Upload
doanthien
View
219
Download
0
Embed Size (px)
Citation preview
86
CHAPTER VI
ABSTRACT: Replicon typing of Plasmids harbouring ESBL gene.
The bacterial resistance to beta-lactam antibiotics is mediated by plasmids containing
ESBL genes which are horizontally transferred across species since we analyzed the
plasmids harboring the resistance genes by replicon typing. For this study we screened
twenty three isolates collected during the period 2009-2010 and screened by the
antimicrobial susceptibility test. It was found that all the isolates showed resistance to
cefoxitin, a second generation cephalosporin and twenty two isolates showed resistance to
amoxyclav. One of the isolate UT1644, was taken for further analysis. The amplicon for
blaCTX-M from this isolate was sequenced and found to be the blaCTX-M-15 allele. Two of the
isolates were resistant to imipenem, a carbapenem antibiotic. One of the carbapenem
resistant isolate P23 was further screened for the presence of metallo beta-lactamase.
Subsequently, it was found to contain a metallo-beta-lactamase but it did not harbor the
NDM-1 gene. Another isolate was found to be a metallo beta-lactamase as confirmed by
Imipenem –EDTA test. However, the carpabenem resistance was not transferrable into
E.coli JM109 indicating that it may be chromosomal. PCR were performed for the four
types of ESBL genes blaTEM, blaSHV, blaCTX-M, and blaOXA from the isolated plasmids.
Analysis of the ESBL genotype by specific PCR showed the presence of the blaSHV allele
(n = 15) followed by blaOXA (n = 7) and blaCTX-M (n = 7) in the isolates. One of the
amplified product of blaSHV was sequenced and it was found to be the blaSHV-5 allele.
Further, we analyzed the replicon pattern for the resistant isolates and found that plasmids
containing ESBL genes from Chennai predominantly belong to IncFIC and IncFIA
replicons.
87
CHAPTER VI: Results and Discussion – Replicon typing of Plasmids
harbouring ESBL genes.
6.1Antimicrobial Susceptibility profile of Klebsiella pneumoniae isolates
In order to identify the replicon associated with ESBL gene, we undertook an analyses of
23 Klebsiella pneumoniae isolates from Madras Medical College, Chennai. First,
antimicrobial susceptibility pattern of the clinical isolates of Klebsiella pneumoniae
collected from Chennai in Oct 2009 against seven commonly used antibiotics was analysed
and data was represented in figure 6.1. All the isolates were resistant to cephoxitin, a
second generation cephalosporin. Cephotaxime, a third generation cephalorsporin was
effective only on two isolates (8.6 %). Amoxyclav is an inhibitor of Class A beta
lactamases and is usually recommended for isolates carrying Class A ESBL genes.
Alternatively these isolates might contain the AmpC beta-lactamases. Many strains of K.
pneumoniae also harbor AmpC beta lactamases in the plasmids which confer resistance to
clavulanic acid. AmpC beta lactamases are active on cephalosporins and can hydrolyze
cephamycins such as cefoxitin and cefotetan; oxyimino-cephalosporins such as
ceftazidime, cefotaxime, and ceftriaxone; and monobactams such as aztreonam. Inhibitors
of class A enzymes such as clavulanic acid, sulbactam, and tazobactam have much less
effect on AmpC β-lactamases [Tan, T. Y et al 2009].
It is significant that 22 isolates showed resistance to clavulanic acid and only one isolate
was sensitive to clavulanic acid (95%). The most effective antibiotic was found to be
imipenem, a carbapenem antibiotic. In addition, in two carbapenem resistant isolates (9%)
were observed in this study. Intermediate resistance to imipenem was observed in three
isolates (13 %).
88
Since many of these antibiotic resistance genes are clustered, we analyzed the resistance to
other group of drugs. It was found that 12 isolates (52 %) were resistant to amikacin, an
aminoglycoside inhibitor and levofloxacin, a quinolone antibiotic. Intermediate resistance
was high for levofloxacin, with 9 isolates (39 %). Resistance to Trimethoprim a
sulphonamide antibiotic was high with 22 isolates resistant to the drug.
Figure 6.1 The Antimicrobial susceptibility of the 23 clinical isolates against 7
commonly used antibiotics is shown. The isolates were classified as Resistant,
Intermediate or Sensitive according to the CLSI Performance Standards for the
Antimicrobial Disk Susceptibility Tests, CLSI Vol 30, No. 1 , Jan 2010. The number on
top of each bar represents the number of isolates.
23
17
22
2
22
12 12
0
2
0
3
0
2
9
0
4
1
18
1
9
2
0
5
10
15
20
25
Resistant
Intermediate
Sensitive
No
. o
f I
sola
tes
89
6.2 Analysis of PCR Detection for ESBL genes
In order to identify the genes conferring the beta-lactam resistance in these isolates, PCR
typing for ESBL genes blaCTX-M , blaTEM, blaSHV and blaOXA-1 was done. The frequency of
the presence ESBL gene among the 23 isolates is given in Table 6.1 .Table 6.1 shows that
among the 23 isolates of this study, there is a higher frequency of the blaSHV allele
followed by blaCTX-M and blaOXA-1.
Table 6. 1 The frequency of occurrence of each ESBL gene in the isolates is
given here (n=23). More than one ESBL gene was observed in some isolates.
ESBL gene No. of isolates
Frequency of
occurrence
CTX-M 7 0.3
TEM 3 0.13
SHV 15 0.65
OXA-1 7 0.3
Since more than one ESBL gene is present in some isolates, we analyzed the distribution of
the ESBL combination in figure 6.2. This data indicates the occurrence of recombination
or plasmid transfer leading more than one ESBL gene in the isolates.
90
Figure 6.2 Distribution of ESBL genotypes in the clinical isolates (n=23).
Plasmids were extracted from each isolate and PCR was performed with ESBL specific
primers. Isolates were scored for specific PCR amplification by agarose gel
electrophoresis. The X- axis shows the ESBL gene combinations observed.
Based on the data from the 23 isolates of K. pneumoniae collected from Chennai, the
blaCTX-M and blaSHV recombination is more frequent than any other type of recombination.
In summary, the data shows the higher frequency of blaSHV followed by blaOXA-1 and
blaCTX-M in plasmid mediated ESBL in Klebsiella pneumoniae isolates in Chennai. This is
similar to a recent study by [Manoharan A et al. 2011] who showed that more than one
ESBL gene was present and this was correlated with increased resistance levels in
Enterobacteriaceae.
10
4
1 1
3
1 1 1 1
0
2
4
6
8
10
12
Nu
mb
er o
f Is
ola
tes
91
In addition the data also indicates high frequency of recombination leading to transfer and
accumulation of ESBL genes in Klebsiella isolates. The spread of ESBL could be due to
cross-infection from a single isolate or alternatively due to the conjugative transfer of
resistant plasmids. In order to find out the relatedness between resistant isolates, we
performed replicon typing of plasmids.
6.3 Plasmid based Replicon typing of MDR isolates
Having analysed the patterns of antibiotic resistance and the frequency of ESBL genes in
the 23 clinical isolates, we wondered if these data could be correlated with phylogenetic
relatedness amongst the ESBL carrying MDR plasmids. Therefore, we investigated the
phylogenetic relatedness among these plasmids by carrying out plasmid based replicon
typing [Carattoli et al 2006] .This method can identify 24 different types of plasmid
incompatibility groups among Enterobacteriaceae. The replicon typing of the isolates in
this study showed the presence of only seven types out of the 24 different Incompatibility
groups analyzed. Figures 6.3 and 6.4 show the PCR amplified products of replicon pattern
for 23 isolates were IncFIA, IncFIB, IncFIC, IncP and IncW. Thus, figures 6.3 and 6.4
shows the amplification of the 462 bp IncFIA product, 702 bp IncFIB product, 262 bp
IncFIC product, 532 bp IncP and 242 bp IncW product and one of each Inc group was
sequenced and compared to confirm of the authenticity of the replicon typing [Carattoli A
et al. 2005].
92
Figure 6.3 PCR based replicon typing of clinical isolates of Klebsiella
pneumoniae: The figure 6.3 panel A shows the specific amplification of the
Incompatibility groups for the isolates UT1 to UT10 while figure 6.3 panel B shows the
same for isoaltes P12 to P25. Panel A shows amplifications for IncFIA, IncFIB and IncP;
Panel B shows the amplification for IncFIC.
93
Figure 6.4 Panel A shows amplifications for IncFIA, IncFIB and IncW. Panel
B shows the amplification for IncFIC. The amplified replicon and its size is
indicated in the picture. The lane WC represents water control. One of the amplified
products was sequenced and analyzed to identify the authenticity of the PCR amplification.
Out of the 23 isolates, Inc groups belonging to the 7 groups listed above were identified in
19 isolates. Table 6.2 shows the relative frequencies of the 7 Inc groups amongst the 19
isolates. The frequency of the IncFIC replicon was highest at 52 %, followed by IncFIA
(47 %), and IncFIB (30 %). The data show that the plasmids containing ESBL genes
(blaSHV, blaCTX-M, blaTEM and blaOXA ) predominantly belong to IncFIC and IncFIA
replicons. This result is consistent with a similar and recent report from Germany[ Mshana
94
et al. 2009]. IncF plasmids are frequently encountered in clinical enterobacterial strains
associated with the dissemination of relevant antimicrobial resistance and virulence genes
[ Villa et al. 2010].
Table 6.2 Shows the frequency of occurrence of the Incompatibility groups in
the isolates (n=23). Some isolates showed more than one replicon.
Inc Group No. of isolates
Frequency of
presence
FIA 11 0.47
FIB 7 0.30
FIC 12 0.52
I1 2 0.08
HI1 1 0.04
P 1 0.04
W 5 0.22
In order to analyze the phylogenetic relatedness of the plasmids, the data from
ESBL and replicon typing for each isolate is represented pictorially in figure 6.5.
95
Figure 6.5 The replicon typing (upper panel) and ESBL typing (lower panel)
results are given for 19 clinical isolates. The amplification is represented by a
horizontal bar against the isolate. The Imipenem resistant isolates are marked IM-R.
The four isolates in which no replicons were identified though ESBL genes had been
identified from plasmid preparations. They are not represented in figure 6.5. It has been
reported that Klebsiella pneumoniae can contain more than one plasmid with multiple beta-
lactamases [ Wei et al. 2005] or alternatively it may be a mosaic plasmid with mosaic
replicons [Osborn et al. 2000] .The mosaic nature of the plasmid replicon and mutations
could be the reason that no replicons could be detected in four isolates. From the replicon
data, it is seen that there are only 8 isolates which contain a single replicon amplification
suggesting a single MDR plasmid. In the other isolates, more than one plasmid is expected
to be present.
From figure 6.5, six isolates which contain only the IncFIC can be seen.These however
contain different combinations of the ESBL genes. The IncFIA containing isolates (11 out
of 19 isolates) are frequently found in combination with other replicons. In the 19 isolates
which showed an amplifiable replicon, there was either an IncFIA or IncFIC replicon. In a
IncFIA
IncFIB
IncFIC
IncW
IncP
IncI1
IncH1
CTX-M
TEM
SHV
OXA-1
96
study carried out in Tunisia [Elhani et al 2010], in K. pneumoniae in Tunisia, the plasmids
carrying the blaSHV-2a or blaCTX-M-15 genes were assigned to IncFII replicon and more
rarely, to IncL/M types. The highly successful blaCTX-M-15 type-carrying plasmids which is
believed to have originated in India is a member of member of the IncF2 broad host range
plasmids [Karisik et al. 2006]. In a study in China, three plasmids large (140 kb), medium
(90 kb) and small (70 kb) have been found to be prevalent in the ESBL Klebsiella
pneumoniae isolates [Yi et al. 2010]. One of them, pKF3-70 has been sequenced
completely and found to belong to IncFII plasmid. In a study of E.coli ESBL isolates in
Germany, a conjugative IncFI plasmid of 145.5 kb carrying blaCTX-M-15 has been
identified [Mshana et al. 2009]. There are only two isolates which have only IncFIA (UT5
and UT6).These two isolates contain the blaOXA-1 ESBL allele. It is possible that these are
highly related to each other. There were four isolates which contained the IncW replicon
but in combination with either IncFIA or IncFIC. The IncW replicons were observed only
in the pus samples. The relative frequency of the IncI1, IncP and IncHI1 are much lower
as when compared with other replicon pattern as can be seen in table 6.2.
We identified two carbapenem resistant isolates P23 and UT10. The isolate P23 has two
replicons IncFIC and IncW and also amplified the blaTEM and blaOXA-1 ESBL. The isolate
UT10 has five different replicons namely FIA, FIB, FIC, I1 and HI1 and contains the
blaSHV ESBL gene. From this data it would appear that the carbapenem resistant isolates
are not phylogenetically related. They might have acquired the carbapenem resistance
either by a point mutation of an existing ESBL gene or might have acquired a new gene
independently.
97
6.3.1. Identification of the blaSHV and blaCTX-M alleles
In order to identify the SHV and CTX-M alelle, we sequenced one of the isolates for each
gene.The blaSHV amplified product from isolate P22 was sequenced using the same primers
used for PCR amplification. The partial coding region was obtained and the S130G
mutation was seen in ESBL isolates of blaSHV gene. (GenBank Accession number-
JX452829). This sequence also had the G238S and E240K mutations in blaSHV-5 figure
6.6. The BLAST analysis of the sequence also showed the highest sequence similarity with
the blaSHV-5 sequences.
Figure 6.6 Translation of the partial coding region of the SHV-5 sequence from
the isolate P22. The presence of the amino acid Leucine at position 35, Serine at
position 238 and Lysine at position 239 (in bold face and marked by an asterisk) confirm
that this sequence is the SHV-5 allele. GenBank Accession number - JX452829.
98
The blaCTX-M amplified product from the isolate UT1644 was sequenced and analyzed by
BLAST. From figure 6.7 the partial coding sequence showed the D240G mutation which
is critical for identification of blaCTX-M-15 allele [ Novais et al. 2010]. Since we did not
have the N terminal sequence we were not able to observe the A77V mutation to
differentiate between the blaCTX-M-15 and blaCTX-M-28 allele.
Figure 6.7 The partial coding region of the CTX-M amplified product from
UT1644 is shown. The critical amino acid positions which distinguish between the
alleles are shown in boldface. This allele has the D240G mutation only, in the region
sequenced. (GenBank Accession number- KC143066)
gaaagcgaaccgaatctgttaaatcagcgagttgagatcaaaaaatctgaccttgttaac
85 E S E P N L L N Q R V E I K K S D L V N
tataatccgattgcggaaaagcacgtcaatgggacgatgtcactggctgagcttagcgcg
105 Y N P I A E K H V N G T M S L A E L S A
*114
gccgcgctacagtacagcgataacgtggcgatgaataagctgattgctcacgttggcggc
125 A A L Q Y S D N V A M N K L I A H V G G
*140
ccggctagcgtcaccgcgttcgcccgacagctgggagacgaaacgttccgtctcgaccgt
145 P A S V T A F A R Q L G D E T F R L D R
accgagccgacgttaaacaccgccattccgggcgatccgcgtgataccacttcacctcgg
165 T E P T L N T A I P G D P R D T T S P R
*167
gcaatggcgcaaactctgcggaatctgacgctgggtaaagcattgggcgacagccaacgg
185 A M A Q T L R N L T L G K A L G D S Q R
gcgcagctggtgacatggatgaaaggcaataccaccggtgcagcgagcattcaggctgga
205 A Q L V T W M K G N T T G A A S I Q A G
ctgcctgcttcctgggttgtgggggataaaaccggcagcggtggctatggcaccacc
225 L P A S W V V G D K T G S G G Y G T T
240٭
99
6.4 Analysis of the Carbapenem resistant isolates
Carbapenems are the drugs of choice for treating MDR infections and can be mediated by
Class D oxacillanases or by class B metallo-beta-lactamases. Resistance to carbapenems
can be mediated by some alleles of blaOXA and metallo-β-lactamase class B enzymes
including the IMP, VIM, GIM, SPM, and the recently identified NDM-1 β-
lactamases.[Walsh et al. 2005, Kumarasamy et al. 2010].These can be identified by the
inhibition of the metallo beta lactamases by EDTA. Two out of 23 isolates were found to
be carbapenem resistant. The beta lactamase activity of the clinical isolate P23 was found
to be inhibited by a increase of 6mm in the presence of 0.5M EDTA as seen in figure 6.8.
A significant decrease in the inhibition zone with the absence of EDTA indicates that the
strain has an active MBL which was seen in both the original Klebsiella pneumoniae
isolate and the E.coli JM109 transformed with the plasmid from this resistance isolate
shown in table 6.3
Table 6.3 Detection of Metallo beta-lactamase with the parent and a
transformed colony. (NZ-No Zone)
Culture IMP IMP+EDTA EDTA CAZ C
P 23 12mm 18mm NZ NZ NZ
Transformed in
E.coliJM109
20mm 26mm NZ NZ NZ
100
Figure 6.8 Detection of Carbapenem metallo-ß-lactamase. A – ceftazidime disc;
B – Imipenem disc; C Imipenem and EDTA; D-only EDTA. The isolate Pus 23 showed an
increase in the clearing zone with IP+EDTA.
The plasmid isolated from this isolate did not amplify the blaNDM-1 gene although a positive
control did amplify the blaNDM-1 product (data not shown). This plasmid was found to have
an IncFIC replicon (Data not shown). Therefore Carpabenem resistance was found to be
transferrable. In the other resistant isolate P10, carbapenem resistance was not transferable.
The plasmid isolated from the isolate P23 was found to be carbapenem resistant and also it
had an IncFIC replicon.
Since this isolate did not harbor the blaNDM – 1 gene, it remains to be established whether
the carbapenem resistance is mediated by any other metallocarbapenemase. The complete
sequencing of some of the plasmids conferring MDR from Indian isolates is very important
and should be a focus of further research.
A A
A B
C
D
101
In summary, our study is significant because these results represent the first report of
replicon typing of ESBL plasmids of Klebsiella pneumoniae from Chennai. Plasmids
containing ESBL genes were predominantly belong to IncFIC and IncFIA replicon pattern.
However, further analysis of these plasmids and sequencing the genetic context of the
resistance genes will assist to understanding the mechanism of transfer of the resistance
genes.