Hyphal

swellingc

(µm)

Sexual characteristicsd

Temp. response (°C)

Oogonia (µm) Antheridia Oospores (µm) Max Opt.

Growth at

25 (mm)

P. aphanidermatum

UQ6082

Dense-

cottony

4-6 (-10) I, 10-16 (-

20)

Nil S, 16-27 (av.

22.1 )

M, 1(-2)/oog. A, 14-22 (av. 18.7) ≤ 45 35-40 38.67

P. deliense UQ6021 Slight

radiate

4-6 (-8) I, 6-10 (-12) Nil S, 18-22 (av.

20.5)

M, 1(-2)/oog. A, 12-19 (av. 15.7) ≤ 40 35 25.71

P. graminicola

UQ6049

Dense-

cottony

2-4 (-6) I, 6-10 (-12) Nil S, 19-24 (av.

21.1)

M, D (occ.), 1-4

(-6)/oog.

A, P, 14-23 (av.

18.7)

≤ 40 35 16.71

P. heterothallicum

UQ6290

Radiate 2-5 (-7) Nil G, 8-15 (-

24)

Nil Nil Nil ≤ 35 25 10.41

P. oligandrum

UQ6085

Radiate 2-5 (-7) Ir, 8-30 (-

36)

Nil O, 14-23 (av.

18.6)

Nil A, 12-20 (av. 14.9) ≤ 40 30 26.13

P. perplexum UQ6250 Radiate 2-4 (-6) Ir, up to 30 Nil S, 14-26 (av.

21.1)

M, 1/oog. A, P (oc.), 14-22

(av. 18.2)

≤ 30 20 9.27

P. spinosum UQ6244 Dense-

cottony

2-5 (-7) Nil G, up to

30

O, 12-24 (av.

18.7)

M, D (occ.), 1 (-

2)/oog.

P, A (oc.), 10-21

(av. 16.7)

≤ 35 25 34.06

P. splendens UQ6036 Dense-

cottony

2-6 (-7) Nil G, 14-30

(-42)

Nil Nil Nil ≤ 35 30 38.67

P. torulosum UQ6291 Radiate 2-4 (-6) I, 4-10 (-12) Nil S, 12-20 (av.

15.8)

M, D (occ.), 1-

2(-3)/oog.

P, 12-18 av. 15.0) ≤ 35 30 12.59

P. ultimum UQ6023 Dense-

cottony

4-6 (-10) Nil G, 12-20

(-25)

S, 19-26 (av.

22.4)

M, 1/oog. A, P (oc.), 16-20

(av. 18.9)

≤ 35 30 30.96

a Morphological characters presented here include max, min and averaged (av.) values of 20 arbitrarily selected structures;

b Sporangial characteristics: filamentous (F), inflated (I),

irregular (Ir) and the width; c Hyphal swelling characteristics: not observed (Nil), globose (G), and the diameter;

d Sexual characteristics of oogonia, antheridia and oospore: smooth

(S), ornamented (O), diclinous (D), monoclinous (M), aplerotic (A), plerotic (P) (occ: occasionally), and the diameter.


59

For species confirmation, sequences obtained using the ITS primers (ITS1 and ITS4) were between

761 to 910 bp and once compared with sequences on the Genbank database, all sequences were

above 99 to 100% identical with reference species (CBS isolates) on the Genbank, so confirming

the status of Pythium spp. in this study. A phylogenetic tree built on the ITS region showed very

high bootstrap values (98-100%) between the morphologically identified and the reference species;

subsequently, the species identification was verified (Fig. 4.1). Of those UQ isolates considered to

be P. myriotylum, sequences of nuclear and mitochondrial loci, including of ITS (57 sequences),

CoxI (47 sequences) CoxII (67 sequences) and β-tubulin (19 sequences) were 99.8 to 100%

homologous to each other (Appendix 2 - 4).

Fig 4.1: A maximum likelihood tree showed phylogenetic relationships among Pythium species

(only representatives presented) recovered from commercial ginger fields in Australia using DNA

sequences encoded from ITS gene. The numbers at the nodes are the percentage of the trees from

bootstrap analysis (1,000 replications).


60

4.3.2. Pathogenicity assays

In vitro pathogenicity tests on excised ginger

Varying levels of virulence were detected among Pythium spp. when inoculated onto ginger sticks.

Once colonized, the ginger became soft, discoloured and white mycelia of pathogenic Pythium spp.

covered the tissue. Most of the isolates identified as P. myriotylum showed a high level of virulence

as assessed by rate of development on the excised ginger rhizome the exception being P.

myriotylum UQ5892 isolate (Fig 4.2). Isolates of P. deliense and P. aphanidermatum also showed

virulence as high as P. myriotylum followed by P. spinosum, P. splendens, P. ultimum, P.

graminicola. P. heterothallicum and P. torulosum were the least aggressive. Those isolates

identified as P. perplexum and P. oligandrum were not able to grow on the ginger sticks and

colonize the tissue in the conditions tested (27 ± 2 °C) and neither of these species was recovered

from the inoculated ginger sticks. None of the control sticks yielded Pythium spp. when samples

were plated out onto PDA plates (Fig 4.2).

Fig 4.2: Aggressiveness of selected Pythium spp. assessed based on mean colonization and

recovery of Pythium spp. on 1 cm segments excised from 5.5 cm long ginger sticks at 27 ± 2 °C at

2 DAI (bars represent standard deviations, n = 6). Means were combined from two independent

assays due to no significant difference between the two repetitions (P = 0.05).

In vitro pre-emerging damping off

The seeds of all tested plant species, except for beetroot germinated well in the control treatments

(disease index, DI ≤ 0.2) and the subsequent seedlings remained healthy afterwards. The DIs in

0.00

1.00

2.00

3.00

4.00

5.00

6.00

Mea

n c

olo

nis

ati

on

(0

- 5

cm

) Aggressiveness


61

control treatments were significantly less (P = 0.05) than those recorded for seeds treated with

Pythium spp., excluding P. oligandrum in which DIs on tested plant species were not different from

those of the control. Similarly, DI recorded on millet infected with P. torulosum was as low as that

of the control. P. aphanidermatum, P. myriotylum, P. graminicola, P. spinosum, P. splendens and

P. ultimum appeared the most aggressive on the tested plant species, except on barley which was

less vulnerable to attack by P. splendens and P. ultimum (DI < 0.5). All pathogenic Pythium spp.

infected and killed the seeds before germination and also young seedlings of plant species tested in

the assays (DI > 0.5 - 1) (Table 3). All eight tested P. myriotylum isolates were highly aggressive on

the 12 tested plant species (DI > 0.5), except for P. myriotylum UQ6152 and UQ6349 which were

less aggressive on lettuce (DI = 0.42 - 0.43). P. myriotylum UQ5892 was least aggressive,

compared to other P. myriotylum isolates on ginger sticks, it was comparable to other isolates of P.

myriotylum in terms of pathogenicity on the crop species assessed (Table 4.3). Where tested, the

isolate of P. torulosum was only highly aggressive on wheat (DI > 0.5) as Zhang and Yang (2000)

had reported. P. heterothallicum and P. perplexum were the least aggressive to those plant species

on which they were tested.


62

Table 4.3: Comparisons of disease indices (0-1) recorded on flower, vegetable and common crops used in rotation with ginger in Australia, which

were inoculated with Pythium spp.a

Isolates Bee

t ro

ot

Ca

rro

t

Cu

cum

ber

Eg

gp

lan

t

Let

tuce

Sp

rin

g o

nio

n

Gy

pso

ph

llia

Ba

rley

Bu

ck

wh

eat

Mil

let

Ry

e

Wh

eat

P. myriotylum UQ5993 0.95 a 0.99 a 0.83 bc 0.88 a 0.78 a 0.83 a 0.83 a 0.88 a 0.74 ab 0.98 a 0.91 ab 1.00 a

P. myriotylum UQ6152 0.88 a 0.58 a 0.78 c 0.84 a 0.43 bc 0.82 a 0.77 ab 0.73 ab 0.67 abc 0.95 a 0.89 ab 0.94 a

P. myriotylum UQ6349 0.89 a 0.58 a 0.88 abc 0.81 a 0.42 c 0.80 a 0.78 ab 0.75 ab 0.64 bc 0.88 ab 0.86 abcd 0.87 a

P. myriotylum UQ5992 0.97 a 0.64 a 0.91 ab 0.78 a 0.65 abc 0.88 a 0.83 a 0.71 abc 0.74 ab 0.97 a 0.86 abcd 0.87 a

P. myriotylum UQ5892 0.89 a 0.87 a 0.77 c 0.83 a 0.61 abc 0.76 a 0.70 b 0.57 bcd 0.53 c 0.98 a 0.72 bcde 0.87 a

P. myriotylum UQ6344 0.98 a 0.69 a 0.91 ab 0.88 a 0.68 ab 0.79 a 0.78 ab 0.73 ab 0.72 abc 0.94 a 0.91 ab 0.92 a

P. myriotylum UQ6018 0.95 a 0.67 a 0.88 abc 0.79 a 0.84 a 0.85 a 0.79 ab 0.76 ab 0.78 ab 0.98 a 0.87 abc 0.92 a

P. myriotylum UQ6016 0.91 a 0.76 a 0.87 bc 0.86 a 0.82 a 0.72 a 0.82 a 0.74 ab 0.70 abc 1.00 a 0.86 abcd 0.93 a

P. spinosum UQ6244 0.96 a 0.98 a 0.94 ab 0.80 a 0.81 a 0.80 a 0.83 a 0.58 bcd 0.77 ab 0.88 ab 0.63 cde 0.92 a

P. splendens UQ6036 0.94 a 0.91 a 0.94 ab 0.79 a 0.83 a 0.74 a 0.77 ab 0.37 d 0.74 ab 0.93 a 0.62 de 0.84 ab

P. ultimum UQ6023 0.95 a 0.91 a 0.99 a 0.84 a 0.83 a 0.79 a 0.79 ab 0.49 d 0.86 a 0.98 a 0.88 ab 0.95 a

P. aphanidermatum UQ6082 - - - - - - - - - 0.92 a 0.87 abc 0.85 a

P. graminicola UQ6049 - - - - - - - - - 0.94 a 1.00 a 0.86 a

P. heterothallicum UQ6290 - - - - - - - 0.39 d - 0.32 c - 0.38 d

P. oligandrum UQ6085 - - - - - - - - - 0.00 d 0.10 f 0.00 e

P. perplexum UQ6250 - - - - - - - 0.42 d - 0.33 c - 0.47 cd

P. torulosum UQ6291 - - - - - - - 0.50 cd - 0.08 d - 0.62 bc

Control 0.43 b 0.15 b 0.03 d 0.13 b 0.10 d 0.17 b 0.10 c 0.07 e 0.20 d 0.00 d 0.07 f 0.13 e

Values followed by different letters within a column show a statistically significant different at the 5% - level as determined by Tukey’s test.

- : not tested; a P. deliense was excluded from this table as most data will be presented in chapter 7


63

Pathogenicity on ginger plants

Reference isolates of P. myriotylum CBS254.70 and P. zingiberis NBRC30817 were included in

this pot trial after an additional quarantine import permit was granted. All P. myriotylum isolates

recovered from PSR ginger were pathogenic at both temperature regimes evaluated, regardless of

ginger cultivars tested. P. myriotylum UQ5892 was the only exception, which was weakly

aggressive at both temperatures and more so at the lower of the two temperature regimes. P.

myriotylum CBS254.70 and P. zingiberis NBRC30817 were only pathogenic to ginger plants at

30/35 °C. None of the other Pythium spp. tested caused disease when assessed at the lower

temperature. Where disease developed, initially above ground symptoms such as water soaking at

collar regions and yellowing of lower leaves were observed as early as 5 and 10 DAI on ginger

plants grown at 30/35 °C and 20/25 °C, night/day temperatures. However, by 21 DAI, disease

severity eventually was not significantly different between the two temperature ranges, except for

P. myriotylum UQ5892. P. myriotylum UQ5993 from capsicum, P. myriotylum CBS254.70, P.

zingiberis NBRC30817, and P. aphanidermatum UQ6082 showed different levels of disease

severity on ginger plants from the control only when the temperatures were higher than 30 °C (Fig

4.3). All other Pythium spp. were non-pathogenic on ginger plants in the bioassays regardless of

temperature. In all assays, Pythium spp. were re-isolated and identified based on morphology from

infested potting mix by baiting confirming successful colonization of tested Pythium spp. in soil.

Where applicable, the pathogenic Pythium spp. were also recovered from artificially induced PSR

ginger in the bioassays.

Fig 4.3: Disease severity (0-3) which was recorded on ginger plants inoculated with selected

Pythium spp. at 21DAI at two temperature ranges 20/25 °C and 30/35 °C with 10 h of photoperiods

(bars represent standard errors, n = 6). Data presented the combination of two pot trials due to no

significant difference in disease severity recorded on the two ginger cultivars tested (P = 0.05).

0

0.5

1

1.5

2

2.5

3

3.5

Dis

ease

sev

erit

y l

evel

s (0

-3)

20/25 °C 30/35 °C


64

4.4. Discussion

Several oomycetes, namely Pythium spp. and Pythiogeton ramosum were isolated directly from

PSR ginger in Queensland, Australia. P. myriotylum was isolated from most of the farms assessed.

P. spinosum and P. graminicola were also occasionally recovered from PSR ginger. Unlike studies

on other crops, including rooibos, bell pepper, common bean and soybean, of which more than one

Pythium sp. was often recovered from diseased plants (Bahramisharif et al., 2013; Chellemi et al.,

2000; Li et al., 2014; Zitnick-Anderson and Nelson, 2014), with PSR on ginger in this study only

one particular Pythium species was isolated per diseased rhizome. In some cases, mixed infections

of Fusarium sp. and Pythium sp. and Pythiogeton sp. were recorded although our findings indicated

that PSR in ginger in Australia was probably not caused by such a disease complex. However, more

pathogenicity assays, where Pythium spp. are co-inoculated in pot trials will be required to confirm

the theory.

In this study, other Pythium spp., including P. aphanideramtum, P. deliense, P. splendens and P.

ultimum, which were recorded on ginger grown in China, India, Japan and Malaysia (Liu, 1977b;

Ichitani and Shinsu, 1980; Dohroo, 2001; Jooju, 2005; Philip, 2005; Shanmaugam et al., 2010; Li et

al., 2014), were only obtained from soil by using ginger baits. It indicated that ginger baits were

quite effective in isolating Pythium spp. from soils around ginger, but the species of interest, P.

myriotylum was not trapped from the field soils. This is possibly due to either the use of unsuitable

baiting conditions or use of substrates which may have favoured the overgrowth of other more

saprophytic species, namely P. splendens and P. spinosum. If this was the case, soil plating dilution

conducted at a temperature more suited for P. myriotylum (over 30 °C) with a Pythium selective

medium will possibly be effective since P. myriotylum populations were assumed to be dominant in

the soil habitat. It will be important from a ginger farming system perspective to evaluate P.

myriotylum population levels before planting ginger back into infested fields. When potting mix

was inoculated with a single Pythium species in an artificially inoculated pathogenicity assays in the

pot trials, the same baiting technique successfully allowed recovery of P. myriotylum (data not

shown). Therefore in the absence of other competitors, recovery of P. myriotylum was obtained

without much effort from the simple baiting technique. The success of recovering Pythium spp.

from soil has been shown in the literature to be dependent on the target species and for P.

myriotylum in particular, others have also reported difficulty (Lumsden et al. 1975; Wang and

Chang 2003).

In most cases, morphology and growth rate allowed us to identify to species status the Pythium spp.

isolated in this study. All 11 Pythium spp. were first identified using the keys of Plaats-Niterink


65

(1981) and Dick (1990), identification of some species, including P. perplexum, P. splendens and P.

heterothallicum was difficult due to morphological similarities to others as well as a lack of sexual

structures. The identified and putative species were further confirmed by sequences of the ITS

region. The ITS sequence analysis is now used worldwide for Pythium identification although

species boundaries could not be revealed by the ITS locus solely (Lévesque and De Cock, 2004;

Robideau et al., 2011). In this study, a BLAST search from the Genbank database resulted in very

high levels of identity, namely over 99 to 100% homology to well-known reference isolates, so

multiple gene sequencing was not required. The only exception was that species boundary of P.

myriotylum and P. zingiberis was not clearly distinguished using only ITS sequence data. However,

this was addressed by analyzing morphology, whole genome data and pathogenicity exclusively

(chapter 3).

There have been many different Pythium spp. reported worldwide as major pathogens of PSR of

ginger (Dohroo, 2005). In Australia, P. myriotylum was reported in 2009 (Stirling et al., 2009) and

in this study, the prevalence and importance of the pathogen were revealed from all infested farms

from the Sunshine Coast, Australia. Moreover, P. myriotylum has also caused major losses to ginger

crops in many other countries that being China, India, Fiji, Korea and Taiwan (Kim et al., 1997a;

Kumar et al., 2008; Stirling et al., 2009; Tsai, 1991; Yuan et al., 2013). P. myriotylum is well-

known for its high temperature preferences and it is most pathogenic at about its temperature

optimum (37 °C) (Plaats-Niterink, 1981). This was supported by the pot trial results, from which

PSR symptoms were only observed on ginger plants inoculated with P. myriotylum CBS254.70, P.

zingiberis NBRC30817 and P. myriotylum UQ5993 (capsicum isolate) at 30 - 35 °C. However,

isolates of P. myriotylum initially obtained from PSR ginger in Australia appeared more aggressive

at a wide temperature range, 20 - 35 °C. Likewise, Perneel et al. (2006) found that P. myriotylum

recovered from cocoyam was most pathogenic to cocoyam at 28 °C. Interestingly, cocoyam was

also more vulnerable to P. myriotylum isolates, which were initially isolated from diseased

cocoyam, than those recovered from other hosts (Perneel et al., 2006). Similarly, we found P.

myriotylum from capsicum and P. myriotylum from ginger were strongly pathogenic to capsicum

and ginger, respectively regardless of temperatures, but they were much less pathogenic when cross

inoculations were undertaken (data not shown). This could be theorised that the P. myriotylum

isolated from PSR infected ginger in this study possibly exhibited some level of host preference, so

more pot trail screenings for their pathogenicity on other crops is warranted. If the theory is

supported by future results, it may have a significant contribution to PSR control programs through

crop rotations.


66

In addition to the ITS region, sequences of CoxI, CoxII and β-tubulin regions of representatives of

P. myriotylum obtained from PSR ginger revealed genetic uniformity of the population. In contrast,

Yuan et al. (2013) found polymorphisms within the ITS regions of P. myriotylum recovered from

PSR ginger in China. The genetical uniformity within the population of P. myriotylum on ginger

farms in Australia, it suggests that P. myriotylum may have been spread from one original source.

Stirling et al. (2009) argued that the incidence of PSR on ginger in 2007 was a sporadic event in a

very wet year on two of the oldest farms under continuous ginger cultivation, and so specific

control methods were not recommended at the time apart from paying better attention to drainage

and soil health. However, PSR is now observed on many farms with up to 70% of the ginger

farmers in the Sunshine Coast region reporting PSR on their farms (T. Pattison pers. comm.) and is

of major concern for the ginger industry. Although quarantine approaches have been deployed in

the regions, stricter on-farm biosecurity to prevent further spread is necessary.

In this study, P. aphanidermatum, P. deliense, P. graminicola, P. spinosum, P. splendens and P.

ultimum, which were isolated from either soil or diseased ginger or both, have also been found

associated with PSR on ginger elsewhere around the world (Dohroo, 2005). Isolates of these species

were able to colonize and cause soft rot on ginger sticks at a single incubation temperature (27 ± 2

°C) and were also highly virulent on a wide host range in vitro assays. However, none of these

listed species caused PSR on ginger, except for P. aphanideramtum which only caused PSR on

ginger at the higher temperature of 30/35 °C. P. aphanidermatum is a high temperature preference

species (Plaats-Niterink, 1981). This is the first report of P. aphanidermatum causing PSR on

ginger in Australia. Li et al. (2014) found that P. aphanidermatum recovered initially from PSR

ginger in China was capable of inducing symptoms of PSR on ginger at 24 - 26 °C. Therefore, it

could be of interest to undertake population studies of P. aphanidermatum and ginger around major

ginger growing regions since findings might lead to a significant impact for PSR control through

selection of tolerant cultivars. The current study could not induce PSR symptoms on ginger plants

inoculated with P. deliense, P. graminicola, P. spinosum, P. splendens and P. ultimum, but presence

of these pathogenic species should not be underestimated. Except for P. spinosum and P. ultimum

which were reported as secondary and postharvest pathogens on ginger, respectively (Dohroo,

2001; Le et al., 2010; Teakle, 1962), presence of other Pythium spp. on Australian ginger farms

might pose additional threats to the ginger industry in Australia once favorable environmental

conditions for these species to thrive are met.

The recovery of non-pathogenic P. oligandrum from soil surrounding PSR ginger plant might be of

interest for further interaction studies with P. myriotylum. P. oligandrum is a mycoparasite of a


67

wide range of oomycete and fungal species (Gerbore et al., 2014). This will be presented in detail in

chapter 6.

In conclusion, PSR disease has remained as a main constraint for ginger industry in Australia since

the first outbreaks recorded in 2007. Although a number of Pythium spp. have been found to be

associated with PSR in certain conditions, the PSR on ginger in Australia was mainly attributed to

P. myriotylum. Pathogenicity of P. myriotylum across a wide temperature range might indicate for

an occurrence of a new more aggressive strain of P. myriotylum. Therefore, it is worth practicing a

stricter quarantine approach to contain the spread, as well as looking for alternative control

strategies, including biocontrol.

Chapter 5 │SNP diagnostics

68

Chapter 5 : COMPARISON OF SNPs AND DEVELOPMENT OF PCR-RFLP FOR

DETECTION TOOL FOR PYTHIUM MYRIOTYLUM ISOLATES RECOVERED

FROM PYTHIUM SOFT ROT GINGER

Abstract

The oomycete Pythium myriotylum is responsible for severe losses in both capsicum and ginger

crops in Australia. Therefore, it is proposed that intraspecific variation within the pathogen might

account for aggressiveness and pathogenicity on diverse hosts. In this study, whole genome data of

four P. myriotylum isolates recovered from three hosts and one P. zingiberis isolate were derived

from Illumina sequencer and 22 conserved loci were extracted and analysed for sequence diversity

based on single nucleotide polymorphisms (SNPs). In most cases, a higher number of true and

unique SNPs occurred in P. myriotylum isolates obtained from ginger with symptoms of Pythium

soft rot (PSR) in Australia compared to other P. myriotylum isolates. Overall, SNPs were

discovered more in the mitochondrial genome than those in the nuclear genome. Among the SNPs,

a single substitution from the cytosine (C) to the thymine (T) in the CoxII gene of 14 P. myriotylum

isolates obtained from PSR ginger was within a restriction site of HinP1I enzyme which was used

in the PCR-RFLP for detection and identification of the isolates without sequencing. The enzyme

specifically cut the PCR amplicons of the CoxII (about 600 bp) of PSR P. myriotylum isolates into

two small fragments (about 425 and 175 bp) which were visualised under UV light. Meanwhile, the

PCR amplicons of other P. myriotylum isolates and other Pythium spp. as well as true fungi were

restricted, resulting in single bands on the gel. The PCR-RFLP was also sensitive enough to detect

P. myriotylum directly from PSR ginger sampled from pot trials without the need of isolation for

pure cultures.

Key words: genome sequencing, genetic variations, restriction enzymes, DNA extracts, cultures

5.1. Introduction

Pythium myriotylum is a destructive soil-borne pathogen that belongs to the order Pythiales, phylum

Oomycete (Plaats-Niterink, 1981; Webster and Weber, 2007). This widespread pathogen causes

pre- and post-emergence damping off and mature plants of many agricultural and horticultural crops

(McCarter and Littrell, 1970; Pacumbaba et al., 1992; Plaats-Niterink, 1981; Porter, 1970;

Sigobodhla et al., 2010; Stirling et al., 2004; 2009; Tsror et al., 2004). Depending on the crop and

field conditions, yield losses caused by P. myriotylum have been reported to be between as little as


69

4% on soybean grown in Japan (Tomioka et al., 2013) to as much as 90% on cocoyam grown in

Cameroon (Pacumbaba et al., 1992) or even up to 100% on ginger grown in Australia (Stirling et

al., 2009).

In many cases temperature plays a significant role on the pathogenicity and aggressiveness of P.

myriotylum; higher temperatures are associated with greater disease levels (Kim et al., 1997a;

Plaats-Niterink, 1981; Stirling et al., 2004; Tomioka et al., 2013). For instance Kim et al. (1997b)

found that ginger plants grown at 35 - 40 °C were killed by P. myriotylum three times faster than for

plants grown at 15 °C. Similarly, on capsicum disease severity was exacerbated when soil

temperature increased from 25 to 40 °C (Stirling et al., 2004). Damping off incidence on soybean

associated with P. myriotylum was also higher when the temperature was around 35 °C compared

with lower temperatures (Southern, 1976; Tomioka et al., 2013) and stands of rye and tomato sown

in a soil mix infested with P. myriotylum were also almost completely lost at 35 °C (Littrell and

McCarter, 1970). However, not all isolates of P. myriotylum appear to require high temperatures

and this may be influenced by the host and geographical origins of the isolates. P. myriotylum

initially recovered from diseased cocoyam was able to quickly kill cocoyam plants at 24 - 28 °C

within a week in an inoculated pathogenicity assays (Perneel et al., 2006; Tambong et al., 1999;

Tojo et al., 2005). As reported in chapter 4, P. myriotylum isolates obtained from PSR ginger in

Australia showed pathogenicity over a wide range temperature from 20 - 35 °C.

In Australia, severe losses in capsicum and ginger crops have been attributed to P. myriotylum

(Stirling et al., 2004; 2009). The isolates of P. myriotylum from these hosts showed a differential

response in pathogenicity to capsicum and ginger plants (unpublished data). Additionally, the

isolates from ginger and capsicum also differed from each other in morphology and physiology

(unpublished data). Therefore, it is theorised that these differences are the result of distinct pathogen

genotypes. The aim of this chapter was to assess the genetic diversity of isolates of P. myriotylum,

to potentially reveal any distinct genotypes associated with pathogenicity on ginger and if found to

use such information to devise detection tools to identify those strains of P. myriotylum associated

with PSR ginger in Australia. For this purpose, sequences of conserved regions obtained from

whole genome sequences of five P. myriotylum isolates originally recovered from different hosts

and locations were subjected to single nucleotide polymorphism (SNP) analyses. SNPs are of

increasing interest for studies in ecology, evolution, conservation, and population history since

SNPs are the most common polymorphism that occurs in genomes and also provide valuable

information for marker design (Brookes, 1999; Brumfield et al., 2003; Morin et al., 2004).


70

Based on our sequence data, a PCR-RFLP (PCR-restriction fragment length polymorphism) tool

was developed and employed for detection and identification of P. myriotylum strains recovered

from PSR ginger in Australia. PCR-RFLPs is a reliable molecular tool for species discrimination of

Pythium (Chen and Hoy, 1993; Chen, 1992; Paul et al., 1998). Gómez‐Alpízar et al. (2011)

successfully utilised a PCR-RFLP of the ITS gene to differentiate P. myriotylum strains recovered

from cocoyam and non-cocoyam hosts. PCR-RFLPs were also commonly used for studies of

Pythium ecology and diversity in the absence of pure cultures (Chen et al., 1992; Rafin et al., 1995)

and as well as for detecting of intra-specific variations among isolates and within single spore

isolates of Pythium (Kageyama et al., 2007; Martin, 1990; Martin and Kistler, 1990).


5.2.1. Pythium and fungal cultures

A total of 43 isolates of 18 Pythium spp., one Pythiogeton ramosum, one Sclerotium sp. and one

Fusarium sp. were included in this study (Table 5.1). In most cases DNA was extracted from living

cultures growing on potato broth (Difco). These isolates had been previously stored in a collection

at Plant Pathology lab, School of Agriculture and Food Sciences, The University of Queensland

after having been obtained from the field or from colleagues as listed. The exception was for the six

P. myriotylum isolates from Japan where DNA extracts were provided by Prof. Kageyama from

Gifu University, Japan.

Table 5.1: Pythium and fungal isolates used in this study

Species Isolate Host/habitat Origin Digested with

HinP1I

P. myriotylum UQ5979 Ginger Australia +

P. myriotylum UQ5980* Ginger Australia +


P. myriotylum UQ6152* Ginger Australia +





P. myriotylum NAM10 Ginger Australia +





71


P. myriotylum KRS14 Ginger Fiji +

P. myriotylum GF64 Kalanchoe Japan -

P. myriotylum BeAT1 Kidney bean Japan -

P. myriotylum FuOri1 Soybean Japan -

P. myriotylum K9-9-7 Sludge Japan -

P. myriotylum GunM1 Myoga ginger Japan -

P. myriotylum GUKan7sh Kanzo Japan -

P. myriotylum BRIP39907 Capsicum Australia -

P. myriotylum UQ5993* Capsicum Australia -

P. myriotylum CBS254.70* Tomato Israel -

P. zingiberis NBRC30817* Ginger Japan -

P. aphanidermatum UQ6082 Soil Australia -

P. aristosporum UQ6377 Wheat Australia -

P. deliense UQ6021 Soil Australia -

P. graminicola UQ6049 Ginger Australia -

P. heterothallicum UQ6290 Soil Australia -

P. irregulare UQ5986 Oat Australia -

P. oligandrum UQ6085 Soil Australia -

P. perplexum UQ6252 Soil Australia -

P. recalcitrans UQ6140 Capsicum Australia -

P. spinosum UQ6026 Soil Australia -

P. splendens UQ6036 Soil Australia -

P. sulcatum UQ6269 Carrot Australia -

P. torulosum UQ6291 Soil Australia -

P. ultimum UQ6023 Soil Australia -

P. vanterpoolii UQ6382 Ginger Australia -

P. vexans KRS11 Ginger Fiji -

Pythiogeton ramosum UQ6020 Ginger Australia -

Sclerotium sp. UQ6043 Ginger Australia -

Fusarium sp. UQ6044 Ginger Australia -

* Isolates were whole genome sequenced for genetic diversity studies


72

5.2.2. Sequence diversity based on SNP analysis

Whole genome sequence data of four isolates, including CBS254.70, NBCR30817, UQ5980 and

UQ6152 presented chapter 3 and an additional sequence of isolate UQ5993 retrieved from Illumina

sequencing method were explored for sequence diversity based on SNP genotyping. A reference

annotated mitochondrial genome of P. ultimum BR114 was mapped with P. myriotylum genome

data to initially identify names of gene sequences. The identified gene sequences from each isolate

of P. myriotylum were retrieved and aligned by utilizing the Geneious 7.1.4 software. The

alignments were visually inspected for SNPs based on presence of heterozygous bases. The SNPs

were then verified by visual inspections of the mapped regions in which 90% of mapped reads

carried the SNP. Additionally, publicly available sequences in a nuclear genome were included in

this study. The studied sequences were translated and aligned to determine if SNPs were

synonymous or non-synonymous. The translated sequences were also aligned by the Geneious 7.1.4

software. Only sequences that appeared highly conserved among the five isolates are presented in

this study.

5.2.3. PCR-RFLP for CoxII region

Based on results, the CoxII gene sequence was further analysed for use in developing a PCR-RFLP

tool to be used for detection and identification of P. myriotylum strains isolated from PSR ginger.

Whole genomic DNA was extracted from both mycelia and infected ginger rhizome obtained from

pot trials in chapter 4 by using the CTAB protocol of Doyle and Doyle (1990). Approximately 600

bp of the CoxII gene was amplified by using two primers: FM66 (5’

TAGGATTTCAAGATCCTGC 3’) and FM58 (5’ CCACAAATTTCACTACATTGA 3’) (Martin,

2000). The PCR was performed in an Eppendorf Mastercycler® with one cycle of denaturation for

5 min at 94 °C, followed by 35 cycles of 94 °C for 30 s, 52 °C for 30 s, and 72 °C for 90 s, and one

cycle of final extension for 10 min at 68 °C. The amplified products were electrophoresed under

110 V in 1.5% agarose gel (Sigma) stained with ethidium bromide for 40 min and visualised with

UV light to confirm the success of the reactions.

An enzyme, HinP1I (New England Biolabs) was selected due to its unique cutting site, which was

predicted using a Web based tool, NEBcutter V2.0. The amplicons of the CoxII gene were digested

with the HinP1I in 12 µL reaction mixtures containing 0.2 µL of the enzyme (2 units), 1.2 µL of

10X NEBuffer, 10 µL of PCR products, and 0.6 µL of dH2O. The digestions were performed at 37

°C for 3 h, followed by a deactivation of the enzyme at 65 °C for 20 min. The RFLP products were

electrophoresed and visualised as described above.


73

5.3. Results

5.3.1. Sequence diversity based on SNP typing

A total of 22 highly conserved gene fragments among the five studied isolates were identified and

retrieved from whole genome data by mapping with annotated genome of P. ultimum BR114. Of

the 22, 17 and five were retrieved from mitochondrial and nuclear genomes, respectively. A

summary of the sequence length, the number of SNPs, the SNPs/kb and number of non-

synonymous SNPs of the 22 gene fragments is presented in Table 5.2. Depending on loci and

isolates, the genetic differences among P. myriotylum isolates varied from zero to up to 1% (6.79

SNPs/kb). Overall, a total of 129 SNPs was identified along 22 genes, including coding and non-

coding genes in nuclear and mitochondrial genomes. Approximately 99.98% of the SNPs were

single base pair (bp) substitutions. There were only two single bp insertions in the small subunit of

mitochondrial genome of the isolate CBS254.70. Of these, 57 were synonymous SNPs and 72 were

non-synonymous SNPs. Of the non-synonymous SNPs, some altered stop codons resulting in

changes in translated protein sequences (Table 5.3). The two isolates UQ5980 and UQ6152

recovered from PSR ginger had the highest number of SNPs (58) and the frequency of one SNP

every 437 bp, compared with the isolates UQ5993 recovered from capsicum and CBS254.70 which

had the lowest number of SNPs (20 and 21 respectively) and the SNP occurred every 1267 bp. With

30 SNPs and the occurrence of one SNP/845 bp, the isolate NBRC30817 was of intermediate

polymorphism among the five isolates studied. Of the studied genes of the nuclear genome, overall

the SNP frequency was detected in every 1450 bp and 2175 bp in UQ5980, UQ5993, UQ6152 and

CBS254.70, respectively. Meanwhile, a SNP was detected around 4.5 and 2.5 times more

frequently (1 SNP per every 320 bp) in the studied genes of the mitochondrial genome in UQ5980

and UQ6152, and CBS254.70 and NBRC30817, respectively. The isolate UQ5993 had a similar

SNP frequency in both nuclear and mitochondrial genomes.


74

Table 5.2: Genetic diversity compared among the five P. myriotylum and P. zingiberis isolates based on a summary of SNP information including

sequence length, number of SNPs/gene, number of SNPs/kb and number of non-synonymous SNPs

Regions

Legth

(bp)

P. myriotylum UQ5980 P. myriotylum UQ6152 P. myriotylum UQ5993 P. myriotylum CBS254.70 P. zingiberis NBRC30817

SNPs SNPs/kb

Non-

synonymous SNPs SNPs/kb

Non-


Non-


Non-


Non-

synonymous

Nu

clea

ra D

NA

SSU (18S) 2305 1 0.43 1.0 1 0.43 1.0 1 0.43 1.0 0 0.00 0.0 3 1.30 1.0

LSU (28S) 3778 2 0.53 0.0 2 0.79 0.0 0 00.0 0.0 0 0.00 0.0 0 0.00 0.0

ITS 817 1 1.22 0.0 1 1.22 0.0 2 2.45 0.0 0 0.00 0.0 0 0.00 0.0

Actin 879 2 2.28 2.0 2 2.28 2.0 1 1.14 1.0 2 2.28 1.0 2 2.28 1.0

β-tubulin 920 0 0.00 0.0 0 0.00 0.0 3 3.26 3.0 3 3.26 3.0 0 0.00 0.0

Mit

och

on

dri

al

b D

NA

CoxI 1478 7 4.74 6.0 7 4.74 6.0 1 0.68 1.0 2 1.35 1.0 0 0.00 0.0

CoxII 773 5 6.47 5.0 5 6.47 5.0 0 0.00 0.0 1 1.29 0.0 0 0.00 0.0

CoxIII 914 3 3.28 3.0 3 3.28 3.0 1 1.09 1.0 1 1.09 1.0 0 0.00 0.0

NAD1 980 2 2.04 0.0 2 2.04 0.0 1 1.02 0.0 0 0.00 0.0 1 1.02 0.0

NAD4L 302 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0

mtSSU 1510 5 3.31 3.0 5 3.31 3.0 1 0.66 0.0 2 1.32 2.0 3 1.99 1.0

mtLSU 2654 4 1.51 2.0 4 1.51 2.0 1 0.38 0.0 3 1.13 2.0 2 0.75 1.0

ATP1 1534 7 4.56 7.0 7 4.56 7.0 0 0.00 0.0 1 0.65 2.0 2 1.30 1.0

ATP8 389 1 2.57 0.0 1 2.57 0.0 1 2.57 0.0 0 0.00 0.0 0 0.00 0.0

ATP9 227 1 4.41 0.0 1 4.41 0.0 0 0.00 0.0 0 0.00 0.0 1 4.41 0.0

NAD7 1178 8 6.79 8.0 8 6.79 8.0 1 0.85 1.0 2 1.70 2.0 4 3.39 3.0

NAD5 1994 5 2.51 0.0 5 2.51 0.0 4 2.01 3.0 2 1.00 0.0 2 1.00 0.0

NAD6 740 0 0.00 0.0 0 0.00 0.0 0 0.00 0.0 1 1.35 0.0 1 1.35 1.0

RPL2 806 1 1.24 1.0 1 1.24 1.0 1 1.24 0.0 0 0.00 0.0 4 4.96 1.0

RPL16 404 1 2.48 0.0 1 2.48 0.0 0 0.00 0.0 0 0.00 0.0 1 2.48 1.0

RPS14 299 0 0.00 0.0 0 0.00 0.0 1 3.34 1.0 0 0.00 0.0 0 0.00 0.0

RPS4 461 2 4.34 0.0 2 4.34 0.0 1 2.17 0.0 2 4.34 1.0 1 2.17 1.0

a Nuclear gene includes: small (SSU) and large subunit (SLU) of rDNA;

b Mitochondrial gene includes: cytochrome c subunit (Cox), NADH dehydrogenase subunit (NAD), ATP

synthase subunit (ATP), ribosomal protein (RPL or RPS).


75

Table 5.3: Characteristics of non-synonymous SNPs in five P. myriotylum and P. zingiberis

isolates; loci without non-synonymous SNPs were excluded in this table.

Regionsa

SNP

position Context

Amino acid

replacement UQ5980 UQ6152 UQ5993 CBS254.70 NBRC30817

SSU (18S) 136 (A/T)CT Ser-Thr A A T A T

Actin 178 (A/G)CT Thr-Ala G G G G A

478 (T/C)GG Arg-Trp C C T T T

655 (C/G)GG Arg-Gly C G G G G

682 (C/T)GG Trp-Arg T T T C T

715 (C/C)GC Cys-Arg C T C T T

β-tubulin 14 T(C/T)T Ser-Phe C C T T C

383 T(C/T)T Ser-Phe C C T T C

482 C(T/C)A Leu-Pro T T C C T

CoxI 358 (C/T)GG Arg-Trp C C T T T

415 (T/C)CC Ser-Pro T T C C C

739 (T/C)TT Phe-Leu T T C C C

1138 (T/C)GT Arg-Cys C C T T C

1156 (C/T)GG Arg-Trp C C T T T

1372 (C/T)CC Pro-Ser C C T T T

1429 (C/T)GC Arg-Cys C C T T T

CoxII 115 (C/T)TT Leu-Phe T T T C T

154 (C/T)AG Gle-stop codon C C T T T

214 (C/T)GC Arg-Cys C C T T T

316 (T/C)CC Ser-Pro T T C C C

664 (C/T)CA Pro-Ser C C T T T

694 (G/A)GT Gly-Ser G G A A A

CoxIII 91 (A/G)AA Lys-Glu G G A A G

94 (G/A)TG Val-Met G G A A A

451 (G/A)CC Ala-Thr G G A A A

622 (A/G)GT Ser-Gly A A G G G

mtSSU 97 (G/A)TA Val-Ile-Ser G G G G A

372 GA(G/A) Glu-Glu-Arg G G A A A

716 A(G/T)C Ser-Ile-Tyr G G T T T

776 A(A/G)T Asn-Ser-Glu A A G G G

844 TC(A/G) Glu-Phe-Gln A A A A G

1187 A(T/-)T Stop codon-Ile - - - T -

1252 A(A/G)G Lys-Glu-Met A A G G G

1500 (A/G)AA Stop codon-

Trp-Glu A A G G G

mtLSU 665 T(T/A)A Stop codon- T T A A A


76

Leu

757 (G/A)CT Thr-Ala G G G A G

865 (G/A)AG Lys-Glu G G G G A

1951 (T/C)AT Phe-His T T C C C

2431 (G/C)GT Gly-Arg C C C G C

ATP1 92 AT(T/G) Stop codon-

Leu G G G G T

104 (T/C)GC Leu-Ser T T C C C

125 C(T/C)A Leu-Pro T T C C C

200 A(C/T)C Thr-Met C C T T T

254 (C/T)GT Ser-Leu C C T T T

485 G(A/G)C Glu-Gly A A G G G

503 A(T/C)A Ile-Thr T T C C C

581 A(C/T)A Thr-Ile C C T T T

779 A(G/A)C Ser-Asn A A A G A

ATP8 47 (C/T)CT Ser-Phe C C T T T

NAD7 91 T(A/G)G Trp-Stop codon A A G G G

148 G(A/G)G Glu-Gly A A G G G

244 C(C/T)T Pro-Leu T T T T C

301 A(T/C)A Ile-Thr T T C C C

402 G(G/A)T Gly-Asp A A A A G

544 A(G/A)T Ser-Asn G G A A A

571 A(A/G)G Lys-Arg G G A A G

630 (A/G)TG Met-Val G G G G A

997 A(G/A)(G/T) Arg-Lys-Asn G G A A A

998 A(G/A)(G/T) Arg-Lys-Asn G G G T G

1000 C(C/T)C Leu-Pro C C T T T

1015 (T/C)GG Met-Thr T T C C C

1141 A(C/T)A Pro-Leu C C T T T

1145 TA(C/A) Stop codon-Tyr A A A C A

NAD5 57 TT(G/T) Leu-Phe T T G T T

135 AT(G/A) Met-Ile A A G A A

158 T(T/C)A Leu-Ser C C T C C

NAD6 217 (A/G)T(A/T) Ile-Thr G G G G A

RPL2 441 A(C/A)G Lys-Asn C C A A A

610 (A/T)TA Ile-Leu T T T T A

RPL16 112 (A/G)AA Lys-Glu G G G G A

RPS4 20 C(T/G)A Arg-Leu G G G G T

52 (T/C)CA Pro-Ser C C C T C

a Cox: cytochrome c subunit; NAD: NADH dehydrogenase subunit; ATP: ATP synthase subunit; RPL and

RPS: ribosomal protein


77

5.3.2. PCR-RFLP analysis

A number of unique SNPs that resulted in restriction sites were identified using a NEBcutter V2.0.

Of those, a single bp substitution of cytosine (C) for thymine (T) was identified at position 175 bp

of the 600 bp of the CoxII amplicon in only P. myriotylum isolates recovered from PSR ginger in

Australia. This SNP resulted in a HinP1I restriction site. The substitution was unique to P.

myriotylum isolates from PSR ginger and this was confirmed with the PCR-RFLP digestion using

the HinP1I. The HinP1I cleaved the PCR products of PSR and non-PSR isolates of P. myriotylum

into two and one bands visualized under UV light, respectively (Fig 5.1). The results indicated the

applicability of the PCR-RFLP of the CoxII gene to discriminate the PSR isolates of P. myriotylum

from the non-PSR ones.

Genomic DNA of P. myriotylum obtained directly from the PSR ginger in chapter-4 pot trials was

sufficient for the PCR amplification of the CoxII gene and the digested products also showed

corresponding bands to those of the pure cultures of PSR isolates of P. myriotylum (Fig 5.1).

Fig 5.1: HinP1I restriction banding patterns of the partly amplified CoxII gene of P. myriotylum

isolates obtained from different hosts and origins: Lane 1, 100 bp ladder marker; lanes 2-15, DNA

templates of P. myriotylum isolates obtained from PSR ginger (except for lane 9, amplification

failed); lanes 16-20, DNA templates of P. myriotylum extracted directly from pot trial PSR ginger;

lane 21-26, DNA templates of P. myriotylum isolates obtained from Japan; lanes 27-28, DNA

templates of P. myriotylum isolates obtained from capsicum wilt; lane 29, P. myriotylum

CBS254.70; lane 30, P. myriotylum NBRC30817


78

5.4. Discussion

This study for the first time compared multi-genes (up to 22 individual genes) within the nuclear

and mitochondrial genomes among the isolates of P. myriotylum obtained from different hosts and

origins. The objective was to assess intraspecific diversity based on the SNP genotyping for

discovery of genetic variants.

Within the genus Pythium, P. irregulare, P. helicoides, P. mercurial and P. ultimum have all been

shown to be highly intraspecific species (Barr et al., 1996; 1997; Belbahri et al., 2008; Garzón et al.,

2005; Kageyama et al., 2007; Matsumoto et al., 2000). Meanwhile, P. myriotylum only exhibits a

SNP variation as was shown for the ITS region for isolates recovered from cocoyam compared to

other non-cocoyam isolates (Gómez‐Alpízar et al., 2011; Perneel et al., 2006). Similar SNP variants

were also observed among P. myriotylum isolates recovered from PSR ginger in China (Yuan et al.,

2013). As reported in chapter 3, sequence divergence among the tested P. myriotylum in this study

was just about 1%, suggesting that little genetic variation among isolates of P. myriotylum. In fact,

the genetic variation varied from no SNP to up to 7.6 SNPs per 1 kb depending on studied loci and

origin of isolates. PSR isolates in Australia had higher SNPs than non-PSR isolates and an overseas

PSR isolate. Likewise, in studies on Phytophthora (Ph.) infestans, Abbott et al. (2010) found that

no SNPs were detected among isolates of Ph. infestans originated from Colombia when examining

five microsatellite flanking regions (MFR) of 57 isolates, but a few SNPs across 32 MFRs were

apparent when comparing Ph. infestans isolates sampled from Russia, Peru, China, USA and

Switzerland. Of the loci within this study, the greatest number of SNPs among the P. myriotylum

isolates was observed in NAD7 locus where up to 6.79 SNPs/kb occurred when examining PSR

isolates. This intra-varietal variation (SNP/kb) was comparable to those identified among P.

ultimum isolates (Eggertson, 2012). Tyler et al. (2006) found a lower SNP frequency of one SNP in

every 5 kb and 20 kb in genome sequences of Ph. ramorum and Ph. sojae, respectively.

Fleischmann et al. (2002) theorized that genetic variation might play important roles in disease

pathogenesis. Therefore, it will be of interest if future studies find any relationship between the

genetic mutations in PSR P. myriotylum isolates and its high aggressiveness to ginger, as well as

variable responses to environmental and ecological changes.

Among the P. myriotylum isolates studied, the overall number of SNPs/kb was similar for each of

the loci within the nuclear genome, but the two isolates of P. myriotylum from PSR ginger had a

higher number of SNPs/kb than the two non-PSR P. myriotylum isolates. The mitochondrial

genome is believed to have evolved faster than the nuclear genome, resulting from a high mutation

rate (Morin et al., 2004), and mitochondrial gene sequences are therefore considered to be a better


79

choices for markers. The SNPs discovered in this study in the mitochondria might be useful to

differentiate the PSR P. myriotylum isolates from non-PSR ones. Currently, partly sequenced CoxI

and CoxII in the mitochondrial genome have been widely used along with the ITS region to

delimitate closely related Pythium spp. (Martin, 2000; Robideau et al., 2011). However, a similar

study by Eggertson (2012) determined that the number of intra-variants of some loci in the nuclear

genome of P. ultimum was much higher than those determined in the mitochondrial genome. Song

et al. (2008) and Eggertson (2012) also argued that it is inappropriate to use multi-loci of the

mitochondrial genome for phylogenetic studies as the genome is non-recombinant and single uni-

parentally inherited, which might result in a species estimate bias.

The PCR-RFLP of the CoxII locus with the HinP1I successfully discriminate the PSR P.

myriotylum isolates from the non-PSR ones and other Pythium spp. as well as from fungi without

the need for further sequencing. A single digestion of the CoxII amplicon with HinP1I was also able

to detect PSR P. myriotylum directly from artificially inoculated ginger without requirements of

pure cultures, so this simple, reliable and accurate technique could be employed to rapidly identify

P. myriotylum that induces PSR in ginger. Likewise, Gómez‐Alpízar (2011) also successfully

developed PCR-RFLP of the ITS locus to detect and differentiate P. myriotylum isolates which

were pathogenic to cocoyam from non-pathogenic P. myriotylum to cocoyam. Interestingly,

regardless of a number of SNPs identified, the PSR P. myriotylum isolates only showed a certain

level of host specificity to ginger, while cocoyam P. myriotylum isolates appeared totally host

specificity, such isolates were identified by a unique SNP on the ITS2 region (Gómez‐Alpízar et al.,

2011). Therefore, the use of such SNPs is open for future research.

PCR-RFLP has been proven to be a powerful molecular tool for detection and identification of

Pythium spp. in other studies (Francis et al., 1994; Gómez‐Alpízar et al., 2011; Harvey et al., 2000;

Kageyama et al., 2005; Matsumoto et al., 2000; Rafin et al., 1995). However, with rapid progress in

developing novel molecular tools, PCR-RFLP is considered to be a time consuming approach

compared to isothermal amplification of DNA techniques such as LAMP (loop-mediated isothermal

amplification) and SMAP 2 (smart amplification process version 2) (Mitani et al., 2007; Notomi et

al., 2000). Both techniques, LAMP and SMAPs have shown to be highly specific detection methods

of pathogen targets with the capability of detecting SNPs (Duan et al., 2015; Mitani et al., 2007;

Yabing et al., 2015). Thus, applications of novel techniques for fast, effective and accurate

detection of PSR P. myriotylum strains will be warranted.


80

Briefly, P. myriotylum recovered from PSR ginger in Australia exhibited a certain level of genetic

variation compared with other P. myriotylum isolates. A number of SNPs were discovered in this

study providing a valuable source for marker development. Moreover, a number of genetic variants

within P. myriotylum was identified. It is possible that these variants may be responsible for

aggressiveness and pathogenicity, as well as variable responses to environmental and ecological

changes. Attempts to correlate the genetic variation within the pathogen with differences in

pathogenicity and environmental response are open for further investigations. Use of PCR-RFLP of

the CoxII locus was successfully deployed to differentiate the PSR P. myriotylum strains from non-

PSR P. myriotylum strains.

Chapter 6 │P. olgiandrum and P. myriotylum interactions

81

Chapter 6 : INTERACTIONS BETWEEN MYCOPARASITIC PYTHIUM OLIGANDRUM

ISOLATED FROM GINGER FIELDS AND PATHOGENIC PYTHIUM

MYRIOTYLUM

Abstract

Pythium oligandrum, an oomycete, a mycoparasite, a competitor, an antibiotic producer and a plant

defence inducer is the most commonly studied within a mycoparasitic group of Pythium. It is

consequently a potential biological control agent (BCA) for a number of crop species. This study

focuses on two endemic strains of P. oligandrum recovered from bulk soils around ginger

exhibiting symptoms of Pythium soft rot (PSR). P. oligandrum showed moderate mycoparasitism

towards an isolate of P. myriotylum Gin1 (Pm-Gin1) that had been originally isolated from PSR

ginger. Whereas the same P. oligandrum isolates showed variable degree of mycoparasitism

towards an isolate of P. myriotylum Cap1 (Pm-Cap1) initially isolated from sudden wilt of

capsicum and towards an isolate of P. ultimum So1 (Pu-So1) recovered from soil in a ginger field.

Corn meal agar cultures pre-colonised by Pm-Gin1 and Pu-So1 did not have an adverse effect on

growth and oospore production of P. oligandrum, but growth of P. oligandrum was affected when

placed on media already colonised by Pm-Cap1. Metabolic compounds, including volatiles and

non-volatiles produced by P. oligandrum appeared non-toxic to tested Pythium spp. P. oligandrum

provided significant protection of millet, rye and wheat seeds against Pm-Gin1 and Pu-So1 in vitro

dual culture assays; however, disease severity of ginger plants co-inoculated with P. oligandrum

and Pm-Gin1 appeared no different in disease response compared with plants with single

inoculation of Pm-Gin1. This is the first attempt to understand interactions between P. oligandrum

and the PSR pathogen of ginger in Australia.

Key words: antagonist, mycoparasite, competitor, toxins, BCA, disease severity

6.1. Introduction

The genus Pythium was first described by Pringsheim in 1858. This genus is now known to be

ubiquitous occupying a wide array of environmental niches (Ho, 2009). Pythium can be pathogenic

to plants (Hendrix and Campbell, 1973) or animals (De Cock et al., 1987), or can be non-pathogenic

(Plaats-Niterink, 1981) existing as a saprophyte, or it can be mycoparasitic (Karaca et al., 2008).

Within the mycoparasitic group, P. oligandrum is the most commonly studied species and has been

demonstrated to have great potential as a biological control agent (BCA). Consequently, it has been

registered as a bio-fungicide in several countries (Benhamou et al., 2012; Brozova, 2002; Gerbore

et al., 2014a). P. oligandrum was originally described by Drechsler in 1930 having been isolated


82

from rotting roots of pea (Pisum sativum). Later, several reports indicated that P. oligandrum was a

parasite of many fungal species such as Fusarium spp., Rhizoctonia solani, Phoma medicaginis,

Sclerotinia spp., Botrytis cinerea and Verticillium spp. (Al-Rawahi and Hancock, 1998; Bradshaw-

Smith et al., 1991; El-Katatny et al., 2006; He et al., 1992; Ikeda et al., 2012; Mette Madsen and de

Neergaard, 1999; Rey et al., 2005; Ribeiro and Butler, 1995), as well as oomycetes, including

Pythium spp., Phytophthora spp. and Aphanomyces cochlioides (Abdelzaher et al., 1997; Benhamou

et al., 1999; Horner et al., 2012; McQuilken et al., 1990; Ribeiro and Butler, 1995; Takenaka and

Ishikawa, 2013). In addition, P. oligandrum has been reported to have the capability of induce

disease resistance and promote plant growth of many crops in both in vitro and in vivo studies

(Benhamou et al., 2012; Brozova, 2002; Gerbore et al., 2014a; Takenaka et al., 2008; Yacoub et al.,

2016). These three-way interaction between P. oligandrum, pathogens and hosts resulting in disease

suppressions were believed to be unique for this BCA (Lévesque, 2011).

Although many studies have reported the beneficial effects of P. oligandrum in protecting crops, the

efficacy of applications is still variable (Floch et al., 2009). Depending on the crop, application

methods and target pathogens, protection levels achieved by P. oligandrum recording from 12 to up

to 100% (Gerbore et al., 2014a). Ribeiro and Butler (1995) found that survival of sugar beet

seedlings increased by 52.5% when grown in dual cultures of P. oligandrum and P. ultimum, in

comparison to single cultures of pathogenic P. ultimum. In similar studies, Ali-Shtayeh and Saleh

(1999) reported that the survival rate of cucumber seedling increased by around 34% in potting mix,

where P. oligandrum was co-inoculated with P. ultimum a opposed to P. ultimum alone. Seed-

coating methods using P. oligandum have also been done. McQuilken et al. (1990) concluded that

commercial pelleting or film-coating seeds of cress and sugar beet with P. oligandrum were as

effective as chemical drenches at reducing damping off caused by P. ultimum, R. solani and A.

cochlioides. Of the two seed treatments with P. oligandrum, the pelleting treatment was more

effective than the film-coating. However, the protection levels either with fungicidal applications or

seed coating with P. oligandrum were still insufficient in controlling damping off in soils with high

pathogen potential (McQuilken et al., 1990; Takenaka and Ishikawa, 2013). Al-Rawahi and

Hancock, (1998) reported fresh biomass of shoots and fruits of bell pepper was significantly higher

following co-inoculation soil treatments with Verticullium dahlia and P. oligandrum than those

treated with V. dahlia alone despite similar disease incidence. Due to inconsistency in disease

control provided by P. oligandrum, it is in general recommended that either multiple applications or

co-inoculations of P. oligandrum with other BCAs are more likely to reduce degrees of variability

in protection provided by P. oligandrum (Al-Rawahi and Hancock, 1998; Floch et al., 2009;

Holmes et al., 1998; Takenaka and Ishikawa, 2013; Gerbore et al., 2014a).


83

Depending on the target phytopathogenic species of Pythium, the antagonistic effect of P.

oligandrum may differ significantly. For example, P. aphanidermatum, P. graminicola and P.

vexans were unaffected by P. oligandrum (Jones and Deacon, 1995; Laing and Deacon, 1991),

while P. oligandrum was most virulent to P. heterothallicum, P. intermedium, P. irregulare and P.

ultimum (Foley and Deacon, 1986). Susceptibility of Pythium spp. to P. oligandrum antagonism can

vary greatly among isolates within a species and be influenced by environmental conditions (Al-

Rawahi and Hancock, 1998; Floch et al., 2009; Foley and Deacon, 1986; Takenaka and Ishikawa,

2013). In chapters 4, isolates of P. myriotylum varied in aggressiveness; those recovered from PSR

ginger were more aggressive and over a wider temperature range on ginger compared with isolates

of P. myriotylum recovered from other host crops. Similarly, isolates of P. myriotylum may vary in

their level of antagonism by P. oligandrum. The origin of the P. oligandrum may also be critical;

those isolated directly from soil collected around PSR ginger may have co-evolved with ginger

infecting isolates of P. myriotylum and therefore are more adapted to attack such strains. In this

study, interactions between P. myriotylum and P. oligandrum were investigated to determine the

potential of P. oligandrum as a BCA against P. myriotylum with the aim of suppressing disease

severity of PSR on ginger.

6.2. Materials and Methods

6.2.1. Pythium spp. cultures

Isolates of P. oligandrum (Po-So1 = UQ6080 and Po-So2 = UQ6085) were obtained from soils

around ginger rhizomes sampled in Yandina, Sunshine Coast by baiting from the soil following the

method of Stanghellini and Kronland (1985). The target phytopathogenic species of Pythium used

included one isolate of P. myriotylum Cap1 (Pm-Cap1 = UQ5993) recovered from capsicum which

had exhibited sudden wilt syndrome, one isolate of P. myriotylum Gin1 (Pm-Gin1 = UQ6512)

collected directly from a ginger rhizome with soft rot disease sampled from Yandina, Sunshine

Coast, Australia and one isolate of P. ultimum So1 (Pu-So1 = UQ6023) recovered from the soil

surrounding a ginger rhizome with soft rot. Working cultures for these isolates were maintained on

potato dextrose agar (PDA, Difco). For long term storage, the cultures were placed on half strength

2% corn meal agar (CMA) prepared from maize meal (Polenta) based on the protocol of Dhingra

and Sinclair (1995) and then submerged in sterile distilled water and stored at room temperature in

the dark.


84

6.2.2. Mycoparasitism of P. oligandrum

Microscopic observations of mycoparasitic capability of Po-So1 and Po-So2 against the

phytopathogenic Pythium isolates were carried out based on the descriptions of Laing and Deacon

(1991) with slight modifications. For this purpose, microscope slides were prepared as follows. One

side of an autoclaved cover slip was gently and quickly dipped into 0.3% (w/v) agar of molten

BCMA which was composed of CMA amended with 15% brown sugar (Bundaberg Rich Brown

Sugar). BCMA promotes the growth and formation of the characteristics spiny oogonia of P.

oligandrum. The molten media created a thin film covering the cover slip, that was left to set in a

laminar flow bench for a few seconds after which the cover slip was transferred, agar-film side up,

onto 2% water agar (WA) within a 90 mm dia Petri plate. Each plate was inoculated with a 5 mm2

plug of either Po-So1 or Po-So2 and the target phytopathogenic Pythium isolates growing actively

on PDA. The plugs were placed 2.5 cm from the edge of the cover slips and opposite to each other.

The plates were sealed with Parafilm and incubated in dark at 25 °C for 3 days. The cover slips

were then transferred onto microscopic slides with the agar film sides down and observed under a

compound microscope to check for parasitism by Po-So1 and Po-So2 following the ratings of

Ribeiro and Butler (1995). These ratings were based on the number of hyphal coils and internal

colonization of Po-So1 and Po-So2 on the target phytopathogens and are as follows.

- Type 0. Immune: No hyphal coiling observed

- Type 1. Resistant: A few incidence of hyphal coiling noted (less than 10 per cover slip) and

strictly limited to hyphal contact regions between Po-So1 and Po-So2 and the target isolates.

No internal colonization noted.

- Type 2. Slightly susceptible: More than 10 hyphal coils observed and coiling found beyond

the contact regions. Internal colonization appeared infrequently.

- Type 3. Moderately susceptible: Hyphal coiling observed abundantly, but some of the target

mycelia are free of Po-So1 and Po-So2 hyphal coils. Internal colonization also observed

abundantly.

- Type 4. Highly susceptible: Hyphal coiling and internal colonization observed throughout.

6.2.3. Growth competition of P. oligandrum

To assess the ability of Po-So1 and Po-So2 to compete with phytopathogenic Pythium spp., a slight

modification of pre-colonized plate method described by Berry et al. (1993) was used. The target

Pythium isolates were subcultured (5 mm2 plugs) on one side of a CMA Petri plate. Four replicate

plates were used per tested target Pythium isolates. The plate was incubated at 25 °C for 5 days by

which point the mycelia had nearly reached the other side of the plate. For each plate, a plug of P.

oligandrum was then introduced on the opposite side of the plate to the plugs of the tested Pythium


85

spp., and the plate continued to be incubated at the same temperature. The base of each plate was

marked with two 5 mm wide strip extending across the plate to include both inoculum plugs. After

3 and 7 days incubation, the medium and culture along the first and second strip, respectively were

excised. Each of the excised strips was subdivided into 5mm squares and plated onto a fresh plate of

BCMA in order of distance from the original P. oligandrum plug. The BCMA plates were

incubated again at 25 °C and examined after 7 days directly under an inverted microscope for the

presence of spiny oogonia. Presence of spiny oogonia indicated the extent of growth of P.

oligandrum into the mycelia of the target phytopathogenic isolates.

6.2.4. Effect of volatile compounds of P. oligandrum on growth of the targets

To assess the influence of volatiles emanating from Po-So1 and Po-So2 on the growth of other

Pythium species, the inverted plate technique from El-Katatny et al. (2006) was undertaken with

some modifications. Plugs of actively growing P. oligandrum were placed in centre of 90 mm PDA

and CMA Petri plates and left at room temperature (22-23 °C) for initial growth for 8 hours. Plugs

of target Pythium isolates were subcultured onto separate PDA plates, then within a laminar flow

bench the lids were removed and the plates containing the tested Pythium isolates were placed

upside down on top of the base of the P. oligandrum plates and sealed with Parafilm. These double-

stacked plates were incubated at 25 °C for 24 hours. Radial growth of the target Pythium isolates

was measured as linear distance and compared with a control treatment, which was treated in the

same fashion but without the presence of Po-So1 and Po-So2 cultures. There were four replicate

plates for each of the three phytopathogenic Pythium isolates.

6.2.5. Effect of non-volatiles compounds of P. oligandrum on growth of the targets

The influence of non-volatile metabolites produced by Po-So1 and Po-So2 on the subsequent

growth of target isolates of Pythium spp. was assessed using the cellophane disc technique adapted

from the description of Bradshaw-Smith et al. (1991). P. oligandrum was grown on surface of

autoclaved 85 mm dia cellophane discs, which were laid onto PDA plates (one disc/plate) so that

the entire surface of the plate was covered. The cellophane discs allowed metabolites produced

from P. oligandrum to diffuse through onto PDA surface, but did not allow the mycelia to penetrate

through. Two days after incubation at 25 °C, the P. oligandrum colonised cellophane discs were

removed and immediately the tested Pythium spp. were placed onto the PDA plates and their daily

growth on the PDA amended with the P. oligandrum metabolites was assessed. For the control

treatments, plates were treated in the same manner, but with non-colonised cellophane discs. There

were four replicate plates for each of the three phytopathogenic isolates.


86

Metabolites produced by P. oligandrum in liquid culture were also assessed against the growth of

the target Pythium spp. The method was modified from Dennis and Webster (1971). P. oligandrum

was grown in potato broth at pH = 5.8 for one month at 25 °C in the dark. Potato broth without

presence of P. oligandrum was used as control. The filtrate was strained through cheese cloth, and

then filtered through Whatman No. 1 paper (0.22 µm pore), warmed in a water bath set at 55 °C and

added to 55 °C-molten PDA medium. The filtrate-PDA mixture (50% v/v) was poured into Petri

plates. These plates were then inoculated with the phytopathogenic Pythium isolates, and the growth

rate was assessed and compared with the control.

Growth inhibition of tested Pythium spp. by metabolites of P. oligandrum was calculated based on

the formula below:

Growth inhibition (%) = C−T

C × 100

C is growth dia. of control plates

T is growth dia. of tested plates

6.2.6. In vitro pre-emerging damping off suppression

Dual culture assays on Petri plates were done to evaluate the efficacy of Po-So1 and Po-So2 at

suppressing pre-emergence damping caused by the selected Pythium isolates. Plugs (0.5 cm2) of P.

oligandrum and the tested phytopathogenic isolate cultures were plated opposite each other in Petri

plates containing CMA. The plates were incubated at 25 °C in the dark for up to 4 weeks. The pre-

emergence damping off assays were conducted with seeds of three crop species, rye (Secale

cereale), white millet (Panicum miliaceum) and wheat (Triticum sp.). Briefly, 10 surface disinfested

seeds were placed onto each of the CMA dual culture plate. The plate was incubated at 25° C for 7

days before rating for disease index. There were two replicate plates per tested phytopathogenic

isolate, and the assays were conducted twice. Negative control plates contained no culture and

positive control plates had a single culture of phytopathogenic isolate. The formula developed by

Zhang and Yang (2000) was used to calculate the disease index.

DI =∑ 𝑋𝑖/4010𝑖=1

- DI is disease index scaling from 0 to 1

- Xi is disease rating of the ith seed (from 1 to 10)

- Number 40 is equal to the number of seeds multiplying with the highest rating scale (from 0

to 4).

- Rating scale used in the experiment was: 0 = seed germinated and seedlings having no



87



6.2.7. Pot trial suppression of P. myriotylum on ginger plants

Since Pu-So1 and Pm-Cap1 isolates were non-pathogenic to ginger plants at 25 - 30 °C, they were

excluded from the pot trials. Tissue culture derived ginger plants (cv ‘Queensland’) were grown in

UC potting mix in 140 mm pots until the plants were about 50 cm high. Inoculum of Pm-Gin1 was

prepared using sorghum seeds as a substrate described in chapter 4. Po-So1 and Po-So2 were grown

in corn meal broth (CMB). The broth had been freshly prepared from 40 g corn meal (Polenta) in 1

L of distilled water (DW) cooked at 60 °C for 1 h then filtered through a double layer of cheese

cloth. The filtrate was made up to 1 L with DW and autoclaved at 121 °C for 20 min priot to

inoculation with P. oligandrum. One week after inoculation, the mycelial mats were harvested from

the CMB and blended in DW in order to make up a solution of oospores-mycelia homogenate (103

oospores/mL) which was used to drench ginger plants (50 mL/pot) at one week before and again

immediately after inoculation with Pm-Gin1 (2 sorghum seeds/pot). Immediately from time of Pm-

Gin1 inoculation onwards, the ginger plants were maintained in a water-logged state in a glasshouse

in which the temperature remained at 25 - 30 °C. Four replicate pots were used per treatment.

Disease severity levels (0 = plants remain green and healthy; 1 = leaf sheath collar discoloured and

lower leaves turned yellow; 2 = plants alive, but shoots either totally yellow or dead; and 3 = all

shoots dead) based on aboveground symptoms were recorded at 7, 14 and 21 days after inoculation

(Stirling et al., 2009). Attempts were made to re-isolate the Pm-Gin1, Po-So1 and Po-So2 either

from diseased rhizomes or from UC mix, in the latter case by baiting with carrot pieces (as in

chapter 4). The experiment was independently repeated.

All data were subjected to analysis of variance (ANOVA) and the mean separation was determined

by Tukey’s least significant difference (LSD) test (P = 0.05) performing with Minitab 16. Where

stated, data from repeated assays were pooled and analysed together if there were no significant

difference between the two repetitions.

6.3. Results

6.3.1. Mycoparasitism and growth competition of P. oligandrum against the targets

No hyphal coiling was observed on the thin film of BCMA on which only P. oligandrum was

present. Therefore, the presence of hyphal coils in dual cultures indicated the parasitizing capability

of Po-So1 and Po-So2 against the tested phytopathogenic Pythium spp. As shown in Table 1, Pm-

Gin1 was consistently moderately susceptible (Type 3) to mycoparasitism by both isolates of Po-


88

So1 and Po-So2. Pm-Cap1 was immune and slightly susceptible (Type 0 and Type 2) to

mycoparasitism by Po-So1 and Po-So2, respectively. Similarly, isolates of Po-So1 and Po-So2

showed differing levels of mycoparasitism towards Pu-So1. Pu-So1 was resistant (Type 1) to Po-

So1, but slightly susceptible to Po-So2 (Table 6.1).

Both isolates of Po-So1 and Po-So2 were able to grow on media already colonised by the

phytopathogenic isolates of Pm-Gin1 and Pu-So1, indicating that metabolites produced by the

biocontrol isolates nor the direct presence of the phytopathogenic mycelia did not have adverse

effects on growth and oospores production of Po-So1 and Po-So2. This was apparent by the

abundance of spiny oospores observed when segments (5 mm2) of culture were removed from the

dual cultures and assessed on the BCMA. Moreover, both the Po-So1 and Po-So2 isolates were able

to grow across the already colonised media by Pm-Gin1 and Pu-So1. However, for the Pm-Cap1

assay, no oogonia of Po-So1 and Po-So2 were observed indicating that neither of the two isolates P.

oligandrum was able to compete fully with this isolate (Table 6.1). Results indicated that both Po-

So1 and Po-So2 isolates were strong growth competitors against Pm-Gin1 and Pu-So1, but they

were not against Pm-Cap1 in which no spiny oospores were detected.

Table 6.1: Mycoparasitism based on the extent of hyphal coiling (Type 0-4, see text for

descriptions) and growth competition (0-7) based on the extent of colonisation in cm measured by

the occurrence of oogonial formation of P. oligandrum against P. myriotylum and P. ultimum (n =

4)

Mycoparasitic levels Growth competition

Po-So1 Po-So2 Po-So1 Po-So2

Pm-Gin1 3 a 3 a 7 a 7 a

Pm-Cap1 0 b 2 a 0 b 0 b

Pu-So1 1 b 2 a 7 a 7 a

None 0 b 0 b 7 a 7 a


5% - level as determined by Tukey’s test.

6.3.2. Effects of volatiles and non-volatiles produced by P. oligandrum on growth of the targets

Regardless of the media used whether CMA or PDA, the volatiles produced from the Po-So1 and

Po-So2 cultures on the inverted Petri plates technique had no negative effects on the growth of the

target Pythium isolates (P > 0.05). Growth of Pm-Gin1 was slightly promoted by volatiles collected


89

from P. oligandrum grown on PDA, but those volatiles collected from P. oligandrum grown on

CMA subsequently caused a slight inhibition of growth of Pm-Gin1 (only about 3% inhibition) (Fig

6.1). Both growth of Pm-Cap1 and Pu-So1 slightly decreased when treated with the volatiles.

Fig 6.1: Effects of volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and in

potato broth on growth of P. myriotylum and P. ultimum as assessed by linear growth on a Petri

plate. Negative values indicate growth promotion in media putatively infused with non-volatiles

from P. oligandrum. Bars represent standard deviation of four replicates.

The growth of all target Pythium isolates were stimulated when subcultured on PDA Petri plates

with non-volatiles produced by Po-So1 and Po-So2 that diffused through cellophane discs, that is

the growth was significantly faster than the control no volatiles. Growth of Pm-Gin1 was increased

by 40 - 52%, while growth of Pu-So1 and Pm-Cap1 were less promoted, increasing by only around

11% and 25%, respectively (Fig 6.2). Growth of the target Pythium isolates on PDA, which was

amended with filtrates collected from liquid cultures of Po-So1 and Po-So2, were however slightly -

moderately inhibited (Fig 6.2). Pm-Gin1 grew around 30% slower on filtrate-PDA than that of the

control, whereas growth of Pu-So1 and Pm-Cap1 were less impacted.

-60

-40

-20

0

20

40

Pm-Gin1 Pm-Cap1 Pu-So1

Gro

wh

t in

hib

itio

n (

%)

Po-So1 on PDA Po-So2 on PDA

Po-So1 on CMA Po-So2 on CMA


90

Fig 6.2: Effects of non-volatiles collected from Po-So1 and Po-So2 grown on cellophane discs and

in potato broth on growth of P. myriotylum and P. ultimum. Negative values indicate growth

promotion of non-volatiles. Bars represent standard deviation of four replicates.

6.3.3. In vitro suppression

All single cultures of the target Pythium isolates were highly aggressive (DI > 0.5) on the seeds of

millet, rye and wheat, killing the seeds either before or immediately after germination. Both isolates

of Po-So1 and Po-So2 were able to reduce DI significantly (P = 0.05) in dual culture plates with

Pm-Gin1. Similarly, interactions between Po-So1/Po-So2 and Pu-So1 in dual cultures also reduced

DIs significantly by 55% to 80%, compared with DIs recorded on single cultures of Pu-So1.

However, Po-So1 and Po-So2 were not able to suppress Pm-Cap1 in dual cultures and DIs > 0.9

were recorded. DIs recorded on single cultures of Pm-Cap1 and dual cultures of Pm-Cap1 and Po-

So1/Po-So2 were not significantly different (Fig 6.3).

-60

-40

-20

0

20

40

Pm-Gin1 Pm-Cap1 Pu-So1

Gro

wth

in

hib

itio

n (

%)

Po-So1 on cellophane Po-So2 on cellophane

Po-So1 in potato broth Po-So2 in potato broth


91

Fig 6.3: Disease index (0-1) recorded for millet, rye and wheat seeds/seedlings grown on single and

dual cultures of Pythium. Bars represent standard deviation of four replicates.

6.3.4. Pot trial suppression

Pot trials were undertaken to further investigate the role of P. oligandrum in control of PSR of

ginger. Presence of Po-So1 and Po-So2 in co-inoculated pots with Pm-Gin1 did not reduce disease

incidence on ginger, compared with pots inoculated with Pm-Gin1 alone. Typical above ground

symptoms of PSR disease were observed on the Pm-Gin1 inoculated control and the Po x Pm-Gin1

co-inoculated treatments from 7 DAI. At 21 DAI, nearly all these plants were dead and no

difference in disease severity was detected among treatment (Fig 6.4). No obvious PSR symptoms

were observed on controls pots and pots inoculated with Po-So1 and Po-So2 alone.

0

0.2

0.4

0.6

0.8

1

1.2D

isea

se i

nd

ex (

0-1

)

Millet Rye Wheat


92

Fig 6.4: Disease severity recorded on ginger plants inoculated with either P. oligandrum or P.

myriotylum or both at 7, 14 and 21DAI 25/30 °C with 10 h of photoperiods (bars represent standard

errors, n = 8). Data presented is for the combination of two pot trials as no significant difference in

disease severity was recorded on the two trials tested (P = 0.05). Disease severity rates from: 0 =

healthy plants; 1 = discoloured sheath collar and yellow lower leaves; 2 = plants alive, but shoots

either totally yellow or dead; and 3 = all shoots dead.

Pm-Gin1 was easily recovered from Pm or a combination of both Po and Pm species infested

potting mix at the end of the experiment using carrot as bait. Recovery of Po-So1 and Po-So2 from

infested pots occurred less frequently (Table 6.2).

Table 6.2: Percentage of carrot baits colonised by P. oligandrum, P. myriotylum or both following

exposure to soil used in the pot trials as shown in Fig 4 (n = 8, combining data from two replicate

pot trials)

Pot trial treatment Percentage recovery in carrot baits

P. oligandrum P. myriotylum

Po-So1 42.5 ± 7.0 0.0 ± 0.0

Po-So2 38.8 ± 9.0 0.0 ± 0.0

Po-So1 + Pm-Gin1 23.8 ± 2.0 97.5 ± 4.0

Po-So1 + Pm-Gin1 21.3 ± 5.0 98.8 ± 2.0

Po-So1 + Po-So2 + Pm-Gin1 27.5 ± 7.0 98.8 ± 2.0

Pm-Gin1 0.0 ± 0.0 100.0 ± 0.0

0

0.7

1.4

2.1

2.8

3.5D

isea

se s

ever

ity (

0 -

3)

7DAI 14DAI 21DAI


93

6.4. Discussion

This study demonstrated that representative isolates of P. myriotylum from capsicum and ginger

responded differently to the mycoparasite P. oligandrum. The isolate Pm-Gin1 was moderately

susceptible (Type 3) to mycoparasitism by P. oligandrum, while Pm-Cap1 was immune or slight

susceptible, Type 0 and Type 2 reactions, to the two isolates of P. oligandrum that were used. Our

results were consistent with other findings where isolates within the same Pythium sp. might exhibit

various degrees of susceptibility or antagonism from P. oligandrum (Floch et al., 2009; Foley and

Deacon, 1986; Takenaka and Ishikawa, 2013). According to Gerbore et al. (2014b) soil-borne host

pathogens were most vulnerable to mycoparasitism by P. oligandum when the latter was originally

recovered from the same rhizospheres as of the pathogens. Indeed, Pm-Gin1 was more susceptible

to endemic P. oligandrum, which had been isolated from soil sampled from around PSR ginger

infected with P. myriotylum, than Pm-Cap1 obtained from a capsicum showing sudden wilt.

Interestingly, Pm-Gin1 showed the consistent degree of susceptibility (Type 3) to the two P.

oligandrum isolates tested; it was even more susceptible than Pu-So1. P. ultimum is a well-known

host of P. oligandrum within the Pythium genus; there have been many successful examples of

using P. oligandrum to suppress P. ultimum infection of cress, cucumber, sugar beet and wheat

(Abdelzaher et al., 1997; Ali-Shtayeh and Saleh, 1999; Holmes et al., 1998; McQuilken et al., 1990;

Ribeiro and Butler, 1995). Therefore, by screening a bigger population of P. oligandrum recovered

from ginger soils where P. myriotylum is known to be present may lead to recovery of more

antagonistic strains of P. oligandrum.

P. oligandrum was capable of competing with phytopathogic species for space and nutrients,

subsequently reducing either disease incidence or disease severity on crops (Cwalina-Ambroziak

and Nowak, 2012; Martin and Hancock, 1987; Takenaka and Ishikawa, 2013). In this study, P.

oligandrum overgrew CMA plates colonised by Pm-Gin1 and Pu-So1, but the mycoparisite was not

able to grow on plates colonised by Pm-Cap1. This implied that the P. oligandrum isolates tested

here were strong growth competitors against Pm-Gin1 and Pu-So1 but not Pm-Cap1. However, the

capacity of the mycoparasitic Pythium sp. to grow across the pre-colonised culture plate could be a

general indicator of its ability to either derive nutrients from the media and/or to tolerate negative

effects of metabolic by-products produced from the pathogenic Pythium spp. Moreover, growth

medium was also important since CMA was found to be a more suitable medium for P. oligandrum

than PDA (Ali-Shtayeh and Saleh, 1999; Foley and Deacon, 1986). Therefore, failing to recover P.

oligandrum from CMA pre-colonised by Pm-Cap1 indicated that Pm-Cap1 was resistant to P.

oligandrum in addition to mycoparasitism evidence.


94

Attempts in collecting metabolites with an antibiotic funtion (Bradshaw-Smith et al., 1991; Gerbore

et al., 2014a; Whipps, 1987) in forms of volatiles and non-volatiles produced by P. oligandrum

were undertaken to assess growth suppressiveness of the mycoparasitic Pythium towards their

targets. Results in this study showed that regardless of the media used (whether PDA or CMA), the

volatile metabolites produced by P. oligandrum had little effect on the growth of tested Pythium

spp. By deploying the same inverted plate technique, Whipps (1987) observed that P. oligandrum

grown on PDA and tap water agar (TWA) media produced volatile compounds that inhibited

growth of Rhizoctonia solani, Sclerotinia sclerotiorum and Botrytis cinerea. Likewise, results from

the same technique conducted by Bradshaw-Smith (1991) indicated that growth inhibition of

Phoma medicaginis and Mycosphaerella pinodes was recorded when challenged with volatiles

produced from P. oligandrum.

The non-volatiles did have effect on growth of the pathogens. Cellophane discs on which P.

oligandrum was grown significantly stimulated growth of the tested Pythium spp presumably

because of non-volatiles present in the discs. We found up to 50% growth stimulation of Pm-Gin1

when grown on the non-volatiles diffused through cellophane discs. Although Whipps (1987) also

observed growth promotion, increasing by 7-10% when F. oxysporum and S. sclerotiorum were

exposed to non-volatiles produced by P. oligandrum collected through cellophane discs supported

by TWA, our finding should be noticed. Additionally, Bradshaw-Smith et al. (1991) found that non-

volatiles diffused through cellophanes discs were non-toxic to fungi tested, including F. solani, P.

medicaginis and M. pinodes. Foley and Deacon (1986) also concluded that there was no evidence

that P. oligandrum produced non-volatile toxins against F. culmorum, R. solani or P. ultimum, and

that consequently no adverse effect on the growth of these phytopathogens was observed.

This differed, however, when the non-volatiles were collected as filtrates from potato broth cultures

of P. oligandrum since a range of growth inhibition of the tested Pythium spp. was observed.

Therefore, it should be noted that antibiosis by P. oligandrum varies depending on strains

themselves and their targets as well as other antibiotic factors, including media and temperature

used (Whipps, 1987). Besides, stresses might impact on antibiotic production of P. oligandrum

(Gerbore et al., 2014a). Hence, under certain conditions it would still be warranted to assess

antibiosis of P. oligandrum against new target hosts.

In general, virulence based on degrees of mycoparasitism and growth competition of P. oligandrum

against tested Pythium spp. was equivalent to disease control on millet, rye and wheat in the in vitro

culture assays. Therefore, presumably millet, rye and wheat were protected from Pm-Gin1 and Pu-


95

So1 infection due to the mycoparasitism and growth competition by P. oligandrum than by any

toxics properties produced by P. oligandrum. These observations are consistent with those of

McQuilken et al. (1990) who suggested that P. oligandrum plays a role as both a mycoparasite and

a competitor against pathogens rather than as an antibiotic producer. Many other workers also found

evidence to support roles of mycoparasitism and growth competition by P. oligandrum. Al-Rawahi

and Hancock (1998) suggested that mycoparasitism of P. oligandrum resulted in a population

reduction of Verticillim dahliae, a wilt pathogen of capsicum, and reduced disease severity was

decreased. The root surface of sugar beet seedlings was colonized by P. oligandrum within 24 h

post inoculation, and protected the crop from subsequent infection by P. ultimum (Martin and

Hancock, 1987). Ali-Shtayeh and Saleh (1999) suggested P. oligandrum suppressed P. ultimum on

cucumber by competition for nutrients and space. Similarly, Takenaka and Ishikawa (2013)

reported sugar beet roots were protected from A. cochlioides infection by early establishment of P.

oligandrum on the root surface of the crop, and reduced disease severity as a result of growth

competition on the crop. In our study, Pm-Cap1 was immune to P. oligandrum tested, and

consequently it was probably not surprising that P. oligandrum did not protect millet, rye and wheat

seeds from infection by Pm-Cap1 in dual cultures assays in Petri plates.

In the pot trial however, P. oligandrum did not provide protection for ginger plants against P.

myriotylum Gin1. These observations contrasted with the in vitro assay and we suggest that poor

colonisation in potting mix by P. oligandrum might have been the cause of this conflictingly

observation and perhaps the soil drench application may have been inadequate in allowing

sufficient colonisation. Soil drenching with an oospore suspension has shown to be effective in

either direct or indirect control of A. cochlioides, V. dahlia, B. cinerea, Phaeomoniella

chlamydospora and Ralstonia solanacearum (Al-Rawahi and Hancock, 1998; Floch et al., 2009;

Takenaka and Ishikawa, 2013; Takenaka et al., 2008; Yacoub et al., 2016), this could be soil

medium dependent. According to Holmes et al. (1998) drenching of mycelial suspension of P.

oligandrum directly to potting mix achieved higher control efficacy of damping off induced by P.

ultimum, compared with oospore drench since active growth of mycelial fragments colonised the

potting mix and rhizosphere quickly prior to the colonization of the pathogen, leading to effective

control of the hosts (Holmes et al., 1998; Martin and Hancock, 1987). Regardless of application

methods, activity and interaction of P. oligandrum against target species appeared dependent on

environmental factors such as temperature, matric potential, pH (Al-Rawahi and Hancock, 1998;

Holmes et al., 1998) and native microbial communities (Vallance et al., 2012; 2009). To some

extent, soil and root colonisations by P. oligandrum are also influenced by soil management and

plant physiology (Gerbore et al., 2014b; Yacoub et al., 2016). Therefore, it would be interesting for


96

future studies on biotic and abiotic factors to expand on the understanding about colonisations and

establishment of P. oligandrum on ginger and adjacent rhizophere.

To sum up, this study provided preliminary knowledge regarding the use of P. oligandrum as a

biocontrol agent against PSR pathogens of ginger. P. oligandrum parasitised and outcompeted Pm-

Gin1 and Pu-So1. There was no evidence that P. oligandrum produces metabolic toxins against Pm-

Gin1 and Pu-So1. P. oligandrum reduced disease of millet, rye and wheat in vitro; however, P.

oligandrum failed to protect ginger from Pm-Gin1 in pot trials. P. oligandrum has been shown to

promote plant growth and activate plant defences; however, this was not evaluated in our work

(Benhamou et al., 2012; Gerbore et al., 2014a). These multi-faceted interactions of P. oligandrum

make the parasitic potential unpredictable due to factors impacting control efficacy of this potential

BCA. Therefore, it is worth assessing interactions between P. oligandrum and new target pathogens

and their host crops as well as factors affecting P. oligandrum. A limitation of this work is that only

two strains of P. oligandrum were evaluated and it is possible that there are other strains of P.

oligandrum that could provide more control of PSR. Hence, selection and screening a larger

population of P. oligandrum recovered from soils from around PSR ginger for better strains will be

of future interest.

Chapter 7 │Record of Pythiogeton ramosum in Australia

97

Chapter 7 : PYTHIOGETON RAMOSUM ASSOCIATED WITH SOFT ROT DISEASE OF

GINGER (ZINGIBER OFFICINALE) IN AUSTRALIA5

Abstract

In addition to Pythium spp., 15 isolates of a Pythium-like organism were recovered from ginger

with soft rot symptoms. These Pythium-like isolates were identified as Pythiogeton (Py.) ramosum

based on its morphology and the ITS sequences. There is relatively little known about this organism

therefore pathogenicity assays and phylogenetic studies were done to examine the role, if any, of

this oomycete in PSR of ginger. Our pathogenicity tests in Petri plates conducted on excised ginger,

carrot (Daucus carota), sweet potato (Ipomoea batatas), potato (Solanum tubersum) and radish

(Raphanus sativus) roots/tubers showed that Py. ramosum was not pathogenic to excised ginger and

radish sticks at 27 °C, but it was pathogenic to carrot, sweet potato and potato sticks. However, the

excised ginger was colonised by Py. ramosum resulting in soft rot and discolouration at temperature

above 30 °C. The pot trials on ginger plants showed that Py. ramosum was also only pathogenic to

ginger at high temperature (30-35° C). Ginger plants inoculated with Py. ramosum exhibited initial

symptoms of wilting and leave yellowing, which were indistinguishable from those of Pythium soft

rot of ginger, at 10 days after inoculation. In addition, morphological and phylogenetic studies

indicated that isolates of Py. ramosum were quite variable and our isolates obtained from soft rot

ginger were divided into two groups based on these variations. This is also for the first time Py.

ramosum is reported as a pathogen on ginger at high temperatures.

Keywords: Pythiaceae, zoospores, narrow hyphae, isolation, cultivation, host range

7.1. Introduction

The genus Pythiogeton (Py.) was first described by Minden (1916) with three species descriptions

based on non-pure cultures. Pythiogeton, together with Pythium and Phytophthora, belong in the

family Pythiaceae although this little studied genus was thought to be a candidate for a new family

5 This chapter was published as:

Le, D.P., Smith, M.K., Aitken, E.A.B., 2015. Pythiogeton ramosum, a new pathogen of soft rot disease of ginger

(Zingiber officinale) at high temperatures in Australia. Crop Prot. 77, 9-17.

http://dx.doi.org/10.1016/j.cropro.2015.07.012

Le, D.P., Smith, M., Aitken, E., 2014. First report of Pythiogeton ramosum (Pythiales) in Australia. Australas. Plant

Dis. Notes 9, 1-3. DOI 10.1007/s13314-014-0130-5


98

named Pythiogetonaceae (Dick, 2001; Voglmayr et al., 1999). With recent sequence analyses of

CoxI (cytochrome c oxidase subunit 1) and ITS (internal transcribed spacer) regions of Pythiogeton

spp., the genus was revealed to be closely related to Pythium and has consequently remained within

the Pythiaceae (De Cock et al., 2010; Huang et al., 2013; Robideau et al., 2011). The genus was

distinguished from Pythium by the presence of narrow hyphae, production of zoospores outside

asymmetrical sporangia and strictly plerotic oospores with extreme thick oospore walls when

present (Huang et al., 2013; Voglmayr et al., 1999). The genus was believed to be recalcitrant for

research because of its unculturable and unstorable features (Jee et al., 2000). However, Ann et al.

(2006) and Huang et al. (2013) recently reasoned that as long as suitable media and working

approaches were implemented, pure cultures can be obtained. In fact, Py. ramosum-like isolates

recovered from cypress and English ivy were able to grow normally on oomycete selective medium

(PARPH), V8 juice (V8), corn meal agar (CMA), potato dextrose agar (PDA) and carrot agar (CA)

media (Silva-Rojas et al., 2004). Huang et al. (2013) also found that the genus is in fact very

common, but it is usually not recovered during isolation. Hence, once typical narrow glassy and

refractive hyphae are recognized, Pythiogeton could be isolated before Pythium or other species

overgrow the cultures.

Approximately 100 years after being described as a new genus, only 15 different species have been

ascribed to Pythiogeton including six new species from Taiwan (Huang et al., 2013). Most

Pythiogeton spp. have been isolated from decayed materials, so they have been consequently

recorded as saprophytes. The exceptions are Py. zeae and Py. zizaniae which are pathogenic to corn

and water bamboo, respectively (Ann et al., 2006; Jee et al., 2000). Pythiogeton ramosum (syn. Py.

autossytum) (Huang et al., 2013) appears to be the most commonly reported species around the

world (Drechsler, 1932; Hamid, 1942; Hsieh and Chang, 1976; Minden, 1916; Nascimento et al.,

2012; Sparrow, 1932; Watanabe, 1974; Zebrowska, 1976). Recently, Py. ramosum was isolated

from diseased cypress and English ivy (Silva-Rojas et al., 2004), and Py. ramosum-like isolates

from California induced symptoms of root and basal stalk rots on wild rice (Doan et al., 2013).

Ginger is the most common spice in the Zingiberaceae and it is cultivated worldwide throughout

tropical and subtropical regions (Kavitha and Thomas, 2008). In Australia, ginger has been grown

in Sunshine Coast, Queensland since 1916 principally for the fresh and confectionery market

(Camacho and Brescia, 2009; Hogarth, 2000). In 2009, Pythium soft rot (PSR) of ginger rhizomes

caused by Pythium myriotylum was reported for the first time in Australia. The disease was highly

destructive and resulted in up to 100% loss in some fields (Stirling et al., 2009). Quarantine

strategies have been implemented to prevent further spread of the pathogen, and a number of


99

control methods have also been applied to suppress disease development. Despite these measures,

P. myriotylum still remains a serious threat to ginger production in southeast Queensland (Smith et

al., 2011; Stirling et al., 2012). Because there are many Pythium spp. associated with PSR of ginger

reported around the world (Dohroo, 2005), we have proposed that there is probably more than one

Pythium sp. causing PSR of ginger in Australia. To test this theory, in 2012, ginger with PSR

symptoms caused by Pythium spp. was sampled from selected farms at Yandina, on the Sunshine

Coast, Queensland, Australia. A number of Pythium spp., including Pythium aphanidermatum,

Pythium deliense, Pythium graminicola and more were recovered either directly from PSR ginger

rhizomes or soils collected around PSR ginger (unpublished data). Most of the recovered Pythium

spp. were recorded for their pathogenicity on ginger elsewhere (Dohroo, 2005). Along with these

Pythium isolates, isolates of Py. ramosum were also recovered from PSR ginger. In this study, we

assessed the diversity of Py. ramosum based on their morphology, sequences of ITS, CoxI and

CoxII regions and pathogenicity in both in vitro and in vivo conditions.


7.2.1 Py. ramosum isolation

Py. ramosum was isolated from PSR ginger collected from two farms at Yandina: farm 1 at

26°32’S, 152°56’E and farm 2 at 26°33’S, 152°56’E. Isolation was as described in chapter 3. Four

selected isolates from the collection, including UQ6020, UQ6053, UQ6211 and UQ6214 (Table

7.1) were used in this study for morphological study, growth rate and pathogenicity assays.

Working cultures of these isolates were maintained on PDA (Difco). To store the isolates, cultures

on PDA were subcultured onto half strength CMA. Cultures of the isolates were incubated in the

dark at 25 °C for a week, then plugs (0.5 cm2) were placed in a sterile vial containing 5 mL

sterilised distilled water (DW). Vials were sealed with Parafilm and kept in the dark at room

temperature for future use.

Table 7.1: List of Pythiogeton spp. used in this study, isolates with BRIP numbers were used for

morphological comparisons, growth rate and pathogenicity.

Isolates BRIP no.* Genbank accession number References

ITS CoxI CoxII

Py. ramosum UQ6020 BRIP59948 KF151204 KM819500 KM819510 This study6


Py. ramosum UQ6207 KF151206 KM819502 KM819512 This study7

6 Isolates recovered from diseased ginger sampled from Yandina farm 1 (26°32’S, 152°56’E)


100

Py.ramosum UQ6208 KF151207 KM819503 KM819513 This study7







Py. ramosum BCRC-CH30007 JQ610179 - - Huang et al. (2013)







Py. abundance BCRC-CH30016 JQ610184 - - Huang et al. (2013)

Py. abundance BCRC-CH30026 JQ610189 - - Huang et al. (2013)

Py. microzoosporumBCRC-CH30013 JQ610183 - - Huang et al. (2013)

Py. oblongilobum BCRC-CH30013 JQ610182 - - Huang et al. (2013)

Py. oblongilobum BCRC-CH30022 JQ610187 - - Huang et al. (2013)

Py. paucisporum BCRC-CH30035 JQ610196 - - Huang et al. (2013)

Py. paucisporum BCRC-CH30039 JQ610198 - - Huang et al. (2013)

Py. proliferatum BCRC-CH30037 JQ610197 - - Huang et al. (2013)

Py. proliferatum BCRC-CH30040 JQ610199 - - Huang et al. (2013)

Py. puliensis BCRC-CH30010 JQ610181 - - Huang et al. (2013)



Py. zeae Lev3132 HQ643405 HQ708452 - Robideau et al.

(2011)

Py. zizaniae BCRC-CH30003 JQ610176 - - Huang et al. (2013)



7 Isolates recovered from diseased ginger sampled from Yandina farm 2 (26°33’S, 152°56’E)


101

Cultures were also checked for their viability after five months, one- and two-year storage by

placing three of the plugs back onto CMA and observing for Pythiogeton recovery.

7.2.2 Growth and morphology

The effect of temperature on daily radial growth rate of four isolates: UQ6020, UQ6053, UQ6211,

and UQ6214 was assessed on 9 cm Petri plates at 5 °C intervals from 10 to 40 °C (as described in

chapter 3). The assay was repeated three times and there was one plate per repetition.

A grass leaf technique was undertaken to observe morphological characteristics of Py. ramosum

where plugs of the culture growing on PDA were transferred into Petri plates containing 25 mL of

sterile distilled water and two pieces of sterile grass leaves each. The plates were kept at 27 °C for

at least one week and then the plates were analysed directly under an inverted microscope for the

presence of sporangia and appressoria. The method of Huang et al. (2013) was modified slightly to

observe zoospore differentiation and zoospores. Plugs of culture growing on PDA were submerged

into plates containing 20 mL corn meal broth (as the preparation of CMA but without agar

amendment), the plates were then incubated at 27 °C for 2 days. After 2 days growth, the corn meal

broth was pipetted out and the mycelia mats were rinsed three times with sterile DW at 20 min

intervals. The mats were then soaked in 0.01 M calcium carbonate solution (Nyochembeng et al.,

2002), the plates were kept at 27 °C for another 1-2 days. The plates were examined either directly

using an inverted microscope (Leica) or using a compound Olympus BH-2 after staining slides with

cotton blue.

7.2.3. DNA extraction and amplification

DNA extraction was carried out as in chapter 3. The two universal primers ITS 1 (5’-

TCCGTAGGTGAACCTGCGG-3’) and ITS 4 (5’-TCCTCCGCTTATTGATATGC-3’) (White et

al., 1990) were used to amplify DNA from ITS regions including the 5.8S rRNA region using a

thermal cycler machine (Mastercycler). In some cases, ITS5 (5’-

GGAAGTAAAAGTCGTAACAAGG-3’) (White et al., 1990) was substituted for the ITS1 in PCR.

The reaction was initially denatured for 5 min at 94 °C, followed by 35 cycles which commenced

with continuous denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, and extending for 90 s at

72 °C. The reaction was eventually extended for 10 min at 68 °C. When the primer ITS5 was used,

the reaction was firstly denatured for 5 min at 96 °C, followed by 35 cycles beginning with 95 °C

for 30 s, another 30 s at 52 °C and 90 s at 72 °C. The final extension was at 72 °C for 10 min

(Huang et al., 2013). After finishing the PCR, the desired DNA was then run under 110V in 1.5%

agarose gel for 45 min to check for a PCR product.


102

Two other coding regions, including CoxI and CoxII were also amplified. Two primers

OomCoxILevup (5’-TCAWCWMGATGGCTTTTTTCAAC-3’) and Fm85mod (5’-

RRHWACKTGACTDATRATACCAAA-3’), and other two FM66 (5’

TAGGATTTCAAGATCCTGC 3’) and FM58 (5’ CCACAAATTTCACTACATTGA 3’) were

used for CoxI and CoxII amplification, respectively (Martin, 2000; Robideau et al., 2011).

7.2.4. Sequencing and analysing sequences

PCR products were sent to Macrogen (Korea) for sequencing services. Both forward and reverse

directions were sequenced and the consensus sequences were made up after manual alignment and

comparison using Clustal 2.0.2. MEGA 5 was used to align the sequences themselves and with

other Pythiogeton spp. from Genbank to analyse whether there were any genetic variations.


In vitro pathogenicity on excised ginger

The above isolates of Py. ramosum and a well-known pathogen, Pythium deliense UQ6021 which

was selected as a positive control, were used in the pathogenicity tests. The assay was conducted to

assess for aggressiveness of the tested isolates on ginger sticks at 25, 30 and 35 °C (as in chapter 3).

The assay was also conducted on radish (Raphanus sativus), carrot (Daucus carota), potato

(Solanum tubersum) and sweet potato (Ipomoea batatas) tubers at 27 °C. The assay was repeated

twice and there were two excised sticks per replicate.

In vitro pre-emerging damping off test

Actively growing cultures of tested Py. ramosum isolates including the positive control P. deliense

UQ6021 were subcultured onto 1.5% WA to screen for their capability of causing pre-emerging

damp off on rye (Secale cereale), white millet (Panicum miliaceum), buck wheat (Fagopyrum

esculentum), wheat (Triticum sp.), barley (Hordeum vulgare), carrot, cucumber (Cucumis sativus),

eggplant (Solanum melongena), lettuce (Lactuca sativa) and spring onion (Allium cepa). The assay

was carried out at 27 °C as described previously in chapter 3. The disease index was calculated

based on descriptions of Zhang and Yang (2000).

DI =∑ 𝑋𝑖/4010𝑖=1

- DI is disease index scaling from 0 to 1

- Xi is disease rating of the ith seed (from 1 to 10)


103

- Number 40 is equal to the number of seeds multiplying with the highest rating scale (from 0

to 4).

- Rating scale used in the experiment was: 0 = seed germinated and seedlings having no




Glasshouse pathogenicity test on ginger plants

Tissue culture ginger plants (Queensland cultivar) growing on steamed University of California

(UC) potting mix in 140 mL pots and approximately 50 cm high (approximately 4 months after

deflasking), the pots were inoculated by inserting four hyphae-colonised autoclaved sorghum seeds

under the soil to a depth of 25-30 mm. The sorghum seeds were prepared as previous descriptions in

chapter 3. The inoculated pots were kept saturated with water from time of inoculation onwards by

placing the pots on saucers which were kept full with tap water. The pathogenicity test was run at

25/30 °C and 30/35 °C (night/day) in a temperature controlled cabinet. The cabinet was set for a 10

h photoperiod. The pathogenicity test at 30/35 °C was repeated twice. There were three replicate

pots per isolate. Disease severity levels based on aboveground symptoms were recorded at 7, 14 and

21 days after inoculation applying the following scales: 0 = healthy plants; 1 = leaf sheath collar

starting discoloration and some leaves starting to turn yellow; 2 = plant alive, but shoots either

totally yellow or dead; and 3 = all shoots dead (Stirling et al., 2009). Attempts were made to re-

isolate the Py. ramosum and P. deliense UQ6021 either from diseased rhizomes or from UC mix, in

the latter case by baiting with carrot pieces (as in chapter 3).

All data from pathogenicity tests and the growth rate experiment were subjected to analysis of

variance (ANOVA) and the means were compared using Tukey’s least significant difference (LSD)

test (P = 0.05) when treatment effects were detected. The ANOVA and comparisons of means were

performed with Minitab 16.

7.3. Results

7.3.1. Growth rate and morphological characteristics

Py. ramosum was identified based on its typical morphology: narrow coenocytic hyaline hyphae

with numerous short branches at right angles with main hyphae, sickle-shape appressoria, and

globose, ellipsoid and long bursiform sporangia (Fig 7.1). However, differences in sporangial

morphology were observed in the isolates recovered from each farm. Group I isolates from one

farm formed different sporangia in sizes and shapes, while group II isolates from the other farm


104

formed only globose sporangia on one-week-old cultures (Fig 7.2). However by the third week the

cultures from both groups became more difficult to distinguish from one another due to the

admixture of bursiform and globose sporangia, even though sporangial sizes of group II isolates

were larger than those of group I isolates (Table 7.2).

Fig 7.1: Typical sickle-shape appressoria and short branch hyphae at right angles with main hyphae

(A), a typical terminal long bursiform sporangium observed on a mature culture (B) (bar = 20 µm)

Fig 7.2: Sporangia of Py. ramosum on one-week-old cultures: an admixture of globose, eclipsoid

and bursiform sporangia observed on cultures of Group I isolates (A); only globose sporangia

observed on cultures of Group II isolates (B) (bar = 20 µm)

Py. ramosum did not grow at 10 or 40 °C; optimum growing temperatures were between 30 and 35

°C. At 10 °C, Py. ramosum stopped growth, but it could regrow if incubated again at 25 °C,

whereas there was no regrowth at 40 °C. The mean growth rate at 25 °C was 21.0 and 21.3 mm/24 h

on PDA and CMA respectively (Fig 7.3). All isolates grew well on the different media, including

PDA, CMA, CMA + 3P, half strength CMA, WA, and potato and corn meal broths. The isolates

were still viable in the storage conditions described above after two years although it took up to a

week for some isolates to recover on CMA at 27 °C.

A B


105

Table 7.2: Morphological comparison between two groups of Py. ramosum isolated from ginger in

this study

Morphological features Py. ramosum group I (UQ6020

and UQ6053)

Py. ramosum group II (UQ6211 and

UQ6214)

Hyphae width (µm) 2-5 (-7.5) 2-5 (-7.5)

Appressoria (µm) Sickle shape (8-12 (-16) x 22-26

(-32))

Sickle shape (7.5-12.5 (-15) x 24-26 (-

34))

Sporangia (µm) Mostly terminal, globose (17-36

(-50)), ellipsoid (29-41 (-50) x

31-77 (-125)), ovoid (32-43 (-

51) x 45-60 (-70)), obovoid-

elongate (39-50 (-62) x 72-129

(-222)), peanut-shape (37-45 (-

52) x 92-116 (-160))

Mostly terminal, globose (20-46 (-

72)), ovoid (35-44 (-63) x 40-58 (-

79)), elongate (32-45(-68) x 70-130 (-

238)), peanut-shape (42-49 (-55) x

130-157 (-192)), utriform (52-60 (-73)

x 115-127 (-148), reinform (35-60 x

135-145), obpyriform (30-62 (-75) x

100-107)

Zoospore size (µm) 12-16 (-18) 12-16 (-18)

Growth rate at 25 °C

on PDA and CMA

(mm)

20.43 and 20.98 21.73 and 21.62


106

Fig 7.3: Growth rate comparison between four isolates of Py. ramosum on PDA at different

temperatures (P<0.01). A bar is representing for a standard deviation of three means.

7.3.2. DNA sequences

Complete sequences of the ITS region including the 5.8S rDNA showed absolute similarity of all

isolates to each other, except UQ6020 and UQ6053, which showed a single base pair substitution

from adenine to guanine at position 844 in 861 bp long sequences. When all available sequences

(isolates from Australia and Taiwan) were compared together, there were 11 single substitution

points along ITS sequence. Australian isolates showed 99-100% similarity to those of Py. ramosum

deposited recently in Taiwan (Huang et al., 2013). The sequencing results supported the species

identification based on morphological characteristics. Based on maximum likelihood tree of the ITS

region, all ten isolates were grouped in one cluster along with other Py. ramosum obtained from

Genbank with high bootstrap value support (100%). Phylogenetic analyses indicated that Py.

ramosum was from the same ancestor with subtle genetic variations and had a separate position

with other Pythiogeton spp. (Fig 7.4). Sequences of CoxI and CoxII were also amplified and

deposited in Genbank. However, with limited reference sequences for CoxI and CoxII available in

Genbank it was not possible to identify any close alignments. Sequence alignment of the CoxI

region of Australian isolates of Py. ramosum showed four single substitution points along 700 bp

long sequences on the basis of which Australian isolates were split into two groups (Fig 7.5). On the

other hand, sequences of the CoxII region were homologous (data not shown).

0

5

10

15

20

25

30

35

10 15 20 25 30 35 40

Ra

dic

al

gro

wth

ra

te (

mm

/24

h)

Temperature (°C)

UQ6020 UQ6053

UQ6211 UQ6214


107


species using DNA sequences encoded from the ITS gene. The numbers at the nodes are the

percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at

http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access-

code=d72e813919072ae4f8d28bd1665f0b31&format=html

http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access-code=d72e813919072ae4f8d28bd1665f0b31&format=html



108


species using DNA sequences encoded from the CoxI gene. The numbers at the nodes are the

percentage of trees from bootstrap analysis (2000 replications). Access to trees can be found at

http://purl.org/phylo/treebase/phylows/study/TB2:S16932?x-access-

code=d72e813919072ae4f8d28bd1665f0b31&format=html


All tested Py. ramosum isolates were non-pathogenic on excised ginger pieces at 25 °C, but at

higher temperature Py. ramosum colonised and caused excised ginger sticks to discolour and rot.

All isolates of Py. ramosum were most aggressive at 35 °C and the aggressiveness did not vary

between tested isolates (Fig 7.6). All isolates were also pathogenic on carrot, sweet potato and

potato tubers 27 °C. The tested tubers were decayed, soft and brown in colour and Py. ramosum

was reisolated after placing decayed tissue onto CMA + 3P. P. deliense UQ6021 was more

aggressive at 25 and 30 °C, but it was less aggressive at 35 °C than the Py. ramosum isolates tested

(P = 0.05). On ginger plants, no visual above ground symptoms were observed from Py. ramosum

infested pots at 25/30 °C, but symptoms were recorded at 30/35 °C (Fig 7.7). There were no

obvious symptoms observed in pots inoculated with P. deliense UQ6021 in all assays. Symptoms

induced by Py. ramosum were indistinguishable from PSR symptoms caused by Pythium spp.

Yellowing appeared first on lower leaves, then moved upward and resulted in the whole plant

becoming yellow, wilting and eventually resulted in the plant’s death. Control plants remained

green and healthy during the experiments. Disease severity levels recorded for group I isolates were

higher than those for group II, but they were not significantly different at P = 0.05. The results were

similar in the second pathogenicity test at 30/35 °C. Py. ramosum was reisolated directly from the




109

infected ginger rhizomes. Py. ramosum was also isolated from the infested potting mix by baiting

with excised carrot roots after four days of incubation.

Fig 7.6: Mean colonization of Py. ramosum and P. deliense UQ6021 based on recovery of 1 cm

segments from 5.5 cm long ginger pieces onto culture plates at 3 days after inoculation at 25, 30 and

35 °C in dark (bars represent standard errors, n = 4).

Fig 7.7: Disease severity levels (0-3) recorded on ginger infected with Py. ramosum and P. deliense

UQ6021 at 30/35 °C (night/day) (bars represent standard errors, n = 6).

0

1

2

3

4

5

6

25 30 35

Mea

n s

pea

d o

f P

yth

ium

an

d P

yth

iog

eto

n (

cm)

Temperature (°C)

P. deliense UQ6021 Py. ramosum UQ6020 Py. ramosum UQ6053

Py. ramosum UQ6211 Py. ramosum UQ6214

0

0.5

1

1.5

2

2.5

3

3.5

7DAI 14DAI 21DAI

Dis

ease

sev

erit

y l

evel

s

P. deliense UQ6021 Py. ramosum UQ6020 Py. ramosum UQ6053

Py. ramosum UQ6211 Py. ramosum UQ6214


110

Py. ramosum isolates caused very low levels of disease on seeds and seedlings of all rotation crops

tested with no significant difference from the control treatment (Table 7.3). However, Py. ramosum

was pathogenic on bean, cauliflower, capsicum and lettuce, but it did not attack seeds and seedlings

of carrot and cucumber (Table 7.3; Fig 7.8). The positive control, P. deliense UQ6021 was very

aggressive on all tested host species (disease index > 0.5).

Fig 7.8: Cauliflower seedlings were attacked by Py. ramosum turning brown and rotten (left) in

comparison to white and healthy seedlings in the control (right).

Py. ramosum BRIP59948 Control


111

Table 7.3: Comparisons of disease indices (0-1) for eight vegetable and five common rotation crops in ginger fields inoculated with P. deliense

UQ6021 and Py. ramosum

Isolates Bea

n

Carr

ot

Cap

sicu

m

Cau

lifl

ow

er

Cu

cum

ber

Egg p

lan

t

Let

tuce

Sp

rin

g o

nio

n

Rye

Mil

let

Bu

ck w

hea

t

Wh

eat

Barl

ey

P. deliense UQ6021 0.9 a 0.9 a 0.9 a 0.8 a 1.0 a 0.8 a 0.8 a 0.8 a 0.9 a 0.9 a 0.4 a 1.0 a 0.7 a

Py. ramosum UQ6020 0.1 bcd 0.3 b 0.5 b 0.5 a 0.1 b 0.7 ab 0.2 bc 0.5 a 0.2 b 0.1 b 0.2 b 0.5 b 0.0 b

Py. ramosum UQ6053 0.0 cd 0.2 b 0.5 b 0.5 a 0.1 b 0.3 b 0.1 c 0.5 ab 0.1 b 0.2 b 0.2 b 0.2 b 0.0 b

Py. ramosum UQ6211 0.4 b 0.2 b 0.4 bc 0.5 a 0.0 b 0.3 b 0.2 bc 0.5 ab 0.1 b 0.1 b 0.2 b 0.3 b 0.0 b

Py. ramosum UQ6214 0.3 bc 0.2 b 0.4 b 0.5 a 0.1 b 0.5 ab 0.4 b 0.5 a 0.2 b 0.2 b 0.3 b 0.2 b 0.0 b

Control 0.0 d 0.1 b 0.2 c 0.1 b 0.1 b 0.3 b 0.0 c 0.2 b 0.1 b 0.1 b 0.1 b 0.1 b 0.0 b

Values followed by different letters within a column show a statistically significant difference at the 5% - level as determined by Tukey’s test.


112

7.4. Discussion

Pythiogeton ramosum was first isolated from plant debris in 1916 by Minden (1916) and it has

since been commonly recovered from materials under anaerobic conditions (Czeczuga et al., 2005;

El-Hissy et al., 1994; Huang et al., 2013; Nascimento et al., 2012). It was believed that Py.

ramosum was a saprophyte and until recently its pathogenicity on living plants had not been

confirmed (Ann et al., 2006). The results from this study allowed us to conclude that Py. ramosum

is indeed pathogenic to several hosts, including this first report on ginger, and that its pathogenicity

is also dependent on temperature. Pathogenicity of Pythiogeton has also been recorded from two

other Pythiogeton spp.: Py. zeae (Jee et al., 2000) and Py. zizaniae (Ann et al., 2006). Pythiogeton

zeae caused basal stalk rot of corn but also attacked tomato, melon fruits and carrot roots (Jee et al.,

2000), while Py. zizaniae was specific to water bamboo (Zizania latifolia) (Ann et al., 2006).

Although Py. ramosum in this study was isolated directly from ginger rhizomes with symptoms of

soft rot, it was not pathogenic on fresh ginger rhizome tissues and living ginger plants until the

temperature reached 30-35 °C, which corresponded to its optimum growth temperature. In addition,

host range test results for five common rotation crops and some vegetable crops indicated that Py.

ramosum isolated from ginger was a moderate pathogen on bean, capsicum, cauliflower, lettuce and

spring onion seedlings even at 27 °C. Since waterlogged soil was required for infection, it might be

suggested that under high temperature and waterlogged conditions, which are stressful to the ginger

plant, might increase susceptibility to infection. However, typical symptoms of PSR were not

observed on positive control plants inoculated with P. deliense. P. deliense is a high temperature

preference species (max growth at 40 °C) with a wide host range including ginger (Haware and

Joshi, 1974; Plaats-Niterink, 1981). Also in our assays, P. deliense was pathogenic on ginger

rhizomes at different temperatures and on all tested crops. Hence, pathogenicity of Py. ramosum to

ginger at high temperature can be confirmed.

The symptoms induced by Py. ramosum infection were indistinguishable from those caused by

Pythium spp. such as P. myriotylum and P. aphanidermatum. Additionally, these temperature and

soil moisture conditions often occur in ginger fields during Queensland’s summer, so it is proposed

that Py. ramosum infected ginger may be misidentified due to its similar symptoms to PSR of

ginger. Furthermore, Py. ramosum was re-isolated from the infected rhizomes to fulfil Koch’s

postulates. This is the first report of Py. ramosum as an additional pathogen of soft rot disease on

ginger. Species in the Pythiogeton genus are mostly saprophytic. The recent occurrence of diseases

caused by newly emerging pathogenic Pythiogeton spp. such as Py. zeae in Korea, Py. zizaniae in

Taiwan and Py. ramosum-like in USA may be due to environmental changes including global

warming. A very typical example is P. helicoides, an emerging pathogen under high temperature


113

conditions. P. helicoides was rarely recorded as a pathogen, but since 2002 it has been reported as

an aggressive pathogen on many host plants (Kageyama, 2014).

Huang et al. (2013) observed that isolates of Py. ramosum from Taiwan produced different types of

sporangia depending on whether Py. ramosum was floated in either sterile or non-sterile field water.

It could be reasoned that morphological variation of Py. ramosum isolates from Taiwan was due to

response of isolates to nutritional conditions. Similarly, isolates of Py. autossytum, which was

considered a conspecific species of Py. ramosum by Huang et al. (2013), formed entirely different

types of sporangia when growing in/on distilled water and string bean agar (Drechsler, 1932).

However, morphological variation was also observed in our research where Py. ramosum isolates

from two groups were manipulated to produce sporangia in the same manner by floating Py.

ramosum cultures on plates containing only sterile distilled water and pieces of grass leaves. It is

obvious that morphology of Py. ramosum is variable and this could result in misidentification if

morphology alone is used for identification. Based on our results, however, morphological variation

of Py. ramosum was not the only criterion for differentiating the two groups of our isolates. The

division of the two groups of Py. ramosum isolates was also supported by mycelial behaviour,

temperature response and molecular sequences. Group I isolates showed sparse aerial mycelia when

growing on PDA and CMA. On the other hand, Group II isolates showed no aerial growth on

culture media. Group I isolates grew faster than Group II isolates at 20 °C, whereas Group II

isolates grew faster at 35 °C (P = 0.05). It is interesting to note that all recently isolated Pythiogeton

spp. reported in the literature have a high temperature preference; most of them grow optimally at

temperatures above 30 °C, but not over 37 °C (Ann et al., 2006; Huang et al., 2013; Jee et al., 2000)

and this was also observed for our Py. ramosum collection. Additionally, a fine intraspecific

variation with one base pair substitution was noticed on ITS sequence alignment between these two

groups. A genetic variation within Py. ramosum populations collected from different hosts and

locations was seen by comparison with other ITS sequences obtained from Genbank (Huang et al.,

2013). Moreover, with four single point substitutions along CoxI sequences, it is suggested that Py.

ramosum is a relatively complex taxon. With only a few sequences available for identification of

Pythiogeton to species level, which are mainly based on the ITS region, identification of

Pythiogeton relies currently on its morphology. However, unlike Pythium which is well known for

similarity in morphology among species, Pythiogeton seems to vary in its morphology within the

species which, as indicated, has its limitations. Except for some recently described species (Ann et

al., 2006; Huang et al., 2013; Jee et al., 2000), previous species such as Py. nigrescens, Py.

transversum, Py. utriforme were mainly described based on impure and irreproducible cultures, so

their identification based on morphology may be in doubt.


114

From the perspective of isolation and maintenance of pure cultures, Pythiogeton has been reported

to be recalcitrant for study due to its unculturable characteristics and requirement for a specific

growth medium (Ann et al., 2006; Huang et al., 2013; Jee et al., 2000). However, our Py. ramosum

isolates grew well on different media, including PDA and WA which were previously reported not

suitable for mycelial growth of Pythiogeton (Ann et al., 2006; Jee et al., 2000). Likewise, Py.

ramosum-like isolates recovered from cypress and English ivy were also able to be cultured on a

number of different media (Silva-Rojas et al., 2004). Huang et al. (2013) reported the genus

Pythiogeton is common in soil habitats and could be cultured using modified PDA medium. Unlike

isolates of Py. zeae recovered from diseased corn (Zea mays), which lost their viability when

subcultured (Jee et al., 2000), our Py. ramosum isolates were still viable after subculturing and

under storage conditions for up to two years. It appears that sporangia produced on half strength

CMA are the main structures responsible for Py. ramosum survival since Py. ramosum is known as

a heterothallic species, which does not produce oospores on single culture. Additionally, we failed

to produce oospores from our Py. ramosum on dual cultures. Because there was no loss of

germination of our Pythiogeton ramosum isolates after two years of storage, it is proposed that the

storage method reported herein could be implemented to preserve Pythiogeton for the long term

with minimum subculturing.

It has been well documented that PSR of ginger is more serious when it occurs in association with

either Fusarium spp. or Meloidogyne spp. or Ralstonia sp. (Dohroo, 2001; Gupta et al., 2010;

Mathur et al., 2000; Rajan et al., 2002). Therefore, it is possible that a similar interaction occurs

between Pythium spp. and Py. ramosum. Due to similar symptoms induced by Py. ramosum and

Pythium sp. on ginger in pot trials, soft rot caused Py. ramosum may be misdiagnosed in the field. It

is therefore necessary to develop a quick tool to detect and monitor Py. ramosum in infected ginger

and in soils. For Pythium, many selective media and baiting materials have been undertaken

successfully to recover and enumerate Pythium populations from soils. In many cases, isolation of

Pythiogeton is often more difficult since Pythiogeton is usually overgrown by Pythium on culture

plates (Huang et al., 2013). Compared with other molecular techniques, LAMP (loop-mediated

isothermal amplification) is able to detect a target pathogen without a requirement of pure DNA

templates. LAMP is an accurate, cheap, fast and robust technique and can be carried out in the field

(Fukuta et al., 2013; Notomi et al., 2000). Therefore, monitoring Py. ramosum together with

Pythium spp. in ginger fields by application of LAMP would be of interest and practical benefit to

farmers.

Chapter 8 │General conclusions and discussion

115

Chapter 8 : GENERAL CONCLUSIONS AND DISCUSSION

In Australia, ginger is a small cash crop producing about AUD 15.6 million at farm gate value per

annum (Camacho and Brescia, 2009). However, from a regional perspective it provides significant

levels of employment, particularly as first-order processing of the crop contributes another AUD 80

million to the local economy. Since the first record in 2007of PSR on the two oldest ginger farms,

Pythium myriotylum still appears as a pathogen of major concern for the ginger industry. This study

was initiated to contribute to a better understanding of Pythium species causing PSR on ginger

through an assessment of Pythium diversity on ginger farms on the Sunshine Coast, Australia.

Within this chapter, a summary of findings, discussion and recommendations for future

investigations are reviewed.

8.1. Summary of findings

The first research chapter (chapter 3) covers the re-examination of species status of P. myriotylum

attributed to the PSR outbreaks of ginger on the Sunshine Coast reported by Stirling et al. (2009). P.

zingiberis-like morphological features of P. myriotylum isolates recovered from PSR ginger were

compared with those produced by reference isolates of P. myriotylum CBS254.70 and P. zingiberis

NBRC30817. All studied isolates shared similar size of oogonia, oospores, and number of

antheridia per oogonium. A typical coiling of the antheridial stalk around the oogoinal stalk before

coming in contact, as originally described for P. zingiberis, was also observed in P. myriotylum

isolates in this study. Both plerotic and aplerotic oospores were recorded in the studied isolates.

Conserved gene fragments extracted from whole genome sequence data showed high degree of

homology, ranging from 99.4 to 100% identity among the isolates. The phylogenetic tree

constructed based on these gene fragments enabled a grouping of P. myriotylum and P. zingiberis

into a separate cluster to other lineages. In vitro pathogenicity assays showed that tested isolates

were capable of attacking different tested plant materials. Finally, it was recommended that the

reference isolate of P. zingiberis NBRC30817 should be reassigned to the taxon P. myriotylum and

P. myriotylum was confirmed as the causal pathogen of PSR disease of ginger in Australia.

A Pythium population study was reported in chapter 4. Eleven Pythium spp. isolated from PSR

ginger and soils sampled from around PSR ginger and were identified based on morphology and

DNA sequences of the ITS region. Only three of the 11 Pythium spp., including P. myriotylum, P.

graminicola and P. spinosum were isolated directly from PSR ginger. Additional sequences of the

CoxI, CoxII and β-tubulin of the P. myriotylum collection exhibited a high degree of homology


116

among the P. myriotylum isolates collected from different ginger farms. In vitro pathogenicity tests

on excised ginger rhizome showed that P. aphanidemartum, P. deliense, P. myriotylum, P.

splendens, P. spinosum and P. ultimum were the most pathogenic. P. myriotylum recovered initially

from PSR ginger was the only pathogen inducing PSR symptoms on ginger in pot trials at a

temperature range from 20 - 35 °C. P. aphanidermatum only attacked and induced PSR on ginger

within the narrower temperature range of 30 - 35 °C. P. oligandrum and P. perplexum recovered

from soils appeared non-pathogenic in all assays.

In chapter 5, the genetic diversity based on SNP genotyping of P. myriotylum isolates obtained from

different hosts and origins is presented. Gene fragments (22 loci) were extracted from whole

genome sequences of four P. myriotylum and one P. zingiberis isolates derived from Illumina

sequencing. True and unique SNPs occurred more frequently in PSR P. myriotylum isolates than

those of others. A total of 129 SNPs was identified along the studied genes. Of these, there were 44

synonymous and 85 non-synonymous SNPs. SNP frequency was 7.64 SNPs/kb. Digestion of PCR

products of the partially amplified CoxII locus with the HinP1I enzyme allowed the PSR P.

myriotylum strains to be distinguished from other P. myriotylum and Pythium spp. and as well as

fungi. PCR-RFLP of the CoxII was sensitive enough to detect PSR P. myriotylum strains directly

from artificially inoculated ginger rhizomes without a requirement of pure cultures.

In chapter 6, studies on the interaction on the PSR pathogen by a mycoparsite, P. oligandrum

recovered from soils collected from around PSR ginger, are described. P. myriotylum Gin1

originally isolated from PSR ginger was moderately susceptible to P. oligandrum based on

mycoparasitism assay. P. myriotylum was not however adversely affected by metabolites produced

by P. oligandrum. The studies did show that P. oligandrum was capable of reducing the disease

index recorded on seedlings of millet, rye and wheat grown on dual cultures of P. oligandrum and

P. myritotylum Gin1. However, P. oligandrum was not able to mitigate disease severity of ginger

when co-inoculated with P. myriotylum Gin1 in pot trials. Interestingly in all assasys conducted, P.

myriotylum Cap1, which was originally isolated from sudden wilt on capsicum, was not negatively

impacted by ginger field derived P. oligandrum, indicating existence of possible host specificity by

P. oligandrum-isolates.

The study also revealed that PSR ginger in Australia was attributed to not only Pythium spp. but

also Pythiogeton (Py.) ramosum, a little studied oomycete genus (chapter 7). A total of 15 isolates

was recovered and identified based on morphology and the ITS region. Py. ramosum was not

pathogenic on excised ginger rhizome and ginger plants at temperature below 30 °C. Typical


117

symptoms of PSR on ginger plants in pot trials were induced by Py. ramosum once the tested

temperature was above 30 °C. Based on sequence diversity of the ITS and CoxI genes and also

temperature response, Py. ramosum isolates were divided into two groups. This is the first report of

Py. ramosum associated with soft rot disease of ginger.

8.2. Discussion

The first report of PSR on ginger was more than 100 years ago in India (Butler, 1907), but the

disease is relatively new to Australia. Therefore, accurate identification of the pathogen involved in

the PSR diseased ginger is crucial to the development and improvement of control strategies.

However, species boundaries among Pythium spp. are not always clear cut. Different Pythium spp.

might share similar morphology (Garzón et al., 2007; Nechwatal and Lebecka, 2014). On the other

hand, the same Pythium sp. might exhibit variation in morphology (Al-Sheikh and Abdelzaher,

2010; Barr et al., 1996; Tojo et al., 1998). Therefore, Pythium identification is not always an easy

task for pathologists with little taxonomic experience (Schroeder et al., 2013). The work is even

more challenging when recent evidence supports natural outcrossing in Pythium resulting in

possible divergent phyto-, patho- and eco-types (Francis and St Clair, 1993; Harvey et al., 2001;

Nechwatal and Lekecka, 2014). With the advent of sequencing technologies, many closely related

Pythium spp. have been either distinguished or reunited (Lévesque and De Cock, 2004; Robideau et

al., 2011). Along with morphological and physiological re-examinations, pathogenicity tests, and

sequences obtained from the whole genome, the results in this study confirmed the identification of

P. myriotylum as the causal pathogen of PSR of ginger in Australia.

A number of different Pythium spp. has been reported to be associated with PSR of ginger

worldwide (Dohroo, 2005). Although in this study 11 Pythium spp. were recovered from soils and

PSR ginger sampled from the Sunshine Coast, Australia, P. myriotylum was predominant. This

species has caused major losses to ginger crops in many other countries, including China, India,

Fiji, Korea and Taiwan (Kim et al., 1997a; Kumar et al., 2008; Stirling et al., 2009; Tsai, 1991;

Yuan et al., 2013). However, other Pythium species, for example P. aphanidermatum and even

another oomycete genus that being Pythiogeton ramosum are also capable of causing soft rot of

ginger at temperatures above 30 °C in soils. These pathogens pose additional threats to the ginger

industry. P. myriotylum is well-known to have wide host range (Plaats-Niterink, 1981), but strains

of P. myriotylum recovered initially from PSR ginger exhibited a certain degree of host preference

(data not presented). Likewise, P. myriotylum isolates originally obtained from cocoyam appeared

to have some degree of host specificity to cocoyam (Perneel et al., 2006). Sequence analyses of four

loci of strains of PSR P. myriotylum recovered from ginger in Australia unveiled genetic uniformity


118

of the population implying that P. myriotylum has probably been dispersed from one original

source.

A uniform Australian population of PSR P. myriotylum was revealed. However, when compared

with other P. myriotylum isolates from various hosts and geographic origins, intraspecific variation

was observed. This first comparison of multiple genes (up to 22 genes) within the nuclear and

mitochondrial genomes among the five P. myriotylum isolates from ginger, capsicum and peanut

discovered little genetic divergence (from 0% to up to 1% difference among the studied genes).

Unlike highly intraspecific species such as P. irregulare, P. helicoides, P. mercurial and P.

ultimum, sequence divergence among isolates might be seen up 3.59% (Barr et al., 1996; 1997;

Belbahri et al., 2008; Garzón et al., 2005; Kageyama et al., 2007; Matsumoto et al., 2000).

Interestingly, sequences of PSR P. myriotylum isolates from Australia were 100% identical in most

genes studied. Therefore, SNPs discovered in PSR P. myriotylum isolates are unique and identical,

which have provided useful markers for detection and identification. A powerful molecular tool,

PCR-RFLP of the CoxII gene was successfully deployed to detect and diffrentiate PSR P.

myriotylum strains from others without the need of isolation of pure cultures. Similarly, Gómez‐

Alpízar (2011) also successfully developed PCR-RFLP of the ITS locus to detect and differentiate

P. myriotylum isolates which were pathogenic to cocoyam from non-pathogenic P. myriotylum to

cocoyam.

In this study, the recovery of P. oligandrum, a well-known wide host range antagonist was

examined to determine if an antagonistic interaction exists with the PSR P. myriotylum which could

lead to potential disease control. Although P. oligandrum did not produce toxic metabolites against

the pathogen hosts, P. myriotylum Gin1, P. myriotylum Cap1 and P. ultimum So1, its

mycoparasitism and competitiveness appeared to be responsible for reductions of the disease index

recorded on millet, rye and wheat grown on dual cultures of P. oligandrum and P. myriotylum

Gin1/P. ultimum So1. Both mycoparasitism and growth competition were principle mechanisms for

suppressing diseases caused by a number of pathogens, namely Verticillum daliae, P. ultimum and

Aphanomyces cochlioides (Al-Rawahi and Hancock, 1998; Martin and Hancock, 1987; Ali-Shtayeh

and Saleh, 1999; Takenaka and Ishikawa, 2013). However, P. oligandrum failed to protect ginger

plants from P. myriotylum Gin1 infection in pot trials. One possible reason for this failure may be

poor colonisation of P. oligandrum in the potting mix. To some extent, soil and root colonisation by

P. oligandrum are influenced by soil management and plant physiology (Gerbore et al., 2014b;

Yacoub et al., 2016).


119

8.3. Recommendations

P. myriotylum was confirmed as the predominant causal agent causing PSR of ginger in Australia,

but the pathogen has exhibited some degree of host preference to ginger. More pot trials evaluating

different crop species for susceptibility to P. myriotylum are warranted, as these data may have

significant contributions to PSR control program through crop rotations. Additionally, the P.

myritoylum population recovered originally from PSR ginger appeared genetically uniform

suggesting the pathogen has been disseminated throughout the industry from one source. Therefore,

stricter on-farm biosecurity to prevent further spread is required. Although detection and

identification of PSR P. myriotylum strains were accurately achieved by PCR-RFLP, it is still time

consuming. Hence, novel and fast turn-around SNP detection approaches, including LAMP and

SMAP 2 need to be developed to quickly track and monitor pathogenic P. myriotylum in the field.

In addition, fast and sensitive detection approaches to monitor other recently reported PSR

pathogens that being P. aphanidermatum and Py. ramosum are also warranted. Discovery of

numerous genetic variants of PSR P. myriotylum strains when compared with other P. myriotylum

strains were theorised to be responsible for aggressiveness and pathogenicity as well as their

variable response to environmental and ecological changes. Therefore, attempts to correlate the

genetic variation and these changes are open for further investigations. Because there was a limited

number of P. oligandrum isolates included in interaction assays, further research with P.

oligandrum populations in soils around PSR ginger to discover strains with improved antagonistic

properties is needed. These could be used in integration with other control approaches for more

sustainable management of PSR of ginger.

References

120

References

Abbasi, P.A., Riga, E., Conn, K.L., Lazarovits, G., 2005. Effect of neem cake soil amendment on

reduction of damping-off severity and population densities of plant-parasitic nematodes and

soilborne plant pathogens. Can. J. Plant Pathol. 27, 38-45.

Abbott, C.L., Gilmore, S.R., Lewis, C.T., Chapados, J.T., Peters, R.D., Platt, H.W., Coffey, M.D.,

Lévesque, C.A., 2010. Development of a SNP genetic marker system based on variation in

microsatellite flanking regions of Phytophthora infestans. Can. J. Plant Pathol 32, 440-457.

Abdelzaher, H.A., Elnaghy, M., Fadl-Allah, E., 1997. Isolation of Pythium oligandrum from

Egyptian soil and its mycoparasitic effect on Pythium ultimum var. ultimum the damping-off

organism of wheat. Mycopathologia 139, 97-106.

Agrios, G.N., 2005. Plant pathology. Elsevier Academic Press, Burlington, Mass.

Ali-Shtayeh, M., Saleh, A.F., 1999. Isolation of Pythium acanthicum, P. oligandrum, and P.

periplocum from soil and evaluation of their mycoparasitic activity and biocontrol efficacy

against selected phytopathogenic Pythium species. Mycopathologia 145, 143-153.

Ali-Shtayeh, M.S, 1986. The genus Pythium in the West Bank and Gaza Strip. Research and

Documentation Centre An-Najah National University, Nablus.

Ali-Shtayeh, M.S., Len, L.-H.C., Dick, M.W., 1986. An improved method and medium for

quantitative estimates of populations of Pythium species from soil. T. Brit. Mycol. Soc. 86,

39-47.

Allain-Boulé, N., Tweddell, R., Mazzola, M., Bélanger, R., Lévesque, C.A., 2004. Pythium

attrantheridium sp. nov.: taxonomy and comparison with related species. Mycol. Res. 108,

795-805.

Al-Rawahi, A.K., Hancock, J.G., 1998. Parasitism and biological control of Verticillium dahliae by

Pythium oligandrum. Plant Dis. 82, 1100-1106.

Al-Sa'di, A.M., Deadman, M.L., Al-Said, F.A., Khan, I., Al-Azri, M., Drenth, A., Aitken, E.A.B.,

2008a. First report of Pythium splendens associated with severe wilt of muskmelon (Cucuinis

melo) in Oman. Plant Dis. 92, 313-313.

Al-Sa'di, A.M., Drenth, A., Deadman, M.L., DeCock, A.W.A.M., Al‐Said, F.A., Aitken, E.A.B.,

2008b. Genetic diversity, aggressiveness and metalaxyl sensitivity of Pythium spinosum

infecting cucumber in Oman. J. Phytopathol. 156, 29-35.

Al-Sheikh, H., Abdelzaher, H.M.A., 2010. Differentiation between two isolates of Pythium ultimum

var. ultimum isolated from diseased plants in two different continents. J. Biol. Sci. 10, 306-

315.

References

121

Ann, P.J., Huang, J.H., Wang, I.T., Ko, W.H., 2006. Pythiogeton zizaniae, a new species causing ba

sal stalk rot of water bamboo in Taiwan. Mycologia 98, 116-120.

Anonymous, 1963. Plant protection research. Diseases Report. Hawaiian Sug. Plrs’ Ass. Exp. Stn

1963, 27-33.

Anonymous, 2010. Ginger, Vibrant Life, Hagerstown, United States, Hagerstown, pp. 17.

Arif, M., Garzon, C., Corona, F.O., 2011. Detection and discrimination of Pythium

aphanidermatum and P. deliense by single probe based real time PCR and multiplex end

point PCR. Phytopathology 101, S9.

Atai, Z., Atapour, M., Mohseni, M., 2009. Inhibitory effect of ginger extract on Candida albicans.

Am. J. Appl. Sci. 6, 1067-1069.

Bahramisharif, A., Lamprecht, S.C., Spies, C.F.J., Botha, W.J., Calitz, F.J., McLeod, A., 2013.

Pythium spp. associated with rooibos seedlings, and their pathogenicity toward rooibos, lupin,

and oat. Plant Dis. 98, 223-232.

Bailey, A.M., Mitchell, D.J., Manjunath, K.L., Nolasco, G., Niblett, C.L., 2002. Identification to the

species level of the plant pathogens Phytophthora and Pythium by using unique sequences of

the ITS1 region of ribosomal DNA as capture probes for PCR-ELISA. FEMS Microbiol. Lett.

207, 153-158.

Bala, K., Robideau, G.P., Lévesque, C.A., Cock, A.W.A.M.d., Abad, Z.G., Lodhi, A.M., Shahsad,

S., Ghaffar, A., Coffey, M.D., 2010. Phytopythium Abad et al. gen. nov. and Phytopythium

sindhum Lodhi et al. sp. nov. Persoonia. 24, 136-137.

Barr, D.J.S., Warwick, S.I., Desaulniers, N.L., 1996. Isozyme variation, morphology, and growth

response to temperature in Pythium ultimum. Can. J. Bot. 74, 753-761.

Barr, D.J.S., Warwick, S.I., Desaulniers, N.L., 1997. Isozyme variation, morphology, and growth

response to temperature in Pythium irregulare. Can. J. Bot. 75, 2073-2081.

Belbahri, L., McLeod, A., Paul, B., Calmin, G., Moralejo, E., Spies, C.F.J., Botha, W.J., Clemente,

A., Descals, E., Sánchez-Hernández, E., Lefort, F., 2008. Intraspecific and within-isolate

sequence variation in the ITS rRNA gene region of Pythium mercuriale sp. nov. (Pythiaceae).

FEMS Microbiol. Lett. 248, 17-27.

Benhamou, N., le Floch, G., Vallance, J., Gerbore, J., Grizard, D., Rey, P., 2012. Pythium

oligandrum: an example of opportunistic success. Microbiology 158, 2679-2694.

Benhamou, N., Rey, P., Picard, K., Tirilly, Y., 1999. Ultrastructural and cytochemical aspects of the

interaction between the mycoparasite Pythium oligandrum and soilborne plant pathogens.

Phytopathology 89, 506-517.

References

122

Bent, E., Loffredo, A., Yang, J.-I., McKenry, M.V., Becker, J.O., Borneman, J., 2009.

Investigations into peach seedling stunting caused by a replant soil. FEMS Microbiol. Ecol.

68, 192-200.

Berry, L.A., Jones, E.E., Deacon, J.W., 1993. Interaction of the mycoparasite Pythium oligandrum

with other Pythium species. Biocontrol Sci. Techn. 3, 247-260.

Bhai, R.S., Kishore, V.K., Kumar, A., Anandaraj, M., Eapen, S.J., 2005. Screening of rhizobacterial

isolates against soft rot disease of ginger (Zingiber officinale Rosc.). JOSAC 14(2), 130-136.

Bhatia, M., Sharma, A., 2012. Antibacterial activities of Trigonella foenum-graecum and Zingiber

officinale. Int. J. Pharm. Sci. Res. 3, 3228-3228.

Bradshaw-Smith, R.P., Whalley, W.M., Craig, G.D., 1991. Interactions between Pythium

oligandrum and the fungal footrot pathogens of peas. Mycol. Res. 95, 861-865.

Braun, H., 1924. Geranium stem rot caused by Pythium complectens n. sp. Host resistance

reactions, significance of Pythium-type of sporangial germination. J. Agr. Res. 29, 399-419.

Brookes, A.J., 1999. The essence of SNPs. Gene 234, 177-186.

Brozova, J., 2002. Exploitation of the mycoparasitic fungus Pythium oligandrum in plant

protection. Plant Prot. Sci. 38, 29-35.

Brumfield, R.T., Beerli, P., Nickerson, D.A., Edwards, S.V., 2003. The utility of single nucleotide

polymorphisms in inferences of population history. Trends Ecol. Evol. 18, 249-256.

Butler, E.J., 1907. An account of the genus Pythium and some Chytridiaceae. Memoirs of the

Department of Agriculture, India (Botanical Series) 1, p70.

Butler, E.J., Bisby, G.R., 1960. The fungi of India. The Indian Council of Agricutural Research,

New Delhi.

C.M.I., 1966. Pythium myriotylum. Commonwealth Agricultural Bureaux, Great Britain.

Camacho, H.E., Brescia, A., 2009. The Australian ginger industry: overview of market trends and

oppotunities. Department of Employment, Economic Development and Innovation, The State

of Queensland, p. 54.

Chagnon, M.C., Belanger, R.R., 1991. Tolerance in greenhouse geraniums to Pythium ultimum.

Plant Dis. 75, 820-823.

Chellemi, D.O., Mitchell, D.J., Kannwischer-Mitchell, M.E., Rayside, P.A., Rosskopf, E.N., 2000.

Pythium spp. associated with bell pepper production in Florida. Plant Dis. 84, 1271-1274.

Chen, W., Hoy, J., Schneider, R., 1992. Species-specific polymorphisms in transcribed ribosomal

DNA of five species. Exp. Mycol. 16, 22-34.

Chen, W., Hoy, J.W., 1993. Molecular and morphological comparison of Pythium arrhenomanes

and Pythium graminicola. Mycol. Res. 97, 1371-1378.

References

123

Chen, W., Hoy, J.W., Schneider, R.W., 1991. Comparisons of soluble proteins and isozymes for

seven Pythium species and applications of the biochemical data to Pythium systematics.

Mycol. Res. 95, 548-555.

Chen, W.D., 1992. Restriction-fragment-length-polymorphisms in enzymatically amplified

ribosomal dnas of 3 heterothallic Pythium species. Phytopathology 82, 1467-1472.

Chowdhury, E.K., Hasan, M.M., Mustarin, K., Hasan, M.S., Fancy, R., 2009. Efficacy of different

fungicides in controlling rhizome rot of ginger. J. Agrofor. Environ. 3(1), 179-181.

Christensen, L.K., Thinggaard, K., 1999. Solarization of greenhouse soil for prevention of Pythium

root rot in organically grown cucumber. J. Plant Pathol. 81(2), 137-144.

Cwalina-Ambroziak, B., Nowak, M., 2012. The effects of biological and chemical controls on

fungal communities colonising tomato (Lycopersicon esculentum Mill.) plants and soil. Folia

Hortic. 24, 13-20.

Czeczuga, B., Kiziewicz, B., Godlewska, A., 2003. Zoosporic fungi growing on leeches

(Hirudinea). Pol. J. Environ. Stud. 12, 361-369.

Czeczuga, B., Mazalska, B., Godlewska, A., Muszyńska, E., 2005. Aquatic fungi growing on dead

fragments of submerged plants. Limnologica - Ecology and Management of Inland Waters, 35,

283-297.

Da Silva, M.P., Munkvold, G., 2010. Interactions between lesion nematodes and Pythium ultimum

on maize seedlings. Phytopathology 100, S28-S28.

Dai, T.T., Lu, C.C., Lu, J., Dong, S., Ye, W., Wang, Y., Zheng, X., 2012. Development of a loop-

mediated isothermal amplification assay for detection of Phytophthora sojae. FEMS

Microbiol. Lett. 334, 27-34.

Dake, G.N., 1995. Diseases of ginger (Zingiber officinale Rosc.) and their management. JOSAC 4,

40-48.

De Cock, A.W., Mendoza, L., Padhye, A.A., Ajello, L., Kaufman, L., 1987. Pythium insidiosum sp.

nov., the etiologic agent of pythiosis. J. Clin. Microbiol. 25, 344-349.

De Cock, A.W., Robideau, G.P., Bala, K., Coffey, M.D., Abad, Z.G., Lévesque, C.A., 2010.

Pythium, Pythiogeton and prov. name Phytopythium: The current status for the species in the

genera. Phytopathology 100, S150-S150.

Deadman, M., Al Hasani, H., Al Sa’di, A., 2006. Solarization and biofumigation reduce Pythium

aphanideramtum induced damping-off and enhance vegetative growth of greenhouse

cucumber in Oman. J. Plant Pathol. 88(3), 335-337.

De-Guzman, C.C., Siemonsma, J.S., 1999. Plant Resources of South East Asia: Spices. Backhuys

Publishers, Leiden, Netherlands.

References

124

Denman, S., Knoxdavies, P.S., Calitz, F.J., Lamprecht, S.C., 1995. Pathogenicity of Pythium

irregulare, Pythium sylvaticum and Pythium ultimum var ultimum to lucerne (Medicago

sativa). Australas. Plant Pathol. 24, 137-143.

Dennis, C., Webster, J., 1971. Antagonistic properties of species groups of Trichoderma: I.

Production of non-volatile antibiotics. Trans. Brit. Mycol. Soc.57, 25-39.

Dhingra, O.D., Sinclair, J.B., 1995. Basic plant pathology methods., 2nd ed. CRC Press, United

States of America.

Dick, M., 2001. Straminipilous fungi: systematics of the peronosporomycetes including accounts of

the marine straminipilous protists, the plasmodiophorids and similar organisms. Kluwer

Academic Publishers, Netherlands.

Dick, M.W., 1990. Keys to Pythium. The College of Estate Management, Whiteknights, Reading,

Great Britain.

Doan, H.K., Davis, R.M., Sartori, F.F., Marcum, D.B., 2013. First report of a Pythiogeton sp.

causing root and basal stalk rot of wild rice in california. Plant Dis. 98, 851-851.

Dohroo N.P., 2001. Etiology and management of storage rot of ginger in Himachal Pradesh. Indian

Phytopathol. 54, 49-54.

Dohroo, N.P., 1987. Pythium ultimum on Zingiber officinale. Indian Phytopathol. 40 (2), 275.

Dohroo, N.P., 2005. Diseases of ginger, In: Ravindran, P.N., Babu, K.N. (Eds.), Ginger, the genus

Zingiber. CRC Press: Boca Raton, pp. 305-340.

Dohroo, N.P., Kansal, S., Mehta, P., Ahluwalia, N., 2012. Evaluation of eco-friendly disease

management practices against soft rot of ginger caused by Pythium aphanidermatum. Plant

Dis. Res. 27 (1), 1-5.

Dohroo, N.P., Sharma, S.L., 1985. Pythium pleroticum on Zingiber officinale. Indian Phytopathol.

38, 391.

Doyle, J.J., Doyle, J.L., 1990. Isolation of plant DNA from fresh tissue. Focus 12, 13-15.

Drechsler, C., 1930. Some new species of Pythium. J. Wash. Acad. Sci. 20, 398-418.

Drechsler, C., 1932. A species of Pythiogeton isolated form decaying leaf-sheaths of the common

cat-tail. J. Wash. Acad. Sci. 22, 421-449.

Drechsler, C., 1934. Pythium scleroteichum n. sp. causing mottle necrosis of sweet potatoes. J. Agr.

Res. 49, 881-890.

Drechsler, C., 1946. Several species of Pythium peculiar in their sexual development.


Duan, Y.B., Yang, Y., Wang, J.X., Liu, C.C., He, L.L., Zhou, M.G., 2015. Development and

application of loop-mediated isothermal amplification for detecting the highly benzimidazole-

resistant isolates in Sclerotinia sclerotiorum. Sci. Rep. 5, 17278.

References

125

Eggertson, Q., 2012. Resolving the Pythium ultimum species complex. PhD theis. Carleton

University Ottawa, Canada.

El-Hissy, F., Khallil, A.R., Ali, E., 1994. Aquatic phycomycetes from egyptian soil (Delta Region).

Microbiol. Res. 149, 271-282.

El-Katatny, M.H., Abdelzaher, H.M.A., Shoulkamy, M.A., 2006. Antagonistic actions of Pythium

oligandrum and Trichoderma harzianum against phytopathogenic fungi (Fusarium

oxysporum and Pythium ultimum var. ultimum). Arch. Phytopathol. Plant Prot. 39, 289-301.

English, P.B., Frost, A.J., 1984. Phycomycosis in a dog. Aust. Vet. J. 61, 291-292.

Fleischmann, R.D., Alland, D., Eisen, J.A., Carpenter, L., White, O., Peterson, J., DeBoy, R.,

Dodson, R., Gwinn, M., Haft, D., Hickey, E., Kolonay, J.F., Nelson, W.C., Umayam, L.A.,

Ermolaeva, M., Salzberg, S.L., Delcher, A., Utterback, T., Weidman, J., Khouri, H., Gill, J.,

Mikula, A., Bishai, W., Jacobs, J.W.R., Venter, J.C., Fraser, C.M., 2002. Whole-Genome

Comparison of Mycobacterium tuberculosis clinical and laboratory strains. J Bacteriol. 184,

5479-5490.

Floch, G.L., Vallance, J., Benhamou, N., Rey, P., 2009. Combining the oomycete Pythium

oligandrum with two other antagonistic fungi: Root relationships and tomato grey mold

biocontrol. Biol. Control 50, 288-298.

Foley, M.F., Deacon, J.W., 1986. Susceptibility of Pythium spp and other fungi to antagonism by

the mycorparasite Pythium oligandrum. Soil Biol. Biochem. 18, 91-95.

Francis, D.M., Gehlen, M.F., Stclair, D.A., 1994. Genetic-variation in homothallic and hyphal

swelling isolates of Pythium ultimum var ultimum and P. ultimum var sporangiferum. Mol.

Plant Microbe In. 7, 766-775.

Fu, C.H., Chen, C.M., Hsieh, H.J., 2005. First report of Formosan michelia seedling root rot caused

by Pythium splendens in Taiwan. Plant Dis. 89, 1361-1361.

Fu, S., Qu, G., Guo, S., Ma, L., Zhang, N., Zhang, S., Gao, S., Shen, Z., 2011. Applications of

Loop-Mediated Isothermal DNA Amplification. Appl. Biochem. Biotech. 163, 845-850.

Fukuta, S., Takahashi, R., Kuroyanagi, S., Ishiguro, Y., Miyake, N., Nagai, H., Suzuki, H., Tsuji,

T., Hashizume, F., Watanabe, H., Kageyama, K., 2014. Development of loop-mediated

siothermal amplification assay for the detection of Pythium myriotylum. Lett. Appl.

Microbiol. 2014 Mar 10. doi: 10.1111/lam.12244.

Fukuta, S., Watanabe, H., Kageyama, K., Takahashi, R., Kuroyanagi, S., Miyake, N., Nagai, H.,

Suzuki, H., Hashizume, F., Tsuji, T., Taguchi, H., 2013. Detection of Pythium

aphanidermatum in tomato using loop-mediated isothermal amplification (LAMP) with

species-specific primers. Eur. J. Plant Pathol. 136, 689-701.

References

126

Fullerton, R.A., Harris, F.M., 1998. Control of rhizomes rot of ginger in Fiji. A report ot the Ginger

Council of Fiji.

Gao, J.Y., Yang, Z.H., Ren, P.Y., Li, Q.J., 2006. Reproductive ecology of Rhynchanthus beesianus

W. W. Smith (Zingiberaceae) in South Yunnan, China: A ginger with bird pollination

syndrome. J. Integr. Plant Biol. 48, 1294-1299.

Garren, K.H., 1971. Peristence of Pythium myriotylum in Soils. Phytopathology 61, 596.

Garzón, C.D., Geiser, D.M., Moorman, G.W., 2005. Amplified fragment length polymorphism

analysis and internal transcribed spacer and CoxII sequences reveal a species boundary within

Pythium irregulare. Phytopathology 95, 1489-1498.

Garzón, C.D., Geiser, D.M., Moorman, G.W., 2005. Diagnosis and population analysis of Pythium

species using AFLP fingerprinting. Plant Dis. 89, 81-89.

Garzón, C.D., Yánez, J.M., Moorman, G.W., 2007. Pythium cryptoirregulare, a new species within

the P. irregulare complex. Mycologia 99, 291-301.

Gerbore, J., Benhamou, N., Vallance, J., Le Floch, G., Grizard, D., Regnault-Roger, C., Rey, P.,

2014a. Biological control of plant pathogens: advantages and limitations seen through the

case study of Pythium oligandrum. Environ. Sci. Pollut. Res. 21, 4847-4860.

Gerbore, J., Vallance, J., Yacoub, A., Delmotte, F., Grizard, D., Regnault-Roger, C., Rey, P.,

2014b. Characterization of Pythium oligandrum populations that colonize the rhizosphere of

vines from the Bordeaux region. FEMS Microbiol. Ecol. 90, 153-167.

Ghosh, R., Datta, M., Purkayastha, R.P., 2006. Intraspecific strains of Pythium aphanidermatum

induced disease resistance in ginger and response of host proteins. Indian J. Exp. Biol. 44, 68.

Ghosh, R., Purkayastha, R.P., 2003. Molecular diagnosis and induced systemic protection against

rhizome rot disease of ginger caused by Pythium aphanidermatum. Curr. Sci. India 85, 1782-

1787.

Gilbert, R.L., Cother, E.J., Nicol, H.I., 1995. Mathematical-methods to compare growth-curves of

Pythium arrhenomanes and 11 other Pythium species as an aid to their identification. Mycol.

Res. 99, 19-30.

Gill, H.S., 1978. Identification of Phytophthora species by disc electrophoresis. Phytopathology 68,

163.

Gómez‐Alpízar, L., Saalau, E., Picado, I., Tambong, J.T., Saborío, F., 2011. A PCR‐RFLP assay for

identification and detection of Pythium myriotylum, causal agent of the cocoyam root rot

disease. Lett. Appl. Microbiol. 52, 185-192.

Graham, K.M., 1971. Plant diseases of Fiji. Her Majesty's Stationery Office, Lodon.

GRP, 2009. Techinical Annual Report - 2008/2009. Ginger Research Programme, NARC,

Kapurkot, Salyan, Nepal.

References

127

Gupta, M., Dohroo, N.P., Gangta, V., Shanmugam, V., 2010. Effect of microbial inoculants on

rhizome disease and growth parameters of ginger. Indian Phytopathol. 63, 438-441.

Gupta, S.L., Paijwar, M.S., Rizvi, G., 2013. Biological management of rot disease of ginger

(Zingiber officinales Rosc.). Trends Biosci. 6(3), 302

Hamid A, 1942. Indian water moulds III, The Indian Academy of Science, pp. 206-215.

Hamilton, K., 2011. Ginger and chemotherapy: A literature review. Shadows: New Zeal. J. Med.

Radiat. Tech. 54, 23-28.

Harvey, P., Lawrence, L., 2008. Managing Pythium root disease complexes to improve productivity

of crop rotations. Outlooks Pest Manage. 19, 127-129.

Harvey, P.R., Butterworth, P.J., Hawke, B.G., Pankhurst, C.E., 2000. Genetic variation among

populations of Pythium irregulare in southern Australia. Plant Pathol. 49, 619-627.

Haware, M.P., Joshi, L.K., 1974. Studies on soft rot of ginger from Madhya Pradesh. Indian


He, S.S., Zhang, B.X., Ge, Q.X., 1992. On the antagonism by hyperparasite Pythium oligandrum.

Acta Phytopathol. Sin. 22, 77-82.

Hendrix, F.F., Campbell, W.A., 1973. Pythiums as plant pathogens. Annu. Rev. Phytopathol. 11,

77-98.

Herrero, M.L.U.Z., Klemsdal, S.S., 1998. Identification of Pythium aphanidermatum using the

RAPD technique. Mycol. Res. 102, 136-140.

Ho, H.H., 2009. The genus Pythium in Taiwan, China (1) - a synoptic review. Front. Biol. China 4,

15-28.

Ho, H.H., 2011. The genus Pythium in Taiwan (2)-an Illustrated diagnostic key. Mycotaxon 116,

33-47.

Hogarth, J., 2000. Buderim Ginger: an export success story: a history of the ginger industry of

Queensland. Hogarth & Buderim Ginger Ltd, Yandina, Queensland.

Holmes, K.A., Nayagam, S.D., Craig, G.D., 1998. Factors affecting the control of Pythium ultimum

damping-off of sugar beet by Pythium oligandrum. Plant Pathol. 47, 516-522.

Hoppe, P.E., 1966. Pythium species still viable after 12 years in air-dried muck soil.

Phytopathology 56, 1411.

Horner, N.R., Grenville-Briggs, L.J., van West, P., 2012. The oomycete Pythium oligandrum

expresses putative effectors during mycoparasitism of Phytophthora infestans and is

amenable to transformation. Fungal Biol. 116, 24-41.

Hsieh, H.J., Chang, H.S., 1976. Five species of Pythium, two species of Pythiogeton new for

Taiwan and Pythium afertile. Bot. Bull. Acad. Sinica (Taipei), 17, 141-150.

References

128

Huang, J.H., Chen, C.Y., Lin, Y.S., Ann, P.J., Huang, H.C., Chung, W.H., 2013. Six new species of

Pythiogeton in Taiwan, with an account of the molecular phylogeny of this genus. Mycoscience

54, 130-147.

Hutchins, D.R., Johnston, K.G., 1972. Phycomycosis in the horse. Aust. Vet. J. 48, 269-278.

Ichitani, T., Amemiya, J., 1980. Pythium gracile isolated from the foci of granular dermatitis in the

horse (Equus caballus). Trans. Mycol. Soc. Japan 21, 263–265.

Ichitani, T., Goto, H., 1982. Distribution of Pythium zingiberum causing rhizome rot in ginger-

growing and its surrounding uncultivated soils. Ann. Phytopath. Soc. Japan 48, 674-676.

Ichitani, T., Shinsu, T., 1980. Pythium zingiberum causing rhizome rot of ginger plant and its

distribution. Ann. Phytopath. Soc. Japan 46 435-441 in Japanese (English abstract).

Ichitani, T., Shinsu, T., 1981. Detection zingiberum causing rhizome rot disease of ginger of

pythium from soils of surrounding area of continuous indoor cropping for immature rhizome

production. Ann. Phytopath. Soc. Japan 47, 158-165.

Ikeda, A., Ichitani, T., 1985. Density of Pythium zingiberum oospores in relation to infection of

Chenopodium quinoa seedlings. Bull. Univ. Osaka Pref., Ser. B 37, 13-18.

Ikeda, S., Shimizu, A., Shimizu, M., Takahashi, H., Takenaka, S., 2012. Biocontrol of black scurf

on potato by seed tuber treatment with Pythium oligandrum. Biol. Control 60, 297-304.

ISPS, 2005. Experiences in Collaboration: Ginger Pests and Diseases. Indo-Swiss Project Sikkim,

India, p. 75.

Ito, S., Tokunaga, Y., 1933 Studies on the rot-disease of rice seedlings caused by Pythium species.

J. Facul. Agri., Hokkaido Imperial University 32, 201-233.

Ito, T., 1944. Some aquatic species of Phycomycetes found in Kyoto. J. Jpn. Botany 20, 51-60.

Jacobs, R.P., 1982. Pythiaceous fungi associated with the decomposition of Nymphoides peltata. A.

van Leeuw. J. Microbiol. 48, 433-445.

Janes, M.E., Nannapaneni, R., Johnson, M.G., 1999. Identification and characterization of two

bacteriocin-producing bacteria isolated from garlic and ginger root. J. Food Prot. 62, 899-899.

Jee, H.J., Ho, H.H., Cho, W.D., 2000. Pythiogeton zeae sp. nov. causing root and basal stalk rot of

corn in Korea. Mycologia 92, 522-527.

Jeffers, S.N., Martin, S.B., 1986. Comparison of two media selective for Phytophthora and Pythium

species. Plant Dis. 70, 1038-1043.

Jiang, Y.N., Haudenshield, J.S., Hartman, G.L., 2012. Characterization of Pythium spp. from soil

samples in Illinois. Can. J. Plant Pathol. 34, 448-454.

Jones, E.E., Deacon, J.W., 1995. Comparative physiology and behaviour of the mycoparasites

Pythium acanthophoron, P. oligandrum and P. mycoparasiticum. Biocontrol Sci. Techn. 5,

27-40.

References

129

Jooju, B., 2005. Evaluation of genetic diversity of Pythium spp. causing soft of ginger using

phenotypic and molecular methods. MPhil Thesis, Bharathidasan Univeristy, Thiruchirapalli.

Kageyama, K., 2014. Molecular taxonomy and its application to ecological studies of Pythium

species. J. Gen. Plant Pathol. 80, 314-328.

Kageyama, K., Kobayashi, M., Tomita, M., Ku bota, N., Suga, H., Hyakumachi, M., 2002.

Production and evaluation of monoclonal antibodies for the detection of Pythium sulcatum in

soil. J. Phytopathol. 150, 97-104.

Kageyama, K., Nakashima, A., Kajihara, Y., Suga, H., Nelson, E.B., 2005. Phylogenetic and

morphological analyses of Pythium graminicola and related species. J. Gen. Plant Pathol. 71,

174-182.

Kageyama, K., Senda, M., Asano, T., Suga, H., Ishiguro, K., 2007. Intra-isolate heterogeneity of the

ITS region of rDNA in Pythium helicoides. Mycol. Res. 111, 416-423.

Kammarnjesadakul, P., Palaga, T., Sritunyalucksana, K., Mendoza, L., Krajaejun, T.,

Vanittanakom, N., Tongchusak, S., Denduangboripant, J., Chindamporn, A., 2011.

Phylogenetic analysis of Pythium insidiosum Thai strains using cytochrome oxidase II (CoxII)

DNA coding sequences and internal transcribed spacer regions (ITS). Med. Mycol. 49, 289-

295.

Karaca, G., Tepedelen, G., Belghouthi, A., Paul, B., 2008. A new mycoparasite, Pythium

lycopersicum, isolated in Isparta, Turkey: morphology, molecular characteristics, and its

antagonism with phytopathogenic fungi. FEMS Microbiol. Lett. 288, 163-170.

Karmakar, N.C., Ghosh, R., Purkayastha, R.P., 2003. Plant defence acitivators inducing systemic

resistance in Zingiber officinale Rosc. against Pythium aphanidermatum (Edson) Fitz. Indian

J. Biotech. 2, 591-595.

Kavitha, P.G., Thomas, G., 2008a. Defence transcriptome profiling of Zingiber zerumbet (L.) Smith

by mRNA differential display. J. Biosciences 33, 81-90.

Kavitha, P.G., Thomas, G., 2008b. Expression analysis of defense-related genes in Zingiber

(Zingiberaceae) species with different levels of compatibility to the soft rot pathogen Pythium

aphanidermatum. Plant Cell Rep. 27, 1767-1776.

Kavitha, P.G., Thomas, G., 2008c. Population genetic structure of the clonal plant Zingiber

zerumbet (L.) Smith (Zingiberaceae), a wild relative of cultivated ginger, and its response to

Pythium aphanidermatum. Euphytica 160, 89-100.

Kernaghan, G., Reeleder, R.D., Hoke, S.M.T., 2008. Quantification of Pythium populations in

ginseng soils by culture dependent and real-time PCR methods. App. Soil Ecol. 40, 447-455.

Kibblewhite, M.G., Ritz, K., Swift, M.J., 2008. Soil Health in Agricultural Systems. Philos. T. R.

Soc. B. 363, 685-701.

References

130

Kim, C.H., Hahn, K.D., Park, K.S., 1996. Survey of rhizome rot incidence of ginger in major

production areas in Korea. Korean J. Plant Pathol. 12, 336-344 (English abstract).

Kim, C.H., Yang, S.S., Hahn, K.D., 1998. Effects of soil disinfection, fungicide application and

narrow ridge cultivation on development of ginger rhizome rot caused by Pythium myriotylum

on the fields. Korean J. Plant Pathol. 14(3), 253-259.

Kim, C.H., Yang, S.S., Hahn, K.D., Kim, C., Yang, S., Hahn, K., 1997a. Ecology of ginger rhizome

rot development caused by Pythium myriotylum. Korean J. Plant Pathol. 13, 184-190.

Kim, C.H., Yang, S.S., Park, K.S., 1997b. Pathogencity and mycological characteristics of Pythium

myriotylum causing rhizome rot of ginger. Korean J. Plant Pathol. 13(3), 152-157.

Kiran, A.G., Augustine, L., Varghese, S., Thomas, G., 2012. Reactive oxygen species sequestration,

hypersensitive response and salicylic acid signalling together hold a central role in Pythium

resistance in Zingiber zerumbet (Zingiberaceae), 6th International Zingiberaceae Symposium

Calicut University Campus, Calicut, Kerala, India, pp. 32-33.

Kizhakkayil, J., Sasikumar, B., 2011. Diversity, characterization and utilization of ginger: a review.

Plant Genetic Resources -Characterization and Utilization 9, 464-477.

Kobriger, K., Hagedorn, D.J., 1984. Additional Pythium species associated with the bean root rot

complex in Wiscosin’s Central Sands. Plant Dis. 68, 595-596

Krell, J., Stebbing, J., 2012. Ginger: the root of cancer therapy? Lancet Oncol. 13, 235-236.

Kroon, L.P.N.M., Bakker, F.T., van den Bosch, G.B.M., Bonants, P.J.M., Flier, W.G., 2004.

Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA

sequences. Fungal Genet. Biol. 41, 766-782.

Krywienczyk, J., Dorworth, C.E., 1980. Serological relationships of some fungi of the genus

Pythium. Can. J. Bot. 58, 1412-1417.

Kubota, M., Abiko, K., 2000. Damping off of cabbage seedling caused by Pythium zingiberis (in

Japanese with English summary). Proc. Kansai Plant Prot. 42, 51-52.

Kubota, M., Nakasuji, S., Shimizu, M., Nishi, K., 2006a. Damping-off of cabbage plug seedlings

caused by Pythium ultimum var. ultimum in Japan. J. Gen. Plant Pathol. 72, 123-125.

Kubota, M., Nakasuji, S., Shimizu, M., Nishi, K., 2006b. Pathogenicity of Pythium ultimum var.

ultimum to cabbage seedlings. Annu. Rep. Kansai Plant Protect. Soc. 48, 49-50.

Kumar, A., Avasthe, R.K., Borah, T.R., Lepcha, B., Pandey, B., 2012. Organic mulches affecting

yield, quality and diseases of ginger in mid hills of North Eastern Himalayas. Indian J. Hortic.

69, 439-442.

Kumar, A., Reeja, S. T., Bhai, R. S., Shiva, K. N. (2008). Distribution of Pythium myriotylum

Drechsler causing soft rot of ginger. JOSAC 17 (1):5-10

References

131

Kumar, A., Sarma, Y.R., 2004. Characterization of Ralstonia solanacearum causing bacterial wilt

in ginger. Indian Phytopathol. 58 (1), 12-17

Kumar, M., Shukla, P.K., 2006. Single-stranded conformation polymorphism of large subunit of

ribosomal RNA is best suited to diagnosing fungal infections and differentiating fungi at

species level. Diagn. Micr. Infec. Dis. 56, 45-51.

Kyuchukova, M.A., Buttner, C., Gabler, J., Bar-Yosef, B., Grosch, R., Klaring, H.P., 2006.

Evaluation of a method for quantification of Pythium aphanidermatum in cucumber roots at

different temperatures and inoculum densities. J. Plant Dis. Prot. 113, 113-119.

Laing, S.A.K., Deacon, J.W., 1991. Video microscopical comparison of mycoparasitism by

Pythium oligandrum, P. nunn and an unnamed Pythium species. Mycol. Res. 95, 469-479.

Langner, E., Greifenberg, S., Gruenwald, O., 1998. Ginger: History and use. Adv. Ther. 15, 25-44.

Le, D.P., 2010. Pathogenicity, morphological and genetic diversity of soft rot disease pathogen,

Pythium myriotylum Drechsl. on ginger (Zingiber officinale Roscoe). Master thesis of Plant

Protection. The University of Queensland.

Le, P.D., Smith, M.K., Aitken, E.A.B., 2010. Pythium spp. on ginger (Zingiber officinale Roscoe)

in Australia, in: Sterling, G.R. (Ed.), Proceedings of the sixth Australasian soilborne diseases

symposium., Twin Waters, Queensland, p. 62. ISBN 978-0-646-53983-6

Lee, S., Garzón, C.D., Moorman, G.W., 2010. Genetic structure and distribution of Pythium

aphanidermatum populations in Pennsylvania greenhouses based on analysis of AFLP and

SSR markers. Mycologia 102, 774-784.

Lee, S., Moorman, G.W., 2008. Identification and characterization of simple sequence repeat

markers for Pythium aphanidermatum, P. cryptoirregulare, and P. irregulare and the

potential use in Pythium population genetics. Curr. Genet. 53, 81-93.

Lee, Y.S., Hoy, J.W., 1992. Interactions among Pythium species affecting root rot of sugarcane.

Plant Dis. 79, 735-739.

Lévesque, C.A., 2011. Fifty years of oomycetes - from consolidation to evolutionary and genomic

exploration. Fungal Diver. 50, 35-46.

Lévesque, C.A., De Cock, A.W.A.M., 2004. Molecular phylogeny and taxonomy of the genus

Pythium. Mycol. Res. 108, 1363-1383.

Li, Y., Mao, L.G., Yan, D.D., Liu, X.M., Ma, T.T., Shen, J., Liu, P.F.,

Li, Z., Wang, Q.X., Ouyang, C.B., Guo, M.X., Cao, A.C., 2014. First report in china of soft

rot of ginger caused by Pythium aphanidermatum. Plant Dis. 98, 1011.

Li, Y.P., You, M.P., Barbetti, M.J., 2014. Species of Pythium associated with seedling root and

hypocotyl disease on common bean (Phaseolus vulgaris) in Western Australia. Plant Dis. 98,

1241-1247.

References

132

Lin, L.T., Chang, S.S., Leu, L.S., 1971. Soft rot of ginger. Plant Prot. Bul. Taiwan 13, 54-67.

Littrell, R.H., McCarter, S., 1970. Effect of soil temperature on virulence of Pythium

aphanidermatum and Pythium niyriotylum to rye and tomato. Phytopathology 60, 704-707.

Liu, K.-L., Porras-Alfaro, A., Kuske, C.R., Eichorst, S.A., Xie, G., 2012. Accurate, rapid taxonomic

classification of fungal large-subunit rRNA genes. Appl. Environ. Microbiol. 78, 1523-1533.

Liu, P.S.W., 1977a. Diseases caused by Phytophthora and Pythium in Sabah, Malaysia, Technical

Bulletin. Department of Agriculture, Sabah, Malaysia, p. 25.

Liu, P.S.W., 1977b. A supplement to a host list of plant diseases in Sabah, Malaysia.

Commonwealth mycological institute, Kew.

Lomavatu, M.F., Conroy, J., Aitken, E.B., 2009. Molecular identification of Pythium isolates of

ginger from Fiji and Australia., in: Williamson, P. (Ed.), 17th Biennial Australasian Plant

Pathology Society Conference., Newcastle, NSW.

Lucas, B., Griffiths, P.D., 2004. Evaluation of common bean accessions for resistance to Pythium

ultimum. Hortscience 39, 1193-1195.

Lumsden, R.D., Ayers, W.A., Dow, R.L., 1975. Differential isolation of Pythium species from soil

by means of selective media, temperature and pH. Can. J. Microbiol. 21, 606-612.

Martin, F., 1990. Taxonomic classification of asexual isolates of based on cultural characteristics

and mitochondrial DNA restriction patterns. Exp. Mycol. 14, 47-56.

Martin, F., 2008. Pythium genetics, Oomycete genetics and genomics. John Wiley & Sons, Inc., pp.

213-239.

Martin, F., Hancock, J., 1987. The use of Pythium oligandrum for biological control of

preemergence damping-off caused by P. ultimum. Phytopathology 77, 1013-1020.

Martin, F.K., 1992. Pythium, In: Singleton, L.L., Mihail, J.D., Rush, C.M. (Eds.), Methods for

research on soilborne phytopathogenic fungi. APS Press, St. Paul, Minn.

Martin, F.N., 1990. Variation in the ribosomal DNA repeat unit within single-oospore isolates of

the genus Pythium. Genome 33, 585-591.

Martin, F.N., 2000. Phylogenetic relationships among some Pythium species inferred from sequence

analysis of the mitochondrially encoded cytochrome oxidase II gene. Mycologia 92, 711-727.

Martin, F.N., Kistler, H.C., 1990. Species-specific banding patterns of restriction endonuclease-

digested mitochondrial DNA from the genus Pythium. Exp. Mycol. 14, 32-46.

Martin, R.R., James, D., Lévesque, C.A., 2000. Impacts of molecular diagnostic technologies on

plant disease management. Annu. Rev. Phytopathol. 38, 207-239.

Mathur, K., Ram, D., Poonia, J., Lodha, B. C., 2002. Integration of soil solarization and pesticides

for management of rhizome rot of ginger. Indian Phytophathol. 55, 345-347.

References

133

Matsumoto, C., Kageyama, K., Suga, H., Hyakumachi, M., 1999. Phylogenetic relationships of

Pythium species based on ITS and 5.8S sequences of the ribosomal DNA. Mycoscience 40,

321-331.

Matsumoto, C., Kageyama, K., Suga, H., Hyakumachi, M., 2000. Intraspecific DNA

polymorphisms of Pythium irregulare. Mycol. Res. 104, 1333-1341.

McCarter, S., Littrell, R., 1970. Comparative pathogenicity of Pythium aphanidermatum and

Pythium myriotylum to twelve plant species and intraspecific variation in virulence.


McLeod, A., Botha, W.J., Meitz, J.C., Spies, C.F.J., Tewoldemedhin, Y.T., Mostert, L., 2009.

Morphological and phylogenetic analyses of Pythium species in South Africa. Mycol. Res.

113, 933-951.

McQuilken, M.P., Whipps, J.M., Cooke, R.C., 1990. Control of damping-off in cress and sugar-beet

by commercial seed-coating with Pythium oligandrum. Plant Pathol. 39, 452-462.

McRae, W., 1911. Soft rot of ginger in the Rangpur district, East Bengal (East Pakistan). Agr. J.

India 6, 139-146.

Mette Madsen, A., de Neergaard, E., 1999. Interactions between the mycoparasite Pythium

oligandrum and sclerotia of the plant pathogen Sclerotinia sclerotiorum. Eur. J. Plant Pathol.

105, 761-768.

Minden, M.V., 1916. Beitrage zur biologie und systematik einheimsche submerser Phycomyceten.

Falk Mykolog Untersuch Berichte 2, 146-255.

Mircetich, S.M., Kraft, J.M., 1973. Efficiency of various selective media in determining Pythium

population in soil. Mycopath. Mycol. Appl. 50, 151.

Mitani, Y., Lezhava, A., Kawai, Y., Kikuchi, T., Oguchi-Katayama, A., Kogo, Y., Itoh, M., Miyagi,

T., Takakura, H., Hoshi, K., 2007. Rapid SNP diagnostics using asymmetric isothermal

amplification and a new mismatch-suppression technology. Nat. Methods 4, 257-262.

Moralejo, E., Clemente, A., Descals, E., Belbahri, L., Calmin, G., Lefort, F., Spies, C.F.J., McLeod,

A., 2008. Pythium recalcitrans sp. nov. revealed by multigene phylogenetic analysis.

Mycologia 100, 310-319.

Morin, P.A., Luikart, G., Wayne, R.K., 2004. SNPs in ecology, evolution and conservation. Trends

Ecol. Evol. 19, 208-216.

Morita, Y., Tojo, M., 2007. Modifications of PARP medium using fluazinam, miconazole, and

nystatin for detection of Pythium spp. in soil. Plant Dis. 91, 1591-1599.

Mu, J.H., Bollon, A.P., Sidhu, R.S., 1999. Analysis of β-tubulin cDNAs from taxol-resistant

Pestalotiopsis microspora and taxol-sensitive Pythium ultimum and comparison of the taxol-

binding properties of their products. Mol. Gen. Genet. 262, 857-868.

References

134

Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loop-mediated isothermal

amplification using loop primers. Mol. Cell. Probe. 16, 223-229.

Nair, R.A., Thomas, G., 2007. Isolation, characterization and expression studies of resistance gene

candidates (RGCs) from Zingiber spp. TAG. Theor. Appl. Genet. 116, 123-134.

Nair, R.A., Thomas, G., 2012. Functional genetic diversity at nucleotide binding site (NBS) loci:

Comparisons among soft rot resistant and susceptible Zingiber taxa. Biochem. Syst. Ecol. 44,

196-201.

Nair, R.A., Thomas, G., 2013. Molecular characterization of ZzR1 resistance gene from Zingiber

zerumbet with potential for imparting Pythium aphanidermatum resistance in ginger. Gene

516, 58-65.

Nambiar, K.K.N., Sarma, Y.R., 1974. Mosaic diseas of ginger (Zingiber officinale Rosc.). Arecanut

and Spices Bulletin 6, 3-4.

Nascimento, C.D.A., Gomes, E.P.C., Souza, J.I.D., Pires-Zottarelli, C.L.A., 2012. Zoosporic true

fungi and heterotrophic straminipiles assemblages from soil of Brazilian Cerrado areas. Fungal

Ecol. 5, 114-123.

Nechwatal, J., Lebecka, R., 2014. Genetic and phenotypic analyses of Pythium isolates from reed

suggest the occurrence of a new species, P. phragmiticola, and its involvement in the

generation of a natural hybrid. Mycoscience 55, 134-143.

Nechwatal, J., Wielgoss, A., Mendgen, K., 2005. Pythium phragmitis sp. nov., a new species close

to P. arrhenomanes as a pathogen of common reed (Phragmites australis). Mycol. Res. 109,

1337-1346.

Nepali, M.B., Prasad, R.B., Sah, D.N., 2000. Survey of ginger growing areas in Syanja, Palpa,

Gulni and Arghaknach districts with special emphasis in rhizome rot disease. Bulletin Lumle

Agricultural Research Station, Nepal.

Nicoll, R., Henein, M.Y., 2009. Ginger (Zingiber officinale Rosc.): A hot remedy for cardiovascular

disease? Int. J. Cardiol. 131, 408-409.

Nishijima, K.A., Alvarez, A.M., Hepperly, P.R., Shintaku, M.H., Keith, L.M., Sato, D.M., Bushe,

B.C., Armstrong, J.W., Zee, F.T., 2004. Association of Enterobacter cloacae with rhizome rot

of edible ginger in Hawaii. Plant Dis. 88, 1318-1327.

Nishino, T., Shinsu, T., Sakaguchi, S., 1984. Studies on the virus disease of ginger. 2. Aphid

species and their seasonal prevalence on ginger. Kyushu Plant Prot. Res. 30, 112-115.

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000.

Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63-63.

Nyochembeng, L.M., Pacumbaba, R.P., Beyl, C.A., 2002. Calcium enhanced zoospore production

of Pythium myriotylum in vitro. J. Phytopathol. 150, 396-398.

References

135

Okubara, P.A., Schroeder, K.L., Paulitz, T.C., 2005. Real-time polymerase chain reaction:

applications to studies on soilborne pathogens. Can. J. Plant Pathol. 27, 300-313.

Olaya, G., Heidel, T., Abad, G., Abad, J., Watrin, C., 2006. Pythium species associated with corn

seedling diseases in the USA, pathogenicity and sensitivity to mefenoxam and azoxystrobin.

Phytopathology 96, S87-S87.

Overy, D.P., Frisvad, J.C., 2005. Mycotoxin production and postharvest storage rot of ginger

(Zingiber officinale) by Penicillium brevicompactum. J. Food Prot. 68, 607-607.

Pacumbaba, R.P., Wutoh, J.G., Eyango, S.A., Tambong, J.T., Nyochembeng, L.M., 1992. Isolation

and pathogenicity of rhizosphere fungi of cocoyam in relation to cocoyam root rot disease. J.


Pandey, A.K., Awasthi, L.P., Srivastva, J.P., Sharma, N.K., 2010. Management of rhizome rot

disease of ginger (Zingiber officinale Rosc.). J. Phytology. 2, 18-20.

Pankhurst, C.E., McDonald, H.J., Hawke, B.G., 1995. Influence of tillage and crop rotation on the

epidemiology of Pythium infections of wheat in a red-brown earth. Soil Biol. Biochem. 27,

1065-1073.

Papavizas, G.C., 1985. Trichoderma and Gliocladium: biology, ecology and potential for

biocontrol. Annu. Rev. Phytopathol. 23, 23-54.

Park, M., 1935. Report of the work of the Mycological Division, Ceylon, 1934. Administration

Report Director of Agriculture, pp. D126-D133.

Park, M., 1937. Report of the work of the Mycological Division, Ceylon, 1936. Administration

Report Director of Agriculture, pp. D28-D35.

Park, M., Bae, J., Lee, D.S., 2008. Antibacterial activity of 10-gingerol and 12-gingerol isolated

from ginger rhizome against periodontal bacteria. Phytother. Res. 22, 1446-1449.

Paul, B., Galland, D., Bhatnagar, T., Dulieu, H., 1998. A new species of Pythium isolated from the

Burgundy region in France. FEMS Microbiol. Lett. 158, 207-213.

Pegg, K.G., Stirling, G.R., 1994. Ginger, In: Persley, D. (Ed.), Diseases of Vegetable Crops.

Department of Primary Industries, Queensland, pp. 55-57.

Perneel, M., Tambong, J.T., Adiobo, A., Floren, C., Saborío, F., Lévesque, A., Höfte, M., 2006.

Intraspecific variability of Pythium myriotylum isolated from cocoyam and other host crops.

Mycol. Res. 110, 583-593.

Pettitt, T.R., Wainwright, M.F., Wakeham, A.J., White, J.G., 2011. A simple detached leaf assay

provides rapid and inexpensive determination of pathogenicity of Pythium isolates to ‘all year

round’ (AYR) chrysanthemum roots. Plant Pathol. 60, 946-956.

References

136

Philip, S., 2005. Pathogenicity and characterization of Pythium species causing soft rot of ginger,

in: Parthasarathy, V.A. (Ed.), Abstracts of M.Sc.and Ph.D Dissertations on spice crops,

Calicut. Indian Institute of Spices Research. p.26.

Plaats-Niterink, A.J.V.D., 1981. Monograph of the genus Pythium. Stud. Mycol. 21, 1-244.

Ploetz, R.C., 2004. Influence of temperature on Pythium splendens induced root disease on

carambola, Averrhoa carambola. Mycopathologia 157, 225-231.

Porter, D.M., 1970. Peanut wilt caused by Pythium myriotylum. Phytopathology 60, 393.

Priekule, I., 2007. First report of Pythium ultimum var. ultimum causing damping-off on okra in

Japan. Plant Pathol. 56, 1042-1042.

Pringsheim, N., 1858. Contribution to morphology and systematics of algae. 2, The Saprolegniales.

Jb Wiss. Bot., 1: 284-306.

Rafin, C., Brygoo, Y., Tirilly, Y., 1995. Restriction analysis of amplified ribosomal DNA of

Pythium spp. isolated from soilless culture systems. Mycol. Res. 99, 277-281.

Rai, M.K., 1993. Identity and taxonomy of hitherto unreported pathogen causing leaf-spot disease

of ginger in India. Mycotaxon 46, 329-333.

Rajan, K.M., Agnihotri, V.P., 1989. Pythium induced rhizome rot of ginger, problems and

progress., In: Agnihotri, V.P., Sing, N., Chaube, H.S., Sing, V.S., Dwivedi, T.S. (Eds.),

Perspective in Phythopathology. Today and Tomorrow's Principles and Publishers, New

Delhi, pp. 189-198.

Rajan, P.P., Gupa, S.R., Sarma Y.R., Jackson, G.V.H., 2002. Diseases of ginger and their control

with Trichoderma harzianum. Indian Phytophathol. 55, 173-177.

Rakesh, K.N., Dileep, N., Noor Nawaz, A.S., Junaid, S. 2013. Antifungal activity of cow urine

against fungal pathogens causing rhizome rot of ginger. Environ. Ecol. 31, 1241-1244

Ram, D., Mathur, K., Lodha, B.C., Webster, J., 2000. Evaluation of resident biocontrol agents as

seed treatments against ginger rhizome rot. Indian Phytopathol. 53(4), 450-454.

Ramakrishnan, T.S., 1949. The occurrence of Pythium vexans de Bary in South India. Indian


Rames, E.K., Smith, M.K., Hamill, S.D., De Faveri, J., 2013. Mircrobial indicators related to yield

and disease and changes in soil microbial community structure with ginger farm management

practices. Australas. Plant Pathol. 42, 685-692.

Rands, R.D., Dopp, E., 1938. Pythium root rot of sugarcane. USDA Tech. Bul. 666, 1-96.

Rathore, V.R.S., Mathur, K., Lodha, B.C., 1992. Acitivty of volatile and non-volatile substrances

produced by Trichoderma viride on ginger rhizome rot pathogens. Indian Phytopathol. 45,

253-254.

References

137

Rey, P., Le Floch, G., Benhamou, N., Salerno, M.-I., Thuillier, E., Tirilly, Y., 2005. Interactions

between the mycoparasite Pythium oligandrum and two types of sclerotia of plant pathogenic

fungi. Mycol. Res. 109, 779-788.

Ribeiro, W.R.C., Butler, E.E., 1995. Comparison of the mycoparasites Pythium periplocum,

Pythium acanthicum and Pythium oligandrum. Mycol. Res. 99, 963-968.

Robertson, G.I, 1980. The genus Pythium in New Zealand. New Zeal. J. Bot. 18 (1), 73-102

Robideau, G.P., Gachon, C.M.M., Hu, C.-H., Küpper, F.C., Rintoul, T.L., Sarhan, E., Verstappen,

E.C.P., Zhang, Y., Bonants, P.J.M., Ristaino, J.B., Lévesque, C.A., De Cock, A.W.A.M.,

Coffey, M.D., Voglmayr, H., Brouwer, H., Bala, K., Chitty, D.W., Désaulniers, N.,

Eggertson, Q.A., 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I

and internal transcribed spacer. Mol. Ecol. Resour. 11, 1002-1011.

Sagar, S.D., Kulkarni, S., Hegde, Y.R., 2009. Molecular variability in Pythium aphanidermatum

causing rhizome rot of ginger. Indian Phytopathol. 62, 217-222.

Samejima, N., Ichitani, T., 1988. Behaviors of Pythium butleri and P. zingiberum in and around

cucumber stem segments buried in recolonized autoclaved soil. Ann. Phytopathol. Soc. Japan

54, 15-19.

Sánchez, J., Sánchez-Cara, J., Gallego, E., 2000. Suitability of ten plant baits for the rapid detection

of pathogenic Pythium species in hydroponic crops. Eur. J. Plant Pathol. 106, 209-214.

Sarma, Y.R., 1994. Rhizome rot of ginger and tumeric, In: Chadha, K.L., Rethium, P. (Eds.),

Advances in Horticulture. Malhotra Publisher, New Delhi.

Sasikumar, B., Zachariah, J.T., Shamina, A., 2000. Characterisation of ginger germplasm based on

isozyme polymorphism., In: Kumar, M.N.a.R.R. (Ed.), Recent Advances in Plants. Crops.

Res. Allied Publishers, New Delhi, pp. 251-255.

Schenk, A., 1859. Algologische Mittheilungen 5. Verh. phys. med. Ges. Würzburg 9, 12-31.

Schroeder, K., Martin, F.N., de Cock, A., Lévesque, C.A., Spies, C., Okubara, P., Paulitz, T.C.,

2013. Molecular detection and quantification of Pythium species - evolving taxonomy, new

tools and challenges. Plant Dis. 97 (1), 1-20

Schroeder, K.L., Okubara, P.A., Tambong, J.T., Lévesque, C.A., Paulitz, T.C., 2006. Identification

and quantification of pathogenic Pythium spp. from soils in Eastern Washington using real-

time polymerase chain reaction. Phytopathology 96, 637-647.

Schroeder, K.L., Paulitz, T.C., 2006. Quantification of Pythium species in soils from dryland cereal-

based cropping systems using real-time PCR. Phytopathology 96, S105-S105.

Senapati, A.K., Sugata, G., 2005. Screening of ginger varieties against rhizome rot disease complex

in eastern ghat high land zone of Orissa. Indian Phytopathol. 58, 437-439.

References

138

Shahare, K.C., Asthana, R.P., 1962. Rhizome rot of ginger and its control. Indian Phytopathol. 15,

77-78.

Shaista, J.K., Fatima, A., Zaidi, N., Ejaz, N., 2010. Effect of different stabilizers on the antibacterial

activity of "ginger garlic paste". J. Appl. Sci. Envir. Manage. 13, 103-109.

Shanmugam, V., Dohroo, N.P., Gupta, M., Gangta, V., Dohroo, A., 2010. First report of Pythium

splendens on ginger. J. Plant Pathol. 92, S109.

Shanmugam, V., Gupta, S., Dohroo, N.P., 2013. Selection of a compatible biocontrol strain mixture

based on co-cultivation to control rhizome rot of ginger. Crop Prot. 43, 119-127.

Sharma, B.R., Dutta, S., Roy, S., Debnath, A., De Roy, M., 2010. The effects of soil physico-

chemical properties on rhizome rot and wilt disease complex incidence of ginger under hill

agro-climatic region of West Bengal. Plant Pathol. J. 26(2), 198-202.

Sharma, N.D., Jain, A.C., 1977. A check-list and selected bibliography of ginger diseases of the

world. Trop. Pest Manage. 23, 474-481.

Shukla, Y., Singh, M., 2007. Cancer preventive properties of ginger: A brief review. Food Chem.

Toxicol. 45, 683-690.

Sigobodhla, T.E., Dimbi, S., Masuka, A.J., 2010. First report of Pythium myriotylum causing root

and stem rot on tobacco in Zimbabwe. Plant Dis. 94, 1067-1067.

Silva-Rojas, H.V., Creswell, T.C., Phillips, J.L., Abad, J.A., Abad, Z.G., 2004. Two putative new

species of Pythiogeton associated with cypress and English Ivy in North Carolina.

Phytopathology 94, S95-S96.

Singh, A.K., 2011. Management of rhizome rot caused by Pythium, Fusarium and Ralstonia spp. in

ginger (Zingiber officinale) under natural field conditions. Indian J. Agr. Sci. 81, 268-270.

Singletary, K., 2010. Ginger. Nutr. Today 45, 171.

Smith, M., Abbas, R., 2011. Controlling Pythium and Associated Pests in Ginger., RIRDC

Publication No. 11/128, Canberra.

Smith, M.K., Smith, J.P., Stirling, G.R., 2011. Integration of minimum tillage, crop rotation and

organic amendments into a ginger farming system: Impacts on yield and soilborne diseases.

Soil Till. Res. 114, 108-116.

Song, H., Buhay, J.E., Whiting, M.F., Crandall, K.A., 2008. Many species in one: DNA barcoding

overestimates the number of species when nuclear mitochondrial pseudogenes are

coamplified. PNAS 105, 13486-13491.

Sonko, R., Njue, E., Ssebuliba, J.M., Jager, A.d., 2005. The Horticultural sector in Uganda., in:

Assche, I.J.V. (Ed.), Scripta Horticulturae. International Society for Horticultural Science,

Belgium.

References

139

Southern, J.W., 1976. Comparative pathogenicity of Pythium myriotylum and P. irregulare to the

soybean cultivar bragg. Phytopathology 66, 1380.

Sparrow, F.K., 1932. Observations on the aquatic fungi of Cold Spring Habor. Mycologia 24, 268-

303.

Spies, C.F.J., Mazzola, M., Botha, W.J., Langenhoven, S.D., Mostert, L., McLeod, A., 2011a.

Molecular analyses of Pythium irregulare isolates from grapevines in South Africa suggest a

single variable species. Fungal Biol. 115, 1210-1224.

Spies, C.F.J., Mazzola, M., McLeod, A., 2011b. Characterisation and detection of Pythium and

Phytophthora species associated with grapevines in South Africa. Eur. J. Plant Pathol. 131,

103-119.

Spies, C.F.J., Meitz-Hopkins, J.C., Langenhoven, S.D., Pretorius, M.C., McLeod, A., 2014. Two

clonal lineages of Phytophthora citrophthora from citrus in South Africa represent a single

phylogenetic species. Mycologia 106, 1106-1118.

Stanghellini, M.E., 1971. The sporangium of Pythium ultimum as a survival structure in soil.

Phytopathology 61, 157.

Stanghellini, M.E., Kronland, W.C., 1985. Bioassay for quantification of Pythium aphanidermatum

in soil. Phytopathology 75, 1242-1245.

Stanghellini, M.E., Mohammadi, M., Förster, H., Adaskaveg, J.E., 2014. Pythium brassicum sp.

nov.: a novel plant family-specific root pathogen. Plant Disease 98, 1619-1625.

Stirling, A.M., 2002. Erwinia chrysanthemi, the cause of soft rot in ginger (Zingiber officinale) in

Australia. Australas. Plant Pathol. 31, 419-420.

Stirling, A.M., 2004. The causes of poor establishment of ginger (Zingiber officinale) in

Queensland, Australia. Australas. Plant Pathol. 33, 203-210.

Stirling, G.R., Eden, L.M., Ashley, M.G., 2004. Sudden wilt of capsicum in tropical and subtropical

Australia: a severe form of Pythium root rot exacerbated by high soil temperatures. Australas.

Plant Pathol. 33, 357-366.

Stirling, G.R., Smith, J.P., Hamill, S.D., Smith, M.K., 2010. Identifying and developing soils that

are suppressive to Pythium rhizome rot of ginger, in: Sterling, G.R. (Ed.), Proceedings of the

sixth Australasian soilborne diseases symposium., Twin Waters, Queensland, p. 89.

Stirling, G.R., Smith, M.K., Smith, J.P., Stirling, A.M., Hamill, S.D., 2012. Organic inputs, tillage

and rotation practices influence soil health and suppressiveness to soilborne pests and

pathogens of ginger. Australas. Plant Pathol. 41, 99-112.

Stirling, G.R., Turaganivalu, U., Stirling, A.M., Lomavatu, M.F., Smith, M.K., 2009. Rhizome rot

of ginger (Zingiber officinale) caused by Pythium myriotylum in Fiji and Australia. Australas.


References

140

Stoilova, I., Krastanov, A., Stoyanova, A., Denev, P., Gargova, S., 2007. Antioxidant activity of a

ginger extract (Zingiber officinale). Food Chem. 102, 764-770.

Suffert, F., Guibert, M., 2007. The ecology of a Pythium community in relation to the epidemiology

of carrot cavity spot. Appl. Soil Ecol. 35, 488-501.

Suryanarayana, V., Pant, R.P., 2008. Mosaic and veinal fleck on ginger in Karnataka - A viral

disease associated with isometric particles. Indian J. Virol. 19, 124-124.

Takahashi, M., 1954a. On the morphology and taxonomy of some species of the genus Pythium

which causes crop diseases. Ann. Phytopathol. Soc. Japan 18, 113-118.

Takahashi, M., 1954b. Pythium zingiberum causing rhizome rot of ginger plant an its distribution.

Ann. Phytopathol. Soc. Japan 18, 435-441.

Takenaka, S., Ishikawa, S., 2013. Biocontrol of sugar beet seedling and taproot diseases caused by

Aphanomyces cochlioides by Pythium oligandrum treatments before transplanting. Japan

Agricul. Res. Quart. 47, 75-83.

Takenaka, S., Sekiguchi, H., Nakaho, K., Tojo, M., Masunaka, A., Takahashi, H., 2008.

Colonization of Pythium oligandrum in the tomato rhizosphere for biological control of

bacterial wilt disease analyzed by real-time PCR and confocal laser-scanning microscopy.


Tambong, J.T., Poppe, J., Höfte, M., 1999. Pathogenicity, electrophoretic characterisation and in

planta detection of the cocoyam root rot disease pathogen, Pythium myriotylum. Eur. J. Plant

Pathol. 105, 597-607.

Tanina, K., Tojo, M., Date, H., Nasu, H., Kasuyama, S., 2004. Pythium rot of chingensai (Brassica

campestris L. chinensis group) caused by Pythium ultimum var. ultimum and Pythium

aphanidermatum. J. Gen. Plant Pathol. 70, 188-191.

Tao, Y., Zeng, F., Ho, H., Wei, J., Wu, Y., Yang, L., He, Y., 2011. Pythium vexans causing stem rot

of Dendrobium in Yunnan province, China. J. Phytopathol. 159, 255-259.

Teakle, D.S., 1960. Species of Pythium in Queensland. Queensland J. Agr. Sci. 17, 15-31.

Teakle, D.S., 1962. Investigation on the genus Pythium in Queensland. Master thesis of Agricultural

Science. The University of Queensland.

Thomas, K.M., 1938. Detailed Administration Report of the Government Mycologist., Madras for

the year 1937-1938, p. 21.

Tojo, M., Kuroda, K., Suzuki, H., 2004. First report of stem rot of Guiana chestnut (Pachira

aquatica) caused by Pythium splendens. Plant Dis. 88, 84-84.

Tojo, M., Nakazono, E., Tsushima, S., Morikawa, T., Matsumoto, N., 1998. Characterization of two

morphological groups of isolates of Pythium ultimum var. ultimum in a vegetable field.

Mycoscience 39, 135-144.

References

141

Tojo, M., Ono, H., Nakashima, C., Yoneyama, S., Jayakody, J.A.S., 2005. First report of root rot of

cocoyam caused by Pythium myriotylum in Sri Lanka. Plant Dis. 89, 1132-1132.

Tomioka, K., Takehara, T., Osaki, H., Sekiguchi, H., Nomiyama, K., Kageyama, K., 2013.

Damping-off of soybean caused by Pythium myriotylum in Japan. J. Gen. Plant Pathol. 79,

162-164.

Trujillo, E.E., 1964. Disease of ginger (Zingiber officinale) in Hawaii. Circular Hawaii Agricultural

Expirment Station, University of Hawaii.

Tsai, Y.P., 1991. List of Plant disease in Taiwan. The plant protection society of the republic of

China and the Phytopathological society of the Republic of China, Taichung, Taiwan.

Tsao, P.H., Ocana, G., 1969. Selective isolation of species of Phytophthora from natural soils on an

improved antibiotic medium. Nature 223, 636-638.

Tsror, L., Hazanovsky, M., Mordechai‐Lebiush, S., Ben‐David, T., Dori, I., Matan, E., 2004. Root

rot and wilt of Kangaroo paw (Anigozanthos manglesii) caused by Pythium myriotylum

(Drechs.) in Israel. J. Phytopathol. 152, 114-117.

Tyler, B.M., Tripathy, S., Zhang, X., Dehal, P., Jiang, R.H., Aerts, A., Arredondo, F.D., Baxter, L.,

Bensasson, D., Beynon, J.L., 2006. Phytophthora genome sequences uncover evolutionary

origins and mechanisms of pathogenesis. Science 313, 1261-1266.

Tzean, S.S., Estey, R.H., 1981. Species of Phytophthora and Pythium as nematode-destroying

fungi. J. Nematol. 13, 160-163.

Urrea, K.E., Rupe, J.C., Rothrock, C.S., Steger, A.J., Anders, M.M, Rojas, A.J., Chilvers, M.I.,

2013. Effect of crop rotation on Pythium spp. population composition in Arkansas soybean

fields. Phytopathology 103, 150-151.

Uzuhashi, S., Tojo, M., Kakishima, M., 2010. Phylogeny of the genus Pythium and description of

new genera. Mycoscience 51, 337-365.

Vallance, J., Déniel, F., Barbier, G., Guerin-Dubrana, L., Benhamou, N., Rey, P., 2012. Influence of

Pythium oligandrum on the bacterial communities that colonize the nutrient solutions and the

rhizosphere of tomato plants. Can. J. Microbiol. 58, 1124-1134.

Vallance, J., Le Floch, G., Déniel, F., Barbier, G., Lévesque, C.A., Rey, P., 2009. Influence of

Pythium oligandrum biocontrol on fungal and oomycete population dynamics in the

rhizosphere. Appl. Environ. Microbiol. 75, 4790-4800.

Vasala, P.A., 2010. Ginger, In: Peter, K.V. (Ed.), Handbook of herbs and spices. Woodhead

Publishing, pp. 195-206.

Vasseur, V., Rey, P., Bellanger, E., Brygoo, Y., Tirilly, Y., 2005. Molecular characterization of

Pythium group F isolates by ribosomal- and intermicrosatellite-DNA regions analysis. Eur. J.


References

142

Villa, N.O., Kageyama, K., Asano, T., Suga, H., 2006. Phylogenetic relationships of Pythium and

Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-Tubulin gene

sequences. Mycologia 98, 410-422.

Voglmayr, H., Bonner, L.J., Dick, M.W., 1999. Taxonomy and oogonial ultrastructure of a new

aero-aquatic peronosporomycete, Medusoides gen. nov. (Pythiogetonaceae fam. nov.). Mycol.

Res. 103, 591-606.

Voravuthikunchai, S.P., Limsuwan, S., Supapol, O., Subhadhirasakul, S., 2006. Antibacterial

activity of extracts from family zingiberaceae against foodborne pathogens. J. Food Safety 26,

325-334.

Wahyuni, S., Xu, D.H., Bermawie, N., Tsunematsu, H., Ban, T., 2003. Genetic relationships among

ginger accessions based on AFLP marker. J. Bioteknologi Pertanian 8, 60-68.

Wang, P.H., Chang, C.W., 2003. Detection of the low-germination-rate resting oospores of Pythium

myriotylum from soil by PCR. Lett. Appl. Microbiol. 36, 157-161.

Wang, P.H., Chung, C.Y., Lin, Y.S., Yeh, Y., 2003. Use of polymerase chain reaction to detect the

soft rot pathogen, Pythium myriotylum, in infected ginger rhizomes. Lett. Appl. Microbiol. 36,

116-120.

Wang, P.H., White, J.G., 1997. Molecular characterization of Pythium species based on RFLP

analysis of the internal transcribed spacer region of ribosomal DNA. Physiol. Mol. Plant P.

51, 129-129.

Ward, E., Foster, S.J., Fraaije, B.A., Mccartney, H.A., 2004. Plant pathogen diagnostics:

immunological and nucleic acid-based approaches. Ann. Appl. Biol. 145, 1-16.

Watanabe, G.M., 1974. Fungi isolated from the underground parts of sugar cane in relation to the

poor ratooning in Taiwan. (2) Pythium and Pythiogeton. Tran. Mycol. Soc. Jap. 15, 343-357.

Watanabe, H., Kageyama, K., Taguchi, Y., Horinouchi, H., Hyakumachi, M., 2008. Bait method to

detect Pythium species that grow at high temperatures in hydroponic solutions. J. Gen. Plant

Pathol. 74, 417-424.

Watanabe, H., Taguchi, Y., Hyakumachi, M., Kageyama, K., 2007. Pythium and Phytophthora

species associated with root and stem rots of kalanchoe. J. Gen. Plant Pathol. 73, 81-88.

Watanabe, T., 1984. Detection and quantitative estimations of Pythium aphanidermatum in soil

with cucumber seeds as a baiting substrate. Plant Dis. 68, 697.

Watanabe, T., 2010. Pictorial atlas of soil and seed fungi: morphologies of cultured fungi and key to

species. CRC Press/Taylor & Francis, Boca Raton.

Webster, J., Weber, R., 2007. Introduction to fungi. Cambridge University Press, Cambridge, UK.

Weiland, J.E., 2011. Influence of isolation method on recovery of Pythium species from forest

nursery soils in Oregon and Washington. Plant Dis. 95, 547-553.

References

143

Whipps, J.M., 1987. Effect of media on growth and interactions between a range of soil-borne

glasshouse pathogens and antagonistic fungi. New Phytol. 107, 127-142.

White, T.J., Bruns, T., Lee, S., Taylor, J., 1990. Amplification and direct sequencing of fungal

ribosomal rna genes for phylogenetics, In: Innis M. A., G.D.H., Sninsky J. J. And White T. J.

(Ed.), PCR Protocols: A guide to methods and applications. Academic Press, Inc. , California,

pp. 315-322.

Williams, J.G., Kubelik, A.R., Livak, K.J., Rafalski, J.A., Tingey, S.V., 1990. DNA polymorphisms

amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18, 6531-

6535.

Wright, H., 2011. Ginger: pungent, yet soothing to the stomach. (EN on Foods). Envir. Nutr. 34, 8.

Yabing, D., Yang, Y., Wang, Y., Pan, X., Wu, J., Cai, Y., Li, T., Zhao, D., Wang, J., Zhou, M.,

2015. Loop-mediated isothermal amplification for the rapid detection of the F200Y mutant

genotype of carbendazim-resistant isolates of Sclerotinia sclerotiorum. Plant Dis.

http://dx.doi.org/10.1094/PDIS-10-15-1185-RE

Yacoub, A., Gerbore, J., Magnin, N., Chambon, P., Dufour, M.C., Corio-Costet, M.F., Guyoneaud,

R., Rey, P., 2016. Ability of Pythium oligandrum strains to protect Vitis vinifera L., by

inducing plant resistance against Phaeomoniella chlamydospora, a pathogen involved in Esca,

a grapevine trunk disease. Biol. Control 92, 7-16.

Yang, K.D., Kim, H.M., Lee, W.H., So, I.Y., 1988. Studies on rhizome rot of ginger caused by

Fuzarium oxysporum f. sp. zingiberi and Pythium zingiberum. Korean J. Plant Pathol. 4, 271-

277.

Yuan, J., Feng, K., Qi, J., Zhang, B., Li, L., Li, C., Qu, Z., 2011. Efficacy of Bacillaceae and

Bacillus against ginger rhizome Pythium rot., in: Reddy, M.S., Wang, Q. (Eds.), 2nd Asian

plant growht-promoting rhizobacteria (PCPR) for sustainable agriuculture, Beijing, China.

Yuan, J.D., Zhang, Y.L., Qi, J.S., Zhang, B., Xu, Z.T., Li, L., Li, C.S., 2013. Pathogen

identification of ginger stalk rot from Shandong province. Acta Phytopath. Sin. 43, S525.

Yuen, G.Y., Xia, J.Q., Sutula, C.L., 1998. A sensitive ELISA for Pythium ultimum using polyclonal

and species-specific monoclonal antibodies. Plant Dis. 82, 1029-1032.

Zachariah, T.J., 2008. Ginger, In: Parthasarathy, V.A., Chempakam, B., Zachariah, T.J. (Eds.),

Chemistry of Spices. CABI, Wallingford, UK, pp. 70-96.

Zebrowska, E., 1976. Nikoflora kilku zbiornikow wodnych Puszczy Kampinoskiej. Acta Mycol. 12,

77-89.

Zhang, B.Q., Yang, X.B., 2000. Pathogenicity of Pythium populations from corn-soybean rotation

fields. Plant Dis. 84, 94-99.

Zitnick-Anderson, K.K., Nelson, B.D., 2014. Identification and pathogenicity of Pythium on

soybean in North Dakota. Plant Dis. 99, 31-38.

Appendix

144

Appendix 1

Fig A1: A maximum likelihood tree showing phylogenetic relationships among Pythium spp. and

the outgroup Ph. sojae using combined DNA sequences of certain nuclear and mitochondrial genes

(length above 25.800 bp). The numbers at the nodes are the percentage of the trees from bootstrap

analysis (1,000 replications) (only bootstrap values greater than 50% are displayed). All sequence

data of P. myriotylum and P. zingiberis were retrieved from whole genome data in this study.

Sequences of other Pythium spp. and Ph. sojae were from genome data deposited in Genbank.

Sequences for some genes in P. aphanidermatum, P. arrhenomanes, and P. iwayamai were not

available and thus were treated as missing data in the sequence alignment and the tree construction.

Appendix

145

Appendix 2

Fig A2: A maximum likelihood tree showed

phylogenetic relationships among Pythium species using

DNA sequences encoded from CoxII gene The numbers

at the nodes are the percentage of the trees from

bootstrap analysis (1,000 replications) (only bootstrap

values greater than 50% are displayed).

Appendix

146

Appendix 3

Fig A3: A maximum likelihood

tree showed phylogenetic

relationships among Pythium

species using DNA sequences

encoded from CoxI gene The

numbers at the nodes are the

percentage of the trees from

bootstrap analysis (1,000

replications) (only bootstrap values

greater than 50% are displayed).

Appendix

147

Appendix 4

Fig A4: A maximum likelihood tree showed phylogenetic relationships among Pythium species

using DNA sequences encoded from β-tubulin gene The numbers at the nodes are the percentage of

the trees from bootstrap analysis (1,000 replications) (only bootstrap values greater than 50% are

displayed).

Documents

CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM …399464/s... · CHARACTERIZATION OF SPECIES ASSOCIATED WITH PYTHIUM SOFT ROT OF GINGER AND EVALUATION OF PYTHIUM OLIGANDRUM AS