J. Plant Biochemistry & Biotechnology Vol. 15, 79-83, July 2006

*Corresponding author. E-mail: sewaram01@yahoo.com

Characterization of Low Molecular Weight Glutenin Subunit GeneRepresenting Glu-B3 Locus of Indian Wheat Variety NP4

Sewa Ram1*, Vinamrata Bhatia1, Veena Jain2 and B Mishra1

1Directorate of Wheat Research, Post Box 158, Karnal 132 001, India2Department of Biochemistry, CCS Haryana Agricultural University, Hisar 125 004, India

Low molecular weight (LMW) glutenin subunits represent major part (30%) of storage proteins in wheat endosperm anddetermine the quality of dough. Despite their importance few LMW glutenin genes have been characterized so far and nonefrom Indian wheat variety. In the present investigation PCR technique was employed to characterize LMW-GS gene representingGlu-B3 locus from Indian bread wheat cultivar NP4. The deduced protein sequence coded by Glu-B3 locus of LMW-GS genefrom NP4 showed the presence of regular structure of the repetitive domain with varying numbers of glutamine (Q) residuesand the presence of 1st cysteine residue within the repetitive domain at 40th position in mature polypeptide. Such structuremight increase and stabilize the gluten polymer through intermolecular interactions of the large numbers of glutamine sidechains and cysteine residues for intermolecular disulphide bond formation leading to stronger dough quality of NP4.Moreover, Glu-B3 specific primers could also be used for identifying 1BL/1RS translocation in addition to amplifying LMWglutenin genes. There was no amplification in 1B/1R translocation lines as short arm of wheat was replaced by short arm ofrye chromosome in these lines. Such information can be useful in wheat improvement for dough properties for betterchapati and bread quality.

Key words: gluten strength, low molecular weight glutenins, mutation, PCR, sequencing, 1B/1R translocation, wheat.

Glutenins and gliadins constitute around 80% of the total

seed proteins in wheat. Glutenins (acid soluble) are

polymeric proteins whose monomeric units are divided

into high (HMW) and low (LMW) molecular weight glutenin

subunits. Low molecular weight glutenin subunits (LMW-

GS) with molecular weight ranging from 35 kDa to 60 kDa

represent about one third of the total seed proteins and

60% of total glutenins (1). LMW-GS are encoded by major

genes at Glu-3 loci on the short arms of homoeologous

group of chromosome 1 closely linked with Gli-1 loci

encoding gliadins and minor genes on group-6

chromosomes (2, 3). Though a number of studies revealed

the variability in LMW-GS genes associated with significant

differences in dough quality in bread (4-6) and durum

wheat (7, 8), the clear cut relationship of individual protein

subunits with gluten quality has not been established. The

ability of LMW-GS to form intermolecular disulphide bonds

with each other and high molecular weight glutenins is

considered important for gluten polymer formation (9).

Despite their importance only a limited number of

LMW-GS genes have so far been characterized because

of difficulties in cloning them (10, 11). For reasons still

unknown, genes located at this locus are recalcitrant to

standard cloning procedures (10). However, recently PCR

techniques have been employed to clone and characterize

LMW-GS genes (10, 12-14). Since LMW-GS genes, like

all other prolamin genes, do not have introns in their

sequences (1, 15-17), PCR techniques have been proved

suitable for cloning and characterizing these genes.

Reports of N-terminal amino acid sequences of LMW

glutenin fractions revealed that they had either methionine

or serine or isoleucine residue at the first position of the

mature polypeptide. These subunits are therefore called

LMW-m, LMW-s and LMW-i type glutenins, respectively

(14, 16). Ikeda et al (18) classified LMW -GS sequences

into 12 groups based on the alignment of the N and C

terminal domains of the deduced amino acid sequences

from 60 gene sequences available in the database. Based

on the distribution of cysteine residues, the LMW-GS

proteins can be classified into three types: i) those with

one cysteine in N-terminal domain; ii) those with a cysteine

residue in the repetitive domain; and iii) those with 8

cysteines in the C-terminal part of the protein (9). All the

LMW glutenins were reported having 1st cysteine residue

in the N-terminal part of the sequence until D‘Ovidio et al(10) and Masci et al (11) detected 1st cysteine residue in the

80 J Plant Biochem Biotech

repetitive domain in durum and bread wheat, respectively.

In this investigation LMW glutenin gene representing

Glu-B3 locus was characterized from bread wheat cultivar

NP4, an Indian wheat variety known for its good quality

characteristics internationally. PCR primers specific to Glu-

B3 locus were used to amplify partial sequence of LMW

glutenin gene. Glu-B3 locus was selected because of

reports indicating the important role of protein subunits

representing the locus in determining gluten quality. The

gene sequence was analyzed and compared with the

existing gene sequences available in the EMBL sequence

data base. The protein sequence was deduced from the

gene sequence using DbClustal analysis. The significance

of the number and position of cysteine residues in LMW

glutenins is discussed. Glu-B3 specific primers could also

be used for identifying 1BL/1RS translocation where short

arm of 1B is substituted by rye chromosome arm.

Materials and Methods

Plant material and gluten strength measurements —

Indian wheat variety NP4 was grown at DWR, Karnal in

two replications and analyzed for different quality traits

associated with gluten strength. Two replicates of each

sample were made (Approved method 26-10) and milled

using Brabender Senior Quadrumet Mill (AACC method

26-21A) with around 70% extraction rate. Whole meal was

extracted using Cyclotec Mill with 0.5 mm sieve. Protein

and moisture content were determined using NIR as per

the approved methods 44-16 and 46-30, respectively (19)

in wheat grains at 14% mb. Mixograph analyses were

conducted according to AACC method of 54-40A with the

modification that Farinograph water absorption value was

used as optimum water content. Mixographs were recorded

electronically with 10-gram bowl (National Mfg Co, Lincoln,

NE, USA) and the spring fixed at 8th position in the scale.

Farinographs were produced according to AACC Method

54-21 using Brabender Farinograph fitted with 10 gram

bowl (Brabender, Duisburg, Germany) and operated at

30 °C. Constant flour weight procedure was used and

absorption values were based on dough consistency at

500 BU.

DNA isolation, PCR amplification and sequencing —

DNA was extracted from single kernel using modified

method (20) with extraction buffer (100 mM Tris, pH 8.0;

50 mM EDTA, pH 8.0; 500 mM NaCl and 2% SDS). Themixture was gently homogenized and maintained at 65 oC

for 10 min. The extracts were centrifuged at 4 oC and theDNA in the supernatant was precipitated with ethanol,dissolved in TE buffer and used for PCR amplification.Low molecular weight glutenin genes were amplified usingsequence specific primers by the method of VanCampenhout et al (12). PCR reactions were performed ina final reaction volume of 50 μl containing 50-100 nggenomic DNA, 1.25 units Taq DNA polymerase, 1x PCRbuffer with 1.5 mM of MgCl2, 250 ng each of the two primersand 300 mM of each deoxyribonucleotide. Primersequence used to amplify LMW glutenin subunits were,forward primer 5′GGTACCAACAACAACAACCC3′ andreverse primer 5′GTTGCTGCTGAGGTTGGTTC3′. ThePCR products were separated on 1.8% agarose gel tovisualize amplification. PCR products were ligated intopUC57 plasmid vector using InsT/Aclone PCR productcloning kit from MBI Fermentas and DH5a strain ofEscherischia coli was transformed using the same kit. Theinsert was sequenced from both forward and reversedirection using the automated DNA sequencer.

Sequence analysis — For determining homology ofnucleotide sequence with other known sequences, thesequence was submitted to BLAST. Multiple sequencealignment using DbClustal software indicated the levels ofhomologies among different sequences reported fromvarious sources. For deducing the primary structure ofprotein, nucleotide sequence was submitted to the EMBLNucleotide Sequence Database using WebIn the EMBLWWW submission system at http://www.ebi.ac.uk/submission/webin.html.

Results and Discussion

Over the last two decades efforts were made to characterizeglutenin genes located at 1 homoeologues. During 1980’s,cDNA libraries were constructed and clones representingLMW glutenins were isolated (21, 22) and sequenced.During 1990’s, PCR technology was employed to cloneand sequence LMW glutenin genes (12, 23) and to developPCR based markers. DNA sequence analysis of theseclones showed that coding regions are uninterrupted byintrons and possess a proline and glutamine rich domainencoded by a tandem array of irregular repeats followedby unique sequence (C-domain). In the presentinvestigation PCR primers specific for Glu-B3 locus wereused to amplify and sequence LMW glutenin genes inNP4 (Fig. 1). Glu-B3 locus was selected because of reportsindicating important role of the protein subunits

representing the locus in determining gluten quality.

LMW Glutenin Gene Sequence 81

The sequence represents the first partial sequence of

LMW-GS gene from an Indian wheat variety. The deduced

protein sequence coded by Glu-B3 locus of LMW-GS

genes showed the presence of regular structure of the

repetitive domain with high proportions of glutamine (Q)

residues. The presence of 1st cysteine residue within the

repetitive domain at 40th position exhibited it’s availability

for intermolecular disulphide bond formation. Although the

octapeptide repeat PPFSQQQQ was most common,

hexapeptide, nonapeptide and pepta peptide repeats were

also present with variations in the number of glutamine

residues. The irregular amount of Gln in the repeats ranging

from 2 to 5 residues may prevent the formation of highly

regular intra and intermolecular interactions. Highly regular

repeats might lead to strongly interacting aggregates

having excessive insolubility and enzyme inaccessibility

in the endosperm. Moreover, the Gln stretches in the

somewhat extended repeated sequence domain are likely

to interact intermolecularly with their counterparts in other

protein molecules through side chain and main chain amide

hydrogen bonding. Thus the repeat might increase the

viscosity and elasticity of the dough through intermolecular

interactions of the large numbers of glutamine side chains

(24) which are both good hydrogen donors and acceptors.

The presence of cysteine residue in the repetitive domain

might have arisen by the substitution of phenylalanine

amino-acid residue which is present in majority of the LMW-

GS genes reported so far. Such a substitution could have

been arisen from a T to G transversion event. Since

cysteine is encoded by a TGT triplet, whereas

phenylalanine present in the repeating units of LMW-GS

are usually coded by TTT triplets. The position of the

cysteine residue is important because 1 and 7 cysteine

residues are involved in intermolecular disulphide bond

formation and thus act as chain extenders (25, 26).

Preponderance of chain extender types in glutenin should

lead to strong gluten with good viscoelastic properties.

The stronger gluten of NP4 was exhibited by different

quality tests showing higher sedimentation volumes (~55

ml), higher Farinograph mixing time (>6.0 min) and higher

tolerance to over mixing, higher Mixograph peak time

(>3.45 min) and higher Alveograph W value (~225 erg).

LMW glutenin protein described in this investigation may

contribute significantly to the stronger gluten of NP4. The

study demonstrated that NP4, an old Indian wheat variety

developed during the beginning of the last century and

acclaimed internationally for quality, contains LMW

Multiple sequence alignment using DbClustal software

showed the levels of homologies among different

sequences reported from various sources. The highest

homology (96%) of the LMW glutenin gene obtained in

this investigation was with the sequence reported by

D‘Ovidio et al (10) followed by varying homologies with

LMW glutenin and gliadin genes. There were differences

at 15 positions in the repetitive domain of the sequence

from NP4 as compared to the sequence reported from

D‘Ovidio et al (10). The differences in nucleotide sequence

resulted into change in amino acid residues at 10 positions

from glutamine to histidine at 43rd position, glutamine to

proline at 51st and 53rd position, glutamine to histidine,

arginine and lysine at 56, 57 and 58th position respectively,

serine to lysine at 62 position and glutamine to histidine at

80th and 83rd position and lysine to proline at 124th position

in deduced mature polypeptide (Fig. 2). At 5 places

differences in nucleotide did not result into change in amino

acid residue because of degeneracy of genetic code.

Fig. 1. Coding region of LMW glutenin genes. S, signal peptide;N, N-terminal domain; R, repetitive domain; C, C-terminal domain.The position of the primers used for PCR analysis is indicated byarrows.

Fig. 2. Comparison between deduced protein sequencerepresenting gene at Glu-B3 locus from NP4 and plDNLMW1Bclone of durum wheat (EMBL data library accession numberY14104). The LMW glutenin sequence of NP4 showed highesthomology (98%) with the reported sequence. The amino acidsequences corresponding to the primers used for PCRamplification are shown by arrows. The positions of cysteineresidues are underlined and differences in amino acid residuesby bold letters. The doted lines indicate the part outside theamplified region in NP4.

82 J Plant Biochem Biotech

glutenin gene at GLu-B3 locus with rare characteristics.

Occurrence of 1st and 7th cysteine residues in flexible

regions of the protein where stretches of glutamines are

present might facilitate polymerization and stabilization of

gluten polymers (9). This is supported by site specific

mutagenesis studies in which LMW-GS lacking 1st cysteine

residue (replaced by arginine) formed lower amount of

polymers (27).

The primers specific to Glu-B3 locus could also be

utilized to identify 1BL/1RS translocation lines where short

arm of wheat was replaced by short arm of rye

chromosome. Since primers were specific to Glu-B3 locus,

there was no amplification in 1B/1R translocation lines

(Fig. 3). Over the past two decades wheat breeders in

India have used the short arm of rye chromosome 1R as

source of genes for disease and pest resistance and

improved agronomic performance. Introduction of large

numbers of diversified germplasm from CIMMYT including

Mexican semi-dwarf genes during 60s and 1BL/1RS

translocation during 90s in the breeding program led to

the generation of high yielding varieties adapted to the

Indian situations. Recently zone-wise analysis of the

gliadin pattern of Indian wheat varieties released during

last 4 decades indicated the prevalence of 1BL/1RS

translocation in cultivars representing Northern Hills, North

West and North East plains where intense cold conditions

prevail during winter period as compared to Central Zone

where warm and dry conditions exist (28). Earlier studies

also showed the presence of genes showing resistance to

cold conditions in 1BL/1RS translocation lines (29).

However, reduced gluten strength and loaf volume and

increased dough stickiness have been reported

associated with 1BL/1RS translocation (30, 31). The

negative effects on dough properties may be due to

presence of secalins coded by 1RS of rye (30) or loss of

wheat prolamins codified by genes of the 1B short arm

(Glu-B3) (32). Though, the effects of 1BL/1RS on dough

properties can be minimized by incorporating specific

combinations of prolamin genes (33). The primers specific

for Glu-B3 locus reported in this investigation can be

utilized while selecting recombinants with chromosomal

segments containing LMW glutenin genes along with

regions of 1B/1R translocation responsible for high yield

potential and disease resistance. This can lead to

enhanced quality of resulting genotypes as well as high

yield potential.

In conclusion, the deduced protein sequence coded

by Glu-B3 locus of LMW-GS gene from NP4 showed the

presence of regular structure of the repetitive domain with

varying numbers of glutamine (Q) residues and the

presence of 1st cysteine residue within the repetitive domain

at 40th position in mature polypeptide. Such structure might

increase and stabilize the gluten polymer through

intermolecular interactions of the large numbers of

glutamine side chains and cysteine residues for

intermolecular disulphide bond formation leading to

stronger dough quality of NP4. PCR amplification using

Glu-B3 specific primers can also be used in improving

wheat quality by selecting chromosomal segments

containing LMW glutenin genes along with regions of 1B/

1R translocation responsible for high yield potential and

disease resistance.

Received 3 March, 2006; accepted 19 June, 2006.

References

1 Ciaffi M, Lee YK, Tamas L, Gupta R, Skerritt J & AppelsR, Theor Appl Genet, 98 (1999) 135.

2 Singh NK & Shepherd KW, Theor Appl Genet, 66 (1998)628.

3 Lew EJL, Kuzmicky DD & Kasarda DD, Cereal Chem, 69(1992) 508.

4 Gupta RB & MacRitchie F, J Cereal Sci, 19 (1994) 19.

5 Luo C, Griffin WB, Branlard G & McNeil DL, Theor ApplGenet, 102 (2001) 1088.

6 Vaccino P, Redaelli R, Metakovsky EV, Borghi B,Corbellini M & Pogna NE, Theor Appl Genet, 105 (2002)43.

7 Pogna NE, Lafiandra D, Feillet P & Autran JC, J CerealSci, 7 (1988) 211.

8 Ruiz M & Carillo JM, Theor Appl Genet, 87 (1993) 353.

9 D‘Ovidio R, & Masci S, J Cereal Sci, 39 (2004) 321.

Fig. 3. PCR amplification products (636 bp) of LMW gluteningene coded by Glu-B3 locus in different wheat varieties. Thepresence of amplification products indicates absence of 1B/1Rtranslocation and the absence of amplification product shows1B/1R translocation where short arm of 1B is substituted by ryechromosome arm. Lane M: marker (1kb DNA ladder).

M

LMW Glutenin Gene Sequence 83

10 D’Ovidio R, Simeone M, Masci S & Porceddu E, TheorAppl Genet, 95 (1997) 1119.

11 Masci S, D’Ovidio R, Lafiandra D & Kasarda DD, PlantPhysiol, 118 (1998) 1147.

12 Van Campenhout S, Vander Stappen J, Sagi L &Volckaert G, Theor Appl Genet, 91 (1995) 313.

13 Benmoussa M, Vezina LP, Page M, Yelle S & Laberge S,Theor Appl Genet, 100 (2000) 789.

14 Cloutier S, Rampitsch C, Penner GA & Lukow OM, JCereal Sci, 33 (2001) 143.

15 Cassidy BG, Dvorak J & Anderson OD, Theor Appl Genet,96 (1998) 743.

16 D‘Ovidio R, Marchitelli C, Ercoli Cardelli L & PorcedduE, Theor Appl Genet, 98 (1999) 455.

17 Lee YK, Ciaffi M, Morell MK & Appels R, Theor Appl Genet,98 (1999) 126.

18 Ikeda TM, Nagamine T, Fukuoka H & Yano H, Theor ApplGenet, 104 (2002) 680.

19 AACC, Approved methods of American Association ofCereal Chemists, 10th edition. The Association: St. Paul,MN, USA (2000).

20 Benito C, Figueiras AM, Zaragoza C, Gallego FJ & de laPena A, Plant Mol Biol, 21 (1993) 181.

21 Pitts EG, Rafalski JA & Hedgcoth C, Nucleic Acids Res,16 (1988) 11376.

22 Colot V, Bartels D, Thompson R & Flavell R, Mol GenGenet, 216 (1989) 81.

23 D’Ovidio R, Tanzarella OA & Porceddu E, Plant Mol Biol,18 (1992) 781.

24 Masci S, D’Ovidio R, Lafiandra D & Kasarda DD, TheorAppl Genet, 100 (2000) 396.

25 Shewry P & Tatham R, J Cereal Sci, 25 (1997) 207.

26 Orsi A, Sparvoli F & Ceriotti A, J Biol Chem, 276(34)(2001) 32322.

27 Patacchini C, Masci S, D‘Ovidio R & Lafiandra R, J Chrom,786 (2003) 215.

28 Sewa Ram, Jain N, Dawar V, Singh RP & Jag Shoran,Crop Sci, 45 (2005) 1256.

29 Metakovsky EV & Branlard G, Theor Appl Genet, 96 (1998)209.

30 Dhaliwal AS, Mares DJ, Marshall DR & Skerritt JH, CerealChem, 65 (1988)143.

31 Lee JH, Graybosch RA & Peterson CJ, Theor Appl Genet,90 (1995) 105.

32 Payne PI, Seekings JA, Worland JA, Jarvis MG & HoltLM, J Cereal Sci, 6 (1987) 103.

33 Martin P & Carrillo JM, Euphytica, 108 (1999) 29.