ELSEVIER Biochimica et Biophysica Acta 1219 (1994) 413-421

BI1 Biochi~ic~a et Biophysica A~ta

Characterization of an Krox-24/Egr-l-responsive element in the human tumor necrosis factor promoter

Bernd Kr~imer, Albrecht Meichle 1, Gabriele Hensel 2, Patrick Charnay 3, Martin Kr6nke * Institut fiir Medizinische Mikrobiologie und Hygiene, Technische Universitiit Miinchen, Trogerstr. 32, 81675 Miinchen, Germany

Received 8 March 1994

Abstract

We have analyzed in various human leukemic cell lines a previously unrecognized region within the human TNF gene promoter that contains the sequence motif 5'-CCGCCCCCGCG-3'. This GC-rich sequence maps to bps - 170 and - 160 of the TNF gene. Electrophoretic mobility shift assays (EMSA) combined with methylation interference analysis revealed the binding of two distinct proteins with overlapping recognition sites. Supershift assays identified the constitutive transcription factor Spl and the immediate-early growth-response transcription factor Egr-1/Krox-24. Interestingly, this Egr-l-related factor was induced by PMA but not by TNF. The TNF gene GC-rich sequence conferred PMA responsiveness when linked to a heterologous minimal c-los promoter. To examine the involvement of Egr-1/Krox-24 in TNF gene regulation, a Krox-24 expression vector was used, pSCTKr24. In Jurkat T cells pSCTKr24 stimulated pTNF-286CAT that contains sequences - 286 to + 34 of the human TNF gene fused to the chloramphenicol acetyltransferase (CAT) gene. Moreover, pSCTKr24 also stimulated the TNF gene GC-rich sequence linked to the minimal c-los promoter. However, deletion of this site did not result in markedly reduced TNF promoter activity, suggesting that the Egr-1/Krox-24 response element may play an auxiliary role in TNF gene regulation.

Keywords: Promoter; Tumor necrosis factor; Transcription factor; (Human)

1. Introduction

Cytokines play a key role in the regulation of the host defense responses against microbial infections and neoplasia. However, an adequate functioning of host defense mechanisms requires a stringent and balanced control of the regulation of cytokine production. This holds true in particular for tumor necrosis factor (TNF), a cytokine with marked proinflammatory biological ac- tivity [1-3]. Deregulated overproduction of T N F al- legedly contributes to the pathophysiology of a number

Abbrevations: CAT, chloramphenicol acetyltransferase; Egr, early growth-responsive; PMA, phorboi-12-myristate-13-acetate; TNF, tumor necrosis factor.

* Corresponding author. Fax: + 49 89 41805242. 1 Present address: G6decke AG, Moswald Alice 1, 79090 Freiburg. 2 Present address: Institut fiir Anatomic und Zellbiologie, Univer-

sit,it Marburg, 3550 Marburg. 3 Present address: Laboratoire de G6n6tique Mol6culaire, CNRS

D 1302, Ecole Normale Sup6d6ure, Pads, France.

0167-4781/94/$07.00 © 1994 Elsevier Science B.V. All rights reserved SSDI 0167-4781(94)00116-K

of disease states such as autoimmune diabetes, septic shock, graft versus host disease or cachexia accompany- ing chronical parasitic infection [1-6]. In addition, sev- eral lines of evidence suggest that TNF can stimulate H I V replication by activating KB enhancer elements within the viral L T R and, thus, might function as a disease progression factor in AIDS [7]. This ambivalent biological significance of TNF actions has raised con- siderable interest in the mechanisms controlling TNF gene expression.

TNF synthesis and secretion is regulated at several levels (for review see [8]). TNF production was shown to be inducible in a variety of different cell types including not only macrophages, B-and T-lymphocytes, but also NK cells, mast cells and a number of tumor cell lines [9-12]. TNF production is regulated in part at post-transcriptional levels [13]. E.g. AU sequences within the 3' untranslated region (UTR) of the TNF m R N A predispose for m R N A degradation by RNAses and regulate translational efficiency [14,15]. Further, a yet undefined post-translational control mechanism regulates the proteolytic cleavage of the membrane-

414 B. Kriimer et al. /Biochimica et Biophysica Acta 1219 (1994) 413 421

bound 31 kDa TNF precursor molecule which is re- quired for the release of soluble TNF from the cell surface [16]. However, major regulatory mechanisms operate at the level of TNF gene transcription. Several stimuli such as LPS, PMA, TNF, IFN-gamma or TGFfl have been shown to enhance the rate of TNF gene transcription [3,17-19]. In contrast, IL-4 or increased intracellular cAMP levels can trigger negative regula- tory circuits inhibiting TNF gene expression at the level of mRNA transcription [20,21].

To date, the nature of these transcriptional control mechanisms is not fully understood. Even though the human TNF promoter contains motifs with similarity to NF-~cB binding sites, these sequences seem neither required nor sufficient for virus or LPS induction [22]. Recently we have localized, as well as others, a PMA- responsive DNA region between bps -286 and -101 [23,24]. We here demonstrate the binding of a PMA-in- ducible protein to a GC-rich region of the TNF pro- moter. This nuclear protein displays the binding speci- ficity characteristic of Egr-1/Krox-24, an immediate- early growth response transcription factor, and appears to contribute to the overall TNF promoter activity.

2. Material and methods

2.1. Cell lines and culture conditions

K562, Jurkat and U937 cell lines were maintained in culture medium consisting of a mixture of Click's/ RPMI (50:50, vol%) supplemented with 5% fetal calf serum (FCS) and 50 /zg/ml each of streptomycin and penicillin.

The Krox-24 expression vector, pSCTKr24, was gen- erated by ligating the coding sequence of the murine Krox-24 gene [26] under the control of the cytomegalo virus enhancer/promoter derived from pSCTGALX- 556 (generous gift of Dr. W. Schaffner). pSCTAHP lacks Krox-24 sequences and was used as a control vector.

2.3. TNF promoter deletion constructs

5' deletions of the TNF gene promoter were gener- ated from a pUC13pML plasmid (generously provided by Genentech, San Francisco, CA, USA) containing the human genomic TNF sequences extending from the EcoRI site located 615 bp 5' of the cap site to the EcoRI site [27]. The nomenclature of the deletion plasmids is based on the most 5' nucleotide of the TNF gene sequence present and its position is denoted relative to the nucleotide representing the transcrip- tional initiation site ( + 1). To generate pTNF-286CAT, a 320 bp Aual I fragment containing bp -286 to + 34 was isolated, converted to blunt ends and ligated to the enhancerless pSVOCAT. To obtain -163 and -139 deletions, pTNF-615CAT [24] was linearized by Clal followed by Bal31 digestions. The digested ends were then treated with T4-polymerase and the Klenow en- zyme to form blunt ends. The end points of the dele- tions were determined by chemical sequencing accord- ing to the method described by Maxam and Gilbert [28]. To generate pTNF-101CAT, pTNF-615CAT was digested with ClaI and SstI, the remaining 4.7 kbp TNF-CAT fragment was gel-purified, converted to blunt ends and finally religated.

2.2. Oligonucleotides and plasmids 2.4. Methylation interference analysis

The sequences of the oligonucleotides used in gel retardation assays are shown in the respective figure legends. For each oligonucleotide upper and lower strands were synthesized on a 380 A DNA synthesizer (AB/I Weiterstadt, Germany) and purified by denatur- ing gel electrophoresis. Complementary strands were boiled and annealed by cooling in 10 mM Tris (pH 7.5), 1 mM EDTA, 100 mM NaC1. To test specific TNF promoter 5' sequences for their ability to activate a heterologous promoter, oligonucleotides were cloned into plasmid pJ21CAT ([25]; kindly provided by Dr. J. Pierce, Boston) containing a minimal mouse c-los pro- moter upstream of the CAT gene. To this, the blunt ended, double-stranded oligonucleotides were phos- phorylated and ligated into the nuclease Sl-digested Sail site of pJ21CAT. To determine both the number and orientation of inserts, plasmids were sequenced by the dideoxy chain termination method using sequenase T M (USB, Cleveland, OH, USA).

DNA fragments containing the TNF promoter re- gion from position -179 to -148 were isolated by B a m H I / H i n d I I I digestion of plasmid p3 x TIJ21CAT (see Fig. 4a). 5' and 3' ends were labeled by using polynucleotide kinase or the Klenow enzyme, respec- tively. For partial methylation, fragments were treated with dimethylsulfate for 8 min at room temperature in 200/zl of a buffer containing 50 mM sodium cacodylate (pH 8.0) and 1 mM EDTA. The reaction was stopped by adding 50/zl 1.5 M sodium acetate (pH 7.0) and 1 M 2-mercaptoethanol. Fragments were then incubated with nuclear extracts and complexed DNA was sepa- rated in a 4% native polyacrylamide gel. Complexed and free DNA were electroeluted and further purified by NACPS column (BRL) chromatography and then incubated with piperidine (10%, v/v) for 30 min at 90°C. Cleavage products were separated on a 15% polyacrylamide, 8 M urea/1 x TBE gel and visualized by autoradiography.

B. Kriimer et al. /Biochimica et Biophysica Acta 1219 (1994) 413-421 415

2.5. Preparations of nuclear extracts

(2-5). 107 cells were incubated with or without PMA washed in buffer A (10 mM Hepes (pH 7.8), 15 mM KCI, 2 mM MgC12, 0.1 mM EDTA, 1 mM DTT, 1 mM PMSF). Cells were then homogenized in buffer A using a 5 ml Dounce homogenizer. Nuclei were pelleted and resuspended in 1 ml of buffer A. A solution of 4 M (NH4)2SO 4 was added dropwise to a final concentra- tion of 0.4 M to extract nuclear proteins. Lysed nuclei were incubated at 4°C for 30 min and chromatin was pelleted for 30 min at 36500 rpm in a 70 Ti rotor (Beckman). Supernatants were precipitated by stepwise addition of 0.35 g/ml (NH4)2SO 4. After centrifuga- tion, pellets were dissolved in buffer C (50 mM Hepes (pH 7.9); 50 mM KCI, 0.1 mM EDTA, 1 mM DT-F, 10% glycerol) and dialyzed for 3 h against 200 volumes of buffer C. Dialysates were cleared by centrifugation and aliquots were frozen in liquid nitrogen and stored at - 80°C.

2.6. Electrophoretic mobility shift assay (EMSA)

matography. For quantification, either the appropriate spots were cut out and the radioactivity was deter- mined by liquid scintillation counting or autoradio- graphs were analysed by two-dimensional laser scan- ning (Personal Densitometer with ImageQuant 3.22, Molecular Dynamics, Krefeld, Germany).

3. Results

3.1. Identification of a functional regulatory element within the human TNF gene promoter

To identify regulatory DNA elements within the human TNF gene upstream region, human pre- erythroid K562 cells, monocytic U937 cells, and acute leukemic Jurkat T cells, were transfected with a series

A ~ CAT pTNF-286CAT

5-10 ~g of nuclear proteins were preincubated for 10 min at 23°C with 4-6 /xg poly(dI : dC) in a binding buffer (10 mM Hepes (pH 7.8), 5 mM MgCI2, 50 mM KC1, 1 mM spermidine, 1 mM DTT, 5% glycerol, final volume 20 ~1). When indicated, unlabeled competitor oligonucleotides were preincubated with nuclear pro- teins 10 min prior to the addition of labeled oligo- nucleotide. For supershift assays, anti-Spl or anti-Egr-1 antibodies (sc-59 X resp. sc-ll0 X, Santa Cruz Biotech- nology, Santa Cruz, USA) were added to the reaction mixture and incubated for 1 h at room temperature. Samples were loaded onto a 0.25 × TBE 6% polyacryl- amide gel and electrophoresed at 20 V/cm. Gels were dried and exposed to Kodak XAR films at -70°C using intensifying screens.

2. 7. Cell transfections and CAT assays

Cells were transfected using the DEAE dextran method as described [24]. Briefly, 5.106 cells were incubated for 30 min in serum-free Click's/RPMI medium containing 0.25 mg/ml DEAE dextran (Pharmacia, Uppsala, Sweden). 0.5 mg/ml chloroquine (Sigma, Miinchen, Germany) and, unless differently indicated, 10/~g of plasmid DNA. 48 h post-transfec- tion, cells were harvested and cytosolic proteins were quantified by a colorimetric assay (Pierce, Rockford, IL, USA). 150-200/zg of protein were incubated for 6 h at 37°C in a buffer containing 0.25 M Tris (pH 7.5), 1 mM acetyl CoA (Boehringer, Mannheim, Germany) and 0.45 nmol (25 nCi) [14C]chloramphenicol (Amer- sham, Braunschweig, Germany). Acetylated forms of chloramphenicol were separated by thin layer chro-

B

C

CAT pTNF-163CAT

CAT pTNF-139CAT

i i L. 100 bp +1

CAT pTNF-101 CAT

K562 U937 Jurkat 100

~ 4o

~ 2

% % % % % % % % % % % % ~, -,~ ,, ,% • ,,~ ,, "%, • ,,~ ,~. ",o,~

S ~ l

CT TTCCAAATCCCC GCCCCCGCGATGGAGAAGAAACCGAGACAGAAGG GAAAGGTTTAGGGGCGGGGGCGGTACCTCTTCTTTGGCTCTGTCTTCC

I I

-179 -148

Fig. 1. 5' deletion analysis of the human TNF promoter. (A) Schematic representation of the human TNF promoter-CAT hybrids. (B) TNF promoter-CAT constructs were transiently transfected into K562, U937 and Jurkat cells. CAT activity was measured in trans- letted cells left untreated (open bars) or stimulated with PMA (filled bars) as described in Material and methods. These relative CAT activities are averages of three to five independent experiments. (C) TNF promoter 5' sequences containing recognition sites for Spl and Krox-24/Egr-1 (site I).

416 B. Kriimer et al. /Biochimica et Biophysica Acta 1219 (1994) 413-421

of T N F p r o m o t e r de l e t i on mu tan t s fused to the bac te - r ial C A T gene (Fig. la ) . T h e s e cell l ines were chosen based on our prev ious observa t ion tha t the e n d o g e n o u s T N F gene is inducib le in these cell types [12]. P M A was used as a s t imulus, because this pho rbo l es te r has p roved to be a p o t e n t i nduce r of T N F gene express ion in many cell types [11]. As shown in Fig. lb , 5' de l e t ion f rom pos i t ion - 139 to pos i t ion - 101 ( p T N F - 1 0 1 C A T ) resu l ted in dras t ica l ly r e d u c e d T N F p r o m o t e r funct ion. F u r t h e r m o r e , this cons t ruc t was no longer P M A - i n - ducible .

This resul t c lear ly ind ica tes the exis tence of a major r egu la to ry e l e m e n t govern ing the basa l activity as well as the P M A respons iveness of the h u m a n T N F pro- m o t e r in a reg ion b e t w e e n bps - 139 and - 101 respec- tive to the T N F m R N A t ransc r ip t ion in i t ia t ion site. This reg ion con ta ins a p a l i n d r o m e , 5 ' - T G A G C T C A - 3 ' , tha t m e d i a t e s T N F respons iveness in U937 ceils [29]. Fac to r s b ind ing to this P M A response e l emen t a p p e a r to be r e l a t ed to if not ident ica l with a T N F - i n d u c i b l e t r ansc r ip t ion fac tor and will be desc r ibed e l sewhere (B.K. et al., u n p u b l i s h e d data) .

3.2. Identification of binding sites for nuclear factors Spl and Krox-24 / Egr-1

W h e n c o m p a r e d to p T N F - 1 6 3 C A T , p T N F - 2 8 6 C A T d i sp layed g rea t e r basa l as well as inducib le p r o m o t e r activity in K562 and U937 cells (Fig. l b ) sugges t ing tha t a second reg ion be tw e e n bps - 2 8 6 and - 1 6 3 may con t r ibu te to T N F p r o m o t e r funct ion. A c o m p u t e r analysis of this p r o t e c t e d site r evea led a GC-r i ch box, 5 ' - C C C C G C C C C C G C G - 3 ' , that conta ins consensus b ind ing sites for bo th S p l [30-32] and the K r o x / E g r family of i m m e d i a t e - e a r l y growth response t ranscr ip- t ion factors [33-37]. To d e t e r m i n e bo th specif ici ty and affini ty of the nuc lea r factors b ind ing to this GC-r i ch motif , e l e c t ropho re t i c mobi l i ty shift assays ( E M S A ) were p e r f o r m e d using an o l igonuc leo t ide , TI , cor re- spond ing to bps - 179 to - 148 of the T N F gene (Fig. lc) . W h e n r a d i o l a b e l e d TI was i ncuba ted with nuc lea r extracts p r e p a r e d f rom Ju rka t cells, severa l specific r e t a r d e d p r o t e i n - D N A complexes were d e t e c t e d (Fig. 2, lanes 1, 5). Complexes I A and IA' were fo rmed const i tut ively. In contras t , complex IB was only de-

A B

P M A : + i +

N E - H e L a / K r 2 4 + + + +

N E - H e L a / w t +

E . c o l i l K r 2 0 ~ + . . . .

E . C o l i l w t - + " " "

P M A + + + + Comp_:._ffl . . . . . + . + .

, C o m p . / H ~ ! . . . . . + +

' C o m p . / u n r e l a t e d + +

I A "-~ IB "-~ IA'

L a n e 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Fig. 2. Binding activities on the GC-rich site I of the TNF promoter. (A) 32p-labeled oligonucleotide probe TI was incubated with nuclear extracts from Jurkat cells untreated (lane 1), stimulated for 2 h with 20 ng/ml PMA (lane 2), pretreated for 2 h with 30 M cycloheximide and subsequently stimulated for 2 h with 20 ng/ml PMA (lane 3) or with 10 ng/ml TNF for 2 h (lane 4). (B) 32p-labeled oligonucleotide probe TI was incubated with nuclear extracts from Jurkat cells left untreated (lane 5) or treated with PMA for 2 h (lanes 6, 11-13). T1 was also incubated with nuclear extracts from HeLa cells overexpressing the murine Krox-24 gene (lanes 7, 14-16). Lane 8, control incubation with extracts from wild-type HeLa cells. Lane 9, incubation of TI with extracts from E. coli overexpressing Krox-20; lane 10, control incubation with extracts from E. coil. Used for competition were excesses of unlabeled TI (lanes 11, 14), HSV-SP1 containing the SP-1 binding site 5'-CCGGCCCGCC- CATCCC-Y (lanes 12, 15) or an unrelated oligonucleotide, 5'-CACTACCGCqTCCTCCAGATGAGCTCATGGGTT-Y (lanes 13, 16).

B. Kriimer et al. / Biochimica et Biophysica Acta 1219 (1994) 413-421 417

tected with extracts of PMA-treated cells (lanes 2, 6), indicating that a constitutive as well as a PMA-induci- ble factor bind to the TNF promoter sequence between bp -179 to -148. Nuclear extracts of U937 cells yielded a similar pattern of protein-DNA complexes (not shown). When Jurkat cells were treated with 30 ~M cyclohemimide (CHX) to inhibit protein synthesis, PMA induction of complex IB was completely inhib- ited (lane 3) indicating the requirement of de novo protein synthesis during the induction process. Inter- estingly, unlike PMA, other known activators of TNF gene expression such as TNF (lane 4), IFN-7 or LPS did not induce complex IB in Jurkat or U937 cells (not shown).

To investigate the specificity of these complexes we used as competitors the homologous oligonucleotide TI as well as an oligonucleotide, HSV-SP1, containing the consensus binding site for the nuclear factor Spl pre- sent in the Herpes Simplex Virus-immediate-early gene 3 promoter [30]. As shown in Fig. 2b, complexes IA, IX and IB could be efficiently inhibited by a 10 to 20-fold molar excess of unlabeled homologous oligonucleotide TI (lanes 11, 14) but not by the same amount of unrelated competitor (lanes 13, 16). This demonstrates the specificity of the protein-DNA interactions. The HSV-SP1 oligonucleotide, however, preferentially com- peted for complex IA, whereas complex IB remained unaffected (Fig. 2b, lane 12). These competition exper- iments indicate the binding of two distinct factors to this GC-rich site of the TNF promoter: a constitutive Spl-like factor and a PMA-inducible factor with an overlapping binding specificity.

A n t i b o d y

P M A

tu ~, LU I . 1 ~ , E

+ + +

IA --~ IB --~

~ - Spl ~ - Egr-1

Lane 1 2 3 4 5 6 Fig. 3. Supershift assays with anti-Spl and anti-Egr-1 antiserum. 32p-labeled oligonucleotide probe TI was incubated with nuclear extracts from Jurkat cells left untreated (lanes 1-3) or stimulated for 2 h with 20 n g / m l PMA (lanes 4-6). 100 ng of either anti-Spl (lanes 3, 6) or anti-Egr-1 (lanes 2, 5) were added and incubated for 1 h at room temperature prior to PAGE.

® ~ ~

O m

6 ~ _ 1

3 t

5'

l: G* G* G* *G C C G* C G G T G 5' A

3'

Lane 1 2 3 4 5 6 7 8 9

lower upper Fig. 4. G-methylation interference analysis of protein-DNA com- plexes identified by EMSA. The - 179 to - 148 fragment TI was end labeled on the sense or antisense strand, partially methylated with dimethylsulfate and incubated with nuclear extracts from PMA treated Jurkat cells (lanes 4, 8) or HeLa cells overexpressing Krox-24 (lanes 5, 9). Cleaved products were separated on a 15% polyacryl- amide gel. Lane 1, uncleaved TI fragment; lanes 2 and 6, G-ladder co-electophoresed with the samples; lanes 3 and 7, unbound DNA. Asterisk indicate guanines that strongly interfered with binding. Sequences around the regions of observed contacted nucleotides are written next to the analysis of each strand.

This inducible factor was suspected to belong to the Krox/Egr family of immediate-early growth-response genes Egr-1 (also designated Krox-24, Zif268, and NGF-1A), Egr-2 (also designated Krox-20) and Egr-3, whose protein products display a similar DNA binding specificity (for review see [35]). The consensus se- quence of this family of transcription factors is 5'- GCGGGGGCG-3' which is included within the GC- rich motif in the human TNF gene promoter. There- fore, to confirm that a Krox/Egr-related factor can bind to this TNF promoter-derived GC-rich sequence, the oligonucleotide probe TI was incubated with either

418 B. Kriimer et al. /Biochimica et Biophysica Acta 1219 (1994) 413-421

A TGAGCTCA

-122 -93

CA T pTNF-286CAT

CAT pTNF-286&CAT

100 bp +1

CAT pTNF-101CAT

B

8O

70 • PMA

60 [] unstimulated ._~ =~ 50 E 8 40 ~ ~ =

30

2O

10 0

pTNF-101CAT pTNF-286ACAT pTNF-286CAT

Fig. 5. The GC-rich region of the TNF promoter confers PMA-re- sponsiveness upon a minimal c-los promoter. (A) Oligonucleotide TI was cloned in three copies ups t ream of the t runcated c-los promoter. Arrows indicate the orientation of TI cloned into the Sail site of plasmid pJ21CAT. (B) p3 × TI21CAT and the control plasmid were transiently transfected into U937 and Jurkat cells. 24 h post-transfec- tion, cells were either left untreated or st imulated for 24 h with 20 n g / m l PMA. CAT activities were measured as described in Fig. 1.

nuclear extracts from HeLa cells overexpressing the mouse Krox-24 gene [34] or with Escherichia coil ex- tracts containing recombinant mouse Krox-20 protein [33]. As shown in Fig. 2b (lanes 7, 15, 16), the HeLa cell-derived Krox-24 leads to the formation of a pro- tein-DNA complex with a mobility similar to that of complex lB. Furthermore, this complex could be com- peted for by the homologous oligonucleotide but nei- ther by the HSV-SP1 nor an unrelated oligonucleotide (lanes 14, 15, 16). The recombinant E. coli-derived Krox-20 produced a slightly less retarded protein-DNA complex (Fig. 2b, lane 9).

Binding of Spl as well as Egr-1 to the GC-rich motif was confirmed by supershift assays using Spl- and Egr-l-specific antisera (Fig. 3). Addition of anti-Egr-1 and anti-Spl resulted in enhanced retardation of either complex IB (lanes 2, 5) or complex IA (lanes 3, 6), respectively. In summary, these results provide strong evidence for the binding of Spl and a PMA inducible nuclear protein, related to or identical with Egr-1, to the GC-rich element in the human TNF promoter.

3.3. Characterization of the Egr-1 binding-sequence in the human TNF promoter

To characterize the specific binding sequence of Egr-1 in the human TNF promoter, methylation inter- ference analysis was performed comparing nuclear ex- tracts from PMA-treated Jurkat cells and from HeLa cells containing recombinant Krox-24. To analyze the methylation interference patterns on the lower and upper strand, TNF promoter fragments spanning bps - 179 to - 148 were 5' or 3' labeled, respectively, and used for preparative gel shifts. As expected, methyla- tion of 6 of 7 guanines on the lower strand and the two guanines from the upper strand interfered strongly with binding of Krox-24 (Fig. 4, lanes 5 and 9). Nuclear extracts from PMA-treated Jurkat ceils revealed the same interference pattern (Fig. 4, lanes 4 and 8) sup- porting the conclusion that PMA induces accumulation of a Krox-24 like factor.

3.4. Functional analysis of the Krox-24-related element

The TNF promoter deletion analysis revealed that the presence or absence of the Krox-24/Egr-1 binding site had significant impact on the promoter strength in K562 and U937 cells (compare pTNF-286CAT with

A

100 bp

-71

CAT

+1

-71 I

-.E~].-Efi~-E~o.t~ I CAT ,

+1

p J21 CAT

p3xTIJ21CAT

U937 Jurkat .00 ] •p3xr.21cAr ,00 ] •p3xT,J21cAr

6o >= 60 8 §

4o ~: 40 L) 0

20 ~ 20

0 0

PMA PMA

Fig. 6. Internal deletion of the 5 ' -TGAGCTCA-3 ' motif reduces TNF promoter strength. (A) pTNF-286CAT was linearized by SstI. Following S1 nuclease digestion, blunt ends were religated to form pTNF-286zaCAT. Nucleotide sequencing revealed deletion of bps - 1 2 1 to - 9 4 . (B) The indicated constructs were transfected into Jurkat cells. CAT activities were measured in cells left untreated or cells st imulated with PMA. The results shown are representative for two independent experiments.

B. Krdmer et al. / Biochimica et Biophysica Acta 1219 (1994) 413-421 419

pTNF-163CAT; Fig. lb). In Jurkat cells, this effect was less pronounced. Strikingly, internal deletion of the 5'-TGAGCTCA-3' motif resulted in markedly reduced TNF promotor activity (Fig. 5, pTNF-286CAT versus pTNF-286dCAT). To investigate a possible regulatory function of Krox-24/Egr-l-related factors, the oligo- nucleotide TI, containing the Spl and Krox-24/Egr-1 binding sites, was ligated into plasmid pJ21CAT. A construct was obtained containing three copies of the oligonucleotide upstream of the minimal fos promoter (p3 × TIJ21CAT, Fig. 6a). When compared to the parental plasmid pJ21CAT, the TNF promoter-derived

A 4,5

4,0

3,5

3,0

2,5

'~- 2,0 "o

1,5

1,0

0,5

0

• pTNF-286CAT • pTNF-139CAT [ ] pTNF-286ACAT

0.0 5.0 10.0

pSCTKr24 [pg]

B

4,0

3,5

3,0

g 2,5

2,0

~2 1,5

1,0

0,5

0 0.0 1,0 2.0 5.0

pSCTKr24 [IJg]

Fig. 7. Krox-24-induced trans-activation of the TNF promoter-de- rived GC-rich element. (A) Jurkat cells were co-transfected with 5 /~g of either pTNF-286ACAT, pTNF-139CAT or pTNF-286CAT and indicated amounts of the Krox-24 expression plasmid pSCTKr24. The amount of DNA added was kept constant at 15 /.~g using the inert plasmid pBluescript. Values of CAT-expression were calculated as relative CAT-activity when co-transfected with pSCTKr24 minus relative CAT-activity when co-transfected with the 'empty' expres- sion vector pSCTzlHP. Fold induction is related to the respective control with co-transfection of 10 ~g of pSCTAHP. (B) Jurkat ceils were co-transfected with 5/zg p3 × TIJ21CAT and indicated amounts of either Krox-24 expression vector or its respective control, pBlue- script was used to keep the total amount of DNA added at 15 jzg. Fold induction is related to the respective control with co-transfec- tion of 5 ~g of pSCTZIHP.

sequences conferred elevated basal expression of the minimal c-los promoter CAT construct in U937 cells. Furthermore, 3xTIJ21CAT was inducible by PMA in both Jurkat and U937 cells (Fig. 6b). As expected, TNF did not stimulate 3xTIJ21CAT (not shown) correspond- ing to its failure to induce Krox-24/Egr-1 binding activity (Fig. 2). To examine whether the TNF gene can be activated by exclusive Egr-1 stimulation, pTNF- 286CAT was co-transfected into Jurkat cells with a Krox-24 expression plasmid, pSCTKr24. As shown in Fig. 7a, pSCTKr24 stimulated pTNF-286CAT, whereas deletion of the 5'-TGAGCTCA-3' motif resulted in a loss of responsiveness to Krox-24 (pTNF-286ACAT). Yet the plasmid pTNF-139CAT did not respond to the Krox-24 expression-plasmid either, suggesting a func- tional connection of the Egr-1 binding sequence with the palindrome 5'-TGAGCTCA-3' in the context of the human TNF promoter, pSCTKr24 also stimulated 3xEgrJ21CAT in a dose-dependent manner but not the 'empty' vector pJ21CAT. In contrast, the control plas- mid pSCTHP had no trans-activating activity (not shown). These results indicate that Krox-24 overex- pression suffices to activate the human TNF promoter.

4. Discussion

In this study, we have identified a GC-rich sequence between position - 170 to - 155 within the 5' flanking region of the human TNF gene that binds nuclear proteins and functions as phorbol-ester-responsive ele- ment. This motif constitutes a target for two transcrip- tion factors, Spl and Krox-24/Egr-1, as demonstrated by electrophoretic mobility shift assays, supershift as- says and methylation interference analysis. The two binding sites overlap, as already pointed out [33,37,38].

Progressive 5' deletions of the TNF gene promoter revealed a major PMA-responsive domain located be- tween bps -139 to -101 (Fig. 1). Indeed, internal deletions of bps -122 to - 9 3 including the palin- dromic motif resulted in markedly reduced TNF pro- moter activity (Fig. 5). This palindrome, 5'-TGAGCT- CA-3', has been reported to mediate TNF activation of its own promoter [29]. In contrast, the impact of the GC-rich sequence on TNF promoter strength appeared less pronounced. Deletion of this site did not result in marked reduction of TNF promoter activity (Fig. 1). Furthermore, in the absence of the palindrome 5'- TGAGCTCA-3', this GC-rich sequence did not exert strong promoter activity (Fig. 5). These findings raise the question of the functional significance of the GC- rich sequence for TNF gene regulation.

Spl is a well-known transcription factor that nor- mally is constitutively expressed and binds to the pro- moters of many genes. Spl often does not display autonomous enhancer-like activity, rather Spl is sensed

420 B. Kriimer et al. / Biochimica et Biophysica Acta 1219 (1994) 413-421

as an auxilliary e lement that can co-opera te with o ther t ranscript ion factors [39-41]. Spl specifically binds GC box D N A with the core sequence G G G C G G [31,32]. The K r o x / E g r genes are induced by diverse agents like LPS, serum, phorbol-es ter or growth factors like nerve cell growth factor (NGF) and epidermal growth factor (EGF) [35,42,43]. The funct ion of some of these genes have not yet been unambiguously defined: in some instances, K r o x / E g r proteins can act as t ranscript ional activators [33,34]. There is, however, also evidence that members of the Egr prote in family can repress certain p romoters [35,39]. Analysis of the s tructure and func- tion of the Egr-1 prote in del ineated independent and modular activation and repression domains [44]. Fur- thermore , dynamic competi t ive interactions between inducible Zif268 (Krox-24) and constitutive Spl bind- ing factors have been proposed to regulate the murine adenosine deaminase gene p romote r [45]. Interestingly, Egr-1 is shown to down-regula te the transcript ion of its own gene expression, whereas Spl activates Egr-1 gene expression [37]. As the rapid down-regula t ion of the T N F gene requires newly synthesized proteins, the finding that K r o x / E g r binding to the T N F p romote r is cycloheximide-sensitive (Fig. 2) makes the GC-rich ele- ment a possible candidate as negative p romote r regula- tor. Notwithstanding, in the context of the T N F pro- moter , the data obta ined point to a positive impact of this e lement on T N F p romote r strength. First, the GC-r ich motif confer red P M A inducibility to a heterol- ogous minimal c-fos promote r and second, a Krox-24 expression plasmid trans-activated both the T N F pro- mote r as well as the minimal c-los promote r linked to the GC-r ich mot i f (Fig. 7). These results may over-em- phasize the activity of this GC-r ich motif, because three copies o f the GC-r ich e lement may not necessar- ily reflect the si tuation with one such sequence present in the T N F promoter . Of note, T N F did not induce Krox-24 /Egr -1 binding activity. Intriguingly, this corre- lated with the observat ion that T N F is a less potent T N F gene inducer than P M A (A.M. et al., unpubl ished data). Thus, high-level T N F promote r activity requires the co-opera t ion of two inducible factors binding to the GC-r ich e lement and the pal indromic motif be tween bps - 1 1 0 and - 1 0 0 . However , it should be kept in mind that K r o x - 2 4 / E g r - 1 are members of a gene fam- ily that show highly conserved D N A binding domains. Thus, it is certainly possible that o ther members of this gene family - already identified [33,46] or yet to be discovered - may encode proteins with different func- tions that can also bind to the GC-r ich sequence of the h u m a n T N F gene promoter . This not ion is suppor ted by our finding that recombinant Krox-20 (Egr-2) binds to the T N F promoter -der ived GC-r ich motif with high affinity (Fig. 2). I t will be interesting to identify the respective K r o x / E g r species induced by diverse physio- logical stimuli, which will eventually provide insight

into the functional significance of the GC-r ich e lement in T N F gene regulation.

Acknowledgments

We thank D. Brunsing for technical assistance. This work was suppor ted by the Deutsche Forschungsge- meinschaft and the Deutsche Krebshilfe.

References

[1] Old, L.J. (1985) Science 230, 630-632. [2] Beutler, B. and Cerami, A. (1986) Nature 320, 584-588. [3] Tracey, K.J., Wei, H., Manogue, K.R., Fong, Y., Hesse, D.G.,

Nguyen, H.T., Kuo, G.C., Beutler, B., Cotran, R.S., Cerami, A. and et al (1988) J. Exp. Med. 167, 1211-1227.

[4] Piguet, P.F., Grau, G.E., Allet, B. and Vassalli, P. (1987) J. Exp. Med. 166, 1280-1289.

[5] Tracey, K.J. and Cerami, A. (1989) Curr. Opin. Immunol. 1, 454-461.

[6] Held, W., MacDonald, H.R., Weissman, 1.L., Hess, M.W. and Mueller, C. (1990) Proc. Natl. Acad. Sci. USA 87, 2239-2243.

[7] Rosenberg, Z.F. and Fauci, A.S. (1990) Immunol. Today 11~ 176-180.

[8] Spriggs, D.R., Deutsch, S. and Kufe, D.W. (1992) Immunol. Ser. 56, 3-34.

[9] Cuturi, M.C., Murphy, M., Costa Giomi, M.P., Weinmann, R., Perussia, B. and Trinchieri, G. (1987) J. Exp. Med. 165, 1581- 1594.

[10] Limb, G.A., Meager, A., Wooltey, J., Wadhwa, M., Biggerstaff, J., Brown, K.A. and Wolstencroft, R.A. (1989) Immunology 68, 514-519.

[11] Ohno, I., Tanno, Y., Yamauchi, K. and Takishima, T. (1990) Immunology 70, 88-93.

[12] KriSnke, M., Hensel, G., Schliiter, C., Scheurich, P., Schiitzc, S. and Pfizenmaier, K. (1988) Cancer Res. 48, 5417-5421.

[13] Beutler, B., Krochin, N., Milsark, I.W., Luedke, C. and Cerami, A. (1986) Science 232, 977-980.

[14] Caput, D., Beutler, B., Hartog, K., Thayer, R., Brown Shimer, S. and Cerami, A. (1986) Proc. Natl. Acad. Sci. USA 83, 1670-1674.

[15] Hart, J., Brown, T. and Beutler, B. (1990) J. Exp. Med. 171, 465-475.

[16] Kriegler, M., Perez, C., DeFay, K., Albert, I. and Lu, S.D. (1988) Cell 53, 45-53.

[17] Hensel, G., M~innel, D.N., Pfizenmaier, K. and Kr6nke, M. (1987) Lymphokine Res. 6, 119-125.

[18] Collart, M.A., Belin, D., Vassalli, J.D., de Kossodo, S. and Vassalli, P. (1986) J. Exp. Med. 164, 2113-2118.

[19] Chantry, D., Turner, M., Abney, E. and Feldmann, M. (1989) J. lmmunol. 142, 4295-4300.

[20] Tannenbaum, C.S. and Hamilton, T.A. (1989) J. Immunol. 142. 1274-1280.

[21] Essner, R., Rhoades, K., McBride, W.H., Morton, D.L. and Economou, J.S. (1989) J. Immunol. 142, 3857-3861.

[22] Goldfeld, A.E., Doyle, C. and Maniatis, T. (1990) Proc. Natl. Acad. Sci. USA 87, 9769-9773.

[23] Economou, J.S., Rhoades, K., Essner, R., McBride, W.H., Gas- son, J.C. and Morton, D.L. (1989) J. Exp. Med. 170, 321-326.

[24] Henset, G., Meichle, A., Pfizenmaier, K. and Kr6nke, M. (1989) Lymphokine Res. 8, 347-351.

[25] Pierce, J.W., Lenardo, M. and Baltimore, D. (1988) Proc. Natl. Acad. Sci. USA 85, 1482-1486.

B. Kriirner et al. / Biochimica et Biophysica Acta 1219 (1994) 413-421 421

[26] Lemaire, P., Revelant, O., Bravo, R. and Charnay, P. (1988) Proc. Natl. Acad. Sci. USA 85, 4691-4695.

[27] Nedwin, G.E., Naylor, S.L., Sakaguchi, A.Y., Smith, D., Jarrett Nedwin, J., Pennica, D., Goeddel, D.V. and Gray, P.W. (1985) Nucleic Acids. Res. 13, 6361-6373.

[28] Maxam, A.M. and Gilbert, W. (1980) Methods Enzymol. 65, 499-560.

[29] Leitman, D.C., Ribeiro, R.C., Mackow, E.R., Baxter, J.D. and West, B.L. (1991) J. Biol. Chem. 266, 9343-9346.

[30] Jones, K.A. and Tjian, R. (1985) Nature 317, 179-182. [31] Kriwacki, R.W., Schultz, S.C., Steitz, T.A. and Caradonna, J.P.

(1992) Proc. Natl. Acad. Sci. USA 89, 9759-9763. [32] Kuwahara, J., Yonezawa, A., Futamura, M. and Sugiura, Y.

(1993) Biochemistry 32, 5994-6001. [33] Chavrier, P., Vesque, C., Galliot, B., Vigneron, M., Dolle, P.,

Duboule, D. and Charnay, P. (1990) EMBO J. 9, 1209-1218. [34] Lemaire, P., Vesque, C., Schmitt, J., Stunnenberg, H., Frank, R.

and Charnay, P. (1990) Mol. Cell Biol. 10, 3456-3467. [35] Sukhatme, V.P. (1990) J. Am. Soc. Nephrol. 1, 859-866. [36] Sukhatme, V.P. (1992) Kidney Int. 41,550-553.

[37] Cao, X., Mahendran, R., Guy, G.R. and Tan, Y.H. (1993) J. Biol. Chem. 268, 16949-16957.

[38] Kutoh, E. and Schwander, J. (1993) Biochem. Biophys. Res. Commun. 194, 1475-1482.

[39] Kadonaga, J.T., Carner, K.R., Masiarz, F.R. and Tjian, R. (1987) Cell 51, 1079-1090.

[40] Fischer, K.D., Haese, A. and Nowock, J. (1993) J. Biol. Chem. 268, 23915-23923.

[41] Lee, J.S., Galvin, K.M. and Shi, Y. (1993) Proc. Natl. Acad. Sci. USA 90, 6145-6149.

[42] DeFranco, C., Damon, D.H., Endoh, M. and Wagner, J.A. (1993) Mol. Endocrinol. 7, 365-379.

[43] Chestier, A. and Charnay, P. (1992) DNA Seq. 2, 325-327. [44] Gashler, A.L., Swaminathan, S. and Sukhatme, V.P. (1993) Mol.

Cell Biol. 13, 4556-4571. [45] Ackerman, S.L., Minden, A.G., Williams, G.T., Bobonis, C. and

Yeung, C.Y. (1991) Proc. Natl. Acad. Sci. USA 88, 7523-7527. [46] Patwardhan, S., Gashler, A., Siegel, M.G., Chang, L.C., Joseph,

L.J., Shows, T.B., Le Beau, M.M. and Sukhatme, V.P. (1991) Oncogene 6, 917-928.