Characterization of a Copper Resistance and

Transport System in Streptococcus Mutans

By

Kamna Singh

A thesis submitted in conformity with the requirements for the degree of

Doctor of Philosophy

School of Graduate Studies

Faculty of Dentistry

University of Toronto

© Copyright by Kamna Singh 2015

ii

Characterization of a Copper Resistance and

Transport System in Streptococcus Mutans

Kamna Singh

Doctor of Philosophy

Faculty of Dentistry

University of Toronto

2015

I. Abstract

Proteins and enzymes require metal ions as enzymatic cofactors for optimal

biological activities. Copper metal ion is utilized by various bacterial systems in trace

amounts; however, it can be extremely toxic at higher concentrations. The copYABZ

operon, involved in copper homeostasis, has been extensively studied and

characterized in several Gram positive bacteria. CopA and CopB encode for P-type

ATPases, involved in copper translocation, whereas, CopY and CopZ regulate the

expression of the cop operon. In Streptococcus mutans, the primary etiological agent

of dental caries, copYAZ has been partially investigated for its role in copper

transport and resistance. In this study, we demonstrated the probable mechanisms by

which copper induces toxicity in S. mutans; and elucidated the role of copYAZ

operon in modulating copper transport and resistance, as well as other physiological

processes of this oral pathogen. Copper induces toxicity by generating oxidative

stress and dissipating membrane potential in S. mutans. During biofilm growth,

copper impaired S. mutans ability to adhere to a surface and produce biofilm

biomass; while significantly repressing the expression of genes involved in

iii

maintaining the functional and structural integrity of biofilm matrix. Results from

copper transport studies validated the role of copYAZ in copper efflux in S. mutans.

The knock-out strain in copYAZ (∆copYAZ) was more sensitive to copper, oxidative

and acid stress relative to its wild type. Loss of copYAZ resulted in prolonged

membrane depolarization in S. mutans. The presence of copper and/or the absence of

copYAZ significantly impaired S. mutans ability to acquire foreign DNA from the

surrounding environments; while repressing the transcription of genes involved in

competence development. The copYAZ-associated phenotypes were further validated

via genetic complementation studies. Taken collectively, we illustrated the

implications of copper-induced toxicity in S. mutans; and have provided evidence

describing the importance of copYAZ operon in copper resistance and transport,

biofilm formation, acid and oxidative stress tolerance, maintenance of membrane

potential, and genetic transformation in S. mutans.

iv

II. Acknowledgments

First and foremost, I would like to express my deepest gratitude to my supervisor Dr.

Dennis Cvitkovitch for his support, expert guidance, understanding, patience, and

encouragement over the course of my graduate program. Very special thanks to my

co-supervisor Dr. Celine Levesque, for providing me with the motivation and

encouragement to pursue this research project. I am very grateful to my advisory

committee members Dr. Trevor Moraes, Dr. Anil Kishen and Dr. Dilani Senadheera

for their aspiring guidance and invaluably constructive criticism.

I am thankful to Ms. Gursonika Binepal for her help and support. I would like to

extend my thanks to other members of Cvitovitch Lab, particularly, Mr. Andrew

Latos, Ms. Kirsten Krastel, Ms. Marie-Christine Kean and Ms. Iwona Wenderska.

Finally, I thank my family for their unconditional love and support. To Mom, Papa,

Ravi, Sahil, Jai and Tanu, I am ever grateful to you all for always being there for me.

Thank you.

v

III. Table of Contents

I. Abstract .......................................................................................................................... ii

II. Acknowledgments ........................................................................................................... iv

III. Table of Contents ............................................................................................................ v

IV. List of Tables ................................................................................................................. vii

V. List of Figures ..............................................................................................................viii

VI. List of Abbreviations ....................................................................................................... x

VII. Preface .......................................................................................................................... xii

1 Literature Review ............................................................................................................ 1

1.1 The oral cavity ................................................................................................................. 1

1.1.1 Microbial habitats of the oral cavity ................................................................. 1

1.1.2 Acquisition of oral microflora ........................................................................... 2

1.1.3 Oral biofilms ...................................................................................................... 4

1.1.4 Oral diseases...................................................................................................... 8

1.1.5 Oral streptococci ............................................................................................. 10

1.2 Streptococcus mutans .................................................................................................... 11

1.2.1 Acidogenicity and aciduricity .......................................................................... 12

1.2.2 Biofilm formation ............................................................................................. 13

1.2.3 Regulatory systems in S. mutans ...................................................................... 14

1.2.4 Genetic competence ......................................................................................... 16

1.2.5 Metal homeostasis............................................................................................ 19

2 An intimate link: two component signal transduction systems and metal transport

systems in bacteria ................................................................................................................. 25

2.1 Abstract ......................................................................................................................... 26

2.2 Introduction ................................................................................................................... 26

2.3 Copper homeostasis ...................................................................................................... 28

2.4 A link between Copper and Silver homeostasis ............................................................ 32

2.5 Manganese homeostasis ................................................................................................ 32

2.6 Cadmium Zinc Cobalt Homeostasis .............................................................................. 34

2.7 Nickel Homeostasis ....................................................................................................... 36

2.8 Future perspectives ....................................................................................................... 38

2.9 Executive summary ........................................................................................................ 39

3 Statement of the problem ............................................................................................... 41

3.1 Rationale and objectives ............................................................................................... 42

3.2 General hypothesis ........................................................................................................ 43

3.3 Objectives and aims ...................................................................................................... 43

4 The copYAZ operon functions in copper efflux, biofilm formation, genetic

transformation and stress tolerance in Streptococcus mutans ............................................... 44

4.1 Abstract ......................................................................................................................... 45

4.2 Importance .................................................................................................................... 46

vi

4.3 Introduction ................................................................................................................... 46

4.4 Material and methods .................................................................................................... 49

4.4.1 Strains and growth conditions ......................................................................... 49

4.4.2 Minimum inhibitory concentration (MIC) assays ............................................ 49

4.4.3 Mutant and complemented strain construction ............................................... 50

4.4.4 Biofilm assays .................................................................................................. 53

4.4.5 Acid tolerance response (ATR) assays............................................................. 53

4.4.6 Growth kinetic analysis ................................................................................... 54

4.4.7 Copper transport assays .................................................................................. 54

4.4.8 Quantitative real time PCR Assays .................................................................. 55

4.4.9 Membrane potential assays ............................................................................. 56

4.4.10 Genetic transformation assays......................................................................... 56

4.5 Results ......................................................................................................................... 58

4.5.1 Copper is toxic to S. mutans and copYAZ is required for copper resistance

in S. mutans ...................................................................................................... 58

4.5.2 CopYAZ has a role in copper export in S. mutans ........................................... 61

4.5.3 Copper inhibits biofilm formation and copYAZ is required to tolerate copper

stress under biofilm growth. ............................................................................ 64

4.5.4 Copper affects the transcription of gtfs and glucan binding protein (gbp)

genes. ............................................................................................................... 67

4.5.5 Copper-induces oxidative stress and CopYAZ modulates oxidative stress

tolerance. ......................................................................................................... 68

4.5.6 Copper inhibits growth under acid stress and CopYAZ modulates the acid

tolerance response of S. mutans ...................................................................... 73

4.5.7 Copper induces membrane depolarization and CopYAZ helps maintain

membrane potential. ........................................................................................ 77

4.5.8 Addition of copper and loss of copYAZ alters transformability of S. mutans .. 80

4.5.9 Copper represses the expression of genes associated with genetic

competence....................................................................................................... 83

4.6 Discussion ..................................................................................................................... 84

4.7 Acknowledgements ........................................................................................................ 89

5 Summary and Conclusions ............................................................................................ 90

5.1 Effects of copper on bacterial physiology ..................................................................... 90

5.2 Characterization of the copYAZ operon ........................................................................ 92

5.3 Effect of copper and CopYAZ in genetic competence ................................................... 95

6 Future directions and significance ................................................................................ 97

6.1 Future directions ........................................................................................................... 97

6.2 Significance ................................................................................................................... 99

VIII. References ................................................................................................................... 101

vii

IV. List of Tables

Table 2-1 Bacterial TCSTS and metal ions ................................................................ 40

Table 4-1 Bacterial strains and plasmids used in this study ....................................... 51

Table 4-2 Primer Sequences used in this study .......................................................... 52

viii

V. List of Figures

Figure 1-1 Diagram representing microbial composition of dental plaque .................. 8

Figure 1-2 Model of CSP- and XIP-induced quorum sensing in S. mutans. .............. 18

Figure 1-3 Metal homeostasis model.......................................................................... 20

Figure 1-4 The copYABZ operon of E. hirae .............................................................. 22

Figure 1-5 Genetic organization of S. mutans copYAZ operon .................................. 23

Figure 4-1 Growth analysis in the presence and absence of copper ........................... 59

Figure 4-2 Growth kinetics under copper stress ......................................................... 60

Figure 4-3 Role of CopYAZ in copper export ........................................................... 62

Figure 4-4 Growth kinetics and transport studies using E. coli strains ...................... 63

Figure 4-5 Effect of copper on biofilm formation ...................................................... 64

Figure 4-6 Cell adherence assays ............................................................................... 66

Figure 4-7 Gene expression analysis of different biofilm matrix-related genes ........ 68

Figure 4-8 Growth Kinetics in the presence and absence of glutathione ................... 69

Figure 4-9 Copper-induced oxidative stress, and involvement of CopYAZ in

protection against oxidative stress .............................................................................. 70

Figure 4-10 Growth kinetics under oxidative stressors .............................................. 72

Figure 4-11 Growth of S. mutans under acid stress with or without copper .............. 74

Figure 4-12 Doubling times under acid stress with or without copper ...................... 75

Figure 4-13 Acid tolerance response assays ............................................................... 76

Figure 4-14 Membrane potential in cells exposed to copper ...................................... 79

Figure 4-15 Transformation frequency assays ........................................................... 81

Figure 4-16 Colony forming units of viable cells at different copper concentrations 82

Figure 5-1 Summary of role of copper and copYAZ operon in S. mutans .................. 94

ix

Figure 5-2 Effect of copper and copYAZ on the competence regulon of S. mutans ... 96

x

VI. List of Abbreviations

aa amino acid

AEP acquired enamel pellicle

ATP adenosine tri-phosphate

ATR acid tolerance response

bp base pair

Ca calcium

CCCP carbonyl cyanide 3-chlorophenylhydrazone

CDM chemically-defined medium

cDNA complementary DNA

CFUs colony forming units

CSP competence-stimulating peptide

Cu copper

DNA deoxyribonucleic acid

EDTA ethylenediaminetetraacetic acid

EPS extracellular polymeric substance

Erm erythromycin

Ftf fructosyltransferase

Gbp glucan-binding protein

Gtf glucosyltransferase

h hour

H2O2 hydrogen peroxide

LB luria broth

xi

GCF gingival crevicular fluid

Ig immunoglobulin

MIC minimum inhibitory concentration

min minute

Mg magnesium

Mn manganese

OD optical density

PBS phosphate buffered saline

PCR polymerase chain reaction

ROS reactive oxygen species

s second

Spec spectinomycin

spp species

TCSTS two-component signal transduction system

THYE Todd Hewitt yeast extract

TYE Tryptone yeast extract

TE Tris-EDTA

v/v volume per volume

XIP sigX-inducing peptide

xii

VII. Preface

Format of the dissertation

The presented dissertation is written in the "Publishable Style". Chapter 1 provides

introduction to the subject and presents the background for the following chapters.

Chapter 2, the review article published in Future Microbiology, describes the link

between bacterial two component systems and their metal transporters. Chapter 3 states

the purpose and rationale of the study. Chapter 4 describes the experimental data that

have been accepted for publication in Journal of Bacteriology. Chapter 5 provides a

brief summary and conclusions drawn from this study and chapter 6 presents the future

directions and significance of this study. The thesis is presented in a format to improve

readability and avoid repetition between the chapters.

1

1 Literature Review

1.1 The oral cavity

1.1.1 Microbial habitats of the oral cavity

The oral cavity represents one of the most diverse and dynamic ecosystems in the human body

known to be colonized with over 700 identified microbial species [1-2]. It is distinct from other

body sites due to the presence of 1) specialized mucosal surfaces such as lips, tongue, cheek, and

palate; 2) hard non-shedding tooth surfaces; 3) saliva; and 4) gingival crevicular fluid (GCF),

that sustain a diverse array of microbes adapted to a biofilm lifestyle, commonly referred to as

plaque [3-4]. The mucosal and tooth surfaces provide the substratum for microbial colonization,

whereas, host oral fluids such as saliva and gingival crevicular fluid provide nutrients and assist

in bacterial adherence for community development on these surfaces [3-4]. Chronologically, in

the oral cavity of a new born baby, the only site available for microbial colonization is the

infant's oral mucosa [5]. The oral mucosa is predominately comprised of stratified squamous

epithelium, and contains specialized mucosal surfaces containing either keratinized (hard palate,

attached gingiva and dorsal surface of tongue) or non-keratinized (all other mucosa of oral

cavity) epithelial cells [3, 6]. The biomass of microbial communities in the oral mucosa in an

infant is restricted by the continuous desquamation of the epithelial cells [7]. On the mucosal

surfaces a variety of distinct habitats exists, each of which provides unique ecological and

biochemical conditions to selectively support the growth and co-existence of specific microbial

species [4, 8]. A major ecological perturbation in the infant’s oral cavity occurs following tooth

eruption around a few months after birth that provides new hard non-shedding surfaces for

microbial colonization [9-11]. While the process of primary dentition is completed by the age of

3 years, the permanent teeth start to erupt around 6 years and completed by the age of 12 years

(Source: American Academy of Pediatric Dentistry). The loss and eruption of teeth causes

perturbations in the local environment, resulting in alterations in the composition of microbial

community [3, 12]. Like the oral mucosa, teeth also provide a variety of sites for colonization

and growth of different microbial communities [9, 13-14]. Variations in the biochemical

properties depending on the anatomy of the tooth can sustain diverse microbial populations [15-

2

16]. For instance, the plaque formed in the hidden area between the teeth (approximal plaque)

and in the gingival crevice (gingival crevice plaque) are favorable habitats for facultative and

obligate anaerobes such as Streptococci and Actinomyces [17-18]. Whereas, the tooth fissures

(fissure plaque) is predominated by species such as certain aerobes and facultative anaerobes, for

e.g. Streptococci [15, 19]. Another important component of oral cavity is the saliva, which plays

an important role in maintaining the oral ecosystem and is critical for oral health by providing

antimicrobial, buffering and conditioning functions in the mouth [20]. Saliva aids the clearing of

food and buffers the oral cavity following the ingestion and metabolism of dietary carbohydrates

by the acidogenic consortia [7, 21]. Salivary components (e.g., mucins, histatins and cystatins)

can adsorb on the tooth surface to form a conditioning film known as the acquired pellicle, which

facilitates bacterial adherence on the surface [22-24]. Saliva is the primary nutrient source for the

resident oral microbes, and also contains antimicrobial factors (e.g. lysozyme and lactoferrin) to

prevent the growth of unwanted exogenous microorganisms [22, 25]. The last major component

of oral cavity is the GCF that flows through the junctional epitelium of gingiva. It is a serum-like

fluid that can act as a source of nutrients and contains components of host defence that include

lysozyme, lactoferin, peroxidases and Immunoglobulin G (IgG) antibodies [26-29].

1.1.2 Acquisition of oral microflora

The oral cavity of an infant is inoculated with microbes that are acquired from mother's milk;

these microbes can then initialize the process of acquisition of resident oral microflora. The

mode of birth delivery also appears to influence the development of oral microflora. On

comparing the oral microbiota of 3-month old infants delivered vaginally and by caesarean

section, a higher prevalence of Streptococci and Lactobacilli was found in the oral microbiota of

vaginally delivered infants [30-31]. In addition to microbial acquisition from the mother, the

infant can also acquire microbes from family members in close proximity, or external food

source such as milk or water [32-34]. This microbial acquisition is controlled by host factors

including saliva. The detailed roles of saliva in microbial acquisition and homeostasis have been

discussed under the section 1.1.3. The first colonizers are referred to as pioneer species and are

mainly streptococci belonging to the mitis-group that includes: Streptococcus salivarius,

3

Streptococcus mitis, and Streptococcus oralis [5, 35-36]. The pioneer microbial community

continue to grow and colonize until it encounters an environmental resistance, such as: shedding

of epithelial cells, shear force due to salivary flow, nutritional limitations and alterations in redox

potential or pH [15, 36]. Many of the pioneer species secrete proteases against secretory

immunoglobulin A (IgA), one of the major host immune defense factors present in the infant’s

saliva [21, 37-38]. The inhibitory activity against secretory IgA allows these pioneer organisms

to colonize the oral mucosal surfaces by overcoming key host-defenses in the early stages of

colonization [38]. Over time, the physiological activity of pioneer microbial community modifies

the surrounding environment making it conducive for the colonization and succession of other

bacterial populations [16, 39]. Some of these modifications include: exposure of new receptors

necessary for bacterial adherence to the surface or to the pre-adhered bacteria (co-aggregation),

generation of metabolic end-products by pioneer species that can be utilized by subsequent

populations, and other environmental changes [40]. The progressive development of pioneer

community also prevents the colonization of unwanted exogenous bacterial species by: 1)

competing for essential nutrients and co-factors; 2) competing for the receptors for adhesion; 3)

creating an environment not favorable for the growth of exogenous species and; 4) generating

inhibitory substances such as bacteriocins, hydrogen peroxide, etc [16, 41].

As the process of dentition progresses, new microenvironments are created that increases the

diversity of the microbial community, with the introduction of members of genera Neisseria,

Lactobacillus, Veillonella, and Actinomyces [35]. The progressive diversity in the microbial

community results to the formation of a complex dental biofilm, commonly called dental plaque.

The dental plaque is highly organized with microbes embedded in a matrix of self-composed

extracellular carbohydrate and/or nucleotide polymers [42-43]. The microbial homeostasis in the

oral cavity is constantly challenged by physical and non-physical changes, such as tooth

extractions, dental treatment, antibiotic use, variation in salivary flow or saliva pH, food habits,

and the presence of host-derived antimicrobial factors [8, 16, 44].

The microbial successions typically fall under two defined categories, namely: 1) Allogenic

succession resulting due to the environmental changes generated by the host, or 2) Autogenic

succession that is a result of the microbial interrelations [45]. During allogenic succession, the

community development is influenced by the non-microbial factors such as tooth eruption,

4

insertion or removal of dentures, and introduction of antimicrobial agents. Whereas, during

autogenic succession, factors derived from pioneer species such as growth factors, alteration in

the environmental pH and the redox potential regulate the progression of microbial community

[45]. The pioneer community continues to develop through series of microbial successions until

equilibrium is attained which results in the formation of the climax community. The climax

community exhibits a highly dynamic relationship between the host, the environment and the

resident microflora in the oral cavity. The oral microflora continues to acquire new bacterial

species over the age of the host. In adults, the composition and proportion of the resident oral

microflora remains fairly stable over time; owing to the microbial homeostasis attained from

various inter-bacterial and host-bacterial interactions [15, 46-47].

1.1.3 Oral biofilms

In natural environments bacteria primarily exist as surface-attached complex microbial

communities known as biofilms [48]. A biofilm is a surface associated four-dimensional

structure that contains mono- or multi-species bacteria co-adhered and embedded into a matrix of

extracellular polymeric substance(s) (EPS) derived from host and/or bacterial factors [43].

Biofilm formation includes three distinct steps: attachment of cells to a surface, growth of the

cells into a sessile biofilm colony, and dispersal of cells from the mature biofilm to colonize into

the surrounding environment. Environmental signals, chemical and physical forces, bacterial

communication factors, and effectors of bacterial or host origin play a significant role in each

distinct stage of biofilm formation [49-50]. Adapting to a biofilm mode of growth provides

bacteria with multiple advantages such as protection from antimicrobial factors, dynamic host

and environmental conditions, and the ability to communicate among themselves [51-52].

The formation of dental plaque occurs via specific steps, each of which determines the successful

attachment and colonization of microbes on the tooth surface. The distinct stages of plaque

formation are described below:

a) Acquired pellicle formation: Once a clean tooth surface is exposed to the oral environment,

adsorption of salivary proteins and glycoproteins to the dental enamel creates an acquired enamel

5

pellicle (AEP) [22]. The AEP is composed of bacterial components such as glucans (explained in

detail in Section 1.2.2), and host components including salivary proteins such as sialyted mucins,

α-amylase, proline-rich proteins, agglutinin, and statherin [24, 53]. An equilibrium attained

between the continuous adsorption and desorption of the salivary molecules on the tooth surface

determines the thickness of pellicle layer [7, 54]. The thickness of the pellicle layer also depends

on the site of formation and the presence of salivary shear forces [54]. The molecular

composition and the physiochemical properties of the pellicle layer play a critical role in

determining the composition and the pattern of dental plaque formation.

b) Attachment and colonization of bacteria on the tooth surface: Microbes usually are

transported passively to the tooth surface via the salivary flow; however few of them possess

specialized structures such as fimbrae or pili that assist them to attach to the surface [32, 39]. The

components of the acquired pellicle play an important role in bacterial adherence to the surface.

Initially, as the microbes approach the pellicle-coated surface, weak and long-range

physiochemical forces are generated by the negatively charged bacterial cells and hydrophobic

tooth surface, that allows reversible attachment of bacteria to the surface [42, 53]. Within a short

period of time, irreversible attachment of bacteria is mediated by strong and specific but short-

range interactions between the microbial adhesins (components of microbial cell surface) and the

complementary receptors on the pellicle layer [42, 53]. After successful attachment, the pioneer

species constituting mainly of the members of the mitis group of streptococci start to divide and

propagate on the surface. The cell walls of several oral streptococci possesses a number of

adhesins such as antigen I/II, glucosyltransferases and lipoproteins that bind to their cognate

receptors on the pellicle layer [10]. For instance, antigen I/II binds to the human salivary

glycoproteins (agglutinins) and other microbial cells; whereas, glucosyltransferases interacts

with blood-related proteins or the adsorbed dextrans and glucans in the pellicle layer [10]. In

some cases, the salivary molecules in the acquired pellicle can undergo conformational changes

leading to exposure of new bacterial receptors known as cryptitopes [20, 22]. These cryptitopes

are recognized by specific bacteria that possess cognate adhesins on their cell surfaces for plaque

formation [20, 22].

The pioneer species continue to grow and propagate in the dental plaque environment. These

species are equipped with special features that enable them to initiate plaque formation on tooth

6

surface [16]. These species secrete IgA protease that allows them to overcome the host defenses;

and they also possess a range of glycosidase activity that enables them to use salivary

glycoproteins as nutrient substrates [16, 21]. On reaching an equilibrium in their population,

these pioneer species start to make conditions conducive for the growth of secondary colonizers.

The pioneer species provides additional adhesins for the secondary colonizers that were

previously unable to adhere to the adhesins of pellicle layer [39]. Additionally, the metabolic

activity of the pioneer communities alters the local environment, thereby, generating an

improved atmosphere for the new bacteria to colonize the dental plaque [16, 50, 55]. Over time,

the diversity in the plaque microflora increases with the introduction and expansion of

Actinomyces and other Gram positive bacilli. A series of complex interactions between the

microbes in the plaque community changes the composition of plaque microflora in due course

of time [55-56]. The conditions continue to progressively change to eventually become

favourable for obligate anaerobes. The graphical demonstration of early and late colonizers of

the plaque formation has been presented in Figure 1-1, with the initial colonizers constituting the

yellow (Streptococcus gordonii, Streptococcus intermedius, S. mitis, S. oralis, and Streptococcus

sanguinis), blue (Actinomyces spp), green (Capnocytophaga plus Campylobacter concisus,

Eikenella corrodens, and Aggregatibacter actinomycetemcomitans serotype a) and purple

(Veillonella parvula and Actinomyces odontolyticus) complexes, whereas the late colonizers

forming the orange (Fusobacterium nucleatum, Prevotella intermedia, Peptostreptococcus

micros, Eubacterium nodatum, and other species) and red complexes (Treponema denticola,

Porphyromonas gingivalis and Tannerella forsythia) [3, 57-59]. F. nucleatum functions as a

bridge organism during plaque formation owing to its capability to co-aggregate with both initial

and late colonizers, while the early and late colonizers do not co-aggregate with each other [50,

60]. In oral health, the microbial composition of dental plaque is diverse and remains relatively

stable over time [14-15].

c) Biofilm maturation and detachment: On attaining maturation, the growth rate of individual

bacteria within the plaque community decreases, significantly increasing the doubling rate from

1-2 hours during early growth to 12-15 hours after 1-3 days of biofilm development [12, 61]. The

microbial diversity reaches its maximum in the mature plaque. Biofilms are embedded in the

EPS matrix composed of different types of biopolymers such as, polysaccharides (glucans,

7

fructans and hetero-polymers), proteins, deoxyribonucleic acid (DNA) and lipids, most of which

are self-produced by the microbes [43, 62]. The adhered bacteria simultaneously propagate and

synthesize EPS to facilitate their adherence together in a mass and firmly to the surface. The

constituents of the EPS matrix assist biofilms in providing protection against desiccation and in

facilitating physical interactions between bacterial cells or between bacteria and the adhered

surface, thereby, encouraging biofilm stabilization [43, 62]. The matrix critically maintains the

structural integrity of the plaque and accounts for biofilm's ability to tolerate environmental

insults. The matrix also assists in retaining water, nutrients and growth factors, while restricting

the penetration of detrimental antimicrobials and host-defence factors [43]. In addition, the EPS

immobilize the cells in the matrix, allowing them to be in close proximity for complex

interactions and cell-to-cell communication, thereby, enabling the bacteria to communicate and

to co-ordinate their metabolic and physiological activities [43, 63].

The final stage in biofilm development is the detachment of cells from the mature biofilms and

their dispersal into the surrounding environment to colonize new sites, thus, playing an important

role in transmission of bacterial infection [41, 64]. The biofilm life-style impacts the genomics

and proteomics of the plaque bacteria during distinct stages of plaque formation. For instance, in

the initial stage of plaque formation, bacterial adhesins and enzymes involved in carbohydrate

catabolism are induced; during plaque colonization and propagation, proteins involved in

biochemical functions are expressed; whereas, at the stage of biofilm maturation, enzymes that

cleave bacterial adhesins are activated, thereby, facilitating cell dispersal from one location to

another [37, 65-66]. Additionally, cell-cell signalling molecules of the plaque bacteria assist

them to communicate and coordinate their gene expression, resulting in formation of complex,

interactive, multi-species, spatially and functionally organized dental plaque [40, 50-51, 55, 67].

8

Figure 1-1 Diagram representing microbial composition of dental plaque

The base of the pyramid is comprised of species thought to colonize the tooth surface and proliferate at an

early stage. The orange complex becomes numerically more dominant later and is thought to bridge the

early colonizers and the red complex species that become numerically more dominant at late stages in

plaque development. Adapted from Socransky and Haffajee, 2000 [68] .

1.1.4 Oral diseases

The healthy oral cavity is predominantly colonized with health-associated commensals, and

some opportunistic pathogens at levels insufficient to cause a disease [47]. In the state of

ecological stability, the microbial homeostasis is achieved by numerous host-microbial

interactions in the oral cavity [47]. Perturbation in the microbial homeostasis can shift the

composition and properties of the resident microflora [19, 52]. This shift in microflora may lead

to progression of oral diseases such as gingivitis, oral candidiasis, endodontic (root canal)

9

infections, alveolar osteitis (dry socket), tonsillitis, dental caries and periodontitis [52, 69]. Oral

bacteria have also been implicated in causing systemic conditions such as infective endocarditis,

coronary heart disease, and increased risk of preterm low-birth-weight babies [70-72].

Additionally, plaque-mediated periodontal disease has been associated with other chronic

diseases, such as chronic kidney disease, diabetes and hypertension [28, 73-76].

Dental caries, one of the most common chronic biofilm infections, is considered as a major oral

health problem due to its high prevalence [77]. In most industrialized countries, dental caries

affects 60-90% of school-aged children and vast majority of adults; whereas, the global

prevalence of dental caries among adults can be nearly 100% of the population [77]. It is a multi-

factorial disease that depends on the availability of susceptible tooth surface, cariogenic

pathogens and preferred substrates (in form of dietary sugars) for sufficient period of time to

initiate the dissolution of tooth enamel [52].

Unlike most medical infections, where a specific pathogen is associated with the disease, in

plaque-mediated diseases particularly dental caries and periodontitis, the disease-associated traits

are usually not restricted to a single species. Therefore, to explain the etiology of plaque-

mediated diseases, three hypotheses have been proposed: Specific, Non-Specific and Ecological

plaque hypothesis. According to the "Specific Plaque Hypothesis", out of the diverse microbial

community present in the plaque microflora, only a few specific species are actively involved in

causing a disease [78-79]. On the contrary, the "Non-Specific Plaque Hypothesis" states that a

disease is an outcome of the overall activity of the total plaque microflora [80]. The "Ecological

Plaque Hypothesis" reconciled the key elements of the earlier two hypotheses and explained the

dynamic relationship between the resident microflora and host ecology in health and disease [15]

[14]. The hypothesis states that changes in the host environment such as: a) shifts in the overall

community metabolism, b) subsequent modification of local environment, c) host factors, and d)

the balance between potential pathogens and species associated with oral health, determines the

conditions conducive for oral health or disease [14-15]. The hypothesis suggests that the

regimens aimed for long term prevention of oral disease should control both the associated

pathogens and the underlying changes in the environment that drive the deleterious shifts in the

microflora [14-15]. For example, for the treatment of periodontal disease caused by oral

pathogens such as P. gingivalis, T. forsythia, and A. actinomycetemcomitans, special measures,

10

such as reducing the severity of inflammation and altering the redox potential of periodontal

pockets, should be considered to restrict the growth of associated microbes [14-15]. Similarly,

low pH environments encourage the growth of acid-producing, acid-tolerating bacteria such as

mutans streptococci and lactobacilli, commonly known for their involvement in dental caries.

The prevention measures against dental caries should target both the associated pathogens and

the environmental factors causing the ecological shifts in the plaque population [14-15, 81]. The

role of oral streptococci in the etiology of dental caries is described under sections 1 and 0.

1.1.5 Oral streptococci

A large population of resident oral microflora is comprised of streptococci, which have been

isolated from various sites in the mouth. Most oral streptococci are usually commensal bacteria,

while some are involved in causing dental caries, periodontitis and occasional extra-oral

infections such as infective endocarditis or brain abscesses [61, 82-84]. The most prevalent oral

streptococci are clustered within four phylogenetic groups: mutans group (prominent members

are Streptococcus mutans and Streptococcus sobrinus), salivarius group (S. salivarius, and

Streptococus vestibularis ), anginosus group (Streptococcus anginosus and S. intermedius), and

mitis group (S. mitis, S. gordonii, S. sanguinis and S. oralis) [85-86]. The pioneer colonizers on

tooth surface are members of the mitis group. These colonizers play a critical role in the

initiation and development of dental plaque (as described previously in sections 1.1.2 and 1.1.3).

Streptococci from the mutans group are commonly associated with the etiology of dental caries.

The mutans streptococci along with Lactobacillus are capable of rapidly metabolizing

carbohydrates into acid end-products and generating acidic environment, while activating their

adaptive response under low pH [87]. The microbial succession during the caries formation

implies the association of mutans streptococci with the caries initiation, whereas lactobacilli are

associated with caries progression [9, 21]. In mutans streptococci, nine serotypes (a-h and k)

have been recognized based on the specificity of carbohydrates present in their cell walls [84, 88-

89]. S. mutans is classified into serotypes c, e, f and k with approximately 70-80% of strains as

serotype c, followed by e (∼20%), f and k (less than 5% each). The isolates of S. cricetus

serotype a, and S. sobrinus serotype d and g have also been recovered from the human oral

11

cavity [84, 88-90]. Streptococcus downei serotype h and Streptococcus ratti serotype b are rarely

isolated from macaques and rats, respectively[86, 90]. The members of salivarius-group colonize

preferably on mucosal surfaces and are not considered as significant pathogens of oral diseases

[14, 91]. Species from the anginosus-group are colonizers of dental plaque and mucosal surfaces,

and are recognized as the main causative agents of maxillo-facial infections [92-93]. The oral

streptococci participate in numerous co-operative and antagonistic bacterial interactions within

the plaque community that determines the health and disease of the oral cavity [3, 12, 40].

1.2 Streptococcus mutans

S. mutans was first isolated from a caries lesion by J Clarke in 1924 [94]. However, it was

decades later that S. mutans was associated with dental caries [87, 95]. In rare cases, S. mutans

has also been shown to cause infective endocarditis, a life threatening heart valves inflammation

[82, 96-97]. In both conditions, S. mutans adapts a biofilm mode of growth to colonize specific

host sites. S. mutans can be transmitted to an infant directly from the mother, or from different

members of the family, indicating both vertical and horizontal mode of transmission [98-99].

During the course of life, most of the initially acquired S. mutans strains persist, some are lost

and other new strains are introduced [98-99]. Following the advent of complete S. mutans

genome sequence, various genomic and proteomic approaches have facilitated our understanding

on the genetics, biochemistry and physiology of this dental pathogen. The genomes of four

different strains of S. mutans have been sequenced with S. mutans UA159 being the first to be

sequenced, followed by S. mutans NN2025, S. mutans LJ23 and S. mutans GS-5 [100-103].

S. mutans harbors several virulence factors that provide the bacterium an ecological advantage

over other oral streptococci. The majority of the genome of S. mutans is dedicated towards the

metabolism of dietary sugars and their associated transport systems. The main virulence features

of S. mutans include: a) the ability to produce large quantities of organic acids (acidogenicity)

from metabolized carbohydrates; b) the ability to sustain under low pH conditions (aciduricity);

and c) the ability to synthesize extracellular polymer matrix from dietary sugars for initial

12

attachment, colonization and accumulation of biofilms on tooth surfaces [87]. The factors

influencing the survival and virulence of S. mutans in the oral biofilm are described below.

1.2.1 Acidogenicity and aciduricity

S. mutans has the ability to transport and metabolize several sugars, such as glucose, fructose,

sucrose, lactose, galactose, mannose, cellobiose, β-glucosides, trehalose, maltose, raffinose,

ribulose, mellobiose, iso-maltosaccharides, and possibly sorbose [101]. S. mutans utilizes these

dietary sugars and generates acid end products such as lactate, formate, acetate and ethanol

[104]. During periods of heavy sugar intake, excessive acid production by acidogenic bacteria

lowers the pH of the dental plaque [105]. S. mutans are capable of maintaining their glycolytic

activity under the acidified milieu, which provides them a competitive advantage over other oral

streptococci and assists them and other acidogenic/aciduric bacteria to dominate in the dental

plaque [105-107]. These acid-induced adaptation and selection processes can perturb the balance

between the demineralization and remineralization of tooth enamel, resulting in initiation and

progression of dental caries.

The ability of S. mutans to tolerate acid stress depends on the implementation of several

constitutive and inductive mechanisms, which assist in their adaptation under acidic

environments [105-106, 108]. The central constitutive mechanism involves the activity of the

F1F0 ATPase proton pump, which is functional under low pH and plays a role in: 1) expelling

protons out of the cell to normalize the intracellular pH, and 2) simultaneously generating ATP

to provide energy for the cellular functions [105-106, 108-109]. The inductive mechanisms are

collectively referred to as the Acid Tolerance Response (ATR), whereby bacteria adjust several

catabolic pathways to maintain their viability [105-106, 108]. Some of these inducible

mechanisms include: 1) alteration in the integrity and composition of the cell envelope resulting

in impaired proton permeability; 2) induction of genes encoding for molecular chaperones,

proteases, and DNA repair enzymes to maintain stability of macromolecules and to prevent

accumulation of misfolded proteins; 3) activation of metabolic pathways involved in recycling of

the carbon acids produced during sugar fermentation, thereby, assisting in alkalization of

cytoplasm; 4) and, synthesis of insoluble glucans, leading to adaptation to a biofilm mode of

13

growth, which have increased acid resistance compared with their planktonic counterparts [105-

106, 108].

1.2.2 Biofilm formation

S. mutans adapts a biofilm-dependent lifestyle to colonize the host body [95]. S. mutans utilizes

certain mechanisms to adhere to the tooth surface and under favorable conditions becomes

significantly predominant in the dental plaque community. The fermentable dietary

carbohydrates, especially sucrose, act as one of the key environmental factors in the initiation

and development of dental caries. In the absence of sucrose, the multifunctional adhesin SpaP

(antigen I/II, P1, PAc) is considered to be the primary factor required for initial adherence of S.

mutans to the tooth surface [53, 110]. S. mutans metabolizes dietary sugars to produce

extracellular polysaccharides that act as major constituent of the EPS in the biofilm matrix [105-

106]. EPS promotes bacterial adherence to the tooth surface or to adhered bacteria, thereby

enhancing the structural integrity of the dental plaque [105-106]. Sucrose, a disaccharide of

fructose and glucose, is a major component of the human diet and is strongly associated with the

initiation and progression of dental caries. In the presence of sucrose, multiple

glucosyltransferases exoenzymes mediate the adherence of S. mutans to the tooth surface, by

synthesizing D-glucose polysaccharides, known as glucans. S. mutans produces three distinct

glucosyltransferases, namely: the glucosyltransferase enzyme GtfB, which acts on sucrose to

produce water-insoluble glucans composed predominantly of α-1,3-linkages, GtfD that converts

sucrose to mostly soluble α-1,6-linked glucans and GtfC makes both α-1,3 and α-1,6 glucans

[111-113]. The high molecular weight polysaccharides produced by the Gtf enzymes have been

implicated in attachment and biofilm formation on the smooth surfaces of the tooth in S. mutans

[63]. In addition, a fructosyltransferase (FTF) enzyme acts on sucrose to produce a fructose

homopolymer that is primarily composed of β-2, 1-linked fructose (inulin) [114]. Glucans are

required for initiating and facilitating S. mutans adherence and accumulation on the tooth surface

and acting as a source of metabolizable polysaccharides outside the cell; whereas fructans are

believed to function exclusively as extracellular storage polysaccharides [10, 115-118].

14

The binding of S. mutans to glucans is mediated by cell associated Gtf enzymes and glucan

binding proteins (Gbps) [119]. S. mutans produces four different Gbps that include GbpA, GbpB,

GbpC and GbpD [120-124]. Immunologically distinct from other Gbps, GbpB affects the initial

steps of sucrose-dependent biofilm formation by modulating cell division and other

physiological processes required for planktonic to biofilm transition [125]. GbpA, GbpC and

GbpD are each transported across membrane, where only GbpA and GbpD are released;

whereas, GbpC is cell-wall bound [119, 126]. GbpA contributes to biofilm architecture by

linking glucans molecules, more or less independent of the bacteria [124-125]. GbpC is essential

in the early stages of biofilm formation and is involved in glucan-dependent aggregation of

bacteria; the loss of GbpC results in impairment in virulence, biofilm biomass, and bacterial

aggregates formation [122, 126-127]. GbpD contribute to the scaffolding of the biofilm and is

required to provide cohesiveness between bacteria and glucans in the biofilm matrix; loss of

GbpD results in extremely fragile biofilms [119].

1.2.3 Regulatory systems in S. mutans

Both Gram positive and Gram negative bacteria utilize quorum sensing signaling system to

communicate under an array of diverse physiological conditions. Quorum sensing in Gram

positive bacteria regulates a number of physiological activities, such as competence development

in Streptococccus gordonii, S. pneumoniae, and S. mutans, sporulation in Bacillus subtilus,

antibiotic synthesis in L. lactis, and induction of virulence factors in Staphylococcus aureus. The

bacterial communication via quorum sensing involves the production, release and detection of

small signaling molecules namely: the auto-inducers (e.g. acylated homoserine lactones) or by

processed oligo-peptides (e.g. competence stimulating peptide) [40, 128]. In the oral cavity auto-

inducer 2 (AI-2), produced by pioneer species, have a tendency to alter the structure and

composition of the developing dental plaque [129]. A recent research has proposed the

involvement of bacterial signaling molecules in eliciting specific responses from host cells,

thereby mounting the possibility of cross-communication between prokaryotic and eukaryotic

cells [49]. The concentration of signaling molecules increases with cell growth and on reaching a

15

threshold density; a signaling cascade is induced leading to alteration in the expression of target

genes thereby shifting the dynamics of bacterial population [40, 128].

Quorum signaling in Gram-positive bacteria can involve the activity of auto-inducers or

processed oligopeptides, also known as pheromones. The pheromones, which are initially

synthesized as inactive pro-peptides in the ribosome, are exported from the cell either by the

general secretion system or by utilizing dedicated ABC transporters [130]. During the export

event, the pro-peptides undergo proteolytic and maturation processes to generate the active and

mature pheromone. Pheromones can be imported into the cytoplasm via peptide transporter

complexes, where they can bind and directly modulate the activity of their cognate

transcriptional regulators [130-132]. Alternatively, on reaching a threshold concentrations in the

extracellular milieu, pheromones can be detected by transmembrane receptors of the two-

component system signal transduction family (TCSTS) [128, 130]. TCSTS are typically

composed of a membrane-bound histidine kinase and cytoplasmic response regulator [133-134].

On responding to a specific signal, the histidine kinase undergoes auto-phosphorylation at a

conserved histidine/serine residue and then transfers the phosphoryl group to a conserved

aspartate in the response regulator [135]. The resulting phosphorylation of the response regulator

triggers a conformational change in its domain, prompting its ability to bind specific DNA

promoter regions, thereby rendering transcriptional regulation of the target genes [135]. In S.

mutans, 14 TCSTSs and an orphan response regulator have been identified until now [101].

Cross-talk between certain histidine kinases and their non-cognate response regulators have also

been identified in this bacterium [136]. In S. mutans, the most extensively studied TCSTSs and

their associated affected phenotypes are as follows: VicKR, which is involved in biofilm

formation, sucrose-dependent adhesion, competence development, acid tolerance, oxidative and

cell envelope stress, and bacteriocin production; CiaHR, which is involved in biofilm formation,

sucrose-dependent adhesion, competence development, acid tolerance, calcium signaling, and

mutacin production; LiaSR, which is involved in cell envelope stress, acid tolerance, osmotic

stress, biofilm formation, and mutacin production; LevSR, which is involved in fructose

metabolism and sugar transport; ScnKR, which is involved in acid tolerance and oxidative stress;

orphan RR GcrR, which is involved in sucrose-dependent adhesion and acid tolerance; and

ComDE, which is involved in genetic competence, biofilm formation, bacteriocin production,

16

and quorum sensing [109, 137-140]. An extensive literature review describing the individual

properties of these TCSTSs can be found in Spatafora et al [139].

Although S. mutans produces and responds to AI-2, its significant role in quorum sensing in not

been ascribed [141]. In S. mutans, two density dependent quorum sensing systems have so far

been identified: one comprising the peptide pheromone competence stimulating peptide (CSP)

and the ComDE TCSTS; and the other one consisting the double tryptophan containing signal

peptide XIP (SigX-inducing peptide), regulated by an Rgg-like transcriptional regulator ComR

[132, 142]. Both quorum sensing pathways convey their respective signals to the activation of

the only alternative sigma factor SigX (also known as ComX) of S. mutans, which is therefore a

master regulator of quorum sensing [143-145]. The two signaling pathways differ in many ways

such as: the CSP peptide pheromone is sensed outside the cell by ComD HK, whereas XIP is

sensed inside the cell after its internalization [146-147]; CSP is active only in peptide-rich media

whereas XIP is active only in peptide-free chemically defined media (CDM) [148]; and CSP

induces the expression of sigX only in a fraction of population while the majority remains un-

induced and a small fraction undergoes cell death, while, stimulation via XIP confers 100%

compliance in sigX activation [142, 149-150]. Despite of all these differences, the ultimate

activation of sigX by either of the pathways modulates genetic competence in S. mutans [143-

144].

1.2.4 Genetic competence

Natural genetic transformation is one of the processes of horizontal gene transfer observed in

several bacteria, including streptococci. The genetic transformation has been reported to play a

role in modulating genetic diversity, cell survival, biofilm formation, bacteriocin production and

general stress response in several bacteria [151-152]. During the process of genetic

transformation, the bacteria enter into a physiological state of genetic competence facilitating the

acquisition of foreign DNA from the external environment. In some bacterial species, the

occurrence of a competent state is constitutive, whereas, in others competence is tightly

regulated and depends on specific factors or conditions, such as pheromones, nutrient availability

and stress [151]. On sensing the specific inducible conditions and/or factors, the expression of

17

master regulator(s) is stimulated which leads to activation of the genes involved in DNA uptake

and recombination [151].

All streptococcal species harbor the master regulator SigX and SigX-dependent effector genes,

usually required for natural genetic transformation [153-154]. However, not all streptococcal

species have been shown to be naturally competent [153-154]. S. mutans is a naturally competent

bacterium, which utilizes at least two quorum signaling pathways in transmitting information

from the secreted peptides CSP and XIP to the SigX, involved in development of competence for

genetic transformation (Figure 1-2) [142, 147]. As described previously, the two quorum sensing

pathways differ both in basic architecture and in mechanism of signaling. CSP, encoded by

ComC as a 46-amino-acid pro-peptide, contains a leader sequence with a double-glycine motif

[147]. During secretion through a dedicated ABC transporter, ComAB, the N-terminal leader

peptide is cleaved off by the proteolytic activity of the transporter to generate a peptide that is 21

residues long (21-CSP) [155]. 21-CSP can either be degraded by HtrA proteases in a process

affected by misfolded proteins or can undergo productive processing by SepM extracellular

protease to generate a mature 18-CSP that binds to ComD leading to phosphorylation of ComE

[156]. As described previously, on reaching a threshold density processed CSP is sensed by the

ComD HK, leading to its auto-phosphorylation and thus activation of the response regulator

ComE RR [143, 153]. In contrast, the peptide encoded by ComS is involved in comR-comS

quorum sensing [132]. ComS encodes for a 17-amino-acid polypeptide, which is secreted and

processed to mature XIP [132, 146]. Though the steps involved in XIP secretion and processing

remain entirely unknown, a predicted mature form of ComS is proposed to be of 7 amino acids in

length. Additionally, synthetic XIP consisting of the C-terminal seven amino acids of ComS

induce a significant increase in sigX transcription when added to cells grown in CDM. XIP

interacts with the Rgg-like transcriptional regulator ComR and collectively, ComR and XIP

activate the expression of sigX and comS, thus creating an auto-induction loop in the signaling

system [132]. The absence of comR or comS shuts down the competence machinery even when

cells are stimulated by CSP, whereas the absence of comE does not have any effect on XIP

induced comX activation [132, 148]. Therefore, the comRS pathway is not only necessary but

sufficient in inducing the expression of SigX, involved in competence development.

18

Figure 1-2 Model of CSP- and XIP-induced quorum sensing in S. mutans.

The ComCDE quorum signaling is mostly devoted towards the activation of bacteriocins

(antimicrobial peptides), whereas ComRS signaling system have a prominent role in competence

development. The two signalling pathways converge on transcription of sigX transcriptional

factor, where the ComRS complex acts as the proximal regulator of the sigX transcription.

Figure is reproduced from Federle et al, 2012 with permission of the copyright owner [142].

The activation of sigX by either CSP-ComDE or ComRS sensing systems also depends on the

components of the growth media: XIP is only active in CDM, devoid of any exogenous peptides,

whereas CSP is active only in nutrient-rich media such as brain heart infusion (BHI) or typtone

19

yeast extract (THYE) [148, 150]. Moreover, CDM medium facilitates a high frequency of

natural transformation without exogenoeus supplementation of CSP or XIP, whereas genetic

transformation in nutrient-rich media is strongly dependent on the addition of exogenous CSP.

Another difference in the pathways of sigX induction via the two quorum sensing system lies in

their mode of induction: the XIP heptapeptide induces sigX expression broadly across the

population in a unimodal way, on the other hand CSP induces in a bimodal way where only a

fraction of the cells acquires competence state [149-150, 157]. S. mutans growing in mixed

biofilms with Candida albicans shows interesting patterns of regulation of the competence

pathway [158], where, comS is not activated in single culture biofilms of S. mutans whereas in

mixed biofilms the dramatic induction of comS triggers the activation of quorum sensing

signaling cascade resulting in induced expression of comR and comX [158]. The study provides

a novel mechanism of competence induction in mixed biofilms and holds relevance as C.

albicans have been isolated from the dental caries lesions associated with S. mutans [158].

1.2.5 Metal homeostasis

Metals play an important role in modulating various cellular processes, thereby, ensuring optimal

cell viability. The unique properties of metals allow them to perform a multitude of tasks that

include: as structural component of bio-molecules, as signaling molecules, and as catalytic co-

factors for proper functioning of various essential metabolic enzymes [159-160]. Metal

requirement is closely monitored within the cell, as in the absence/deficiency of a particular

metal ion a stress response is induced that can lead to altered cellular metabolism [161].

Similarly, at higher concentrations metals can be extremely destructive by affecting bacterial

physiology such as: induction of oxidative stress, impairment of protein stability and function,

structural damage of bio-molecules, etc [161-162]. In order to sustain cell viability, extensive

regulatory and protein-coding machinery is devoted to maintain the metal homeostasis. Metal

homeostasis is achieved by maintaining the intracellular metal concentration at an optimal bio-

available concentration and is mediated by balancing efflux and intracellular trafficking/storage

of metal ions (Figure 1-3).

20

Figure 1-3 Metal homeostasis model

Metals play an important role in modulating various cellular processes in all living systems. The

unique properties of metals allow them to perform a multitude of tasks that include: as structural

component of bio-molecules, as signaling molecules, and as catalytic co-factors for proper

functioning of various essential metabolic enzymes. Required in trace amounts, metals can be

extremely toxic at higher concentrations, therefore there trafficking is closely monitored across

the cell membrane and within the cytoplasm.

In S. mutans divalent metal ions such as iron (Fe), manganese (Mn) and calcium (Ca) are known

be required for its growth and survival [163-165]. Of these divalent cations, role of Mn in S.

mutans physiology and its homeostasis has been well characterized. In bacteria, Mn functions as

the co-factor for superoxide dismutase involved in dis-mutation of the toxic superoxide

radicals[166], and for the enzymes required in lactic acid fermentation. S. mutans contains the

sloABCR operon, which encodes an ATP-binding protein, an integral membrane protein, a

solute-binding lipoprotein, and a metal-dependent regulator [164]. Together SloABC forms a

transport system for the transport of both Fe and Mn, whereas the SloR metallo-regulator

21

represses the operon only in response to intracellular Mn [164]. SloR homologs are found in

other bacterial species such as MntR in B. subtilis, IdeR in Mycobacterium tuberculosis, ScaR in

S. gordonii. In S. mutans, SloR has been associated with several physiological activities such as

cell adherence, biofilm formation, genetic competence, metal ion homeostasis, and oxidative

stress tolerance [167]. Moreover, SloR-Mn regulates the expression of the orphan response

regulator GcrR, which acts downstream of SloR to control ATR in S. mutans [140, 168]. GcrR

also modulates sucrose-dependent adherence and aggregation by repressing the transcription of

gbpC, gtfB and gtfC, genes critical for biofilm formation and virulence in S. mutans [122, 140].

Loss of GcrR results in reduced virulence and cariogenicity in S. mutans [140].

Another metal cation, calcium, has been shown to activate CiaHR TCSTS system involved in

ATR in S. mutans [165]. In S. mutans, CiaHR is known to modulate acidogenesis, biofilm

formation, and genetic transformation. The ciaHR is part of the ciaRHX operon, where ciaX

encodes a Ca-sensing secreted peptide, which responds to Ca levels and allows the auto-

regulation of CiaHRX system [79]. With these examples, it is clear that there is a close link

between metal homeostasis and TCSTSs in S. mutans; detailed literature review on discussing

the link between bacterial metal homeostasis and their cognate TCSTSs is presented in Chapter

2.

In this study we investigated the role of copper (Cu) on the physiology and virulence in S.

mutans. Copper homeostasis has been extensively studied in Enterococcus hirae, L. lactis, and B.

subtilis [169-172]. In all these bacterial systems, the genes involved in copper transport are

usually located on the chromosome as copper transporting operon (cop operon). The knock-out

mutants in cop operon become more prone to killing under copper induced stress, confirming

their importance in copper resistance [169-172]. The best-understood copper transport and

resistance system is that of E. hirae [173]. The copYABZ operon of E. hirae encodes two P-type

ATPases, CopA, and CopB involved in copper translocation, and CopY and CopZ, which

regulate the expression of the cop operon in response to both copper starvation and copper

excess (Figure 1-4) [169]. Under normal conditions, zinc forms complex with CopY and binds to

the inverted-repeat sequence, upstream of the copY gene and negatively regulates the expression

of the co-transcribed genes in the cop operon. At high intracellular concentrations of copper ions,

CopZ binds to copper and form Cu+- CopZ complex [174]. For the de-repression of the operon,

22

Cu+-CopZ donates copper to CopY, thereby displacing the bound Zn2+ and releasing CopY from

the DNA [169, 173, 175].

Figure 1-4 The copYABZ operon of E. hirae

Two P-type ATPases, CopA and CopB transport copper across the membrane and CopY and CopZ,

regulate the expression of the cop operon in response to both copper starvation and copper excess. CopB

was shown to catalyze the accumulation of copper and silver ions in native membrane vesicles of E. hirae

in an energy dependent manner. These vesicles accumulate copper in ATP-dependent manner and extrude

copper ions in whole cells. These ATPases are induced at high extracellular concentration of copper and

silver. The regulation of these ATPases is accomplished by a negative repressor CopY and copper

chaperone CopZ. Under normal conditions, CopY binds as a Zn(II)-CopY complex to the inverted repeat

sequence upstream of the copY gene and thereby, negatively regulates the expression of the co-transcribed

genes on the cop operon. At excessive concentrations of copper ions into the cell, CopZ binds to copper

and form Cu(I)-CopZ complex. For the induction of the operon, Cu(I)-CopZ donates copper to CopY,

thereby displacing the bound Zn(II) and releasing CopY from the DNA, resulting in the de-repression of

the operon. Adapted from Solioz et al (2003) [169]

23

In dental plaque, copper alone or in combination with other antimicrobials have been linked with

reduction in occurrence of dental caries [176-177]. Copper has an inhibitory effect on the growth

of S. mutans [176-177]. In S. mutans, the absence of any putative or known cupro-enzyme

signifies non-essentiality of copper in bacterial metabolism; however the presence of an entire

copper resistance and transport operon, copYAZ, suggests the primary function of the system in

defending against Cu stress.

Figure 1-5 Genetic organization of S. mutans copYAZ operon

The copYAZ operon has been partially investigated in S. mutans (Figure 1-5) [178]. The copYAZ

is co-transcribed as a polycistronic operon, where the knock-out mutant in the entire operon

becomes more sensitive to killing specifically under copper stress relative to the wild type strain

[178]. Moreover, copYAZ operon is specifically induced in the presence of copper and is

negatively regulated by CopY [178]. Also, copZ has been shown to de-repress the activity of cop

operon. Despite of all these findings, the function of this operon in copper transport (import

and/or export of copper) and its contribution to other virulence features in S. mutans has not yet

been established. Copper is utilized to maintain optimal cellular metabolism by several bacteria,

however at higher concentrations it can be extremely toxic. Copper induces toxicity by targeting

different processes or pathways in different bacteria. In our study we focused on investigating

the effects of copper on different physiological activities of S. mutans. Copper was demonstrated

24

to induce oxidative stress, affect the survival of the cells under copper and acid stress, inhibit

biofilm formation, disrupt membrane potential and reduce genetic transformation frequency in S.

mutans. Our results also indicate that the copYAZ operon is not only involved in copper transport

but also in protecting the cells under acid and oxidative stress, assisting in maintenance of cell

membrane potential, and in modulation of biofilm formation and genetic transformation under

copper stress.

25

2 An intimate link: two component signal

transduction systems and metal transport systems in

bacteria

Singh K, Senadheera DB, Cvitkovitch DG

Future Microbiol 9(11), 1283-1293 (2014)

26

2.1 Abstract

Bacteria have evolved various strategies to contend with high concentrations of environmental

heavy-metal ions for rapid, adaptive responses to maintain cell viability. Evidence gathered in

the past two decades suggests that bacterial two component signal transduction systems

(TCSTSs) are intimately involved in monitoring cation accumulation, and can regulate the

expression of related metabolic and virulence genes to elicit adaptive responses to changes in the

concentration of these ions. Using examples garnered from recent studies, we summarize the

cross-regulatory relationships between metal ions and TCSTSs. We present evidence of how

bacterial TCSTSs modulate metal ion homeostasis and also how metal ions, in turn, function to

control the activities of these signaling systems linked with bacterial survival and virulence.

Keywords: Transition metal ion homoeostasis; two component signal transduction systems;

gene regulation.

2.2 Introduction

Bacterial interactions with transition metal ions present a dual challenge: while many metal ions

are biologically necessary at low levels, they can also be toxic at high concentrations. Bacteria

use metal ions as co-factors for the function of several critical enzymes involved in electron

transport and/or cell metabolism [179-182]. Accumulation of metal ions can impose deleterious

effects on metabolic and cellular pathways thus compromising cell survival: different metal ions

in the cytoplasm can tend to displace the metal co-factors at the active site(s) of enzymes

ultimately leading to their inactivation [180, 183]. For instance, when cellular metal homeostasis

is disrupted, metals at the upper end of the Irving-Williams series - Mn(II) < Fe(II) 

< Co(II) < Ni(II)  < Cu(II) >  Zn(II) - have the potential to displace enzymatic metal co-factors at

the lower end, thus rendering the proteins inactive [183-184]. In other cases, metal ions can also

affect cell growth and viability by disrupting the structure of nucleic acids, phospholipid

membranes, and enzyme function [185-186]. Therefore, bacteria have developed complex

27

mechanisms to monitor cellular metal ion levels and simultaneously maintain the homeostasis of

multiple cations within a cell [187-188]

Bacteria use various strategies to regulate heavy-metal homeostasis, which include the use of

metal efflux pumps, channels, cation-specific metallo-regulatory proteins, small non-coding

RNAs, and two component signal transduction systems (TCSTSs) [180]. The intracellular import

of metal ions is often facilitated by ATP-binding cassette transporters and Nramp transporters,

whereas their export is usually carried out by cation-diffusion facilitators (CDFs) [189], P-type

ATPases [190-191], and tripartite resistance-nodulation-cell division (RND) transporters [192].

The regulation of metal trafficking proteins or their encoding genes is usually modulated by

TCSTSs or metallo-regulatory proteins. Bacterial TCSTSs are comprised of a membrane-bound

histidine kinase (HK) and an intracellular cognate response regulator (RR) protein [133]. Upon

reaching an appropriate threshold signal, the bacterial HK undergoes auto-phosphorylation,

which in turn, transfers the phosphate to its cognate RR protein. Once phosphorylated, the RR

undergoes a conformational change which alters its binding affinity to specific sequences in the

promoter/operator regions of its target genes [135]. As a result, the RR can activate or inhibit the

transcription of target genes required for an adaptive response. Another group of regulatory

proteins include cytoplasmic metalloregulators, which unlike TCSTSs are comprised of a single

protein that can perform dual functions of sensing and responding to metal ions [18-20]. In fact,

these proteins are specialized allosteric proteins that can directly bind to a specific or a small

number of cognate metal ions [193-195]. Upon binding, the protein undergoes a conformational

change in the regulatory region allowing it to control the transcription of target genes [195]. The

products encoded by these genes can have multiple functions and may include proteins involved

in growth, stress tolerance, virulence and metal trafficking within or between cellular

compartments [18-20]. The function, mechanism and ion specificity of metallo-regulators has

been previously reviewed by others [193-195]. TCSTSs or cytoplasmic metallo-regulators can

exist together in bacteria. While they are capable of independent activation and regulation [18-

20], intracellular cross-talk between these signaling systems has been noted in some species [36-

37].

Of transition metal ions, the homeostasis of iron (Fe) has been widely investigated and

extensively reviewed [196-201]. In this review, we will focus on the relationship between the

28

activity of bacterial TCSTSs and homeostasis of Copper (Cu), Manganese (Mn), Zinc (Zn),

Nickel (Ni), Silver (Ag), Cobalt (Co) and Cadmium (Cd).

2.3 Copper homeostasis

Cu is an important transition metal required for the growth of most living organisms. Owing to

its redox properties, it has a vital role in maintaining biological processes important for cell

viability. Cu exists in two oxidation states, Cu+ and Cu2+, and is utilized by an array of metallo-

enzymes to catalyze electron transfer reactions. In bacteria, Cu functions as a cofactor for over

30 enzymes, such as superoxide dismutase, cytochrome c oxidase or lysyl oxidase [171, 202].

Although required at lower concentrations, accumulation of excess Cu within the cell under

aerobic conditions can catalyze the production of hydroxyl radicals via Fenton and Haber-Weiss

reactions. The production of reactive oxygen species (ROS) in the presence of Cu is believed to

cause cellular damage by reacting with a number of cellular macromolecules such as lipids,

proteins, and nucleic acids [203]. However, there is little or no direct evidence that shows that

Cu-induced ROS generation is the major cause of Cu toxicity. Alternative mechanisms of Cu

toxicity in E. coli have been suggested where Cu, instead of being involved in oxidative DNA

damage, was shown to suppress Fe-mediated oxidative damage [204]. In E. coli growth

inhibition due to Cu could be reversed by the addition of branched chain amino acids [204]. The

authors proposed that Cu can block the synthesis of branched chain amino acids by targeting the

Fe-S cluster containing dehydratases, where Cu replaces the Fe, rendering them inactive and

blocking their activity [204]. However, a similar mechanism was not observed in Salmonella,

where the addition of exogenous branched chain amino acids didn't revert the Cu-mediated

growth inhibition [30]. It was suggested that Cu might have different targets than Fe-S clusters or

the bacterium might have evolved multi-factorial mechanisms to contend with Cu-induced

toxicity [205]. In an another study, it was shown that the E. coli Cu efflux system CusCFBA

(described below) was induced during anaerobic amino acid limiting conditions to protect Fe-S

cluster enzymes from endogenous Cu toxicity [206]. Challenges posed by Cu necessitate the

activity of complex regulatory networks to maintain Cu homeostasis in the cell. The evolution of

29

divergent mechanisms in various bacterial systems to contend with Cu (and metal ion) toxicity

remains a topic that demands further exploration.

To contend with Cu toxicity, bacteria utilize at least one of three principal mechanisms. These

include, a) Cu export across the plasma membrane into the periplasmic space or the extracellular

environment, b) extracellular and/or intracellular Cu sequestration via Cu binding proteins, c) Cu

oxidation to a less toxic Cu2+ state [207]. The mechanisms to maintain Cu homeostasis have been

extensively studied in several bacteria including E. coli, Pseudomonas, Xanthomonas,

Enterococcus and Bacillus [208]. In Gram negative bacteria, excess Cu is either accumulated in

the periplasm or is exported out of the cells. In these organisms, the genes contributing to Cu

homeostasis are either located on the chromosome or are plasmid born. In many

Enterobacteriaceae, such as E. coli, Cu stress tolerance is modulated by chromosomal regulons

designated cue (Cu efflux) and cus (Cu sensing), as well as by plasmid-born machinery such as

the pco system [209]. E. coli utilizes cytoplasmic MerR-type regulator CueR, which in concert

with the CusRS TCSTS, regulate the expression of target genes involved in Cu homeostasis

[209-211]. Under aerobic conditions, CueR is activated by elevated intracellular Cu

concentrations, which can then directly bind the CueR box in the promoter region of copA and

cueO encoding a P-type ATPase and an oxygen-dependent multi-copper oxidase, respectively

[209, 211]. The CopA protein helps export excess Cu+ from the cytoplasm into the periplasm,

where it is oxidized to the less toxic Cu2+ form with the aid of CueO [212]. Under anaerobic

conditions, the CusRS TCSTS maintains Cu homeostasis, wherein the CusS sensor kinase is

activated by a threshold periplasmic Cu concentration, which then transfers this signal via a

phopho-relay event to its cognate responder protein CusR [211]. As a result, CusR regulates

transcription of the cusRS operon, as well as the adjacent, but divergently oriented cusCFBA

operon by directly binding to the CusR box (AAAATGACAANNTTGTCATTTT) between the

cusC and cusR promoters [213]. The CusCBA (a proton-cation antiporter) and CusF (a Cu

chaperone) proteins have also been demonstrated to aid in Cu stress tolerance [214].

Interestingly, no other sequence in the entire genome of E.coli was found to contain a CusR box

suggesting it binds specifically and only to the intergenic region between the cusRS and

cusCFBA operons [213]. In Cornybacterium glutamicum, the E.coli homologue of CusRS was

identified and characterized as copRS TCSTS. CopRS senses extra-cytoplasmic levels of Cu+

30

concentrations, and induces the set of genes involved in Cu homeostasis and resistance [215].

Like in E.coli, CopR specifically binds and regulates the expression of two divergently oriented

operons cg3286-cg3289 and copR-cg3281, which encodes for Cu resistance proteins (e.g.

putative multicopper oxidase CopO and the putative copper export ATPase CopB) and CopRS

TCSTS respectively [215].

In cyanobacterium Synechocystis sp. PCC 6803, CopRS two-component system is known to be

essential for copper resistance [216]. CopS was shown to have a high affinity to bind Cu in vitro,

moreover its localization both in the plasma and thylakoid membrane suggested that CopS can

possibly bind and respond to Cu both in the periplamic and thylakoid lumen in Synechocystis

[216]. However, further studies are warranted to completely understand the mechanism and

conditions involved in Cu binding to CopS under natural conditions. In the presence of Cu,

CopR directly binds and regulates the expression of both copBAC, the putative heavy-metal

efflux-RND copper efflux system and its own locus (copMRS operon) [216].

In E. coli two other TCSTSs, CpxAR and YedVW, were shown to be induced in the presence of

Cu [213]. CpxAR is involved in membrane stress tolerance; it activates the transcription of CpxP

protease for degradation of denatured proteins. Furthermore, a CpxR binding-site, a conserved

tandem repeat pentanucleotide sequence GTAAA(N)(4-8)GTAAA, was identified in the

promoter region of several copper-inducible genes [217]. Knockout mutants of CpxAR were

more sensitive to killing under Cu stress suggesting the role of this TCSTS in copper

homeostasis in E. coli [217]. The function of YedVW is not well characterized; however, YedV

kinase has been shown to transfer phosphate not only to YedW but also CusR. The YedVW was

not induced by Cu in a CusR-deficient mutant suggesting the induction of YedVW system in a

CusR-dependent manner [213]. Although the function of YedVW in Cu homeostasis is not yet

characterized, its induction likely results from cross-talk between the CusRS and YedVW

systems in the presence of Cu [213].

In Helicobacter pylori, a major colonizer of the human gastric mucosa, Cu is imported in a non-

specific manner [218]. Cu ions accumulated in the periplasm are detoxified via the metal export

system, crdAB and czcBA, orthologous to that of the E. coli four-component Cu export system

CusCFBA and is directly controlled by the CrdRS TCSTS [219]. The expression of crdA,

31

encoding the protein most highly expessed under copper stress is directly controlled by the

CrdRS TCSTS [219], where CrdR was shown to bind the operator region of the crdA promoter.

Despite their speculations, the authors did not demonstrate that CrdS can directly sense Cu from

the surrounding environment. H. pylori mutants' deficient in CrdS and CrdR cannot colonize the

mouse stomach, indicating a crucial role for Cu homeostasis in the adaptation to the gastric

environment [219].

In addition to the utility of chromosomal Cu resistance genes, E. coli also utilizes a conjugative

plasmid harboring the pco gene cluster comprised of pcoABCDRSE to contend with Cu stress

[220]. These encode the multi-Cu oxidase, PcoA, the outer membrane protein, PcoB, the

periplasmic proteins, PcoC and PcoE, and the inner membrane protein PcoD. The pco operon is

Cu-inducible and is regulated by a specific pCoRS TCSTS encoded by the same operon [220].

Although cusRS and pcoRS encode homologous Cu-responsive regulatory systems, they do not

substitute for one another. The CusRS and PcoRS have different sensitivities or induction

profiles to varying Cu concentrations and are comprise of independent copper-responsive

regulatory systems in this bacterium [220].

Similar plasmid-encoded regulation of Cu resistance operon, copABCDRS, is observed in

Pseudomonas syringae and is regulated by the corresponding copRS TCSTS [221]. CopABCD

functions in the binding of copper, while CopR and CopS form a TCSTS system that regulates

the expression of copABCD [221-223]. In P. syringae multi copper oxidase copA and outer

membrane protein copB are essential to fundamental copper resistance whereas periplasmic

proteins, copC and copD are required for full Cu resistance [221-223]. In vitro studies suggested

the direct binding of CopR to the cop box (a conserved CopR binding region) in the promoter

region of the Cu resistance operon [224]. In Pseudomonas fluorescens strain TSS, homologous to

plasmid encoded cop operon however chromosomally located, Cu resistance genes copRSCD but

not copAB have been identified [225]. The expression of copCD is directly regulated by the two

component responder protein CopR, which auto-regulates its expression in response to Cu [225-

226]. In addition to Cu resistance, CopRS modulates bacterial growth, biofilm formation, and

tissue dissemination, thereby suggesting its involvement in the regulation of bacterial virulence

determinants in P. fluorescens [225].

32

2.4 A link between Copper and Silver homeostasis

In the periodic table Cu and Ag both belong to Group 11, of the transition metal elements.

Similar to Cu, Ag has an antimicrobial effect on bacteria and is widely incorporated into

products in medical equipment and public environments [227]. Silver cations (Ag+) are

bactericidal at low concentrations and are used to treat burns, wounds and ulcers. In addition,

silver catheters and silver-coated catheters are used for their inhibitory role in microbial growth

and biofilm formation [227]. Silver nanoparticles are effective not only against bacterial

infections, but also are active against several types of viruses including the human immuno-

deficiency virus, hepatitis B virus, herpes simplex virus, respiratory syncytial virus, and monkey

pox virus [228]. Because of similar chemical properties of Cu and Ag, bacteria utilize a similar

set of genes to cope with their homeostasis and resistance. In E. coli, the central role of CusS has

been associated with modulating transcription of genes involved in Cu and Ag efflux [210].

CusS is activated in a metal- dependent manner and up-regulates the expression of cusCFBA that

is required for Cu and Ag resistance. In a clinically isolated Ag resistant strain of Salmonella,

metal ion resistance was conferred by the plasmid pMGH100, which has nine genes required for

Ag resistance that are arranged as three transcriptional units [227]. Genes present within these

units encode the SilRS TCSTS, a periplasmic Ag+-binding protein (SilE), an Ag+ efflux pump (a

P-type ATPase SilP), and a membrane potential-dependent three-polypeptide cation/proton

antiporter (SilCBA). The function of SilP in transporting cytoplasmic Ag directly into the

periplasm or across the outer membrane is yet not investigated. However, SilABC forms the

three polypeptide RND protein which removes Ag from the cytoplasmic region directly to the

outside of the cell without its release into the periplasmic space. The silver dependent activation

of the SilE, SilP and SilCBA is regulated by the SilRS system [227].

2.5 Manganese homeostasis

Mn has a vital function in regulation of bacterial metabolism, since it acts as a cofactor for

metabolic enzymes such as superoxide dismutase, catalase, pyruvate carboxylase, and

phosphoenolpyruvate carboxykinase[229-230]. Mn is essential for detoxification of ROS thereby

33

protecting the cells against oxidative stress, also recently, low molecular weight Mn complexes

have been shown to reduce oxidative tissue injury and ROS in in vitro and in vivo biological

systems [166, 231]. B. subtilis utilizes Mn during different stages of its developmental cycle and

particularly for efficient sporulation [232].

In Pseudomonas putida, a Mn2+-oxidizing bacterium [233], the MnxSR two-component

regulatory system is comprised of two sensor kinases, MnxS1 and MnxS2, as well as one

responder protein, MnxR. Together MnxS1, MnxS2 and MnxR have a central role in regulating

Mn2+oxidation [234]. The oxidation of Mn2+ to Mn3+ and Mn4+ is assumed thermodynamically

favorable as bacteria may derive energy from this reaction. The MnxR regulates Mn2+ oxidation;

however, in order to be activated, MnxR requires signaling from both cognate sensor kinases

since deletion of MnxS1 or MnxS2 results in complete loss of its ability to oxidize Mn2+ [234].

Mn together with Ca2+ and Cl- act as a catalytic center for the oxygen-evolving photosynthetic

machinery in higher plants and cyanobacteria [235]. Cyanobacterial cells take up Mn2+ ions

using an ABC-type transporter encoded by the mntCAB operon: mntA encodes an ATP binding

subunit, mntB encodes a gene for its hydrophobic subunit, and the mntC encodes a Mn2+ binding

subunit [236]. Two different studies in Synechocystis identified a TCSTS comprised of ManS

and ManR involved in sensing and regulating the mntCAB operon, respectively [237-238]. At

high Mn2+ concentrations, cell membrane localized ManS is speculated to bind Mn2+ and convey

the signal to its cognate responder protein, ManR. Once activated, ManR can repress the

transcription of the mntCAB operon thus inhibiting Mn uptake. On the other hand, under low

Mn2+concentrations, ManS is speculated not to bind Mn2+ ions and thus, ManR remains inactive

resulting in de-repression of the mntCAB operon, facilitating uptake of Mn [237-238].

The effect of Mn in activating and regulating the expression of two component signaling systems

has been observed in several organisms [239-242]. In Streptomyces reticuli, a soil microbe, the

SenS/SenR system modulates the expression cpeB, which encodes a Mn-dependent peroxidase

involved in protecting the cells under oxidative stress [240]. In M. tuberculosis, Mn and Ca are

known to activate the TrcRS TCSTS [243]. The TcrRS TCSTS suppresses the expression of

rv1057, which encodes the only seven-bladed β-propeller protein required for the structural

integrity of the cell envelope of M. tuberculosis and might be a component of the mycobacterial

34

envelope [242]. Though not much has been published regarding rv1057, studies suggest that the

Rv1057 protein may function similar to TolB, a β-propeller protein that interacts with

peptidoglycan-associated proteins and maintains envelope integrity in Gram negative bacteria

[244]. In E. coli, Mn-containing serine/threonine protein phosphatases, PrpA and PrpB regulate

the CpxAB TCSTS and the periplasmic protease HtrA/DegP, which help contend with

environmental stress tolerance [239, 241].

In Streptococcus mutans, which is one of the primary causative agents of human dental caries

[245], the sloABCR operon encodes components of a putative metal uptake system. These genes

encode an ATP-binding protein, an integral membrane protein, a solute-binding lipoprotein, and

a metal-dependent regulator, respectively [164]. The SloABC transport both Fe and Mn,

although the SloR represses this system only in response to Mn [164]. The SloR in S. mutans is a

one component cytoplasmic metal dependent regulator, which modulates several physiological

functions that include cell adherence, biofilm formation, genetic competence, metal ion

homeostasis, oxidative stress tolerance, and antibiotic gene regulation [167]. In this organism,

SloR-Mn regulates the expression of an orphan responder protein designated GcrR, which acts

downstream to tolerate acid stress, an important virulence factor of this cariogenic pathogen

[140, 168]. The interaction between the metalloregulatory protein SloR and RR GcrR provides

an excellent example of cross-talk between one component and two component metal regulatory

systems in bacteria. In S. mutans, acid tolerance is known to be mediated by several TCSTSs

including the CiaHR system that is activated by Ca2+ [165]. This system also regulates multiple

virulence phenotypes including the ability to produce acid, form biofilm and develop genetic

competence [165]. The ciaRH is part of the ciaRHX operon, where ciaX encodes a calcium

sensing signaling peptide that allows the CiaRH system to modulate its operon own expression in

response to this cation [165].

2.6 Cadmium Zinc Cobalt Homeostasis

Bacteria utilize Zn as an enzymatic co-factor and for the integrity of structural elements of the

cell. Like other heavy metals, at high concentrations Zn can be highly toxic to the cell.

35

Therefore, intracellular levels of Zn are often tightly regulated by an extensive network of

transporters, ligands and transcription factors. In E. coli, Zn detoxification is primarily achieved

by exporters such as ZntA, a P-type ATPase, ZntB, a cation diffusion facilitator and periplasmic

proteins such as Spy or ZraP [246].

In E.coli, the BaeSR TCSTS is one of three extra-cytoplasmic stress response (ESR) systems that

helps elicit adaptive responses to changing environmental conditions [247]. On sensing transient

environments (e.g., stresses posed by indole, tannin, flavonoids, sodium tungstate, or high levels

of metal cations), the BaeS is activated and transduces its signal by catalyzing phosphorylation

of the transcription factor BaeR [247]. In E. coli and Salmonella BaeR activates the expression

of its own operon as well as genes involved in responses to contend with envelope stress, drug

resistance, and metal resistance [248-250]. In E. coli, the BaeSR TCSTS can sense Fe and Zn in

the surrounding environment, and in turn, regulate the expression of genes involved in the

formation and modification of membrane structure and function [251]. The BaeSR together with

the CpxAR TCSTS co-regulate the ZraP and Spy periplasmic chaperones required for envelope

stress sensing [252]. Though the function of the periplasmic chaperone, Spy, in Zn detoxification

is not known, its induction in the presence of Zn and impaired growth of the knock out mutant in

spy under Zn stress suggest that it might play a role in Zn detoxification probably by facilitating

the folding of the transmembrane or periplasmic transporters involved in Zn export [248]. In S.

typhimurium, BaeSR was shown to be involved in regulating the expression of multidrug efflux

pumps and providing resistance against Cu and Zn toxicity [253].

In E. coli another Zn-responsive TCSTS, HydHG TCSTS system, when under excess Zn

concentrations, modulates the expression of the periplasmic Zn-binding protein ZraP to maintain

Zn homeostasis [254]. Similarly in S. typhimurium, ZraSR (HydHG), have been shown to

modulate the expression of periplamic protein, ZraP required for regulation of the ZntA

transporter of Zn [255]. The periplasmic protein and Zn-dependent chaperone ZraP has an

important role in maintaining envelope homeostasis and contributes to the regulation of response

regulator zraR of the ZraSR TCSTS [255]. In another study, it was shown that while ZraP and

ZraSR can be induced by indole. In the zraP knock out mutant a significant reduction in zraR

expression was observed even in the presence of indole [255]. Although it was suggested that

ZraP regulated the expression of the ZraSR TCSTS, the fact that both ZraP and ZraSR are

36

induced by indole is noteworthy; since ZraP is a periplasmic chaperone, there is a possibility that

it might act as a signal transducer for indole, wherein the absence of this protein, the signal for

ZraR activation is not conveyed resulting in its low expression levels [255]. The same group

further showed that regulatory cross-talk occurs between the ZraPSR and BaeSR systems,

wherein the loss of BaeR led to the induction of ZraPSR [255].

In P. aeruginosa, the CzcRS TCSTS regulates the expression of CzcCBA efflux system, which

confers specific resistance against Zn, Cd, and Co cations [256]. CzcA functions as a cation-

proton antiporter, and CzcB acts as a cation binding subunit. Both CzcA and CzcB proteins form

a membrane bound protein complex which can catalyze an energy-dependent efflux of Zn, Co,

and Cd ions [257]. The CzcC provides substrate specificity towards Co and Cd [257]. In the

presence of Zn, Cd or Co, the metal-inducible TCSTS, CzcRS is activated, and in turn, induces

the expression of czcCBA encoding a metal efflux pump [256]. Further, the CzcRS is involved in

cross-talk with the CopRS TCSTS, wherein the CopR regulator required for Cu homeostasis,

links Cu resistance to Zn tolerance by activating the czcRS operon [258]. In P. aeruginosa, a

putative cop box was identified between czcC and the czcR regulatory gene suggesting that CopR

can bind to this region and regulate the transcription of the czcRS and czcCBA operons [259].

2.7 Nickel Homeostasis

Ni is required as a structural component of metallo-enzymes [260-261]. It is also needed to form

a part of the active site of a number of enzymes including peptide deformylase, reductase and

ureases, as well as some superoxide dismutases and hydrogenases [260-261]. Like other

transition metal ions, at higher concentrations, Ni cations can confer harmful effects such as the

generation of free radicals, inhibition of enzyme activity, contribution to DNA damage,

developmental defects and cancer [262-263]. E. coli utilize Ni to survive under anaerobic

growth. In fact, high levels of Ni are used for the optimal activity of Ni/Fe hydrogenases,

enzymes involved in H2 oxidation [264-265]. The NikR, transcription factor has been

characterized in various bacteria, and is known to repress or activate specific genes in response

to Ni availability [266].

37

Microbial Ni uptake is either accomplished by non-specific transport systems for divalent cations

or by high affinity Ni-specific systems [267-268]. In E. coli, an ATP-binding cassette

transporter, designated as NikABCDE, serves as the main importer for Ni ions. NikABCDE is

comprised of NikA, a periplasmic Ni-binding and Ni-sensing protein; NikB and NikC integral

inner membrane proteins; as well as NikD and NikE membrane-associated ATPase proteins

[266, 269]. The nikABCDE operon responds to the presence of intracellular Ni, oxygen tension

and nitrate availability. The transcription of the nikABCDE operon is positively regulated by the

fumarate nitrate regulatory protein (FNR) transcription factor in the absence of oxygen [270] and

is negatively regulated by the NikR repressor in the presence of high concentrations of Ni ions

[271-272]. Another major transcriptional regulator identified for the nikABCDE operon is the

nitrate responsive NarLX two-component system [273]. In the presence of nitrate, NarX HK

phosphorylates the cognate RR NarL, which represses the expression of the nikABCDE operon

by binding to a distinct operator site from that of NikR [273]. The expression of the operon is

tightly regulated by the mechanisms described depending on the presence of stressors involved

[266].

In Synechocystis species, the nrsBACD operon encodes proteins required for Ni resistance [274].

NrsB and NrsA are homologues of the P. aeruginosa CzcB and CzcA proteins, respectively

[274]. Together the NrsA and NrsB, form a membrane-bound protein complex that can catalyze

Ni efflux by a proton/cation antiport system. The role of NrsC in Ni export is unknown. NrsD, a

membrane protein, confers resistance to Ni and also acts as a Ni exporter [274]. Upstream of this

operon and in reverse orientation, the NrsRS TCSTS can sense and respond to Ni. Once

activated, it modulates expression of the nrsBACD operon, whose products regulate Ni

homeostasis [274]. When Ni accumulates in the periplasm, the nrsBACD operon is activated

under the control of NrsSR TCSTS; the accumulation of Ni in the cytosol is sensed by InsR

(internal nickel-responsive sensor) [275]. InsR, a CsoR/RcnR like metallo-regulator, binds

directly at the cryptic transcription start sites within the nrs operon which enables independent

repression of nrsD (of other nrs genes) in response to cytosolic Ni ions [275]. In the mutant

deficient in inrS, as a result of Ni-dependent derepression of nrsD, an increase in export of Ni

from the cytosol to periplasm was observed resulting in enhanced Ni resistance and reduced

cytosolic Ni accumulation [275]. The regulation of the nrsBACD operon either by cytoplasmic

38

metallo regulatory protein or membrane bound TCSTS occurs depending on the surplus

accumulation of Ni within the cytosol or periplasm respectively [275]. However, whether the

regulatory pathways involve any crosstalk for efficient homeostasis remains a question [275].

2.8 Future perspectives

Despite our enhanced understanding of the role of TCSTSs in bacterial physiology, more studies

are required to dissect the direct mechanisms underlying these processes. For instance, the nature

of cation-induced activation (i.e. direct or indirect stimulation of the sensor kinases) remains an

area of research that deserves greater attention. As discussed earlier, in Synechocystis, in vitro

studies have shown direct binding and activation of the HK by Cu cations [216]. Such studies

provide groundwork for more extensive research to understand the bio-physical interactions

between the TCSTS and metal cations. Emerging research in the field of bacterial metallo-

regulation reveals the conservation and pairing of TCSTSs with corresponding cation

uptake/efflux systems. Recently, upon analyzing the phylogeny of responder proteins belonging

to TCSTSs, patterns of orthology/paralogy between Cu, Cd, Zn, and Co efflux proteins, as well

as among their regulatory proteins (e.g., CopR, CzcR, CopS, and CzcS) was discovered [276].

Further, comparative analyses of three-dimensional structures has confirmed a common

evolutionary origin for these regulatory proteins [276]. Hence, the shared mechanism of

activation or function of these systems can be exploited to develop novel therapies against

bacterial infections. Bacteria deprived of the genes involved in metal homeostasis or those tied to

their regulation tend to have diminished virulence relative to their parent strains. Since metal-ion

homeostasis and TCSTSs are closely coupled to bacterial survival and virulence mechanisms,

understanding the molecular mechanisms underlying these processes can have significant clinical

implications in curbing bacterial virulence.

39

2.9 Executive summary

� Transition metal-ion homeostasis is important for bacterial survival. While these cations

can be detrimental at high concentrations, they can sometimes serve essential functions in

maintaining optimal physiology of these organisms.

� Of cellular components that are involved in metal homeostasis, bacterial TCSTSs have

intimate and complex roles in responding, as well as in eliciting cellular responses to metal

cation stress.

� Cytoplasmic metallo-regulators differ from the TCSTSs, as the former are comprised of a

single protein that can perform dual functions of sensing and responding to metal ions

whereas latter utilizes two different proteins to perform these functions.

� Bacterial TCSTSs accomplish metal-ion homeostasis by not only regulating metal export,

but also by modulating the production of proteins associated with metal detoxification.

� Many RRs can directly bind to the promoter regions of their target genes whose products

modulate metal trafficking and homeostasis (summarized in Table 1); however sensing and

activation of their cognate HKs by metal cations is still an area which demands more

investigative work.

� Bacterial metallo-regulation reveals the conservation and pairing of TCSTSs with their

corresponding cation uptake/efflux systems.

40

Table 2-1 Bacterial TCSTS and metal ions

Metal Ion TCSTS Organism Operon regulated RR directly

binding to

operon

Cu CopRS C. glutamicum [215]

P. fluorescens [225-226]

Synechocystis [216]

cg3286-cg3289 and copR-cg3281

copRSCD

copBAC, copMRS

Yes

Yes

Yes

CusRS E.coli [36-37] cusCFBA, cusRS Yes

CpxAR E.coli[217] Specific copper-inducible genes Yes

YedVW E.coli [213] Several copper-inducible genes No

CrdRS H. pylori [219] crdAB, czcBA,crdRS Yes

Plasmid

Encoded

pCoRS

CopRS

E.coli [220]

P. syringae [221, 224]

pcoABCDRS, pcoE

copRS, copABCD

Yes

Yes

Ag CusRS E.coli [36-37] cusCFBA, cusRS Yes

SilRS Salmonella [227] silE, silP, silABC ND

Mn MnxSR P. putida [234] Involved in Mn2+ Oxidation ND

ManSR Synechocystis [237-238] mntCAB Yes

Cd, Zn, Co BaeSR

E.coli [247]

S typhimurium [249, 253]

Several metal resistance genes

Several metal resistance genes

---

---

ZraSR S. typhimurium [255] zraP ND

HydHG E.coli [254] zraP Yes

CzcRS P aeruginosa [256] czcRS, czcABC Yes

Ni NrsRS Synechocystis [275] nrsBACD Yes

NarLX E.coli [273] nikABCDE Yes

41

3 Statement of the problem

It is established that metal ions play an important role in bacterial cellular processes to ensure

optimal cell viability at all times. The unique properties of metals allow them to function as

structural component of bio-molecules, signalling molecules, and catalytic co-factors of various

essential metabolic enzymes [159-160]. Bacteria are known to have specialized mechanisms to

counter the perturbations in the intracellular metal homeostasis. The unwanted metal imbalance

can have deleterious effects on bacterial physiology such as: induction of oxidative stress,

impairment of protein stability and function, or structural damage of bio-molecules, etc [161-

162].

Most bacteria require copper as an essential co-factor for metabolic enzymes, although there are

others where copper is not required for any of their metabolic activity [277]. Copper exists in

two oxidation states: cuprous (Cu+) and cupric (Cu2+) forms; the interchange between these states

via Fenton reactions can lead to the generation of reactive oxygen species (ROS), especially

superoxide radicals which are toxic to the cells [208]. The production of ROS causes major

damage to nucleic acids, proteins or lipids, thereby compromising cell viability [203]. However,

some reports indicate the involvement of non-redox mechanisms of copper toxicity [204, 206,

278]. One such example is copper displacing the iron cation from Fe-S clusters of the

dehydratases enzymes thereby, rendering them inactive [206, 278]. Therefore, mechanisms

involved in copper homeostasis can have different cellular targets among different bacterial

species.

Copper has been linked to the inhibition of biofilm formation and detachment in S. gordonii

[279]. Previous studies have shown that in S. mutans the addition of copper modulates the

expression of gtfD both at the transcriptional and translational levels [280]. In S. mutans, in two

different microarray studies conducted in our lab showed that the expression of the copYAZ

genes was modulated in the presence of acid or CSP [109, 157]. In S. mutans strain GS-5, copper

was shown to irreversibly inhibit the activity of F-ATPases, thereby compromising the cell's

ability to carry out glycolysis in acidic environments [281].The mechanism by which copper

renders toxicity in S. mutans has yet not been fully discovered.

42

3.1 Rationale and objectives

S. mutans is known to contribute in initiation and progression of dental caries- a chronic

transmissible bacterial infection. Since its post-genome sequence era, the research on and

understanding S. mutans' physiology and identifying its virulence attributes has vastly expanded,

accredited to the recent advances in the field of genomics, proteomics and transcriptomics. The

three established virulence attributes of S. mutans include: acidogenicity, aciduricity and biofilm

formation.

S. mutans genome encodes the copYAZ operon, a copper transport and resistance system. The

structure analysis for the S. mutans CopYAZ was performed using Phyre-2 structure prediction

site (http://www.sbg.bio.ic.ac.uk/phyre2/html/page.cgi?id=index). The S. mutans copA encodes

for a 742 amino acids (a.a) long predicted protein belonging to the P-type ATPases class of metal

exporters. The CopA product is predicted to contain 7 trans-membrane domains with an

intracellular N- and an extracellular C-terminal. The copY encodes translated product of 147 a.a

residues and is predicted to be a negative transcriptiopnal regulator of copA, harboring winged

helix DNA-binding domain. The copZ encodes for a 67 a.a residues putative copper chaperone

and harbors a metal binding domain. Using BLASTP, the percentage sequence similarity

analysis of S. mutans copA encoded protein with other bacterial Cop proteins showed high

sequence similarity with: E. hirae CopA (96%), E. hirae CopB (86%), Staphylococcus aureus

CopB (91%), S. aureus CopA (81%), Enterococcus faecalis CopA (99%), S. thermophilus

copper P-type ATPase (100%), S. salivarius CopA (100%). Moreover, the gene expression

analysis revealed an induction of the copYAZ operon under copper stress in S. mutans. With

these preliminary results we postulated the presence of a functional copYAZ operon in S. mutans,

which resembles other functional bacterial copper transporters in copper efflux, and in protecting

the cell under copper and/or other cellular stressors.

Copper is toxic to S. mutans, however, the pathways affected by copper warrants further

investigation. S. mutans genome does not appear to have any intracellular copper requirement,

either in cupro-proteins (copper-containing proteins) or as enzymatic co-factors; therefore

implying the major function of copper homeostatic systems is protecting the cells against copper

stress [170, 277]. Although copper resistance and the transport system copYAZ have been

43

partially characterized in S. mutans, the role of this operon in bacterial virulence is not yet

characterized. Based on above observations we presented the following hypothesis.

3.2 General hypothesis

In S. mutans, an imbalance in copper homeostasis induces toxic effects on its main features such

as biofilm formation, competence and stress tolerance. The CopYAZ system is required for

copper homeostasis and for the modulation of virulence attributes in S. mutans.

3.3 Objectives and aims

Given that biofilm formation and stress tolerance are vital to the virulence of S. mutans,

understanding the contribution of copper to these processes remains the question warranting

further research. In an attempt to elucidate the physiological and molecular mechanisms

underlying copper response in S. mutans, the goal of this dissertation is to investigate the

following specific aims:

Specific Aim 1: Determine the effects of copper on biofilm formation, genetic competence

and stress response in S. mutans.

Specific Aim 2: Understand the role of the copYAZ operon in copper transport and stress

tolerance in S. mutans.

Specific Aim 3: Determine the underlying molecular mechanism by which copper

modulates genetic competence and biofilm formation in S. mutans.

44

4 The copYAZ operon functions in copper efflux,

biofilm formation, genetic transformation and stress

tolerance in Streptococcus mutans

Running Title: Streptococcus mutans copper transport system

Kamna Singh, Dilani B. Senadheera, Céline M. Lévesque, Dennis G.

Cvitkovitch*

Dental Research Institute, Faculty of Dentistry, University of Toronto

*Corresponding Author E-mail: d.cvitkovitch@dentistry.utoronto.ca

J Bacteriol. 2015 Aug 1; 197(15):2545-57. doi: 10.1128/JB.02433-14.

Epub 2015 May 26

45

4.1 Abstract

In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions, while

avoiding cell damage. Most Gram positive bacteria utilize the copYABZ operon for copper

homeostasis, where copA and copB encode for copper transporting P-type ATPases, whereas

copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm

forming oral pathogen that harbours a putative copper transporting copYAZ operon. Here, we

characterized the role of copYAZ operon in the physiology of S. mutans and delineated the

mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced

toxicity in S. mutans by generating oxidative stress and disrupting its membrane potential. The

deletion mutant of the copYAZ operon in S. mutans UA159 strain, designated ΔcopYAZ, resulted

in reduced cell viability under copper-, acid- and oxidative-stress relative to the wild type.

Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was

impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total

biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and

gbpC genes, whose products have a role in maintaining the structural and/or functional integrity

of the S. mutans biofilm. Further, supplementation with copper or loss of the copYAZ resulted in

a significant reduction in transformability and transcription of competence- associated genes.

Copper transport assays revealed that the ΔcopYAZ strain accrued significantly high amounts of

intracellular copper compared with the wild-type strain, thereby, demonstrating a role for

CopYAZ in copper efflux of S. mutans. The complementation of CopYAZ system restored

copper expulsion, membrane potential, and stress tolerance in copYAZ-null mutant. Taken

collectively, we have established the function of the S. mutans CopYAZ system in copper export,

and have further expanded the importance of copper homeostasis and the CopYAZ system in

modulating streptococcal physiology including the stress tolerance, membrane potential, genetic

competence and biofilm formation.

46

4.2 Importance

S. mutans is best known for its role in initiation and progression of human dental caries, one of

the most common chronic diseases worldwide. S. mutans is also implicated in bacterial

endocarditis, a life-threatening inflammation of heart valves. S. mutans core virulence factors

include its ability to produce and sustain acidic conditions, and to form a polysaccharide-encased

biofilm that provides protection against environmental insults. Herein, we demonstrated that the

addition of copper and/or deletion of copYAZ (the copper-homeostasis system) have serious

implications in modulating biofilm formation, stress tolerance and genetic transformation in S.

mutans. Manipulating the pathways affected by copper and copYAZ system may help to develop

potential therapeutics to prevent S. mutans infection in, and beyond, the oral cavity.

4.3 Introduction

Many bacteria utilize copper as an essential co-factor for enzymes involved in electron transfer

reactions that include, superoxide dismutase, cytochrome c oxidase or NADH-dehydrogenase

[171, 202]. Although required in low concentrations, copper at higher levels can pose a threat

owing to its high reactivity. Copper can exist in cuprous (Cu+) and cupric (Cu2+) oxidative forms;

the interchange between these states via Fenton reactions can lead to the generation of reactive

oxygen species (ROS), especially superoxide radicals. The ROS are believed to cause cellular

damage by reacting with a number of cellular macromolecules such as lipids, proteins, and

nucleic acids [203, 208, 282]. However, there is little or no direct evidence that shows that

copper-induced ROS generation is the main mode of copper-toxicity in bacteria [204, 206, 278].

In Escherichia coli, copper was demonstrated to target and replace iron from the iron-sulphur

clusters of dehydratases, thereby, rendering them inactive and perturbing the biosynthesis of

branched chain amino acids [172, 204, 206, 278]. Supplementation of E. coli cultures with

branched chain amino acids was shown to reverse the copper-induced growth inhibition [278].

However, a similar mechanism was not observed in Salmonella, where the addition of exogenous

branched chain amino acids did not revert copper-mediated growth inhibition, thereby suggesting

the involvement of a different cellular target for copper-toxicity [205]. Copper-mediated

47

membrane depolarization has also been reported in E. coli [283]. Challenges posed by copper

necessitate the involvement of complex regulatory machinery to maintain copper homeostasis in

the cell. To contend with copper toxicity, bacteria utilize at least one of three principal

mechanisms that include, a) copper export across the plasma membrane into the periplasmic

space or the extracellular environment, b) extracellular and/or intracellular copper sequestration

via copper binding proteins and, c) copper oxidation to a less toxic Cu2+ state [207]. The

mechanisms involved in copper stress tolerance can vary among bacterial species and exploring

these pathways is an important step to implement the use of such metal cations as antimicrobial

therapeutics.

Streptococcus mutans is considered as the primary etiological agent of dental caries, one of the

most widespread infectious diseases worldwide [19, 77]. Numerous studies have indicated the

inhibitory effects of copper on S. mutans growth and caries formation [87, 95, 177, 284-288].

The copper concentration in saliva and dental plaque fluctuate between individuals and depend

on the age, sex, nutrient intake, etc. [289-292]. Copper concentrations in saliva can range from

0.05-61.7 µM, whereas the numbers fluctuate between 26 and 1520 ppm within the plaque

biofilm. By administering copper-containing mouth rinses, copper has been shown to

dramatically influence the growth and pathogenicity of S. mutans [291]. In S. mutans strain GS-

5, copper irreversibly inhibited the activity of F-ATPases, thereby compromising the cell's ability

to carry out glycolysis in acidic environments [281]. Further, this cation was shown to modulate

S. mutans gtfD expression whose products are associated with soluble glucan production and

biofilm formation of S. mutans [280]. Like many Gram positive bacteria, S. mutans genome

sequence does not appear to encode proteins or enzymes that require copper for their functional

activity [277]. Even though copper is not required for its cellular processes, S. mutans must still

possess a functional copper-exporting machinery to avoid cell damage under excessive copper

concentrations.

Unlike Gram negative bacteria that traffic copper through different cellular compartments from

the cytosol to the periplasm and from the periplasm to the extracellular environment, Gram

positive bacteria possess rather simple copper homeostatic systems dedicated towards extrusion

of excess copper cations from the cytosol to the extracellular milieu [170]. The CopYABZ

copper homeostasis system of Enterococcus hirae is the best understood copper homeostasis

48

model in Gram positive bacteria [169-170, 293-294]. This operon encodes four proteins that

include two copper P-type ATPases, CopA and CopB, a copper responsive repressor, CopY, and

a copper-chaperone, CopZ [169, 293-294]. The CopZ family of metallo-chaperones is conserved

within various bacterial and eukaryotic systems [169-170]. A homologous copper transport and

resistance system, encoded by copYAZ, has been partially characterized in S. mutans strain

JH1005 [178]. The sensitivity of the copYAZ knockout mutant was shown to be specific to

copper and CopY was demonstrated to act as a negative regulator of the operon [178]. Although

not tested conclusively, CopZ was speculated to de-repress the cop operon activity and the

deficiency of copYAZ was shown to result in enhanced sensitivity to cell-killing under copper

stress [178].

Here we investigated the effects of copper on the physiology of S. mutans and the role of

CopYAZ in copper homeostasis. While previous studies have implicated metal cations in biofilm

formation and genetic competence development [295-297], the role of copper and the CopYAZ

in regulating these phenotypes is poorly understood in S. mutans. The ability of this organism to

adhere to hard surfaces and form a biofilm is an important virulence factor that is critical for its

survival and persistence in the oral cavity. Within the plaque biofilm, S. mutans is capable of

natural transformation that is made possible when it accomplishes a transient physiological state

referred to as genetic competence [147, 153]. Genetic transformation is important for acquiring

novel, heritable functions that can enhance fitness and drive evolution [151]. In S. mutans,

genetic competence is induced by two signaling peptides designated the competence-stimulating

peptide (CSP encoded by comC) and the comX-inducing peptide (XIP encoded by comS) [132,

142-143, 146]. Under specific competence-inducing conditions, both CSP and XIP can activate

the transcription of the master competence regulator encoded by the comX (or sigX) alternate

sigma factor required for the transcription of genes involved in DNA uptake and recombination

[132, 142-143, 146]. Notably, the S. mutans competence development pathway activated by CSP

and XIP is closely intertwined with its biofilm pathway [142, 145, 147, 298-299]. However, it

remains to be studied how and whether copper exerts its influence to regulate these phenotypes

via the putative CopYAZ copper transport system in S. mutans.

Herein, we showed that copper instigates a compromised state in S. mutans, by dissipating

membrane potential and decreasing its ability to endure environmental oxidative and pH stress,

49

produce biofilm, and develop genetic competence. Utilizing a copYAZ deletion mutant,

designated as ∆copYAZ, we validated the function of S. mutans CopYAZ in copper efflux. We

also report that the addition of copper or the absence of copYAZ system reduces the transcription

of genes involved in biofilm matrix production and genetic competence development; loss of

copYAZ leads to impairment of stress tolerance, transformability, and membrane potential in S.

mutans.

4.4 Material and methods

4.4.1 Strains and growth conditions

All S. mutans strains were grown in Todd-Hewitt yeast extract (THYE) (Becton Dickinson,

Sparks, MD) broth as standing cultures or on THYE with 1.5% (wt/vol) agar (Bioshop,

Burlington, Ontario, Canada) at 37°C in air with 5% (vol/vol) CO2. Tryptone yeast extract

medium (TYE) (10% Tryptone, 5% yeast extract, 17.2 mM K2HPO4) was utilized for the acid

tolerance response (ATR) assays (Tryptone was obtained from Bioshop, Burlington, Ontario,

Canada). For the ATR assays, NaOH or HCl was added to TYE to adjust the pH to 7.5 or 5.5 and

3.5, respectively. E. coli strains were cultivated aerobically in Luria Bertani (LB) medium at

37°C. Chemically defined media [132, 300] was used for transformation frequency assays.

Antibiotics were added whenever required in recommended concentrations: erythromycin

(10 µg/ml), chloramphenicol (10 µg/ml), spectinomycin (1000 µg /ml) for S. mutans and

ampicillin (100 µg/ml), chloramphenicol (20 µg/ml) for E. coli.

4.4.2 Minimum inhibitory concentration (MIC) assays

MIC assays were conducted as previously described [301]. Briefly, 100 µl of mid-log phase

bacterial cells adjusted to an OD600 of ~0.01 were added to a 96-well microtiter plate containing

THYE medium supplemented with two-fold serial dilutions of CuSO4 or CuCl2 (Sigma-Aldrich)

solutions (concentrations ranging from 0 to 25 mM), AgNO3 (1 to 100 µM), CdSO4 (0 to 1.5

µM), HgNO3 (0 to 10 µM), ZnCl2 (0 to 25 mM), MnCl2 (0 to 100 mM), or CaCl2 (0 to 100 mM).

After incubation at 37°C with 5% (vol/vol) CO2 for 24 h, bacterial growth was

50

spectrophotometrically measured by using a micro-titer plate reader at an absorbance of 600 nm.

The MIC was determined as the lowest concentration that inhibited visible cell growth relative to

no copper control.

4.4.3 Mutant and complemented strain construction

A deletion mutant (designated as ∆copYAZ) of the copYAZ (NCBI database gene annotation:

SMU_424, SMU_426, SMU_427) in S. mutans UA159 wild type background was constructed

for this study. Briefly, a knockout mutant was constructed using the PCR-ligation mutagenesis

strategy as described by Lau et al [302], by deleting the operon and inserting an erythromycin

resistance cassette at the locus in the UA159 background. The deletion of copYAZ operon in the

∆copYAZ strain was confirmed by PCR amplification, DNA sequencing and quantitative Real

Time PCR (qRT-PCR) analyses. The complementation analysis was done using E. coli copA

deficient mutant (designated as DW3110, obtained from the Keio collection). Complemented

strains of E. coli copA were constructed using the Thermo Scientific CloneJET PCR Cloning Kit

as per the manufacturer's instructions. Briefly, the S. mutans copYAZ was PCR amplified using

UA159 genomic DNA as the template, and ligated into the pJET vector. The vector was first

transferred into E. coli DH5α chemically competent cells (Invitrogen Subcloning Efficiency™

DH5α™ Competent Cells). The clones were selected on LB agar plates supplemented with

ampicillin (100 µg/ml) and confirmed using nucleotide sequencing. The resulting plasmid was

then transferred into chemically competent cells of the E. coli DW3110 mutant to obtain the

complemented strain DW3110compYAZ. Similarly, to generate a complemented strain in

S. mutans, similar PCR products were utilized and ligated into plasmid pIB166 [303] harbouring

a chloramphenicol resistance marker and a constitutive promoter upstream of a multiple cloning

site. The cloned vector with the entire copYAZ was transferred into the ∆copYAZ and the

resulting strain was designated as Comp∆copYAZ. Complementation with empty vector was

utilized as control (DW3110pJET or ∆copYAZpIB) (data not shown). Bacterial strains and

primers utilized in this study are summarized in Table 4-1and Table 4-2, respectively.

51

Table 4-1 Bacterial strains and plasmids used in this study

Strain Relevant characteristics Source or reference

UA159 S. mutans Wild type Erms J. Ferretti, University of Oklahoma

∆copYAZ In-frame copYAZ deletion mutants

derived from UA159; Ermr

This study

Comp∆copYAZ ∆copYAZ transformed with pIB-YAZ

Cmr, Ermr

This study

W3110 E. coli wild type Keio Collection

DW3110 W3110 ∆copA Keio Collection

DW3110compYAZ DW3110 transformed with pJET-copYAZ

Ampr, Emr

This study

Plasmid

pIB166 Shuttle plasmid containing the P23

lactococcal promoter; Cmr

[303]

pIB-YAZ S. mutans copYAZ fragment cloned into

pIB166 Cmr, Emr

This study

pJET Plasmid containing T7 promoter; Ampr Thermoscientific CloneJET PCR

Cloning Kit

pJET-copYAZ S. mutans copYAZ fragment cloned into

pJET Ampr, Emr

This study

pDL277 E. coli-Streptococcus shuttle vector,

Spr

[304]

52

Table 4-2 Primer Sequences used in this study

Primer Name Sequence Purpose

copY-For 5' CTTATTGCTGGTCCGCTTCAAC 3' qRT-PCR

copY-Rev 5' CGACACTTGCTGCTCTAATGCCTC 3' qRT-PCR

copA-For 5' GGGTCAATCAATGGTCAGGGAAG 3' qRT-PCR

copA-For 5' CAGCAATCTTGGCAATGGGTG 3' qRT-PCR

copZ-For 5' GACAATGTCACCAAACGC 3' qRT-PCR

copZ-For 5' TGGTTCCTTTCAGTGCTCG 3' qRT-PCR

GtfB-For 5′ ACACTTTCGGGTGGCTTG 3′ qRT-PCR

GtfB-Rev 5′ GCTTAGATGTCACTTCGGTTG 3′ qRT-PCR

GtfC-For 5′ CCAAAATGGTATTATGGCTGTCG 3′ qRT-PCR

GtfC-Rev 5′ TGAGTCTCTATCAAAGTAACGCAG 3 qRT-PCR

16SrRNA- For 5′ CTTACCAGGTCTTGACATCCCG 3′ qRT-PCR

16SrRNA- Rev 5′ ACCCAACATCTCACGACACGAG 3′ qRT-PCR

GbpB-For 5′ AGCAACAGAAGCACAACCATCAG 3′ qRT-PCR

GbpB-Rev 5′ CCACCATTACCCCAGTAGTTTCC 3′ qRT-PCR

copYAZ P1 5' AGTATGTTTGTAGTCAGTTGCG 3' Gene Deletion

copYAZ P2 5' GCGCGCCTAATCGTTGAAGCGGACC 3' Gene Deletion

copYAZ P3 5' GGCCGGCCCAGGAAATCCAAGCAAGTGG 3' Gene Deletion

copYAZ P4 5' ATACCAGACTCGCATCATAAGC 3' Gene Deletion

Ermcst- F 5′ GCGCGCCCCGGGCCCAAAATTTGTTTGAT 3′ Gene Deletion

Ermcst- B 5′ GCCGGCCAGTCGGCAGCGACTCATAGAAT 3′ Gene Deletion

compForE 5' GAATTCGAATTCAATGTAGATGAAAGGAGC 3' Cloning in

pIB166

compRevX 5' CTCGAGCTCGAGGGTATATGAAGCCTACTT 3' Cloning in

pIB166

compRevX 5' CTCGAGCTCGAGGGTATATGAAGCCTACTT 3' Cloning in pJET

compForP 5' CTGCAGCTGCAGAATGTAGATGAAAGGAGC 3' Cloning in pJET

53

4.4.4 Biofilm assays

Biofilms were cultivated in 96-well polystyrene microtiter plates using ¼THYE media

supplemented with 10 mM sucrose and varying concentrations of CuSO4 or CuCl2 (0, 100 µM,

250 µM, 500 µM, 1 mM, 2 mM, 5 mM). All wells were inoculated with overnight cell

suspensions of S. mutans wild-type and mutant strains and the plates were incubated for 24 h at

37°C with 5% (vol/vol) CO2. Following incubation, broth was carefully removed and the

biofilms were stained with 0.01% (wt/vol) safranin to determine the relative biomass, as

previously described [305]. For biofilm initial adhesion studies, cells (20µl of mid-logarithmic

cells) were incubated in 12-well polystyrene microtiter plates containing 2 ml ¼-THYE media

supplemented with 10 mM sucrose and varying concentrations of CuSO4 (0, 500, 1000 µM). The

plates were incubated for different time intervals, and the planktonic cells were removed.

Attached cells were washed twice with 1× phosphate buffered saline (PBS) solution before being

scraped from plates and re-suspended in 200 µl of PBS. Cells were briefly sonicated, serially

diluted in 10-fold decrements in 1× PBS, and 20 µl of each dilution was spotted in triplicates on

THYE agar plates. After 48 h of incubation, colonies were counted for the dilutions showing

individual colonies (30-300 in number), and the percentage of cells attached/able to grow were

calculated between the presence and absence of copper.

4.4.5 Acid tolerance response (ATR) assays

ATR assays were conducted as previously described [109]. Briefly, overnight cultures grown in

THYE media were diluted 1:20 using sterile pre-warmed tryptone-yeast extract media at pH 7.5

supplemented with 1% (wt/vol) glucose (TYEG). Cultures were then grown until mid-

logarithmic phase (optical density at 600 nm [OD600], ∼0.4), divided into two equal aliquots and

pelleted via centrifugation. For non-adapted cells, one aliquot was re-suspended in TYEG at a

lethal pH value of 3.5, and for adapted cells, the other aliquot was first re-suspended in TYEG at

pH 5.5 and incubated at 37°C with 5% CO2 for 2h before exposing them to lethal pH 3.5.

Following incubation at 37°C with 5% CO2, cell fractions were removed from cultures at time

zero and after 2h. Cells were gently sonicated, serially-diluted in 10 mM potassium phosphate

54

buffer (pH 7.2) and spotted in triplicate (20 μl of each dilution) onto THYE agar plates. After

incubation for 48 h, colony forming units (CFUs) were counted and ATR was calculated as the

percentage of CFU obtained at lethal pH after 2 h relative to the number of CFU present at time

zero.

4.4.6 Growth kinetic analysis

For growth kinetic assays, S. mutans strains were grown in THYE with varying concentrations

of CuSO4 or CuCl2, paraquat (0, 5 mM, 10 mM, 25 mM, 50 mM) or hydrogen peroxide (H2O2)

(0, 0.0015%, 0.003%, 0.0045%, 0.006% (v/v)). Overnight cultures of S. mutans strains were

diluted 1:20 in fresh THYE medium, and grown till mid-logarithmic phase (O.D ~ 0.4). 20 µl of

cell inocula was added to 350 µl THYE containing varying concentrations of test reagents in

quadruplicate. Cells were incubated at 37°C for 24 h; non-inoculated wells and wells containing

THYE medium with or without reagents alone were used as controls. No antibiotics were used in

growth assays to avoid additional stress. The optical density readings were taken every 20 min

using an automated growth reader workstation (Bioscreen C, Growth Curves USA) and were

plotted over time to obtain growth curves.

4.4.7 Copper transport assays

Overnight cultures grown in THYE were diluted 1:20 and suspended in fresh media

supplemented with or without 1 mM CuSO4 or CuCl2 (suspended in milliQ water). Samples were

incubated at 37°C with 5% CO2 till they reach mid-logarithmic phase (OD600 0.4-0.6). Following

incubation, cells were harvested by centrifugation at 3800×g. To minimize the probability of

measuring membrane-associated copper cations, cells were washed twice with 0.01 M NaClO4,

an experimental electrolyte previously shown to remove residual metal from media and bacterial

surfaces [306]. Cells were re-suspended in ice cold 1× PBS and filtered through a 0.22-µm-pore-

size nitrocellulose filter. The filter was washed twice with 1 ml of ice-cold 1× Tris-EDTA buffer

and once with 1 ml of ice-cold milliQ water. The filter was digested with 4% HNO3 followed by

55

inductively coupled plasma atomic emission spectroscopic (ICP-AES) analysis using the

ANALEST facilities (Analytical Lab for Environmental Science Research and Training) at

University of Toronto. A 100 mg/ml CuSO4 or CuCl2 (suspended in 4% HNO3 in milliQ water)

stock solution was used to prepare standards ranging from 3 µg/ml to 100 µg/ml for ICP-AES

calibration. A standard curve was plotted and utilized to analyse the intracellular copper

concentrations. No detectable amounts of copper were observed in THYE or LB media alone.

The measured intracellular copper concentrations were normalized per mg dry weight of cells.

4.4.8 Quantitative real time PCR Assays

Total RNA was isolated from 18-h-old biofilms grown in the presence or absence of 500 µM

CuSO4 in ¼ THYE media supplemented with 10 mM sucrose. Due to its poor biomass

production, higher numbers of wells (three-times the number of wild type) were inoculated to

isolate RNA from 18-h-old biofilms of the ∆copYAZ grown in the presence of copper. The

planktonic cells were removed and the biofilm cells were washed with 1× PBS. The biofilm cells

were scraped from the polystyrene surface and suspended in ice-cold 1× PBS. Cells were

sonicated and collected after centrifugation at 3800×g. For expression analysis of the genes

associated with the competence regulon, cells were cultivated in chemically defined media

(CDM) [132, 300] at 37°C with 5% CO2, until they reached mid-logarithmic growth phase. Cells

were then treated with 100 µM CuSO4 for 30 min. For expression analysis of the genes

associated with acid stress, mid-logarithmic cells cultivated in THYE were treated with 500 µM

CuSO4 for 30 min. Total RNA was harvested from the cell pellets as previously described [307].

After DNAse treatment, RNA was subjected to reverse transcription using the First Strand cDNA

Synthesis Kit (Fermentas). Quantitative Real Time PCR analyses were conducted using the

Quantitect SYBR-Green PCR kit (Qiagen, Mississauga, Ontario, Canada). The fold expression

change was calculated according to the method of Pfaffl et al. [308-309] using the following

formula: Fold change = [Efftarget gene (Ct-control- Ct-experimental)]/ [Eff16S rRNA (Ct-control- Ct-experimental)].

Where E = (10-1/slope) represents the efficiency of gene amplification and Ct values are the

threshold cycle values of the target gene [301, 307]. Results were normalized against S. mutans

16S rRNA or gyrA expression; expression of these house-keeping genes was found stable under

56

the test conditions (data not shown). Statistical analysis was conducted using a Student’s t-test

and a P value of <0.05 was considered significant. Primers utilized are listed in Table S1.

4.4.9 Membrane potential assays

Overnight S. mutans cultures were diluted 1:20 in fresh THYE and cells were grown to mid-

logarithmic phase before washing and re-suspending them in minimal media [310] or in 1× PBS

supplemented with 25 mM glucose. The membrane potential assays were conducted by

measuring the florescence intensity of an anionic dye DiSBAC3- using the Five Photon kit

manufacturer’s protocol. As bis-oxonol is a lipophilic anionic molecule, the dye accumulates in

the cell upon membrane depolarization, where it binds to intracellular components and results in

an increase in cytosolic bis-oxonol fluorescence intensity. After incubating the cells with dye for

10 min, fluorescence was measured using the TECAN fluorescence plate reader (excitation

wavelength of 530 nm, emission wavelength of 560 nm) and the fluorescence intensity was

expressed as Arbitrary Units (AU). After dye stabilization 1 mM CuSO4 was added. The plate

conditions were set at 37°C with shaking for 5 sec before every read and fluorescence intensity

measurements were taken every 15 min for at least 6 h. carbonyl cyanidem-

chlorophenylhydrazone (CCCP), a known membrane depolarizer, was used as a positive control,

wherein the addition of 10 µM CCCP resulted in an immediate increase in fluorescence intensity.

Change in membrane potential (ΔΨ, expressed as AU) was taken as the difference between the

fluorescence value at a specific time point (every 15 min) of incubation (Ψf) and the initial

stabilization value (Ψi). To control for the dye’s intensity change, Ψc (culture sample) was

normalized with Ψb (blank with dye). Statistical analysis was conducted using a Student’s t-test

with a P value of <0.05 considered as significant.

4.4.10 Genetic transformation assays

Overnight cultures of S. mutans grown in THYE were pelleted, washed, diluted (1:20) and re-

suspended in chemically defined media [132, 300]. Cultures were allowed to grow at 37°C with

57

5% CO2 to mid-logarithmic growth phase (OD600 of ~ 0.4). Cultures were then divided into

three aliquots and treated with: 1) no copper; 2) 100 µM CuSO4 and 3) 250 µM CuSO4. The

copper concentrations used were based on the MICs calculated in the CDM media: S. mutans

UA159: 1000 µM and ∆copYAZ: 500 µM CuSO4. Next, 1 µg of plasmid DNA (pDL277,

containing a spectinomycin resistance marker) was added to 500 µl aliquots of cell suspensions

and incubated in 5% CO2 at 37°C for 90 min. Following incubation, samples were briefly

sonicated, serially diluted, and plated onto THYE agar, with and without spectinomycin, to

determine the number of transformants and the total number of possible viable cells,

respectively. Transformation frequency was calculated as the percentage between transformant

CFUs and total number of viable CFUs, times 100. Statistical analysis was conducted using a

Student’s t-test with a P value of <0.05 considered as significant.

58

4.5 Results

4.5.1 Copper is toxic to S. mutans and copYAZ is required for copper

resistance in S. mutans

To investigate the physiological function of the copYAZ operon in S. mutans, an isogenic mutant,

designated ∆copYAZ, was constructed and characterized in vitro. Growth kinetics and minimum

inhibitory concentration (MIC) were assessed using the wild type and mutant strain under

varying concentrations of CuSO4 solutions. A two-fold decrease in the MIC was observed in the

∆copYAZ (2 mM CuSO4) as compared with the UA159 strain (4 mM CuSO4) under copper stress

(P <0.05). At higher concentrations (≥ 6 mM for ∆copYAZ and ≥ 12 mM for UA159), copper had

a bactericidal effect on S. mutans viability. Complementation studies conducted with the

Comp∆copYAZ (∆copYAZ harboring pIB-YAZ) strain showed restoration of copper-dependent

growth inhibition to levels observed with the UA159 wild-type strain (MIC of 4 mM CuSO4; P

<0.05). Growth assays conducted with the wild-type, ∆copYAZ and Comp∆copYAZ strains

revealed that exposure to added copper resulted in growth impairment of all strains and that loss

of the copYAZ resulted in enhanced toxicity to copper, relative to wild-type and complemented

strains (Figure 4-1and Figure 4-2). To validate that effects observed in growth assays were due to

copper cations the experiments were repeated with CuCl2 which showed a similar influence on S.

mutans growth as observed with CuSO4. In addition, we performed growth inhibitory assays for

wild-type and ∆copYAZ in the presence of varying concentrations of other metal ions that

included Ag, Cd and Hg; MICs for these assays did not reveal statistically relevant differences

(MICs 100 µM, 1.5 µM, 6 µM respectively for Ag, Cd and Hg). Hence, these results highlighted

the importance and specificity of the CopYAZ system in copper-induced toxicity in S. mutans.

59

0

0.2

0.4

0.6

0.8

1

1.2

0 100 200 300 400 500 600 700 800 900 1000 1100

Abso

rban

ce (6

00

nm

)

Time (minutes)

Figure 4-1 Growth analysis in the presence and absence of copper

Growth analysis of S. mutans strains cultivated in the presence or absence of 2 mM CuSO4.

Results are representative of six independent experiments conducted with duplicates for each

strain. ■ indicate S. mutans wild type strain, ▲ indicate ∆copYAZ, and ● indicate

comp∆copYAZ; solid-filled indicate strains grown in the absence of CuSO4, and hollow icons

indicate strains grown in the presence of 2 mM CuSO4.

Time (min)

60

0

0.2

0.4

0.6

0.8

1

1.2

0 200 400 600 800 1000

Ab

sorb

an

ce (

60

0 n

m)

Time (min)

UA159 0 mM

CuSO4

UA159 0.5 mM

CuSO4

UA159 1 mM

CuSO4

∆copYAZ 0 mM

CuSO4

∆copYAZ 0.5 mM

CuSO4

∆copYAZ 1 mM

CuSO4

Figure 4-2 Growth kinetics under copper stress

S. mutans UA159 and ∆copYAZ strains cultivated under varying concentrations of CuSO4.

Results are the representative of six independent experiments conducted with duplicates for each

strain.

61

4.5.2 CopYAZ has a role in copper export in S. mutans

In several Gram positive bacteria CopA functions in copper export. Copper transport studies,

using ICP-AES analysis, revealed that S. mutans UA159 grown in the presence of 1 mM CuSO4

had a significantly high amount of intracellular copper (Figure 4-3) as compared to those grown

without copper supplementation (no detectable amount of intracellular copper). A two-fold

increase in the amount of intracellular copper was observed in the ∆copYAZ compared with the

wild type strain (Figure 4-3; P<0.05), thus suggesting the involvement of copYAZ in copper

efflux in S. mutans. In the wild type and ∆copYAZ strains, transport studies conducted with Ag

and Mn cations (using 50 µM AgNO3 or 1 mM MnCl2) showed no statistically significant

differences in the intracellular levels of these cations. This latter result support the specificity of

the CopYAZ transport system to copper cations, which was further validated using the CopYAZ

complemented Comp∆copYAZ strain whose ability to efflux copper at levels comparable to the

wild type parent (Figure 4-3). In the complementation experiments, we employed an E. coli

strain deficient in copA (DW3110), which exhibits a defect in copper efflux and its detoxification

[212]. The recombinant S. mutans copYAZ operon successfully complemented the deficiency in

DW3110, as observed by a significantly decreased sensitivity to copper-induced killing, and

reduced intracellular copper ion accumulation (Figure 4-4A and Figure 4-4B); thus supporting a

specific function for the S. mutans CopYAZ in copper transport and resistance.

62

-1

0

1

2

3

4

5

6

7

8

9

0 1000

Intr

acel

lula

r C

op

per

Co

nc(

ug

/ml)

/ D

ry w

eig

ht

(mg

)

CuSO4 treated (µM)

UA159

∆copYAZ

Comp∆copYAZ

* *

Figure 4-3 Role of CopYAZ in copper export

Intracellular copper concentration normalized to dry weight of cells of S. mutans wild type

UA159 (■ bar), ∆copYAZ (■ bar), and comp∆copYAZ ( bar). Cells were grown in the presence

or absence of 1 mM CuSO4 until the mid-logarithmic growth phase. Cells were lysed and

intracellular copper concentration was normalized with cell dry weight. Results shown here are

the mean values obtained from three independent experiments ± standard error (*P <0.05).

63

0

10

20

30

40

50

0 1000

Intr

acel

lula

r C

op

per

C

onc(

ug

/ml)

/Dry

wei

ght

(mg

)

CuSO4 treated (µM)

W3110

DW3110

DW3110compYAZ

* *

Figure 4-4 Growth kinetics and transport studies using E. coli strains

A) E. coli strains cultivated in the presence or absence of 2 mM CuSO4. Results are

representative of six independent experiments conducted with duplicates for each strain. Legend:

squares indicate wild type, triangles indicate cop mutant, circles indicate complemented strain of

E. coli strains, solid-filled indicate strains grown in the absence of CuSO4, and hollow icons

indicate strains grown in the presence of 2 mM CuSO4. B) Intracellular copper concentration

normalized to dry weight of cells of E. coli wild type W3110 (black bar), DW3110 (grey bar),

and DW3110compYAZ (white bar) was quantified using ICP-AES. No copper was detected in

cells with no copper treatment. Results shown here are the mean values obtained from three

independent experiments ± standard error (*P <0.05).

Absorbance (

600

nm)

Time (minutes)

64

4.5.3 Copper inhibits biofilm formation and copYAZ is required to

tolerate copper stress under biofilm growth.

Both the wild type and ∆copYAZ strains produced comparable biomass in 18-h biofilms grown

in the absence of copper. A significant reduction of biofilm biomass was observed in ∆copYAZ

biofilms cultivated with 500 µM CuSO4 relative to the wild type (Figure 4-5A). Biofilm biomass

was drastically reduced at 1 mM CuSO4 in both wild type and mutant strains (Figure 4-5A).

0

20

40

60

80

100

120

0 500 1000

Bio

film

Bio

mas

s (%

)

CuSO4 (µM)

UA159

ΔcopYAZ

A*

*

**

1

10

100

0 500 1000

Cel

l Ad

her

ence

Per

centa

ge

(%)

CuSO4 (µM)

UA159

∆copYAZ

B

**

*

*

*

*

Figure 4-5 Effect of copper on biofilm formation

A) Biomass of 18-h biofilms derived from wild type UA159 (■ bars) and ∆copYAZ (■ bars)

strains grown in the absence or presence of CuSO4. Results shown represent the mean values

obtained from three independent experiments with three replicates for each strain ± standard

error (*P <0.05). B) Percentage of the cells adhered to the surface after 1 h incubation using

UA159 (■ bars) and ∆copYAZ (■ bars) in the presence of varying concentrations of CuSO4

relative to no copper. Results shown represent the mean values obtained from three independent

experiments with three replicates for each strain ± standard error (*P <0.05).

65

Initial cell attachment assays were conducted to evaluate the percentage of cells attached to a

surface in the presence or absence of copper for different time intervals. At 1 h incubation, the

percentage of cells adhered in the presence of 500 µM CuSO4 was significantly reduced in both

wild type (~50 % decrease) and ∆copYAZ strains (~80 % decrease) relative to the no copper

control (Figure 4-5B). At 1 mM CuSO4, further reduction in the percentage of cells adhered was

observed in both wild type and mutant strains. After prolonged incubation of 2 h or 4 h, no

significant decrease in the number of cells adhering to surface was observed in wild type strain at

500 µM CuSO4. However, the ∆copYAZ cultivated in the presence of copper showed a

significant reduction in the number of cells attached relative to the no copper control at all time

periods (Figure 4-6). Results from these experiments showed that the addition of copper and

deletion of the copYAZ operon reduced the ability of cells to adhere likely leading to defective

biofilms.

66

0.1

1

10

100

0 500 1000

Cel

l Ad

her

ence

Per

centa

ge

at 4

h (

%)

CuSO4 (µM)

UA159

∆copYAZ

B

*

*

1

10

100

0 500 1000

Cel

l Ad

her

ence

Per

cen

tage

at 2

h (

%)

CuSO4 (µM)

UA159

∆copYAZ

A

*

*

Figure 4-6 Cell adherence assays

Percentage of the cells (log scale) adhered to the polystyrene surface after A) 2h and B) 4h

incubation using UA159 (black bars) and ∆copYAZ (grey bars) in the presence of varying

concentrations of CuSO4 relative to no copper. Results shown represent the mean values obtained

from three independent experiments with three replicates for each strain ± standard error (*P

<0.05).

67

4.5.4 Copper affects the transcription of gtfs and glucan binding

protein (gbp) genes.

To assess the underlying molecular mechanism associated with copper-mediated reduced cell

adherence and reduced biofilm biomass of S. mutans, we examined the effects of copper on the

transcription of gtfs (gtfB, gtfC, gtfD) and gbps (gbpB and gbpC) whose products are needed to

maintain the structural and functional integrity of the S. mutans biofilm [63, 116-117, 119, 124,

127]. Gene expression analysis using qRTPCR of biofilm-derived cDNAs with or without of 500

µM CuSO4 demonstrated a significant ≥ 2-fold down-regulation of all five genes (P < 0.05) in

the presence of copper relative to the no copper control (Figure 4-7). In the absence of copper,

the transcription of gtf and gbp genes was not significantly affected between ΔcopYAZ and wild

type biofilms (data not shown). Furthermore, in the presence of copper an enhanced

transcriptional repression of gtfC, gtfD, gbpB and gbpC was observed in ΔcopYAZ biofilms

relative to those of the wild-type strain. In S. mutans, the negative regulatory role of copper on

the transcription of the gbp genes- whose products facilitate biofilm cell adherence, as well as the

gtfs- whose products are responsible for glucan production that maintain the integrity of the

biofilm matrix, might explain the impaired biofilms observed under copper stress.

68

-5.00

-4.00

-3.00

-2.00

-1.00

0.00

gtfC gbpB gtfB gtfD gbpB

No

rmal

ized

Fo

ld E

xpre

ssio

n

rela

tiv

e to

no

cop

per

co

ntr

ol

UA159

∆copYAZ

Figure 4-7 Gene expression analysis of different biofilm matrix-related genes

S. mutans UA159 (■ bars) and ∆copYAZ (■ bars) treated with 500 µM CuSO4 relative to no

copper control. Results shown represent the mean values obtained from four independent

experiments with three replicates for each strain ± standard error (*P <0.05 for all the genes

shown in the graph).

4.5.5 Copper-induces oxidative stress and CopYAZ modulates oxidative

stress tolerance.

The copper-induced growth inhibition was assessed in the presence of the antioxidants,

glutathione and thiourea. Addition of 1.5 mM glutathione dramatically improved the growth of S.

mutans UA159, ΔcopYAZ, and compΔcopYAZ strains cultivated in the presence of 2 mM CuSO4

compared to no added glutathione control (Figure 4-9A). Treatment with glutathione in the

absence of copper did not alter the growth of S. mutans strains used in this study (Figure 4-8).

The reversion of copper-induced growth defects was also observed in the presence of the

antioxidant thiourea. These results emphasize that copper-induced toxicity in S. mutans is likely

dependent on copper-dependent generation of oxidative stress in S. mutans. Biofilms were also

assessed to study the effect of glutathione (or thiourea) in reversal of the copper-induced biofilm

defect by cultivating 18 h biofilms in the presence or absence of copper supplemented with or

69

without 1.5 mM glutathione. Glutathione alone did not have any effect on the biofilm biomass of

all three strains tested. Addition of 1.5 mM glutathione did not improve the biomass production

of the biofilms cultivated in the presence of 500 µM or 1 mM copper in S. mutans UA159,

ΔcopYAZ, and compΔcopYAZ strains. These results suggest that S. mutans can utilize an alternate

route to contend with copper stress during biofilm growth.

0

0.2

0.4

0.6

0.8

1

1.2

Ab

sorb

an

ce (

60

0 n

m)

Time (min)

UA159 THYE

UA159 with Glutathione

∆copYAZ THYE

∆copYAZ with Glutathione

Comp∆copYAZ THYE

Comp∆copYAZ with Glutathione

Figure 4-8 Growth Kinetics in the presence and absence of glutathione

S. mutans UA159, ∆copYAZ and comp∆copYAZ grown in the presence of the 1.5mM

glutathione. Results are the representative of six independent experiments conducted with

duplicates for each strain.

70

A

B

0.0

0.2

0.4

0.6

0.8

1.0

1.2

0 100 200 300 400 500 600 700 800

Abso

rban

ce (600nm

)

Time (mins)

0

200

400

600

800

1000

1200

Control Paraquat

Lag

tim

e (m

in)

UA159

∆copYAZ

Comp∆copYAZ

H2O2

* *

*

*

* *

Figure 4-9 Copper-induced oxidative stress, and involvement of CopYAZ in protection

against oxidative stress

A) Growth curves of wild type UA159 (■), ∆copYAZ (■), and comp∆copYAZ ( ) strains in the

presence of 2mM CuSO4 copper with (� ) or without (ο) 1.5mM glutathione. Results are

representative of six independent experiments conducted using duplicate samples for each strain.

B) Lag times of UA159 (■ bars), ∆copYAZ (■ bars), and comp∆copYAZ ( bars) to reach an

OD600 of nearly 0.1 in the presence and absence of the oxidative stressors paraquat (25 mM)

paraquat and H2O2 (0.0045%). The top two lines indicate the statistical significant results within

the strains under different stressors. Results are the mean of three independent experiments

conducted with three replicates for each strain (* P <0.001).

71

We next investigated the role of copYAZ in protecting the cells against oxidative stress. Growth

kinetics analyses were performed using wild type UA159, ΔcopYAZ and compΔcopYAZ strains

in the presence of the oxidizers methyl viologen dichloride (paraquat) or hydrogen peroxide.

Though all strains cultivated in the presence of either paraquat or hydrogen peroxide reached a

comparable final optical density after 24 h (Figure 4-10A and Figure 4-10B), the lag growth

phase of ΔcopYAZ was drastically prolonged relative to wild type (Figure 4-9B), thereby

suggesting a role of the efflux system in protecting cells under oxidative stress. In the

complementary CompΔcopYAZ strain, the lag phase in the presence of oxidative stressors was

restored to that of wild type levels.

72

0.0625

0.125

0.25

0.5

1

0 200 400 600 800 1000

Ab

sorb

an

ce (6

00

nm

)

Time (min)

UA159

∆copYAZ

Comp∆copYAZ

B

0.05

0.1

0.2

0.4

0.8

0 200 400 600 800 1000

Ab

sorb

an

ce (6

00

nm

)

Time (min)

UA159

∆copYAZ

Comp∆copYAZ

A

Figure 4-10 Growth kinetics under oxidative stressors

S. mutans UA159, ∆copYAZ and comp∆copYAZ grown in the presence of the oxidative stressors

A) paraquat (25 mM) and B) H2O2 (0.0045%). Results are the representative of six independent

experiments conducted with duplicates for each strain.

73

4.5.6 Copper inhibits growth under acid stress and CopYAZ modulates

the acid tolerance response of S. mutans

Previous reports indicate that cuprous ions added to S. mutans strain GS-5 cultures can

irreversibly inhibit the activity of F-ATPases, thereby compromising its ability to carry out

glycolysis in acidic environments [281]. Here, growth kinetic analyses were performed in the

presence and absence of copper in neutral and acidic pH using wild type UA159, ∆copYAZ, and

Comp∆copYAZ strains. Although the ∆copYAZ strain displayed similar doubling times relative to

wild type under acid (pH 5.5) or copper (1 mM CuSO4) stress, the doubling times and the yield

of the ∆copYAZ was markedly impaired in THYE at pH 5.5 supplemented with 1 mM CuSO4

(Figure 4-11 and Figure 4-12). The combined effect of acid and copper stress caused an

approximate two- and five-fold increase in the doubling times of S. mutans UA159 and ∆copYAZ

respectively, compared to their growth in the presence of either of these stressors alone (Figure

4-12).

74

0.06

0.12

0.24

0.48

0.96

0 200 400 600 800 1000 1200

Ab

sorb

an

ce (6

00

nm

)

Time (min)

Comp∆copYAZ pH 5.5 Comp∆copYAZ pH 5.5 + 1mM CuSO4

UA159 pH 5.5 UA159 pH 5.5 + 1mM CuSO4

∆copYAZ pH 5.5 ∆copYAZ pH 5.5 + 1mM CuSO4

Figure 4-11 Growth of S. mutans under acid stress with or without copper

Growth curves of S. mutans UA159, ∆copYAZ, and comp∆copYAZ strains in the presence of acid

(pH 5.5) and/or copper (1 mM CuSO4) stress.Results are representative of six independent

experiments with duplicate samples for each strain.

75

0

100

200

300

400

500

pH 7.5 pH 5.5 pH 7.5 + 1 mM

CuSO4

pH 5.5 +1 mM

CuSO4

Do

ub

lin

g T

ime

(min

s)

UA159

∆copYAZ

Comp∆copYAZ

*

CuSO4 CuSO4

*

*

Figure 4-12 Doubling times under acid stress with or without copper

Evaluation of S. mutans doubling time in the presence of various stressors using wild type

UA159 (black bars), ∆copYAZ (grey bars), and comp∆copYAZ (light grey bars). Results are the

mean of three independent experiments with duplicate samples of each strain ± standard error

(*P <0.05).

76

These results emphasize the synergistic effects of copper and acid against S. mutans growth. The

increased susceptibility of the ∆copYAZ strain under acid and copper stress can be due to 1)

surplus accumulation of copper ions, or 2) lack of cellular protection offered by the CopYAZ

copper efflux system. To examine the importance of copYAZ in the acid adaptation process, we

conducted acid tolerance response (ATR) assays. Not surprisingly, for all the three tested strains

the percentage survival of adapted cells (which were previously subjected to pH 5.5) was higher

than that for non-adapted cells (which were maintained at pH 7.5). The loss of copYAZ decreased

the ability of S. mutans to survive the pH 3.5 challenge regardless of pre-acid adaptation, relative

to wild type (Figure 4-13). No significant difference in the percentage survival at pH 3.5 was

observed between the Comp∆copYAZ and wild type strains under either non-adapted or pre-

adapted conditions, thereby demonstrating that copYAZ contributed to ATR response in

S. mutans.

0.001

0.01

0.1

1

10

100

UA159 ∆copYAZ Comp∆copYAZ

Per

cen

tag

e S

urv

ival

(%

)

Non Adapted

Adapted*

*

*

*

Figure 4-13 Acid tolerance response assays

Percentage survival (in log scale) of S. mutans cells after 2 h incubation at lethal pH 3.5. Cell

were either exposed (adapted cells- ■ bars) or not (non-adapted cells- ■ bars) for pre-adaptation

at signal pH of 5.5. Results shown are the mean values obtained from three independent

experiments ± standard error (*P <0.05).

77

Previously, copper has been shown to reduce the activity of F-ATPase in S. mutans [281]. Hence

we examined the role of copper on the transcription of acid stress-related genes that include

components of the S. mutans F0F1 ATPase (SMU.1530 (atpD), SMU.1531 (atpE), SMU.1532

(atpF), SMU. 1534 (atpH)), and uvrA, a DNA damage repair gene, which is induced under acid

stress [311]. Expression of genes was not significantly affected between the wild type strain

cultivated in the presence and absence of copper. However, in ΔcopYAZ, the transcription of

uvrA was significantly down-regulated by more than 2-fold (P <0.05) and 3.6-fold (P <0.05)

incubated with and without copper respectively, relative to the wild type strain. A significant 2.2-

fold reduction (P <0.05) in the expression of atpH was observed in ΔcopYAZ in the presence of

copper relative to control without copper. Studies are currently underway to analyze the impact

of copper and copYAZ operon on the acid-inducible regulon of S. mutans that is responsible

for the observed acid-sensitive phenotype in this oral pathogen.

4.5.7 Copper induces membrane depolarization and CopYAZ helps

maintain membrane potential.

In E. coli and Salmonella sp., contact-killing on copper surfaces involves immediate membrane

depolarization, subsequently leading to compromised cell viability [283]. To test whether copper

and CopYAZ modulate S. mutans membrane potential, we conducted fluorometric assays with

bis-oxonols dyes, which can enter depolarized cells and bind intracellular proteins or

membranes. Higher fluorescence intensity, as a result of elevated influx of the dye, indicates

increased membrane depolarization. In S. mutans, addition of copper initiated a gradual increase

in the fluorescence intensity, which was maximal after 15 min of incubation relative to the no

copper control (Figure 4-14A). The increase in fluorescence intensity suggested that copper

influx induced a dissipation of the membrane potential. The S. mutans ∆copYAZ cells exhibited a

depolarized membrane phenotype, where the cells cultivated even in the absence of copper,

showed a gradual and sustained increase in the DiSBAC3-dependent fluorescence intensity,

compared with wild type (Figure 4-14B). Furthermore, restoration of the fluorescence intensity

in the complemented Comp∆copYAZ strain to the wild type levels provided additional evidence

for the involvement of this operon in S. mutans membrane depolarization. In membrane potential

78

assays, CCCP was used as a positive control; the addition of 10 µM CCCP resulted in an

immediate increase in fluorescence intensity, as a result of instant membrane depolarization (∆ѱ

units exceeding over 2-fold compared to no CCCP control).

79

-400

-300

-200

-100

0

100

200

300

400

500

0 15 30 45

∆ѱ

(A

rbit

rary

Uni

ts F

luor

esce

nce)

Time (mins)

UA159

∆copYAZ

Comp∆copYAZ

-800

-400

0

400

800

1200

1600

UA159 ∆copYAZ Comp∆copYAZ

∆ѱ

(A

rbit

rary

Uni

ts F

luor

esce

nce)

No

1 mM CuSO4

CuSO4

A

B

* *

*

*

*

*

*

Figure 4-14 Membrane potential in cells exposed to copper

Changes in membrane potential of S. mutans strain measured using a bis-oxonol probe over

45 min. A) Fluorescence intensity of cells with 15 min incubation in the absence (■ bars) or

presence (■ bars) of 1 mM CuSO4. Statistical significance was calculated using a Student's t-test

at each time point (* P < 0.05). B) Fluorescence intensity of wild type UA159 (), ∆copYAZ

(), and comp∆copYAZ () in the absence of copper over a period of 45 min. Data shown are

the mean of four independent experiments ± standard error. Statistical significance was observed

at each time point between the ∆copYAZ and other two strains (P < 0.05).

80

4.5.8 Addition of copper and loss of copYAZ alters transformability of

S. mutans

Genetic transformation assays were conducted to investigate the effect of copper on genetic

competence development of S. mutans. These assays were conducted in two different growth

media, namely THYE and CDM, which activate separate competence induction pathways via the

CSP-activated ComDE and XIP-activated ComRS signaling pathways, respectively ([132, 148].

When supplemented with 10µM, 100 µM, 250 µM, 500 µM or 1 mM CuSO4, UA159 and

∆copYAZ strains grown in THYE, which is a peptone-abundant nutrient rich medium, a five-fold

decrease in transformation frequency was observed in the wild type strain only at the 1 mM

CuSO4 relative to controls without copper (P <0.05; data not shown). In the ∆copYAZ mutant

transformability was significantly reduced by over 10-fold relative to wild type, irrespective of

copper supplementation (data not shown). The effects of copper on transformability were

stronger when cells were grown in CDM medium. For instance, in CDM medium a 20-fold

reduction in transformation frequency was observed in both the wild type and ∆copYAZ strains in

the presence of 100 µM CuSO4 relative to the no copper control (P <0.05; Figure 4-15).

Furthermore, in the presence of copper, we noted that transformability of wild type and mutant

strains were significantly reduced in a dose-dependent manner (Figure 4-15); our comparison of

viable recipient cells between these strains, showed that total cell viability was not affected under

these copper concentrations for UA159 and ∆copYAZ strains (Figure 4-16). Also interestingly,

loss of the copper efflux system in the ∆copYAZ strain impaired its transformability by over 30-

fold relative to wild type (P<0.05), even in the absence of the copper stress (Figure 4-15). To

argue against the possibility of this transformation defect arising due to copper-mediated plasmid

DNA damage, we conducted transformation assays by utilizing cells pre-incubated with copper.

These cells were washed to remove exogenous or cell-associated copper and then supplemented

with fresh medium containing plasmid DNA. A similar decrease in genetic transformation was

observed in the presence of copper relative to the no copper control, thereby confirming that the

defect in genetic transformation was indeed due to copper present within the cells (data not

shown).

81

1.00E-06

1.00E-04

1.00E-02

1.00E+00

0 100 250

Tra

nsf

orm

atio

n f

req

uen

cy (

%)

CuSO4 (µM)

UA159

ΔcopYAZ

*

*

*

*

*

*

*

Figure 4-15 Transformation frequency assays

Transformation frequency assays were conducted using S. mutans UA159 (■ bar) and ∆copYAZ

(■ bar) strains in the presence of varying concentrations of copper. The transformation frequency

was calculated as the percentage between transformants and recipients cells (log scale). Results

are mean of three independent experiments conducted in triplicates. (* P <0.05)

82

1.0E+04

1.0E+06

1.0E+08

0 100 250

CF

Us

of

via

ble

cel

ls

CuSO4 (µM)

UA159

ΔcopYAZ

Figure 4-16 Colony forming units of viable cells at different copper concentrations

S. mutans colony forming unit of the total viable cells (during the transformation frequency

assays) in the presence of varying copper concentrations using wild type UA159 (black line),

∆copYAZ (grey line). Results are the mean of three independent experiments with duplicate

samples of each strain ± standard error (*P <0.05).

83

4.5.9 Copper represses the expression of genes associated with genetic

competence.

To determine the pathways by which copper and CopYAZ modulate transformability of S.

mutans, we compared the expression of comC, comD, comE, comR, comS, and comX

competence-related genes between the isogenic strains treated with or without copper. In S.

mutans UA159, compared with the no copper control, supplementation with 100 μM CuSO4

reduced the expression of comX and comS by 2-fold and 2.8-fold, respectively (P<0.001).

Regardless of the presence of copper, expression of the comX, which is critical for competence

development, was reduced by 2.5-fold in the ∆copYAZ, compared with the wild type strain

(P<0.001). Moreover, relative to the wild type, the expression of comS was repressed over 8-fold

and 12.5- fold in the copper transporter mutant in the absence and presence of copper,

respectively (P<0.001).

84

4.6 Discussion

Fluctuations in intracellular levels of copper can have severe implications on the physiology of

all prokaryotes. The mechanisms involved in copper-induced killing vary amongst bacterial

species. Bacteria usually initiate a global adaptive genetic response to copper, depending on their

physiological copper requirements and presence of copper in their environmental niches [312-

317]. While in some bacteria, such as Enterococcus faecalis and Pseudomonas aeruginosa, a

large portion of the genome (approximately 300 genes) is differentially expressed under copper

stress; in other bacteria such as Lactococcus lactis, only 11 genes were copper-responsive [314,

316-317]. While we did not analyze changes in entire copper-regulon of S. mutans, targeted gene

expression analysis in this work revealed that copper-responsive genes included the gtfBCD and

gbpBC associated with biofilm formation, the comS and comX genes critical for competence

development, and the uvrA and atpH genes involved in acid-stress tolerance. An important

aspect of this work was also to validate the role of the S. mutans CopYAZ in copper efflux,

which influenced its ability to tolerate environmental stressors and maintain its membrane

potential. The link between copper homeostasis via the CopYAZ and its effects on comS and

comX transcription for competence development is novel. Since the competence pathway is

closely linked with the biofilm and stress tolerance pathways of S. mutans [144-145, 147, 299],

this work adds to the current knowledge as to how these pathways can be modulated by

environmental copper stress.

The growth kinetic assays and MICs in this work indicated that higher concentrations of copper

are toxic to S. mutans and its toxicity is counteracted through CopYAZ activity. In most bacteria,

CopA has been speculated or proven to remove copper cations from the cell [170, 212, 293],

which we validated using copper transport assays. Since we observed that both the wild type and

∆copYAZ cells were able to accumulate copper cations, we suspect that in S. mutans copper

import/influx occurs passively, in a non-specific manner, as demonstrated in other bacteria such

as Helicobacter pylori and E. coli [219, 318-319].

In the oral cavity, since S. mutans is constantly exposed to fluctuating oxidative stress, its ability

to adapt to such conditions is important for its survival. Here, we demonstrated that the addition

of the glutathione dramatically reversed the copper-induced growth defect in S. mutans cultures,

85

thus suggesting that toxicity to copper is likely a result of copper-dependent generation of

oxidative stress in S. mutans. Copper can generate oxidative stress either by depleting

glutathione (due to its capability of forming a complex with glutathione) [320] or by generating

reactive oxygen species (ROS), especially superoxide radicals which are toxic to the cells [170,

208]. Copper, due to its high reactivity, is capable of replacing Fe or Mn from the active site of

proteins, thereby rendering them inactive [184]. In S. mutans, perR (peroxide regulator), sod

(superoxide dismutase) and dpr (dps-like peroxidase resistance protein) gene products are

associated with resistance to oxidative stress [163, 321-323]. The dpr-encoded protein requires

Fe, sod -encoded protein requires Mn/Fe and PerR has been speculated to require Mn or Fe for

their activity [163, 321, 323-324]. Hence, copper can be speculated to replace Fe/Mn from the

active sites of dpr, sod, and/or perR encoded products, thereby inactivating these proteins and

compromising the cell viability under oxidative stress. However, further research is warranted to

dissect the specific underlying mechanisms involved in this process. Our results also

demonstrated the importance of S. mutans copYAZ operon in resistance against oxidative stress,

thereby suggesting its involvement in stress adaptation process of this oral pathogen.

Copper and acidic pH exerted a synergistic effect against growth of S. mutans. Growth in THYE

at pH 5.5 or in THYE with 1 mM CuSO4 did not produce a discernible phenotype between the

∆copYAZ and UA159 strains. However, a significant increase in the doubling times were noted

when these strains when cultivated in THYE at pH 5.5 with 1 mM CuSO4, thus suggesting a

synergistic effect of acid and copper stress against S. mutans growth. Since cuprous ions in

S. mutans have been previously associated with impaired glycolysis under acid stress [281], our

study supports this finding by demonstrating a notable growth defect in the presence of copper

and acid stress. The impaired growth observed for the ∆copYAZ strain in the presence of copper

and acid stress can be due to accumulation of surplus copper in the cells or due to the

involvement of the copYAZ operon in protection under acid stress. S. mutans produces lactic acid

as a metabolic end-product of dietary sugars and mounts an ATR that affords it growth and

survival under pH values as low as 3.5 [105, 109]. During the ATR, S. mutans undergoes a

number of physiological changes such as increased synthesis of stress responsive proteins,

membrane fatty acid changes, and increased activity of proton translocating ATPases [105, 109].

Such adaptation requires a pre-exposure to a sub-lethal signal of pH 5.5 to activate the processes

86

to protect cells against killing pH values (pH 2.0-3.0) [105, 109]. A severe decrease in the

viability of both the adapted and non-adapted ∆copYAZ compared with the wild type at pH 3.5,

implicated the contribution of copYAZ to the ATR of S. mutans. In the presence of copper, the

transcriptional repression of the acid stress related genes, uvrA and atpH, likely contributed to

the observed acid sensitive phenotype of S. mutans. Repression in the expression of uvrA in

∆copYAZ also supported the association of the copYAZ operon in acid stress response. Although,

we did not analysed the impact of copper on influencing the acid-inducible regulon of S. mutans;

results from this study offer the foundation towards understanding the copper-mediated acid-

tolerance response in this oral pathogen. Further studies are currently underway to elucidate the

effect of copper on modulating S. mutans proteome; hence, aiming to determine the proteins

involved in acid adaptation process under copper stress.

Under normal growth conditions, bacteria maintain their membrane potential by establishing

multiple ion gradients across their intact cytoplasmic membrane. The maintenance of intact cell

membranes is crucial to maintain ATP hydrolysis and proton motive force [325-326]. A

disturbance in the amount of ions can result in hyper-polarization (higher negative intracellular

electrical potential) or depolarization (higher positive intracellular electrical potential) of the

membrane potential. A rational target for copper-induced toxicity in bacteria is their cell wall or

cell membrane, as these are the exposed parts of bacteria to external stress. Reports have

indicated that in Gram positive bacteria, the metal binding sites usually lie within the

peptidoglycan layer [327-328]. Copper also tends to accumulate on the inner side of the cell

membrane, making the inner side more positive and thus causing membrane depolarization [283,

329]. Here, we demonstrated the effect of copper on initiating an immediate membrane potential

dissipation, which was significantly higher in the ∆copYAZ strain relative to the wild type strain.

The S. mutans ∆copYAZ cells exhibited a depolarized membrane phenotype, even in the absence

of copper, compared with wild type cells. The gradual increase in membrane depolarization

observed in ∆copYAZ can be due to membrane perturbation caused by the loss of the CopA

trans-membrane protein. Our findings are in agreement with another study, where the loss of E.

coli arsenic and antimony efflux system was shown to be linked with cell membrane

depolarization [330]. Disturbances in the bacterial membrane potential can alter certain cellular

processes such as cell division and differentiation, integrity of cellular membranes, electron

87

transport across the membranes, localization of specific proteins and protein complexes, and

levels of cellular energy [325, 331-333]. In S. mutans, copper acting as a membrane potential

dissipater might contribute to the generation of copper-dependent oxidative and acid stress,

where both these stresses are likely to be affected by variations in the bacterial membrane

integrity and/or changes in the electron transport across the bacterial membrane [326, 334-336]

Copper has an inhibitory effect on biofilm formation in S. mutans. This mechanism relies on the

ability of copper to inhibit early attachment of cells to the surface and to significantly reduce

biomass production in S. mutans. The reduction in cell adherence and biomass production was

more prominent in the ∆copYAZ strain, likely due to surplus accumulation of copper within the

cells. In the presence of sucrose, cell-wall associated Gtfs mediate the synthesis of D-glucose

polysaccharides, which are glucans that promote S. mutans adherence to tooth surface and other

adhered bacteria [63, 116]. S. mutans produces three different Gtfs that include: GtfB, which

produces water-insoluble glucans composed predominantly of α-1,3-linkages; GtfD that mostly

produces soluble α-1,6-linked glucans; and GtfC that synthesizes both α-1,3 and α-1,6 glucans

[111-113]. In our work expression of gtfB, gtfC, and gtfD were significantly repressed by copper.

The transcriptional repression of these gtf genes validated the effects of copper in influencing

genes critical for glucan production and biofilm matrix formation; their downregualtion under

copper explains poor biofilm biomass observed. In addition to Gtfs, surface associated Gbps in S.

mutans promote cell-cell aggregation by mediating the binding of S. mutans to glucans [119,

125, 337]. Addition of copper significantly reduced the transcription of gbpB and gbpC further

expanding on components affected by environmental copper. The down-regulation of these gbps

distinctly emphasized the effect of copper in initial sucrose-dependent biofilm formation, where

expression of these genes is essential for the transition from planktonic to biofilm growth [37,

125]. In contrast to our gtf transcription results, previously others showed that supplementation

with 1 mM copper induced the transcription and translation of gtfD but not gtfBC [280]. In their

study, RNAs isolated from planktonic cells were used for expression analysis [31], whereas this

study utilized RNAs from 18-h biofilms cultivated with or without added copper. In the absence

of copper, we did not note a significant change in the transcriptional levels of gtfBCD, and

gbpBC between the ∆copYAZ and wild type strains; hence, it is not surprising that we obtained

comparable amounts of biofilm biomass between these strains. In addition to the repressive

88

effects of copper on gtfBCD and gbpBC transcription, loss of copper efflux in the ∆copYAZ

mutant lead to reduced gtfs and gbps expression in cop mutant biofilms with added copper in the

medium. These results provide strong evidence that copper is extremely effective in inhibiting

biofilm formation, one of the most vital virulence attributes of this oral pathogen.

The influence of copper and the CopYAZ system on genetic competence development and comX

and comS expression in S. mutans is novel. The ComDE and ComRS signaling pathways

involved in S. mutans competence development differ in their mechanism of action [132, 143,

146, 298]. The CSP-ComDE pathway is activated by CSP whose precursor peptide is encoded by

comC gene [143, 147, 149]. Upon activation of the ComD and subsequent phosho-transfer to

ComE leads to activation ComX that is a critical switch required for the competent state of S.

mutans [143, 145]. Recently, the proximal regulator of ComX was described as the ComR, an

Rgg-like transcriptional regulator in the cytosol, which in conjunction with internalized XIP is

able to activate ComX for the transcription of late competence genes required for DNA uptake

and recombination [132]. It has been shown that nutrients and peptones present in the growth

medium of S. mutans can differentially affect CSP and XIP activity needed for competence

activation [132, 146, 148, 150, 298]. CDM medium was shown to be optimal only for XIP-

mediated competence induction, whereas the peptone-rich THYE medium was optimal for

transformation in the presence of CSP [132, 146, 148, 298]. In our assays, since the effect of

copper on S. mtuans transformability is dramatically pronounced in CDM relative to that under

THYE, we speculate that its influence on genetic competence primarily occurs via the XIP-

induced signaling pathway. Moreover, the observation that of all competence-related genes

tested (e.g., comCDE, comRS, and comX), only comS and comX expression was significantly

affected under our test conditions provides additional evidence that the effects of copper on

transformation is modulated by the XIP-ComRS pathway. The effect of copper on the expression

of comS but not comR suggests that copper represses the activity of ComX by affecting the

function or secretion of ComS and/or XIP, thus causing a dramatic reduction in transformation

frequency. In the absence of copper, a significant reduction in transformation frequency of the

∆copYAZ relative to wild type implies the importance of this operon in genetic competence

development in S. mutans. Previously, in Streptococcus pneumoniae, inactivation of a putative

metal transporting operon (AdcCBA) was shown to have a competence-deficient phenotype

89

[338-339]. The operon was speculated to be involved in zinc transport and the addition of zinc

improved the transformability of the adc null mutants [338-339]. In our study, although the

mechanism involved in modulation of competence by the copYAZ is not fully understood, two

suggestions can be proposed based on the observed transcriptional repression of comS: 1) the

CopYAZ may have a role in modulating the function, processing, or export of XIP, and/or 2) the

membrane perturbation resulted due to loss of the CopA may hinder the process of DNA

acquisition resulting in defective transformation frequency.

Conclusively, results from the present study enhance our understanding about the effects

of copper on S. mutans survival under planktonic and biofilm growth conditions. We also

demonstrated the role of the copYAZ system in maintaining S. mutans physiology under stress

conditions. Insights into the mechanism of copper toxicity and its connection with biofilm

formation and genetic transformation is instrumental in understanding and devising new

strategies to utilize copper as an effective anti-biofilm agent to combat S. mutans infections.

Since, S. mutans can be considered as an ideal model organism to study the genetics and

physiology in pathogenic Gram positive bacteria [340], our study holds relevance in suggesting

the importance of copper acquisition and homeostasis in closely-related pathogens.

4.7 Acknowledgements

We acknowledge the technical assistance provided by Ms. Kirsten Krastel in performing the

MIC assays and DNA cloning for this study. This research was supported by NIH

RO1DE013230-03 and CIHR-MT15431 to DGC. CML is a recipient of a Canada Research

Chair. KS is a recipient of Cell Signaling Fellowship CIHR-STP-53877.

90

5 Summary and Conclusions

This dissertation characterizes the importance of copYAZ-mediated copper homeostasis in

modulation of stress tolerance and biofilm formation, two important virulence factors of S.

mutans. Our results show that copper-induces toxicity in S. mutans UA159 by generating

oxidative stress and dissipating its membrane potential. Furthermore, we established that copper

exposure impaired various important physiological attributes of S. mutans such as: 1) acid

tolerance, 2) genetic transformation and 3) surface adherence to initiate biofilm formation. Using

gene expression analysis we have shown that copper had a repressing effect on the transcription

of S. mutans genes involved in biofilm matrix formation, genetic competence and acid tolerance.

We have also demonstrated the importance of copYAZ in copper homeostasis by facilitating

copper expulsion from S. mutans, which otherwise can exert a detrimental effect on the survival

and stress tolerance (towards copper, acid and oxidative stress) of this bacterium. In S. mutans,

the loss of copYAZ resulted in cells having a dissipated membrane potential compared to wild

type in spite of controlled ionic environment. In conclusion, the inhibitory effects of copper, and

importance of copYAZ in affecting several virulence features in S. mutans, provides strong

evidence in associating copper homeostasis with the bacterium’s ability to adapt and survive

under fluctuating environments.

5.1 Effects of copper on bacterial physiology

The medicinal use of copper dates back to the 19th century, where a variety of copper

preparations -including metallic surfaces and coatings- were utilized to treat bacterial and viral

infections [341]. However, the application of copper was reduced with the advent of new and

efficient antibiotics in antimicrobial therapeutics. In the last few decades, the acquisition of

antibiotic resistance genes by the pathogenic bacteria via the process of natural selection has

challenged their eradication, thereby, posing a huge threat against clearance of bacterial

infections. The use of metals as antimicrobials have gained special interest in recent years due to

their ability to disrupt antibiotic-resistant biofilms, to exert synergistic bactericidal activity with

other biocides, and to inhibit metabolic pathways in a selective manner [162, 342]. The

91

conventional antimicrobial activity of metal ions allows them to participate in targeting specific

or discrete metabolic reactions, depending upon the physical and chemical properties of both the

metal atoms and the accessible donor ligands within the intracellular biomolecules [342].

One such transition metal ion, copper, induces killing of the antibiotic resistant bacterial

populations, either via direct contact killing or by copper in solutions. The direct contact with

copper surface exhibits a 7-8 log higher rate of killing than when exposed to copper in solutions

[343-345]. There are various proposed models to understand the mechanisms by which copper

renders toxicity in different bacterial species. Bacteria usually initiate a global adaptive genetic

response to copper insult, which involves induction of stress regulons [314, 316-317]. However,

the range of copper induced toxic effects can be determined from the stretch of regulatory

response it generates in particular species. The difference in the copper-responsive regulons

between bacterial species depends on their physiological copper requirements and the presence

of copper in their respective niches [172, 346-347]. In this study, we made a significant progress

in establishing the effect of copper in modulating the transcription of the vital genes involved in

stress tolerance, genetic competence development, and biofilm formation in S. mutans.

We demonstrated a novel inhibitory effect of copper on S. mutans biofilm formation. Addition of

copper reduced the ability of S. mutans to adhere to a surface, thus leading to poor biomass

production. Moreover, with copper supplementation, there was an over 2-fold repression in the

transcription of genes encoding GTFs and GBPs. We know that GTFs and GPBs are required for

sucrose-dependent bacterial adherence to the tooth surface and to pre-adhered bacteria, which

provides a link for the copper-mediated biofilm impairment in S. mutans [63, 117, 119, 127].

Herein, we demonstrated that copper induced an oxidative stress in S. mutans and instigated the

depolarization of membrane potential. The disturbance in the ion gradient across the cell

membrane can result in hyper-polarization (higher negative intracellular electrical potential) or

depolarization (higher positive intracellular electrical potential) of the membrane potential. Metal

cations, like copper, tend to accumulate on the inner side of the cell membrane making it more

positive and thus causing membrane depolarization. Addition of copper induces oxidative stress

and causes severe growth defects in S. mutans cells growing under acid stress, while suppressing

the expression of related acid stress genes. Since, both the oxidative and acid stresses can be

92

affected by variations in the bacterial membrane integrity and/or changes in the electron

transport across the bacterial membrane as shown in retrograde studies, we suggest that these

defects are the consequences from the copper affecting membrane potential in S. mutans [326,

334-335, 348]. Furthermore, it can be postulated that in S. mutans as a consequence of copper-

induced membrane depolarization, other cellular processes such as cell division, integrity of

cellular membranes and dissipation of cellular energy might also be affected, where these

processes vastly rely on maintenance of membrane potential [325, 336]. Future studies are

warranted to study the specific targets involved in copper induced toxicity in this oral pathogen.

The presence of copper in dental amalgams and drinking water has been reported to inhibit

S. mutans growth and reduce caries formation [287]. In this study, we demonstrated copper-

dependent inhibition of S. mutans biofilm formation and its effect on attenuating cell survival

under acid-stress. Residing in the highly fluctuating oral environment, the integral ability to

tolerate the stresses and proliferate and sustain life as a biofilm are considered as the two major

virulence attributes in S. mutans [349-350]. Our study provides strong evidence by which copper

affects these virulence features on physiological and molecular levels, thereby, holding strong

relevance in offering the background knowledge of copper utilization as an effective

antimicrobial against dental caries. More detailed discussion is presented in section 4.6.

5.2 Characterization of the copYAZ operon

The ability of bacteria to survive under copper stress depends on the expression of the genes

involved in copper resistance and tolerance. As described previously, the principle mechanisms

of copper tolerance include: trans-membrane copper expulsion from the cytoplasm to periplasm

or to extracellular milieu; sequestration of copper by metallo-proteins; and oxidation of toxic

cuprous ions to less toxic cupric ions by multi-copper oxidases. Bacterial copper transporting

P1B-type ATPases (a sub-class of P-type ATPases specialized for heavy metal ion transport) are

highly specific for copper (in some cases they also transport silver cations); disruption in their

function results in intracellular accumulation of copper cations (and/or silver cations) and

modulation of bacterial virulence [190, 212, 293, 351-352]. All bacteria possess at least one

93

copper exporting P1B-type ATPases to expel excess cytoplasmic copper. Mutations in the genes

encoding for copper transporters results in increased sensitivity to stresses and decreased

virulence in many bacteria such as P. aeruginosa and S. pneumoniae [315, 353]. E. coli utilizes

copper P1B-ATPases to cope with host phagosomal oxidative burst during infection [354]. More

examples are reported in the literature describing the role of the copper exporting ATPases in

modulating certain physiological features required for bacterial colonization and pathogenesis

[191, 312, 347].

S. mutans have a copYAZ system, and in this study we have demonstrated its specific role as a

copper exporter. The strain lacking copYAZ accumulated significantly higher amounts of copper

within the cell as compared with the wild type UA159 strain. The intracellular copper

accumulation in our study coincides with various published reports, which suggest the

involvement of an unidentified copper-specific uptake system, or an unknown passive non-

specific copper uptake mechanism in S. mutans [208, 347, 355]. We tested two putative

cadmium transporter ATPases, SMU_723 and SMU_2057 with high sequence similarity to the S.

mutans copA gene, which did not show difference in copper sensitivity compared with the wild

type, thereby, we dismissed the role of these putative transporters in S. mutans copper transport.

The role of copYAZ in copper efflux, was substantiated by utilizing a E. coli strain lacking copA

that was complemented with the S. mutans copYAZ operon. The presence of S. mutans copYAZ

significantly reduced the intracellular copper ion accumulation in the test E.coli mutant, thereby,

reinforcing the role of S. mutans CopYAZ in copper efflux. The S. mutans ∆copYAZ strain was

complemented with copYAZ operon, which restored copper efflux and further validated the

function of this system in S. mutans copper export. We have confirmed that the copYAZ affords a

resistance against copper-induced toxicity by specifically expelling copper; while other test

metal stressors such as silver, cadmium, mercury did not result to an increased killing in

copYAZ-null mutant.

Amongst other stress-related phenotypes of S. mutans, we observed that ∆copYAZ cells exhibited

a depolarized membrane phenotype suggesting a state of compromised cell membrane integrity

or a significantly increased accumulation of intracellular cations. The gradual increase in

membrane depolarization observed in ∆copYAZ can be due to membrane perturbation caused by

the loss of the CopA trans-membrane protein. This is in consonance with the previous reports

94

showing that the loss of the metal efflux system have a membrane depolarization phenotype

[283].

Figure 5-1 Summary of role of copper and copYAZ operon in S. mutans

The loss of copYAZ also resulted in sensitivity to killing under acid or oxidative stress, thereby,

emphasizing the involvement of this operon in general adaptive response of S. mutans. As

described previously, the involvement of copYAZ in modulating membrane potential partially

explains the sensitivity of ∆copYAZ to acid and oxidative stress. Conclusively, this is the first

study to identify and characterize the role of copYAZ as the specific copper efflux system (

95

Figure 5-1), which has significant implications on stress induced physiological adaptation in S.

mutans.

5.3 Effect of copper and CopYAZ in genetic

competence

Association of metal ions and genetic competence has been previously reported in Gram positive

bacteria; for instance, calcium in S. pneumonia [296] and either calcium or magnesium in

Azotobacter vinelandii [295, 297] are considered as important factors in competence

development. Previously, in S. mutans the development of genetic competence is shown to be

associated with the bacterium's ability to form biofilms and to tolerate stress [143-144, 147, 153].

In this study, we also established the effect of copper in modulating S. mutanss stress tolerance

response and its ability to acquire foreign DNA. We demonstrated that copper supplementation

resulted in a 20-fold repression of the natural genetic transformation frequency in S. mutans and

a simultaneous 2-fold repression in the expression of comS and comX, (involved in XIP-mediated

competence development). The deletion of copYAZ also resulted in a significant 30-fold

reduction in the transformation frequency compared with UA159 strain and repression of comX

and comS relative to wild type strain, by 2.5 fold and 8.5 fold respectively. These results clearly

signify the importance of the copYAZ system in modulation of genetic competence in S. mutans.

Taken collectively, we have demonstrated the novel activity of copper and copper transport

system in modulating genetic competence development in S. mutans (Figure 5-2). These results

imply the importance of copper and copYAZ system in circumventing the ability of S. mutans to

uptake foreign DNA that may assist bacteria in acquiring resistance against certain

antimicrobials and/or host factors. Moreover, copper and copYAZ dependent impairment in

genetic competence development might also result in compromising S. mutans ability to cause

infection in a changing environment [151]. More detailed description is provided in section 4.6.

96

comR comS

Copper

comX

Induction of late

competence genes

ComR

Outside

Inside

Opp

Processing

XIP ComS

Figure 5-2 Effect of copper and copYAZ on the competence regulon of S. mutans

97

6 Future directions and significance

6.1 Future directions

In this study, our specific objectives were to delineate the mechanism involved in copper-

mediated cell toxicity, to define the systems involved in copper transport, and to enhance our

understanding about copper homeostasis. We made significant progress towards understanding

the phenotypes associated with copper in S. mutans, which lays the foundation to several

important questions. It is predicted that CopZ functions as a copper-chaperone to translocate

copper within the cytoplasm. However, the protein machinery involved in copper exchange

between the cytoplasm and extracellular milieu still needs further exploration. Moreover, the

chemistry of copper's affinity to associate with these proteins, and their detailed role in

homeostasis awaits further exploration. Future research is also warranted to investigate the

importance of the copper transport and resistance machinery in modulating S. mutans

pathogenesis and virulence in the host. The homeostasis of other metal ions, except manganese

and iron, has not yet been defined in S. mutans, further investigation studying these homeostatic

systems and the possible cross talk between their pathways involved in homeostasis also remains

an interesting area to be explored.

Metal ions with high reactivity in the Irving–Williams series can replace less reactive metal ions

from metalloprotein complex [184]. Considering the fact that copper is a highly reactive, it can

be postulated that copper can affect the functioning of various metalloproteins in S. mutans.

Emerging research have also shown that metal sensors and transporters participate in allowing

the cell to overcome inadequate protein:metal affinities; thereby, assisting the metalloproteins to

acquire the right metal ion [356-357]. Future experiments need to be directed towards

understanding the possible role of S. mutans CopYAZ system in modulating the association of

copper with specific metalloproteins. Understanding the mechanisms of how S. mutans'

physiology is regulated by cellular copper holds a strong relevance in devising new therapeutic

measures, where metal transporters and sensors proteins can be targeted to circumvent its

pathogenicity.

98

One of the most significant contributions of this study was to provide evidence relevant to

association between copper/CopYAZ system and genetic transformation in S. mutans. While the

impact of addition of copper or absence of copYAZ on repressing the transcription of sigma-X

and comS provide an explanation for the observed genetic transformation defect, the mechanism

by which copper and copYAZ regulate the expression of these genes remains unclear. Copper can

be postulated to modulate the processing, sensing and/or uptake machinery of precursor peptide;

thereby affecting the XIP mediated genetic transformation. The impairment in the genetic

transformation can also be a result of altered membrane potential as observed in ∆copYAZ strain

relative to wild type. Future quantification of secreted XIP in presence and absence of copper

stress can be done to provide an explanation if the peptide secretion or uptake through specific

system is affected. Further, a proteome analysis in presence or absence of copper stress is

required to understand the mechanisms underlying copper related phenotypes observed in this

study.

In the past few decades, instrumental progress has been made in understanding the metal

utilization pathways and identifying metalloproteins [179, 195]. However, the computational and

systems biology analyses of the total content metallomes (entirety of metal and metalloid species

within a cell or tissue type [358]) and metalloproteome (proteome associated with the metallome

[358]) are limited. There is a direct need to understand the metal transport systems in terms of

their origin (which would identify the functional environment), how these systems were first

acquired (categorically linking the genetic exchange), and if these systems are involved only in

response to a signal or can behave as a source of a signal. Although, an advanced computational

and comparative genomics study suggested a common evolutionary origins of metal transporters

and their regulatory signal transduction in bacteria [276], further studies are warranted to

understand the functional diversification of these systems across the bacterial kingdom.

Moreover, in oral cavity, studies should also be conducted utilizing comparative genomic

approaches to decipher the importance of copper and other metal ions in the physiology and

metabolism of oral microbes. Results from such studies can help to design novel therapeutic

measures to reduce oral infections; for instance, manipulation of the metal-dependent

physiological processes in accordance to inhibit disease-associated but encourage health-

associated microbial colonization in the oral cavity.

99

6.2 Significance

Significant advances have been made over the past few decades on illustrating the importance

and homeostasis of essential transition metal ions in bacteria. These efforts have led to fruitful

information regarding the mechanisms that bacteria employ on regulation, utilization,

transportation and detoxification of metal ions. Here we described the mechanisms by which

copper renders toxicity in S. mutans. An emphasis was made on demonstrating these

mechanisms on physiological and molecular levels. S. mutans ability to form biofilms and

tolerate fluctuating environments provides it with a competitive advantage over many

commensal organisms in the oral cavity. A number of studies have reported the importance of

other metal ions in S. mutans, for instance, manganese and iron acts as a co-factor of superoxide

dismutase; while zinc have inhibitory effect on the GTF activity, acid production, and glycolysis

[359-361]. The transport and homeostasis of iron and manganese in S. mutans has been attributed

to SloABC system, and is associated with cell adherence, biofilm formation, genetic competence,

and oxidative stress tolerance [164, 167]. Another metal cation thoroughly studied for its

importance in metabolism of S. mutans is calcium. In S. mutans, calcium ions activate CiaRH

TCS, which is involved in acid tolerance and production, biofilm formation, and development of

genetic competence [165]. These studies establish the foundation towards understanding on the

importance of transition metal ions and their regulatory role in modulating the various

physiological processes in S. mutans. In our study we focused on understanding copper-induced

toxicity and the effect of copper on several virulence factors in this oral pathogen. Copper has an

inhibitory effect under both planktonic and biofilm growth conditions in S. mutans. Interestingly,

during planktonic growth copper induces toxicity by the generation of oxidative stress and

disruption of membrane potential; whereas during biofilm formation copper represses the

transcription of genes associated with matrix production resulting in poor biofilm biomass

production. Copper's effect on biofilm formation and its involvement in stress response makes it

an ideal antimicrobial candidate against S. mutans infections. In several bacteria, metal

transporters are known to play a crucial role in bacterial virulence [171, 179, 182, 338] and with

our study we demonstrated the significance of copYAZ operon in copper transport, genetic

transformation, and stress response in S. mutans. While further genetic and biochemical studies

are warranted to decipher the underlying genetic pathways that modulate these phenotypes,

100

results from our study have set a platform to understand the important role of copYAZ system in

modulating the growth and survival of S. mutans under stress and normal conditions.

Understanding the mechanisms by which copper exerts its toxicity in S. mutans can have

implications in devising novel clinical applications of copper in anti-caries therapeutics. Since S.

mutans is considered as a Gram positive paradigm, our study also provides a basic background

required to study other copper homeostatic systems in other closely related bacterial pathogens.

101

VIII. References

1. Wade WG: Characterisation of the human oral microbiome. J Oral Biosci 55(3), 143-148

(2013).

2. Dewhirst FE, Chen T, Izard J et al.: The human oral microbiome. J Bacteriol 192(19),

5002-5017 (2010).

3. Aas JA, Paster BJ, Stokes LN, Olsen I, Dewhirst FE: Defining the normal bacterial flora

of the oral cavity. J Clin Microbiol 43(11), 5721-5732 (2005).

4. Xu X, He J, Xue J et al.: Oral cavity contains distinct niches with dynamic microbial

communities. Environ Microbiol 17(3), 699-710 (2014).

5. Smith DJ, Anderson JM, King WF, van Houte J, Taubman MA: Oral streptococcal

colonization of infants. Oral Microbiol Immunol 8(1), 1-4 (1993).

6. Squier CA, Kremer MJ: Biology of oral mucosa and esophagus. J Natl Cancer Inst

Monogr 2001(29), 7-15 (2001).

7. Long SS, Swenson RM: Determinants of the developing oral flora in normal newborns.

Appl Environ Microbiol 32(4), 494-497 (1976).

8. Law V, Seow WK, Townsend G: Factors influencing oral colonization of mutans

streptococci in young children. Aust Dent J 52(2), 93-100 (2007).

9. Nyvad B: Microbial colonization of human tooth surfaces. Acta Pathol Microbiol

Immunol Scand 32, 1-45 (1993).

10. Nobbs AH, Lamont RJ, Jenkinson HF: Streptococcus adherence and colonization.

Microbiol Mol Biol Rev 73(3), 407-450 (2009).

11. Könönen E: Development of oral bacterial flora in young children. Ann Med 32(2), 107-

112 (2000).

102

12. Zijnge V, van Leeuwen MBM, Degener JE et al.: Oral biofilm architecture on natural

teeth. PLoS ONE 5(2), e9321 (2010).

13. Marsh PD: Dental plaque: biological significance of a biofilm and community life-style.

J Clin Periodontol 32(6), 7-15 (2005).

14. Marsh P: Dental plaque as a biofilm and a microbial community – implications for health

and disease. BMC Oral Health 6(1), 1-7 (2006).

15. Marsh PD: Microbial ecology of dental plaque and its significance in health and disease.

Adv Dent Res 8(2), 263-271 (1994).

16. Gibbons RJ: Microbial ecology adherent interactions which may affect microbial ecology

in the mouth. J Dent Res 63(3), 378-385 (1984).

17. Moore WEC, Moore LVH: The bacteria of periodontal diseases. Periodontology 2000

5(1), 66-77 (1994).

18. Syed SA, Loesche WJ: Bacteriology of human experimental gingivitis: effect of plaque

age. Infect Immun 21(3), 821-829 (1978).

19. Marsh PD: Are dental diseases examples of ecological catastrophes? Microbiology

149(2), 279-294 (2003).

20. Amerongen AVN, Veerman ECI: Saliva – the defender of the oral cavity. Oral Dis 8(1),

12-22 (2002).

21. Marcotte H, Lavoie MC: Oral microbial ecology and the role of salivary immunoglobulin

A. Microbiol Mol Biol Rev 62(1), 71-109 (1998).

22. Lendenmann U, Grogan J, Oppenheim FG: Saliva and dental pellicle- a review. Adv Dent

Res 14(1), 22-28 (2000).

23. Yao Y, Berg EA, Costello CE, Troxler RF, Oppenheim FG: Identification of protein

components in human acquired enamel pellicle and whole saliva using novel proteomics

approaches. J Biol Chem 278(7), 5300-5308 (2003).

103

24. Hannig C, Hannig M, Attin T: Enzymes in the acquired enamel pellicle. Eur J Oral Sci

113(1), 2-13 (2005).

25. Tenovuo J: Antimicrobial function of human saliva - how important is it for oral health?

Acta Odontol Scand 56(5), 250-256 (1998).

26. Lamster IB: Evaluation of components of gingival crevicular fluid as diagnostic tests.

Ann Periodontol 2(1), 123-137 (1997).

27. Lamster IB, Ahlo JK: Analysis of gingival crevicular fluid as applied to the diagnosis of

oral and systemic diseases. Ann NY Acad Sci 1098(1), 216-229 (2007).

28. Lamster IB, Novak MJ: Host mediators in gingival crevicular fluid: Implications for the

pathogenesis of periodontal disease. Crit Rev Oral Biol Med 3(1), 31-60 (1992).

29. Suomalainen K, Saxén L, Vilja P, Tenovuo J: Peroxidases, Iactoferrin and lysozyme in

peripheral blood neutrophils, gingival crevicular fluid and whole saliva of patients with

localized juvenile periodontitis. Oral Dis 2(2), 129-134 (1996).

30. Lif Holgerson P, Harnevik L, Hernell O, Tanner ACR, Johansson I: Mode of birth

delivery affects oral microbiota in infants. J Dent Res 90(10), 1183-1188 (2011).

31. Nelun Barfod M, Magnusson K, Lexner MO, Blomqvist S, Dahlén G, Twetman S: Oral

microflora in infants delivered vaginally and by caesarean section. Int J Paediatr Dent.

21(6), 401-406 (2011).

32. Marsh P, Martin M: Acquisition, adherence, distribution and functions of the oral

microflora. In: Oral Microbiol. Springer US, 56-97 (1992).

33. Sampaio-Maia B, Monteiro-Silva F: Acquisition and maturation of oral microbiome

throughout childhood: An update. Dent Res J 11(3), 291-301 (2014).

34. Bearfield C, Davenport ES, Sivapathasundaram V, Allaker RP: Possible association

between amniotic fluid micro-organism infection and microflora in the mouth. BJOG

109(5), 527-533 (2002).

104

35. Li J, Helmerhorst EJ, Leone CW et al.: Identification of early microbial colonizers in

human dental biofilm. J Appl Microbiol 97(6), 1311-1318 (2004).

36. Plonka KA, Pukallus ML, Barnett AG, Walsh LJ, Holcombe TH, Seow WK: Mutans

streptococci and lactobacilli colonization in predentate children from the neonatal period

to seven months of age. Caries Res 46(3), 213-220 (2012).

37. Welin J, Wilkins JC, Beighton D, Svensäter G: Protein expression by Streptococcus

mutans during initial stage of biofilm formation. Appl Environ Microbiol 70(6), 3736-

3741 (2004).

38. Feller L, Altini M, Khammissa RAG, Chandran R, Bouckaert M, Lemmer J: Oral

mucosal immunity. Oral Surg Oral Med Oral Pathol Oral Radiol Endod 116(5), 576-583

39. Gibbons RJ, Houte JV: Bacterial adherence in oral microbial ecology. Annu Rev

Microbiol 29(1), 19-42 (1975).

40. Hojo K, Nagaoka S, Ohshima T, Maeda N: Bacterial interactions in dental biofilm

development. J Dent Res 88(11), 982-990 (2009).

41. Filoche S, Wong L, Sissons CH: Oral biofilms: emerging concepts in microbial ecology.

J Dent Res 89(1), 8-18 (2010).

42. Nobbs AH, Jenkinson HF, Jakubovics NS: Stick to your gums: mechanisms of oral

microbial adherence. J Dent Res 90(11), 1271-1278 (2011).

43. Flemming H-c, Wingender J: The biofilm matrix. Nat Rev Microbiol 8(9), 623-633

(2010).

44. Peyyala R, Ebersole JL: Multispecies biofilms and host responses: “Discriminating the

trees from the forest”. Cytokine 61(1), 15-25 (2013).

45. Marsh PD: Role of the Oral Microflora in Health. Microb Ecol Health D 12(3), 130-137

(2000).

105

46. Bowden G: The microbial ecology of dental caries. Microb Ecol Health Dis 12(3), 138-

148 (2000).

47. Marsh PD: Role of the oral microflora in health. Microb Ecol Health Dis 12(3), 130-137

(2000).

48. Wright CJ, Burns LH, Jack AA et al.: Microbial interactions in building of communities.

Mol Oral Microbiol 28(2), 83-101 (2013).

49. Cuadra-Saenz G, Rao DL, Underwood AJ et al.: Autoinducer-2 influences interactions

amongst pioneer colonizing streptococci in oral biofilms. Microbiology 158(Pt 7), 1783-

1795 (2012).

50. Kolenbrander PE: Oral Microbial Communities: Biofilms, Interactions, and Genetic

Systems. Annu Rev Microbiol 54(1), 413-437 (2000).

51. Kolenbrander PE, Palmer Jr RJ, Periasamy S, Jakubovics NS: Oral multispecies biofilm

development and the key role of cell–cell distance. Nat Rev Microbiol 8(7), 471-480

(2010).

52. Jakubovics NS, Kolenbrander PE: The road to ruin: the formation of disease-associated

oral biofilms. Oral Dis 16(8), 729-739 (2010).

53. Bowen WH, Schilling K, Giertsen E et al.: Role of a cell surface-associated protein in

adherence and dental caries. Infect Immun 59(12), 4606-4609 (1991).

54. Amaechi BT, Higham SM, Edgar WM, Milosevic A: Thickness of acquired salivary

pellicle as a determinant of the sites of dental erosion. J Dent Res 78(12), 1821-1828

(1999).

55. Kuramitsu HK, He X, Lux R, Anderson MH, Shi W: Interspecies interactions within oral

microbial communities. Microbiol Mol Biol Rev 71(4), 653-670 (2007).

56. Carlsson J: Bacterial metabolism in dental biofilms. Adv Dent Res 11(1), 75-80 (1997).

106

57. Liljemark WF, Bloomquist C: Human oral microbial ecology and dental caries and

periodontal diseases. Crit Rev Oral Biol Med 7(2), 180-198 (1996).

58. Paster BJ, Boches SK, Galvin JL et al.: Bacterial diversity in human subgingival plaque.

J Bacteriol 183(12), 3770-3783 (2001).

59. Moore WE, Holdeman LV, Cato EP, Smibert RM, Burmeister JA, Ranney RR:

Bacteriology of moderate (chronic) periodontitis in mature adult humans. Infect Immun

42(2), 510-515 (1983).

60. He X, Hu W, Kaplan CW, Guo L, Shi W, Lux R: Adherence to streptococci facilitates

Fusobacterium nucleatum integration into an oral microbial community. Microb Ecol

63(3), 532-542 (2012).

61. Rosan B, Lamont RJ: Dental plaque formation. Microbes Infect 2(13), 1599-1607 (2000).

62. Das T, Sehar S, Manefield M: The roles of extracellular DNA in the structural integrity

of extracellular polymeric substance and bacterial biofilm development. Environ

Microbiol Rep 5(6), 778-786 (2013).

63. Koo H, Xiao J, Klein MI, Jeon JG: Exopolysaccharides produced by Streptococcus

mutans glucosyltransferases modulate the establishment of microcolonies within

multispecies biofilms. J Bacteriol 192(12), 3024-3032 (2010).

64. Kaplan JB: Biofilm dispersal: mechanisms, clinical Implications, and potential

therapeutic uses. J Dent Res 89(3), 205-218 (2010).

65. de la Fuente-Núñez C, Reffuveille F, Fernández L, Hancock REW: Bacterial biofilm

development as a multicellular adaptation: antibiotic resistance and new therapeutic

strategies. Curr Opin Microbiol 16(5), 580-589 (2013).

66. Benítez-Páez A, Belda-Ferre P, Simón-Soro A, Mira A: Microbiota diversity and gene

expression dynamics in human oral biofilms. BMC Genomics 15(1), 1-13 (2014).

107

67. Kolenbrander PE, Andersen RN, Blehert DS, Egland PG, Foster JS, Palmer RJ:

Communication among oral bacteria. Microbiol Mol Biol Rev 66(3), 486-505 (2002).

68. Socransky SS, Haffajee AD: Periodontal microbial ecology. Periodontology 2000 38(1),

135-187 (2005).

69. Paju S, Scannapieco FA: Oral biofilms, periodontitis, and pulmonary infections. Oral Dis

13(6), 508-512 (2007).

70. Cabell CH, Abrutyn E, Karchmer AW: Bacterial endocarditis: the disease, treatment, and

prevention. Circulation 107(20), e185-e187 (2003).

71. McGhie D, Hutchison JG, Nye F, Ball AP: Infective endocarditis caused by

Streptococcus mutans. Br Heart J 39(4), 456-458 (1977).

72. Huck O TH, Davideau J L: Relationship between periodontal diseases and preterm birth:

recent epidemiological and biological data. J Pregnancy 2011, (2011).

73. Pucher J, Stewart J: Periodontal disease and diabetes mellitus. Curr Diab Rep 4(1), 46-50

(2004).

74. Li X, Kolltveit KM, Tronstad L, Olsen I: Systemic diseases caused by oral infection. Clin

Microbiol Rev 13(4), 547-558 (2000).

75. Shira Davenport E: Preterm low birthweight and the role of oral bacteria. J Oral

Microbiol 2, 10.3402/jom.v3402i3400.5779 (2010).

76. Fisher MA, Borgnakke WS, Taylor GW: Periodontal disease as a risk marker in coronary

heart disease and chronic kidney disease. Curr Opin Nephrol Hypertens. 19(6), 519-526

(2010).

77. Petersen PE, Bourgeois D, Ogawa H, Estupinan-Day S, Ndiaye C: The global burden of

oral diseases and risks to oral health. Bulletin of the World Health Organization 83, 661-

669 (2005).

108

78. Loesche WJ: The specific plaque hypothesis and the antimicrobial treatment of

periodontal disease. Dent Update 19(2), 68-74 (1992).

79. Emilson C-G, Krasse BO: Support for and implications of the specific plaque hypothesis.

Eur J Oral Sci 93(2), 96-104 (1985).

80. Theilade E: The non-specific theory in microbial etiology of inflammatory periodontal

diseases. J Clin Periodontol 13(10), 905-911 (1986).

81. Takahashi N, Nyvad B: The role of bacteria in the caries process: ecological perspectives.

J Dent Res 90(3), 294-303 (2011).

82. Whitmore SE, Lamont RJ: The pathogenic persona of community-associated oral

streptococci. Mol Microbiol 81(2), 305-314 (2011).

83. Knirsch W, Nadal D: Infective endocarditis in congenital heart disease. Eur J Pediatr

170(9), 1111-1127 (2011).

84. Whiley RA, Beighton D: Current classification of the oral streptococci. Oral Microbiol

Immunol 13(4), 195-216 (1998).

85. Kawamura Y, Hou X-G, Sultana F, Miura H, Ezaki T: Determination of 16S rRNA

sequences of Streptococcus mitis and Streptococcus gordonii and phylogenetic

relationships among members of the genus streptococcus. Int J Syst Bacteriol 45(2), 406-

408 (1995).

86. Hardie JM, Whiley RA: Classification and overview of the genera Streptococcus and

Enterococcus. J Appl Microbiol 83(S1), 1S-11S (1997).

87. Loesche WJ: Role of Streptococcus mutans in human dental decay. Microbiol Rev 50(4),

353-380 (1986).

88. Facklam R: What happened to the streptococci: overview of taxonomic and nomenclature

changes. Clin Microbiol Rev 15(4), 613-630 (2002).

109

89. Nakano K, Nomura R, Nemoto H et al.: Detection of novel serotype k Streptococcus

mutans in infective endocarditis patients. J Med Microbiol 56(10), 1413-1415 (2007).

90. Hung W-C, Tsai J-C, Hsueh P-R, Chia J-S, Teng L-J: Species identification of mutans

streptococci by groESL gene sequence. J Med Microbiol 54(9), 857-862 (2005).

91. Marsh PD: Role of the oral microflora in health. Microb Ecol Health Dis 12(3), (2011).

92. Whiley RA, Beighton D, Winstanley TG, Fraser HY, Hardie JM: Streptococcus

intermedius, Streptococcus constellatus, and Streptococcus anginosus (the Streptococcus

milleri group): association with different body sites and clinical infections. J Clin

Microbiol 30(1), 243-244 (1992).

93. Băncescu G, Dumitriu S, Băncescu A, Skaug N: Phenotypic characterization of some

anginosus group isolates from oral and maxillofacial infections. Roum Arch Microbiol

Immunol 57(2), 139-145 (1998).

94. Clarke JK: On the bacterial factor in the etiology of dental caries. Br J Exp Pathol 5(3),

141-147 (1924).

95. Hamada S, Slade HD: Biology, immunology, and cariogenicity of Streptococcus mutans.

Microbiol Rev 44(2), 331-384 (1980).

96. Robbins N, Szilagyi G, Tanowitz HB, Luftschein S, Baum SG: Infective endocarditis

caused by Streptococcus mutans: A complication of idiopathic hypertrophic subaortic

stenosis. Arch Intern Med 137(9), 1171-1174 (1977).

97. Schelenz S, Page AJF, Emmerson AM: Streptococcus mutans endocarditis: beware of

the‘ diphtheroid’. J R Soc Med 98(9), 420-421 (2005).

98. Lapirattanakul J, Nakano K: Mother-to-child transmission of mutans streptococci. Future

Microbiol 9(6), 807-823 (2014).

99. Berkowitz RJ: Mutans streptococci: acquisition and transmission. Pediatr Dent 28(2),

106-109 (2006).

110

100. Biswas S, Biswas I: Complete genome sequence of Streptococcus mutans GS-5, a

serotype c strain. J Bacteriol 194(17), 4787-4788 (2012).

101. Ajdić D, McShan WM, McLaughlin RE et al.: Genome sequence of Streptococcus

mutans UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99(22), 14434-

14439 (2002).

102. Aikawa C, Furukawa N, Watanabe T et al.: Complete genome sequence of the serotype k

Streptococcus mutans strain LJ23. J Bacteriol 194(10), 2754-2755 (2012).

103. Maruyama F, Kobata M, Kurokawa K et al.: Comparative genomic analyses of

Streptococcus mutans provide insights into chromosomal shuffling and species-specific

content. BMC Genomics 10, 358-358 (2009).

104. Guo L, Hu W, He X, Lux R, McLean J, Shi W: Investigating acid production by

Streptococcus mutans with a surface-displayed pH-sensitive green fluorescent protein.

PLoS ONE 8(2), e57182 (2013).

105. Matsui R, Cvitkovitch D: Acid tolerance mechanisms utilized by Streptococcus mutans.

Future Microbiol 5(3), 403-417 (2010).

106. Hamilton IR, Buckley ND: Adaptation by Streptococcus mutans to acid tolerance. Oral

Microbiol Immunol 6(2), 65-71 (1991).

107. Li Y-H, Hanna MN, Svensäter G, Ellen RP, Cvitkovitch DG: Cell density modulates acid

adaptation in Streptococcus mutans: implications for survival in biofilms. J Bacteriol

183(23), 6875-6884 (2001).

108. Len ACL, Harty DWS, Jacques NA: Stress-responsive proteins are upregulated in

Streptococcus mutans during acid tolerance. Microbiology 150(5), 1339-1351 (2004).

109. Senadheera D, Krastel K, Mair R et al.: Inactivation of VicK affects acid production and

acid survival of Streptococcus mutans. J Bacteriol 191(20), 6415-6424 (2009).

111

110. Crowley PJ, Brady LJ, Michalek SM, Bleiweis AS: Virulence of a spaP mutant of

Streptococcus mutans in a gnotobiotic rat model. Infect Immun 67(3), 1201-1206 (1999).

111. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans

gtfC gene, coding for synthesis of both soluble and insoluble glucans. Infect Immun

56(8), 1999-2005 (1988).

112. Hanada N, Kuramitsu HK: Isolation and characterization of the Streptococcus mutans

gtfD gene, coding for primer-dependent soluble glucan synthesis. Infect Immun 57(7),

2079-2085 (1989).

113. Gilpin ML, Russell RR, Morrissey P: Cloning and expression of two Streptococcus

mutans glucosyltransferases in Escherichia coli K-12. Infect Immun 49(2), 414-416

(1985).

114. Wexler DL, Hudson MC, Burne RA: Streptococcus mutans fructosyltransferase (ftf) and

glucosyltransferase (gtfBC) operon fusion strains in continuous culture. Infect Immun

61(4), 1259-1267 (1993).

115. Koo H, Falsetta ML, Klein MI: The exopolysaccharide matrix: a virulence determinant of

cariogenic biofilm. J Dent Res 92(12), 1065-1073 (2013).

116. Yamashita Y, Bowen WH, Burne RA, Kuramitsu HK: Role of the Streptococcus mutans

gtf genes in caries induction in the specific-pathogen-free rat model. Infect Immun 61(9),

3811-3817 (1993).

117. Bowen WH, Koo H: Biology of Streptococcus mutans derived glucosyltransferases: Role

in extracellular matrix formation of cariogenic biofilms. Caries Res 45(1), 69-86 (2011).

118. Decker E-M, Dietrich I, Klein C, von Ohle C: Dynamic production of soluble

extracellular polysaccharides by Streptococcus mutans. Int J Dent 2011, 6 (2011).

119. Lynch DJ, Fountain TL, Mazurkiewicz JE, Banas JA: Glucan-binding proteins are

essential for shaping Streptococcus mutans biofilm architecture. FEMS Microbiol Lett

268(2), 158-165 (2007).

112

120. Banas JA, Potvin HC, Singh RN: The regulation of Streptococcus mutans glucan-binding

protein A expression. FEMS Microbiol Lett 154(2), 289-292 (1997).

121. Matsumoto-Nakano M, Fujita K, Ooshima T: Comparison of glucan-binding proteins in

cariogenicity of Streptococcus mutans. Oral Microbiol Immunol 22(1), 30-35 (2007).

122. Biswas I, Drake L, Biswas S: Regulation of gbpC expression in Streptococcus mutans. J

Bacteriol 189(18), 6521-6531 (2007).

123. Fujita K, Matsumoto-Nakano M, Inagaki S, Ooshima T: Biological functions of glucan-

binding protein B of Streptococcus mutans. Oral Microbiol Immunol 22(5), 289-292

(2007).

124. Mattos-Graner RO, Porter KA, Smith DJ, Hosogi Y, Duncan MJ: Functional analysis of

glucan binding protein B from Streptococcus mutans. J Bacteriol 188(11), 3813-3825

(2006).

125. Duque C, Stipp RN, Wang B et al.: Downregulation of GbpB, a component of the VicRK

regulon, affects biofilm formation and cell surface characteristics of Streptococcus

mutans. Infect Immun 79(2), 786-796 (2011).

126. Matsumura M, Izumi T, Matsumoto M, Tsuji M, Fujiwara T, Ooshima T: The role of

glucan-binding proteins in the cariogenicity of Streptococcus mutans. Microbiol Immunol

47(3), 213-215 (2003).

127. Nakano K, Matsumura M, Kawaguchi M et al.: Attenuation of glucan-binding protein C

reduces the cariogenicity of Streptococcus mutans: analysis of strains isolated from

human blood. J Dent Res 81(6), 376-379 (2002).

128. Rutherford ST, Bassler BL: Bacterial quorum sensing: its role in virulence and

possibilities for its control. Cold Spring Harb Perspect Med 2(11), (2012).

129. Cuadra-Saenz G, Rao DL, Underwood AJ et al.: Autoinducer-2 influences interactions

amongst pioneer colonizing streptococci in oral biofilms. Microbiology 158(7), 1783-

1795 (2012).

113

130. Jimenez JC, Federle MJ: Quorum sensing in group A Streptococcus. Front Cell Infect

Microbiol 4, 127 (2014).

131. Fleuchot B, Gitton C, Guillot A et al.: Rgg proteins associated with internalized small

hydrophobic peptides: a new quorum-sensing mechanism in streptococci. Mol Microbiol

80(4), 1102-1119 (2011).

132. Mashburn-Warren L, Morrison DA, Federle MJ: A novel double-tryptophan peptide

pheromone controls competence in Streptococcus spp. via an Rgg regulator. Mol

Microbiol 78(3), 589-606 (2010).

133. Stock AM, Robinson VL, Goudreau PN: Two-component signal transduction. Annu Rev

Biochem 69(1), 183-215 (2000).

134. Bijlsma JJE, Groisman EA: Making informed decisions: regulatory interactions between

two-component systems. Trends Microbiol 11(8), 359-366 (2003).

135. West AH, Stock AM: Histidine kinases and response regulator proteins in two-

component signaling systems. Trends Biochem Sci 26(6), 369-376 (2001).

136. Stipp RN, Boisvert H, Smith DJ, Höfling JF, Duncan MJ, Mattos-Graner RO: CovR and

VicRK regulate cell surface biogenesis genes required for biofilm formation in

Streptococcus mutans. PLoS ONE 8(3), e58271 (2013).

137. Chen P-M, Chen H-C, Ho C-T et al.: The two-component system ScnRK of

Streptococcus mutans affects hydrogen peroxide resistance and murine macrophage

killing. Microbes Infect 10(3), 293-301 (2008).

138. Deng DM, Liu MJ, ten Cate JM, Crielaard W: The VicRK system of Streptococcus

mutans responds to oxidative stress. J Dent Res 86(7), 606-610 (2007).

139. Smith EG, Spatafora GA: Gene regulation in S. mutans : complex control in a complex

environment. J Dent Res 91(2), 133-141 (2012).

114

140. Idone V, Brendtro S, Gillespie R et al.: Effect of an orphan response regulator on

Streptococcus mutans sucrose-dependent adherence and cariogenesis. Infect Immun

71(8), 4351-4360 (2003).

141. Sztajer H, Lemme A, Vilchez R et al.: Autoinducer-2-Regulated Genes in Streptococcus

mutans UA159 and Global Metabolic Effect of the luxS Mutation. J Bacteriol 190(1),

401-415 (2008).

142. Federle MJ, Morrison DA: One if by land, two if by sea: signalling to the ranks with CSP

and XIP. Mol Microbiol 86(2), 241-245 (2012).

143. Li Y-H, Tang N, Aspiras MB et al.: A quorum-sensing signaling system essential for

genetic competence in Streptococcus mutans is involved in biofilm formation. J Bacteriol

184(10), 2699-2708 (2002).

144. Ahn S-J, Wen ZT, Burne RA: Multilevel control of competence development and stress

tolerance in Streptococcus mutans UA159. Infect Immun 74(3), 1631-1642 (2006).

145. Aspiras MB, Ellen RP, Cvitkovitch DG: ComX activity of Streptococcus mutans growing

in biofilms. FEMS Microbiol Lett 238(1), 167-174 (2004).

146. Khan R, Rukke HV, Ricomini Filho AP, Fimland G, Arntzen MT, Bernd, Petersen FC:

Extracellular identification of a processed type II ComR/ComS pheromone of

Streptococcus mutans. J Bacteriol 194(15), 3781-3788 (2012).

147. Li Y-H, Lau PCY, Lee JH, Ellen RP, Cvitkovitch DG: Natural genetic transformation of

Streptococcus mutans growing in biofilms. J Bacteriol 183(3), 897-908 (2001).

148. Desai K, Mashburn-Warren L, Federle MJ, Morrison DA: Development of competence

for genetic transformation of Streptococcus mutans in a chemically defined medium. J

Bacteriol 194(15), 3774-3780 (2012).

149. Lemme A, Gröbe L, Reck M, Tomasch J, Wagner-Döbler I: Subpopulation-specific

transcriptome analysis of competence-stimulating-peptide-induced Streptococcus mutans.

J Bacteriol 193(8), 1863-1877 (2011).

115

150. Son M, Ahn S-J, Guo Q, Burne RA, Hagen SJ: Microfluidic study of competence

regulation in Streptococcus mutans: environmental inputs modulate bimodal and

unimodal expression of comX. Mol Microbiol 86(2), 258-272 (2012).

151. Johnsborg O, Eldholm V, Håvarstein LS: Natural genetic transformation: prevalence,

mechanisms and function. Res Microbiol 158(10), 767-778 (2007).

152. van der Ploeg JR: Regulation of bacteriocin production in Streptococcus mutans by the

quorum-sensing system required for development of genetic competence. J Bacteriol

187(12), 3980-3989 (2005).

153. Cvitkovitch DG: Genetic competence and transformation in oral streptococci. Crit Rev

Oral Biol Med 12(3), 217-243 (2001).

154. Oggioni MR, Morrison DA: Cooperative Regulation of Competence Development in

Streptococcus pneumoniae: Cell-to-Cell Signaling via a Peptide Pheromone and an

Alternative Sigma Factor. In: Chemical Communication among Bacteria. American

Society of Microbiology, (2008).

155. Petersen FC, Scheie AA: Genetic transformation in Streptococcus mutans requires a

peptide secretion–like apparatus. Oral Microbiol Immunol 15(5), 329-334 (2000).

156. Hossain MS, Biswas I: An Extracelluar Protease, SepM, Generates Functional

Competence-Stimulating Peptide in Streptococcus mutans UA159. J Bacteriol 194(21),

5886-5896 (2012).

157. Perry JA, Jones MB, Peterson SN, Cvitkovitch DG, Lévesque CM: Peptide alarmone

signalling triggers an auto-active bacteriocin necessary for genetic competence. Mol

Microbiol 72(4), 905-917 (2009).

158. Sztajer H, Szafranski SP, Tomasch J et al.: Cross-feeding and interkingdom

communication in dual-species biofilms of Streptococcus mutans and Candida albicans.

ISME J 8(11), 2256-2271 (2014).

116

159. Appenroth K-J: Definition of “heavy metals” and their role in biological systems. In: Soil

heavy metals. Springer Berlin Heidelberg, 19-29 (2010).

160. Anastassopoulou J, Theophanides T: The role of metal ions in biological systems and

medicine. In: Bioinorganic Chemistry, Kessissoglou D. Springer Netherlands, 209-218

(1995).

161. Ma Z, Jacobsen FE, Giedroc DP: Metal transporters and metal sensors: how coordination

chemistry controls bacterial metal homeostasis. Chem Rev 109(10), 4644-4681 (2009).

162. Agranoff DD, Krishna S: Metal ion homeostasis and intracellular parasitism. Mol

Microbiol 28(3), 403-412 (1998).

163. Martin ME, Byers BR, Olson MO, Salin ML, Arceneaux JE, Tolbert C: A Streptococcus

mutans superoxide dismutase that is active with either manganese or iron as a cofactor. J

Biol Chem 261(20), 9361-9367 (1986).

164. Paik S, Brown A, Munro CL, Cornelissen CN, Kitten T: The sloABCR operon of

Streptococcus mutans encodes an Mn and Fe transport system required for endocarditis

virulence and its Mn-dependent repressor. J Bacteriol 185(20), 5967-5975 (2003).

165. He X, Wu C, Yarbrough D et al.: The cia operon of Streptococcus mutans encodes a

unique component required for calcium-mediated autoregulation. Mol Microbiol 70(1),

112-126 (2008).

166. Bani D BA: Developing ROS scavenging agents for pharmacological purposes: recent

advances in design of manganese-based complexes with anti-inflammatory and anti-

nociceptive activity. Curr. Med. Chem. 19(26), 4431-4444. (2012).

167. Rolerson E, Swick A, Newlon L et al.: The SloR/Dlg metalloregulator modulates

Streptococcus mutans virulence gene expression. J Bacteriol 188(14), 5033-5044 (2006).

168. Dunning DW, McCall LW, Powell WF et al.: SloR modulation of the Streptococcus

mutans acid tolerance response involves the GcrR response regulator as an essential

intermediary. Microbiology 154(4), 1132-1143 (2008).

117

169. Solioz M, Stoyanov JV: Copper homeostasis in Enterococcus hirae. FEMS Microbiol

Rev 27(2–3), 183-195 (2003).

170. Solioz M, Abicht H, Mermod M, Mancini S: Response of Gram-positive bacteria to

copper stress. J Biol Inorg Chem 15(1), 3-14 (2010).

171. Samanovic Marie I, Ding C, Thiele Dennis J, Darwin KH: Copper in microbial

pathogenesis: meddling with the metal. Cell Host Microbe 11(2), 106-115 (2012).

172. Rensing C, McDevitt S: The copper metallome in prokaryotic cells. In: Metallomics and

the Cell, Banci L. Springer Netherlands, 417-450 (2013).

173. Huat Lu Z, Dameron C, Solioz M: The Enterococcus hirae paradigm of copper

homeostasis: copper chaperone turnover, interactions, and transactions. Biometals 16(1),

137-143 (2003).

174. Cobine P, Wickramasinghe WA, Harrison MD, Weber T, Solioz M, Dameron CT: The

Enterococcus hirae copper chaperone CopZ delivers copper(I) to the CopY repressor.

FEBS Lett 445(1), 27-30 (1999).

175. Magnani D, Solioz M: Copper chaperone cycling and degradation in the regulation of the

cop operon of Enterococcus hirae. Biometals 18(4), 407-412 (2005).

176. Afseth J AS, Monell-Torrens E,, Brown WH RG, Brunelle J, et al.: Effect of copper

applied topically or in drinking water on experimental caries in rats. Caries Research 18,

434-439 (1984).

177. Drake DR, Grigsby W, Cardenzana A, Dunkerson D: Synergistic, growth-inhibitory

effects of chlorhexidine and copper combinations on Streptococcus mutans, Actinomyces

viscosus, and Actinomyces naeslundii. J Dent Res 72(2), 524-528 (1993).

178. Vats N, Lee SF: Characterization of a copper-transport operon, copYAZ, from

Streptococcus mutans. Microbiology 147(3), 653-662 (2001).

118

179. Wakeman CA, Skaar EP: Metalloregulation of Gram-positive pathogen physiology. Curr

Opin Microbiol 15(2), 169-174 (2012).

180. Ma Z, Jacobsen FE, Giedroc DP: Metal transporters and metal sensors: how coordination

chemistry controls bacterial metal homeostasis. Chem Rev 109 (10), 4644–4681 (2010).

181. Finney LA, O'Halloran TV: Transition metal speciation in the cell: Insights from the

chemistry of metal ion receptors. Science 300(5621), 931-936 (2003).

182. Honsa ES, Johnson MDL, Rosch JW: The roles of transition metals in the physiology and

pathogenesis of Streptococcus pneumoniae. Front Cell Infect Microbiol 3, (2013).

183. Waldron KJ, Robinson NJ: How do bacterial cells ensure that metalloproteins get the

correct metal? Nat Rev Microbiol 7, 25-35 (2009).

184. Irving H, Williams RJP: The stability of transition-metal complexes. J Chem Soc, 3192-

3210 (1953).

185. Hoshino N, Kimura T, Yamaji A, Ando T: Damage to the cytoplasmic membrane of

Escherichia coli by catechin-copper (II) complexes. Free Radic Biol Med 27(11–12),

1245-1250 (1999).

186. Stohs SJ, Bagchi D: Oxidative mechanisms in the toxicity of metal ions. Free Radic Biol

Med 18(2), 321-336 (1995).

187. Hood MI, Skaar EP: Nutritional immunity: transition metals at the pathogen–host

interface. Nat Rev Microbiol 10(8), 525-537 (2012).

188. Cassat J, Skaar E: Metal ion acquisition in Staphylococcus aureus: overcoming

nutritional immunity. Semin Immunopathol 34(2), 215-235 (2012).

189. Montanini B BD, Jeandroz S, Sanders D, Chalot M.: Phylogenetic and functional analysis

of the Cation Diffusion Facilitator (CDF) family: improved signature and prediction of

substrate specificity. BMC Genomics 8(107), (2007 ).

119

190. Argüello J, Eren E, González-Guerrero M: The structure and function of heavy metal

transport P1B-ATPases. Biometals 20(3-4), 233-248 (2007).

191. Klein JS, Lewinson O: Bacterial ATP-driven transporters of transition metals:

physiological roles, mechanisms of action, and roles in bacterial virulence. Metallomics

3(11), 1098-1108 (2011).

192. Murakami S: Multidrug efflux transporter, AcrB—the pumping mechanism. Curr Opin

Struct Biol 18(4), 459-465 (2008).

193. Chen PR, He C: Selective recognition of metal ions by metalloregulatory proteins. Curr

Opin Chem Biol 12(2), 214-221 (2008).

194. Merchant AT, Spatafora GA: A role for the DtxR family of metalloregulators in gram-

positive pathogenesis. Mol Oral Microbiol 29(1), 1-10 (2014).

195. Giedroc DP, Arunkumar AI: Metal sensor proteins: nature's metalloregulated allosteric

switches. Dalton Trans (29), 3107-3120 (2007).

196. Oglesby-Sherrouse AG, Murphy ER: Iron-responsive bacterial small RNAs: variations on

a theme. Metallomics 5(4), 276-286 (2013).

197. Roche B, Aussel L, Ezraty B, Mandin P, Py B, Barras F: Iron/sulfur proteins biogenesis

in prokaryotes: Formation, regulation and diversity. Biochim Biophys Acta 1827(3), 455-

469 (2013).

198. Canessa P, Larrondo L: Environmental responses and the control of iron homeostasis in

fungal systems. Appl Microbiol Biotechnol 97(3), 939-955 (2013).

199. Franza T, Expert D: Role of iron homeostasis in the virulence of phytopathogenic

bacteria: an ‘à la carte’ menu. Mol Plant Pathol 14(4), 429-438 (2013).

200. Cassat James E, Skaar Eric P: Iron in Infection and Immunity. Cell Host Microbe 13(5),

509-519 (2013).

120

201. Cornelis P, Wei Q, Andrews SC, Vinckx T: Iron homeostasis and management of

oxidative stress response in bacteria. Metallomics 3(6), 540-549 (2011).

202. Andreini C, Banci L, Bertini I, Rosato A: Occurrence of copper proteins through the

three domains of life: A bioinformatic approach. J Proteome Res 7(1), 209-216 (2007).

203. Dupont CL, Grass G, Rensing C: Copper toxicity and the origin of bacterial resistance-

new insights and applications. Metallomics 3(11), 1109-1118 (2011).

204. Macomber L, Rensing C, Imlay JA: Intracellular copper does not catalyze the formation

of oxidative DNA damage in Escherichia coli. J Bacteriol 189(5), 1616-1626 (2007).

205. Achard MES, Tree JJ, Holden JA et al.: The multi-copper-ion oxidase CueO of

Salmonella enterica serovar typhimurium is required for systemic virulence. Infect

Immun 78(5), 2312-2319 (2010).

206. Fung DKC, Lau WY, Chan WT, Yan A: Copper efflux is induced during anaerobic

amino acid limitation in Escherichia coli to protect iron-sulfur cluster enzymes and

biogenesis. J Bacteriol 195(20), 4556-4568 (2013).

207. Hodgkinson V, Petris MJ: Copper homeostasis at the host-pathogen interface. J Biol

Chem 287(17), 13549-13555 (2012).

208. Rademacher C, Masepohl B: Copper-responsive gene regulation in bacteria.

Microbiology 158(Pt 10), 2451-2464 (2012).

209. Grass G, Rensing C: Genes involved in copper homeostasis in Escherichia coli. J

Bacteriol 183(6), 2145-2147 (2001).

210. Gudipaty SA, Larsen AS, Rensing C, McEvoy MM: Regulation of Cu(I)/Ag(I) efflux

genes in Escherichia coli by the sensor kinase CusS. FEMS Microbiol Lett 330(1), 30-37

(2012).

121

211. Outten FW, Huffman DL, Hale JA, O'Halloran TV: The independent cue and cus systems

confer copper tolerance during aerobic and anaerobic growth in Escherichia coli. J Biol

Chem 276(33), 30670-30677 (2001).

212. Rensing C, Fan B, Sharma R, Mitra B, Rosen BP: CopA: An Escherichia coli Cu(I)-

translocating P-type ATPase. Proc Natl Acad Sci U S A 97(2), 652-656 (2000).

213. Yamamoto K, Ishihama A: Transcriptional response of Escherichia coli to external

copper. Mol Microbiol 56(1), 215-227 (2005).

214. Munson GP, Lam DL, Outten FW, O'Halloran TV: Identification of a copper-responsive

two-component system on the chromosome of Escherichia coli K-12. J Bacteriol

182(20), 5864-5871 (2000).

215. Schelder S, Zaade D, Litsanov B, Bott M, Brocker M: The two-component signal

transduction system CopRS of Corynebacterium glutamicum is required for adaptation to

copper-excess stress. PLoS ONE 6(7), e22143 (2011).

216. Giner-Lamia J, López-Maury L, Reyes JC, Florencio FJ: The CopRS two-component

system is responsible for resistance to copper in the cyanobacterium Synechocystis sp.

PCC 6803. Plant Physiol 159(4), 1806-1818 (2012).

217. Yamamoto K, Ishihama A: Characterization of copper-inducible promoters regulated by

CpxA/CpxR in Escherichia coli. Biosci Biotechnol Biochem 70(7), 1688-1695 (2006).

218. Ge Z, Taylor DE: Helicobacter pylori genes hpcopA and hpcopP constitute a cop operon

involved in copper export. FEMS Microbiol Lett 145(2), 181-188 (1996).

219. Waidner B, Melchers K, Stähler FN, Kist M, Bereswill S: The Helicobacter pylori

CrdRS two-component regulation system (HP1364/HP1365) is required for copper-

mediated induction of the copper resistance determinant CrdA. J Bacteriol 187(13),

4683-4688 (2005).

122

220. Rouch DA, Brown NL: Copper-inducible transcriptional regulation at two promoters in

the Escherichia coli copper resistance determinant pco. Microbiology 143(4), 1191-1202

(1997).

221. Mills SD, Jasalavich CA, Cooksey DA: A two-component regulatory system required for

copper-inducible expression of the copper resistance operon of Pseudomonas syringae. J

Bacteriol 175(6), 1656-1664 (1993).

222. Mellano MA, Cooksey DA: Induction of the copper resistance operon from Pseudomonas

syringae. J Bacteriol 170(9), 4399-4401 (1988).

223. Mellano MA, Cooksey DA: Nucleotide sequence and organization of copper resistance

genes from Pseudomonas syringae pv. tomato. J Bacteriol 170(6), 2879-2883 (1988).

224. Mills S, Lim C-K, Cooksey D: Purification and characterization of CopR, a

transcriptional activator protein that binds to a conserved domain (cop box) in copper-

inducible promoters of Pseudomonas syringae. Mol Gen Genet 244(4), 341-351 (1994).

225. Hu Y-h, Wang H-l, Zhang M, Sun L: Molecular analysis of the copper-responsive

CopRSCD of a pathogenic Pseudomonas fluorescens strain. J Microbiol 47(3), 277-286

(2009).

226. Zhang X-X, Rainey PB: Regulation of copper homeostasis in Pseudomonas fluorescens

SBW25. Environ Microbiol 10(12), 3284-3294 (2008).

227. Silver S: Bacterial silver resistance: molecular biology and uses and misuses of silver

compounds. FEMS Microbiol Rev 27(2-3), 341-353 (2003).

228. Galdiero S, Falanga A, Vitiello M, Cantisani M, Marra V, Galdiero M: Silver

Nanoparticles as Potential Antiviral Agents. Molecules 16(10), 8894-8918 (2011).

229. Borgstahl GEO, Pokross M, Chehab R, Sekher A, Snell EH: Cryo-trapping the six-

coordinate, distorted-octahedral active site of manganese superoxide dismutase. J Mol

Biol 296(4), 951-959 (2000).

123

230. Barynin VV, Whittaker MM, Antonyuk SV et al.: Crystal structure of manganese

catalase from Lactobacillus plantarum. Structure 9(8), 725-738 (2001).

231. Bencini A FP, Valtancoli B, Bani D.: Low molecular weight compounds with transition

metals as free radical scavengers and novel therapeutic agents. Cardiovasc Hematol

Agents Med Chem 8(3), 128-146 (2010 ).

232. Que Q, Helmann JD: Manganese homeostasis in Bacillus subtilis is regulated by MntR, a

bifunctional regulator related to the diphtheria toxin repressor family of proteins. Mol

Microbiol 35(6), 1454-1468 (2000).

233. Corstjens PL, de Vrind JP, Westbroek P, de Vrind-de Jong EW: Enzymatic iron oxidation

by Leptothrix discophora: identification of an iron-oxidizing protein. Appl Environ

Microbiol 58(2), 450-454 (1992).

234. Geszvain K, Tebo BM: Identification of a two-component regulatory pathway essential

for Mn(II) oxidation in Pseudomonas putida GB-1. Appl Environ Microbiol 76(4), 1224-

1231 (2010).

235. Yachandra V, DeRose V, Latimer M, Mukerji I, Sauer K, Klein M: Where plants make

oxygen: a structural model for the photosynthetic oxygen-evolving manganese cluster.

Science 260(5108), 675-679 (1993).

236. Bartsevich VV, Pakrasi HB: Manganese transport in the cyanobacterium Synechocystis

sp. PCC 6803. J Biol Chem 271(42), 26057-26061 (1996).

237. Ogawa T, Bao DH, Katoh H, Shibata M, Pakrasi HB, Bhattacharyya-Pakrasi M: A two-

component signal transduction pathway regulates manganese homeostasis in

Synechocystis 6803, a photosynthetic organism. J Biol Chem 277(32), 28981-28986

(2002).

238. Yamaguchi K, Suzuki I, Yamamoto H et al.: A two-component Mn2+-sensing system

negatively regulates expression of the mntCAB operon in Synechocystis. Plant Cell

14(11), 2901-2913 (2002).

124

239. Missiakas D, Raina S: Signal transduction pathways in response to protein misfolding in

the extracytoplasmic compartments of E. coli: role of two new phosphoprotein

phosphatases PrpA and PrpB. EMBO J 16(7), 1670-1685 (1997).

240. Lucana DOdO, Zou P, Nierhaus M, Schrempf H: Identification of a novel two-

component system SenS/SenR modulating the production of the catalase-peroxidase

CpeB and the haem-binding protein HbpS in Streptomyces reticuli. Microbiology

151(11), 3603-3614 (2005).

241. Jakubovics NS, Jenkinson HF: Out of the iron age: new insights into the critical role of

manganese homeostasis in bacteria. Microbiology 147(7), 1709-1718 (2001).

242. Pang X, Cao G, Neuenschwander PF, Haydel SE, Hou G, Howard ST: The β-propeller

gene Rv1057 of Mycobacterium tuberculosis has a complex promoter directly regulated

by both the MprAB and TrcRS two-component systems. Tuberculosis (Edinb) 91, S142-

S149 (2011).

243. Haydel SE, Dunlap NE, Benjamin Jr WH: In vitro evidence of two-component system

phosphorylation between the Mycobacterium tuberculosis TrcR/TrcS proteins. Microb

Pathog 26(4), 195-206 (1999).

244. Haydel SE, Clark-Curtiss JE: The Mycobacterium tuberculosis response regulator

represses transcription of the intracellularly expressed rv1057 gene, encoding a seven-

bladed β-propeller. J Bacteriol 188(1), 150-159 (2006).

245. Loesche WJ: Role of Streptococcus mutans in human dental decay. Microbiol. Mol. Biol.

Rev. 50(4), 353-380 (1986).

246. Rowley G, Spector M, Kormanec J, Roberts M: Pushing the envelope: extracytoplasmic

stress responses in bacterial pathogens. Nat Rev Micro 4(5), 383-394 (2006).

247. Leblanc SKD, Oates CW, Raivio TL: Characterization of theinduction and cellular role

of the BaeSR two-component envelope stress response of Escherichia coli. J Bacteriol

193(13), 3367-3375 (2011).

125

248. Wang D, Fierke CA: The BaeSR regulon is involved in defense against zinc toxicity in E.

coli. Metallomics 5(4), 372-383 (2013).

249. Appia-Ayme C, Patrick E, J. Sullivan M et al.: Novel inducers of the envelope stress

response BaeSR in Salmonella typhimurium: BaeR is critically required for tungstate

waste disposal. PLoS ONE 6(8), e23713 (2011).

250. Zoetendal EG, Smith AH, Sundset MA, Mackie RI: The BaeSR two-component

regulatory system mediates resistance to condensed tannins in Escherichia coli. Appl

Environ Microbiol 74(2), 535-539 (2008).

251. Ogasawara H, Shinohara S, Yamamoto K, Ishihama A: Novel regulation targets of the

metal-response BasS–BasR two-component system of Escherichia coli. Microbiology

158(Pt 6), 1482-1492 (2012).

252. Hagenmaier S, Stierhof YD, Henning U: A new periplasmic protein of Escherichia coli

which is synthesized in spheroplasts but not in intact cells. J Bacteriol 179(6), 2073-2076

(1997).

253. Nishino K, Nikaido E, Yamaguchi A: Regulation of multidrug efflux systems involved in

multidrug and metal resistance of Salmonella enterica serovar typhimurium. J Bacteriol

189(24), 9066-9075 (2007).

254. Leonhartsberger S, Huber A, Lottspeich F, Böck A: The hydH/G genes from Escherichia

coli code for a zinc and lead responsive two-component regulatory system. J Mol Biol

307(1), 93-105 (2001).

255. Appia Ayme C, Hall A, Patrick E, Rajadurai S, Clarke TA, Rowley G: ZraP is a

periplasmic molecular chaperone and a repressor of the zinc-responsive two-component

regulator ZraSR. Biochem J 442(1), 85-93 (2012).

256. Hassan M-e-T, van der Lelie D, Springael D, Römling U, Ahmed N, Mergeay M:

Identification of a gene cluster, czr, involved in cadmium and zinc resistance in

Pseudomonas aeruginosa. Gene 238(2), 417-425 (1999).

126

257. Rensing C, Pribyl T, Nies DH: New functions for the three subunits of the CzcCBA

cation-proton antiporter. J Bacteriol 179(22), 6871-6879 (1997).

258. Dieppois G, Ducret V, Caille O, Perron K: The transcriptional regulator CzcR modulates

antibiotic resistance and quorum sensing in Pseudomonas aeruginosa. PLoS ONE 7(5),

e38148 (2012).

259. Caille O, Rossier C, Perron K: A copper-activated two-component system interacts with

zinc and imipenem resistance in Pseudomonas aeruginosa. J Bacteriol 189(13), 4561-

4568 (2007).

260. Mulrooney SB, Hausinger RP: Nickel uptake and utilization by microorganisms. FEMS

Microbiol Rev 27(2-3), 239-261 (2003).

261. Ragsdale SW: Nickel-based enzyme systems. J Biol Chem 284(28), 18571-18575 (2009).

262. Costa M, Sutherlandurname J, Peng W, Salnikow K, Broday L, Kluz T: Molecular

biology of nickel carcinogenesis. Mol Cell Biochem 222(1-2), 205-211 (2001).

263. Von Burg R: Nickel and some nickel compounds. J Appl Toxicol 17(6), 425-431 (1997).

264. Fontecilla-Camps JC, Volbeda A, Cavazza C, Nicolet Y: Structure/function relationships

of [Ni-Fe] and [Fe-Fe] hydrogenases. Chem Rev 107(10), 4273-4303 (2007).

265. Maroney MJ: Structure/function relationships in nickel metallobiochemistry. Curr Opin

Chem Biol 3(2), 188-199 (1999).

266. Dosanjh NS, Michel SLJ: Microbial nickel metalloregulation: NikRs for nickel ions.

Curr Opin Chem Biol 10(2), 123-130 (2006).

267. Eitinger T, Mandrand-Berthelot MA: Nickel transport systems in microorganisms. Arch

Microbiol 173(1), 1-9 (2000).

268. Nies DH: Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev

27(2-3), 313-339 (2003).

127

269. Navarro C, Wu L-F, Mandrand-Berthelot M-A: The nik operon of Escherichia coli

encodes a periplasmic binding-protein-dependent transport system for nickel. Mol

Microbiol 9(6), 1181-1191 (1993).

270. Wu LF, Mandrand-Berthelot MA, Waugh R, Edmonds CJ, Holt SE, Boxer DH: Nickel

deficiency gives rise to the defective hydrogenase phenotype of hydc and fnr mutants in

Escherichia coli. Mol Microbiol 3(12), 1709-1718 (1989).

271. Chivers PT, Sauer RT: Regulation of high affinity nickel uptake in bacteria: Ni2+-

dependent interaction of NikR with wild-type and mutant operator sites. J Biol Chem

275(26), 19735-19741 (2000).

272. De Pina K, Desjardin V, Mandrand-Berthelot M-A, Giordano G, Wu L-F: Isolation and

characterization of the nikR gene encoding a nickel-responsive regulator in Escherichia

coli. J Bacteriol 181(2), 670-674 (1999).

273. Rowe JL, Starnes GL, Chivers PT: Complex transcriptional control links NikABCDE-

dependent nickel transport with hydrogenase expression in Escherichia coli. J Bacteriol

187(18), 6317-6323 (2005).

274. López-Maury L, García-Domínguez M, Florencio FJ, Reyes JC: A two-component signal

transduction system involved in nickel sensing in the cyanobacterium Synechocystis sp.

PCC 6803. Mol Microbiol 43(1), 247-256 (2002).

275. Foster AW, Patterson CJ, Pernil R, Hess CR, Robinson NJ: Cytosolic Ni(II) Sensor in

Cyanobacterium: Nickel detection follows nickel affinity across four families of metal

sensors. J Biol Chem 287(15), 12142-12151 (2012).

276. Bouzat J, Hoostal M: Evolutionary analysis and lateral gene transfer of two-component

regulatory systems associated with heavy-metal tolerance in bacteria. J Mol Evol 76(5),

267-279 (2013).

128

277. Ridge PG, Zhang Y, Gladyshev VN: Comparative genomic analyses of copper

transporters and cuproproteomes reveal evolutionary dynamics of copper utilization and

its link to oxygen. PLoS ONE 3(1), e1378 (2008).

278. Macomber L, Imlay JA: The iron-sulfur clusters of dehydratases are primary intracellular

targets of copper toxicity. Proc Natl Acad Sci U S A 106(20), 8344-8349 (2009).

279. Mitrakul K, Loo CY, Hughes CV, Ganeshkumar N: Role of a Streptococcus gordonii

copper-transport operon, copYAZ, in biofilm detachment. Oral Microbiol Immunol 19(6),

395-402 (2004).

280. Chen P-M, Chen J-Y, Chia J-S: Differential regulation of Streptococcus mutans gtfBCD

genes in response to copper ions. Arch Microbiol 185(2), 127-135 (2006).

281. Dunning JC, Ma Y, Marquis RE: Anaerobic killing of oral streptococci by reduced,

transition metal cations. Appl Environ Microbiol 64(1), 27-33 (1998).

282. Arredondo M, Núñez MT: Iron and copper metabolism. Mol Aspects Med 26(4–5), 313-

327 (2005).

283. Warnes SL, Caves V, Keevil CW: Mechanism of copper surface toxicity in Escherichia

coli O157:H7 and Salmonella involves immediate membrane depolarization followed by

slower rate of DNA destruction which differs from that observed for Gram-positive

bacteria. Environ Microbiol 14(7), 1730-1743 (2012).

284. Dreizen S, Spies HA, Spies TD: The copper and cobalt levels of human saliva and dental

caries activity. J Dent Res 31(1), 137-142 (1952).

285. Grytten J, Tollefsen T, Afseth J: The effect of a combination of copper and hexetidine on

plaque formation and the amount of copper retained by dental plaque bacteria. Acta

Odontol Scand 45(6), 429-433 (1987).

286. Grytten J, Aamdal Scheie A, Afseth J: Effect of a combination of copper and hexetidine

on the acidogenicity and copper accumulation in dental plaque in vivo. Caries Res 22(6),

(1988 ).

129

287. Mahler DB: The high-copper dental amalgam alloys. J Dent Res 76(1), 537-541 (1997).

288. Afseth J, Amsbaugh SM, Monell-Torrens E et al.: Effect of copper applied topically or in

drinking water on experimental caries in rats. Caries Res 18(5), 434-439 (1984).

289. Afseth J: Some aspects of the dynamics of Cu and Zn retained in plaque as related to

their effect on plaque pH. Eur J Oral Sci 91(3), 169-174 (1983).

290. Bales CW, Freeland-Graves JH, Askey S et al.: Zinc, magnesium, copper, and protein

concentrations in human saliva: age- and sex-related differences. Am J Clin Nutr 51(3),

462-469 (1990).

291. Afseth J, Oppermann RV, Rølla G: Accumulation of Cu and Zn in human dental plaque

in vivo. Caries Res 17(4), 310-314 (1983).

292. Maltz M, Emilson C-G: Effect of copper fluoride and copper sulfate on dental plaque,

Streptococcus mutans and caries in hamsters. Eur J Oral Sci 96(5), 390-392 (1988).

293. Odermatt A, Suter H, Krapf R, Solioz M: Primary structure of two P-type ATPases

involved in copper homeostasis in Enterococcus hirae. J Biol Chem 268(17), 12775-

12779 (1993).

294. Lu ZH, Solioz M: Copper-induced proteolysis of the CopZ copper chaperone of

Enterococcus hirae. J Biol Chem 276(51), 47822-47827 (2001).

295. Page WJ, Sadoff HL: Physiological factors affecting transformation of Azotobacter

vinelandii. J Bacteriol 125(3), 1080-1087 (1976).

296. Trombe M-C: Characterization of a calcium porter of Streptococcus pneumoniae

involved in calcium regulation of growth and competence. J Gen Microbiol 139(3), 433-

439 (1993).

297. Page WJ, Doran JL: Recovery of competence in calcium-limited Azotobacter vinelandii.

J Bacteriol 146(1), 33-40 (1981).

130

298. Wenderska IB, Lukenda N, Cordova M, Magarvey N, Cvitkovitch DG, Senadheera DB:

A novel function for the competence inducing peptide, XIP, as a cell death effector of

Streptococcus mutans. FEMS Microbiol Lett 336(2), 104-112 (2012).

299. Petersen FC, Tao L, Scheie AA: DNA binding-uptake system: a link between cell-to-cell

communication and biofilm formation. J Bacteriol 187(13), 4392-4400 (2005).

300. van de Rijn I, Kessler RE: Growth characteristics of group A streptococci in a new

chemically defined medium. Infect Immun 27(2), 444-448 (1980).

301. Suntharalingam P, Senadheera MD, Mair RW, Lévesque CM, Cvitkovitch DG: The

LiaFSR system regulates the cell envelope stress response in Streptococcus mutans. J

Bacteriol 191(9), 2973-2984 (2009).

302. Lau PCY, Sung CK, Lee JH, Morrison DA, Cvitkovitch DG: PCR ligation mutagenesis

in transformable streptococci: application and efficiency. J Microbiol Methods 49(2),

193-205 (2002).

303. Biswas I, Jha JK, Fromm N: Shuttle expression plasmids for genetic studies in

Streptococcus mutans. Microbiology 154(8), 2275-2282 (2008).

304. LeBlanc DJ, Lee LN, Abu-Al-Jaibat A: Molecular, genetic, and functional analysis of the

basic replicon of pVA380-1, a plasmid of oral streptococcal origin. Plasmid 28(2), 130-

145 (1992).

305. Perry JA, Lévesque CM, Suntharaligam P et al.: Involvement of Streptococcus mutans

regulator RR11 in oxidative stress response during biofilm growth and in the

development of genetic competence. Lett Appl Microbiol 47(5), 439-444 (2008).

306. Navarrete JU, Borrok DM, Viveros M, Ellzey JT: Copper isotope fractionation during

surface adsorption and intracellular incorporation by bacteria. Geochim Cosmochim Acta

75(3), 784-799 (2011).

307. Senadheera MD, Lee AWC, Hung DCI, Spatafora GA, Goodman SD, Cvitkovitch DG:

The Streptococcus mutans vicX gene product modulates gtfB/C expression, biofilm

131

formation, genetic competence, and oxidative stress tolerance. J Bacteriol 189(4), 1451-

1458 (2007).

308. Pfaffl MW: A new mathematical model for relative quantification in real-time RT–PCR.

Nucleic Acids Res 29(9), e45 (2001).

309. Pfaffl MW, Horgan GW, Dempfle L: Relative expression software tool (REST©) for

group-wise comparison and statistical analysis of relative expression results in real-time

PCR. Nucleic Acids Res 30(9), e36 (2002).

310. Fujiwara S, Kobayashi S, Nakayama H: Development of a minimal medium for

Streptococcus mutans. Arch Oral Biol 23(7), 601-602 (1978).

311. Hanna MN, Ferguson RJ, Li Y-H, Cvitkovitch DG: uvrA is an acid-inducible gene

involved in the adaptive response to low pH in Streptococcus mutans. J Bacteriol

183(20), 5964-5973 (2001).

312. Baker J, Sitthisak S, Sengupta M, Johnson M, Jayaswal RK, Morrissey JA: Copper stress

induces a global stress response in Staphylococcus aureus and represses sae and agr

expression and biofilm formation. Appl Environ Microbiol 76(1), 150-160 (2010).

313. Kershaw CJ, Brown NL, Constantinidou C, Patel MD, Hobman JL: The expression

profile of Escherichia coli K-12 in response to minimal, optimal and excess copper

concentrations. Microbiology 151(4), 1187-1198 (2005).

314. Teitzel GM, Geddie A, De Long SK, Kirisits MJ, Whiteley M, Parsek MR: Survival and

growth in the presence of elevated copper: transcriptional profiling of copper-stressed

Pseudomonas aeruginosa. J Bacteriol 188(20), 7242-7256 (2006).

315. Shafeeq S, Yesilkaya H, Kloosterman TG et al.: The cop operon is required for copper

homeostasis and contributes to virulence in Streptococcus pneumoniae. Mol Microbiol

81(5), 1255-1270 (2011).

316. Magnani D, Barré O, Gerber SD, Solioz M: Characterization of the CopR regulon of

Lactococcus lactis IL1403. J Bacteriol 190(2), 536-545 (2008).

132

317. Coelho Abrantes M, Lopes MdF, Kok J: Impact of manganese, copper and zinc ions on

the transcriptome of the nosocomial pathogen Enterococcus faecalis V583. PLoS ONE

6(10), e26519 (2011).

318. Rensing C, Grass G: Escherichia coli mechanisms of copper homeostasis in a changing

environment. FEMS Microbiol Rev 27(2-3), 197-213 (2003).

319. Cooksey DA: Copper uptake and resistance in bacteria. Mol Microbiol 7(1), 1-5 (1993).

320. Helbig K, Bleuel C, Krauss GJ, Nies DH: Glutathione and transition-metal homeostasis

in Escherichia coli. J Bacteriol 190(15), 5431-5438 (2008).

321. Fujishima K, Kawada-Matsuo M, Oogai Y, Tokuda M, Torii M, Komatsuzawa H: dpr

and sod in Streptococcus mutans are involved in coexistence with S. sanguinis, and PerR

is associated with resistance to H2O2. Appl Environ Microbiol 79(5), 1436-1443 (2013).

322. Yamamoto Y, Higuchi M, Poole LB, Kamio Y: Role of the dpr product in oxygen

tolerance in Streptococcus mutans. J Bacteriol 182(13), 3740-3747 (2000).

323. Yamamoto Y, Poole LB, Hantgan RR, Kamio Y: An iron-binding protein, Dpr, from

Streptococcus mutans prevents iron-dependent hydroxyl radical formation in vitro. J

Bacteriol 184(11), 2931-2939 (2002).

324. Nakayama K: Nucleotide sequence of Streptococcus mutans superoxide dismutase gene

and isolation of insertion mutants. J Bacteriol 174(15), 4928-4934 (1992).

325. Strahl H, Hamoen LW: Membrane potential is important for bacterial cell division. Proc

Natl Acad Sci U S A 107(27), 12281-12286 (2010).

326. Bakker EP, Mangerich WE: Interconversion of components of the bacterial proton

motive force by electrogenic potassium transport. J Bacteriol 147(3), 820-826 (1981).

327. Beveridge TJ, Murray RG: Sites of metal deposition in the cell wall of Bacillus subtilis. J

Bacteriol 141(2), 876-887 (1980).

133

328. Beveridge TJ, Forsberg CW, Doyle RJ: Major sites of metal binding in Bacillus

licheniformis walls. J Bacteriol 150(3), 1438-1448 (1982).

329. Li F, Feterl M, Warner JM, Keene FR, Collins JG: Dinuclear polypyridylruthenium(II)

complexes: flow cytometry studies of their accumulation in bacteria and the effect on the

bacterial membrane. J Antimicrob Chemother 68(12), 2825-2833 (2013).

330. Meng Y-L, Liu Z, Rosen BP: As(III) and Sb(III) uptake by GlpF and efflux by ArsB in

Escherichia coli. J Biol Chem 279(18), 18334-18341 (2004).

331. Barak I, Muchova K: The role of lipid domains in bacterial cell processes. Int J Mol Sci

14(2), 4050-4065 (2013).

332. Busch KB, Deckers-Hebestreit G, Hanke GT, Mulkidjanian AY: Dynamics of

bioenergetic microcompartments. Biol Chem 394(2), 163-188 (2013).

333. Ramamurthi KS, Losick R: Negative membrane curvature as a cue for subcellular

localization of a bacterial protein. Proc Natl Acad Sci U S A 106(32), 13541-13545

(2009).

334. Marquis RE: Oxygen metabolism, oxidative stress and acid-base physiology of dental

plaque biofilms. J Ind Microbiol 15(3), 198-207 (1995).

335. Imlay JA: Pathways of oxidative damage. Annu Rev Microbiol 57(1), 395-418 (2003).

336. Dimroth P, Kaim G, Matthey U: Crucial role of the membrane potential for ATP

synthesis by F(1)F(o) ATP synthases. J Exp Biol 203(1), 51-59 (2000).

337. Schilling KM, Bowen WH: Glucans synthesized in situ in experimental salivary pellicle

function as specific binding sites for Streptococcus mutans. Infect Immun 60(1), 284-295

(1992).

338. Dintilhac A, Alloing G, Granadel C, Claverys J-P: Competence and virulence of

Streptococcus pneumoniae: Adc and PsaA mutants exhibit a requirement for Zn and Mn

134

resulting from inactivation of putative ABC metal permeases. Mol Microbiol 25(4), 727-

739 (1997).

339. Dintilhac A, Claverys JP: The adc locus, which affects competence for genetic

transformation in Streptococcus pneumoniae, encodes an ABC transporter with a putative

lipoprotein homologous to a family of streptococcal adhesins. Res Microbiol 148(2), 119-

131 (1997).

340. Lemos JA, Quivey RG, Koo H, Abranches J: Streptococcus mutans: a new Gram-positive

paradigm? Microbiology 159(Pt 3), 436-445 (2013).

341. Dollwet HHA, Sorenson JRJ: Historic uses of copper compounds in medicine. Trace

Elem Med 2, 80-87 (1985).

342. Lemire JA, Harrison JJ, Turner RJ: Antimicrobial activity of metals: mechanisms,

molecular targets and applications. Nat Rev Microbiol 11(6), 371-384 (2013).

343. Santo CE, Lam EW, Elowsky CG et al.: Bacterial killing by dry metallic copper surfaces.

Appl Environ Microbiol 77(3), 794-802 (2011).

344. Santo CE, Taudte N, Nies DH, Grass G: Contribution of copper ion resistance to survival

of Escherichia coli on metallic copper surfaces. Appl Environ Microbiol 74(4), 977-986

(2008).

345. Grass G, Rensing C, Solioz M: Metallic copper as an antimicrobial surface. Appl Environ

Microbiol 77(5), 1541-1547 (2011).

346. Andreini C, Banci L, Bertini I, Rosato A: Occurrence of copper proteins through the

three domains of life: a bioinformatic approach. J Proteome Res 7(1), 209-216 (2008).

347. Argüello JM, Raimunda D, Padilla-Benavides T: Mechanisms of copper homeostasis in

bacteria. Front Cell Infect Microbiol 3, 73 (2013).

135

348. McAuliffe O, Ryan MP, Ross RP, Hill C, Breeuwer P, Abee T: Lacticin 3147, a broad-

spectrum bacteriocin which selectively dissipates the membrane potential. Appl Environ

Microbiol 64(2), 439-445 (1998).

349. Lemos JA, Burne RA: A model of efficiency: stress tolerance by Streptococcus mutans.

Microbiology 154(11), 3247-3255 (2008).

350. JA B: Virulence properties of Streptococcus mutans. Front Biosci 9, 1267-1277 (2004).

351. Argüello JM: Identification of ion-selectivity determinants in heavy-metal transport P1B-

type ATPases. J Membr Biol 195(2), 93-108 (2003).

352. Tottey S, Rich PR, Rondet SAM, Robinson NJ: Two Menkes-type ATPases supply

copper for photosynthesis in Synechocystis PCC 6803. J Biol Chem 276(23), 19999-

20004 (2001).

353. Schwan WR, Warrener P, Keunz E, Kendall Stover C, Folger KR: Mutations in the cueA

gene encoding a copper homeostasis P-type ATPase reduce the pathogenicity of

Pseudomonas aeruginosa in mice. Int J Med Microbiol 295(4), 237-242 (2005).

354. White C, Lee J, Kambe T, Fritsche K, Petris MJ: A Role for the ATP7A copper-

transporting ATPase in macrophage bactericidal activity. J Biol Chem 284(49), 33949-

33956 (2009).

355. Fu Y, Chang F-MJ, Giedroc DP: Copper transport and trafficking at the host–bacterial

pathogen interface. Acc Chem Res 47(12), 3605-3613 (2014).

356. Waldron KJ, Robinson NJ: How do bacterial cells ensure that metalloproteins get the

correct metal? Nat Rev Micro 7(1), 25-35 (2009).

357. Foster AW, Osman D, Robinson NJ: Metal preferences and metallation. J Biol Chem

289(41), 28095-28103 (2014).

136

358. Szpunar J: Advances in analytical methodology for bioinorganic speciation analysis:

metallomics, metalloproteomics and heteroatom-tagged proteomics and metabolomics.

Analyst 130(4), 442-465 (2005).

359. P D Bauer CT, D Drake, K G Taylor, and R J Doyle: Acquisition of manganous ions by

mutans group streptococci. J Bacteriol 175(3): 819–825, (1993 February).

360. Phan TN, Buckner T, Sheng J, Baldeck JD, Marquis RE: Physiologic actions of zinc

related to inhibition of acid and alkali production by oral streptococci in suspensions and

biofilms. Oral Microbiol Immunol 19(1), 31-38 (2004).

361. Wunder D, Bowen WH: Action of agents on glucosyltransferases from Streptococcus

mutans in solution and adsorbed to experimental pellicle. Arch Oral Biol 44(3), 203-214