CHAPTER-II

CHEMICAL SYNTHESIS OF OLIGONUCLEOTIDES

INTRODUCTION

In the present work, chemical methods have been employed for

the synthesis of oligonucleotides required for structural studies

of mnt operator DNA elements and mnt operator-repressor

interactions. This chapter consists of a brief introduction to

the general principles involved in the chemical synthesis of

oligonucleotides, followed by specific methodology used for the

synthesis, purification and characterization of oligonucleotides

d ( CACGTG) , d ( CACCGTG) , d ( CACGGTG) and 3 7 base pair DNAs,

corresponding to mnt operator region of bacteriophage P22.

2.1. PRINCIPLES IN CHEMICAL SYNTHESIS OF OLIGONUCLEOTIDES:

The DNA consists of a backbone made of alternating phosphate

and sugar moieties (2 1 -deoxyribose), with two· types of

heterocyclic bases, namely the purines (adenine and guanine) and

pyrimidines (cytidine and thymine) attached to the sugars as

• 0 glycosidic side chains. The chemical synthes1s of DNA (Michelson

and Todd 1955, Bannwarth 1986, Engels and Uhlmann 1989) involves

the formation of an internucleotide phosphodiester bond between

3 1 -phosphate of a nucleotide and 5 1 -hydroxyl group of preceding

one, followed by chain extension using similar reactions. The

reverse combination of 5 1 -phosphate 3 1 -hydroxyl condensation is

possible in principle, but the former method is preferred since

it involves 5 1 -hydroxyl (primary functional group) which is more

reactive than the secondary 3 1 -hydroxyl group. Prior to c"onden-

28

sation reactions, various reactive groups such as exocyclic

amino groups of bases, sugar hydroxyls and acid groups of

phosphates are required to be protected to direct the condensa­

tions in a regiospecific manner. At the end of the chain assembly

these protecting groups are removed and the desired DNA sequence

is purified by chromatographic procedures.

2.1.1. Protecting _groups in oligonucleotide synthesis:

Two kinds of groups are used for masking oligonucleotide

functional groups (Khorana 1978, Gait 1984) during synthesis;

(1) permanent protecting groups for protection of exocyclic amine

and phosphate groups, which remain attached through out the

synthesis and ( 2) temporary protecting group for protection of

5 1 -hydroxyl which is removed during each step of nucleotide

addition. These protecting groups along with methods for their

removal are depicted in table 1 (Sonveaux 1986).

2.1.2. Internucleotide bond formation:

A simplified representation of the various chemistries

involved in internucleotide bond formation is depicted in scheme

1. Phosphodiester (I), phosphotriester (II) and H-phosphonate

(III) chemistries utilise nucleotide monomers (~, ~ and 2) which

have a pentavalent phosphorous atom whereas the phosphite

triester (IV) and the related phosphoramidite (V) methods contain

phosphorous in the trivalent state (11 and 15). Although phos-

29

Table 1. Protecting groups and deprotecting conditions used in oligonucleotide synthesis

Functional group

5'hydroxyl of sugar

5'hydroxyl of sugar

Exocyclic amino (A,C)

Exocyclic amino (G)

Phosphate (phoshphotriester)

Phosphate (phosphoramidite)

Phosphite (phsophite procedure)

Protecting group

DMTR

Pyxyl

Benzoyl

Isobutryl

P/0-Cl-phenyl

_$-cyanoethyl

Methyl

Deprotecting condition

3% dichloroacetic acid or phenyl dihydrogen phosphate 2 min RT

-do-

Ammonia, 16 hrs 65°C

Ammonia, 16 hrs 65°C

Oximate, 4 hrs RT

Triethylamine or ammonia, 1 hr RT

Thiophenol, 0.5 hrs RT

phodiester chemistry (I) was extensively used by Khorana in the

synthesis of phenylalanine t-RNA gene (Brown et. al. 1 1979) 1 it

has several drawbacks for routine use. As a result it has now

been replaced by the phosphotriester chemistry and more recently

by the phosphoramidi te and H-phosphonate chemistry. The main

chemical principles of various methods are described below.

1) Phosphotriester method (II) (Letsinger and Mahadevan 1965 1 Van

Boom et.al. 1 1971)

a) In this chemistry the acid group of phosphate monomer ~ is

protected as ester by R''·

b) Condensation of .1. with an incoming nucleotide ~ gives a

triester dinucleotide .§.. This product is neutral and has

favourable solubility properties in organic solvents

enabling its easy purification.

c) But phosphorus in .§. is pentavalent and therefore requires

activation through a condensing agent for further chain

extension.

d) Arenesulphonyl triazoles and tetrazoles (Katagiri et. al. 1

197 4) were previously used as condensing agents but more

effective reagents are TPSCl and MSNT (Reese et.al. 1 1978 1

Jones et.al. 1 1980) in the presence of a catalyst N-methyl

30

imidazole or pyridine N-oxide (Effimov et.al., 1982 and

1986).

e) The method is applicable in both solution phase and solid

phase (Chaudhari et.al., 1984 and Gait 1984).

2) Phosphite triester method (IV) (Letsinger et.al., 1975)

a) This chemistry an has advantage of high reactivity of phos­

phorus in trivalent state. Consequently these reactions are

fast and have to be done at low temperatures. Phosphite tri­

esters are prepared in situ and used directly.

b) The product of condensation 13 retains the phosphorous which

is oxidised to pentavalent state 14 immediately after each

condensation.

c) R'' is normally a methyl group and this method is applicable

only for solid phase synthesis.

3) Phosphoramidite method (V}

a) This is an improvement over phosphite triester chemistry as

the monomer amidites have combined advantages of stability

and reactivity (Beaucage and Caruthers 1981, McBridge and

Caruthers 1983).

b) In the amidite monomer 15, R'' group is p-cyanoethyl group.

NN' diisopropylamino group on phosphorous confers stability

31

and is converted to a good leaving group in the presence of

a mild acid such as tetrazole.

c) The resulting product is oxidised in a similar way to that

of phosphite triester.

d) This is the method of choice in automated machines that are

in use.

4) H-Phosphonate method (III)

a) H-phosphonate chemistry, an old idea (Todd et.al., 1957} has

been developed recently (Froehler et.al., 1986; Garegg

et.al., 1986) for oligonucleotide synthesis. This utilises

pentavalent phosphorous compound 7 which has hydrogen

instead of hydroxyl on the phosphorous atom.

b) The reagent used for activation is pivoloyl chloride ..

c) This method has the following advantages such as ( i) no

protection of phosphate is required (ii) oxidation of P-H

is achieved by a .global oxidation at the end of the

synthesis rather than at the end of each step. ·

d) The monomers are stable and are neither hygroscopic nor

susceptible to air oxidation. The potential of H­

Phosphonate chemistry is yet to be fully utilised for

routine oligonucleotide synthesis.

32

I Phosphodiester method

0

II e RO-P-0 + R'OH

I

TI Phosphotrl ester method

0

II e RO _;,_p-o +

I .. OR

4

ill Phosphonete method

0

R'OH

5

II RO -P- 0 + RbH

I H

1 8

R =Bese 1 R" =Bese 2 R-=Phosphete protection

0

TPSCl II RO-P-

1

OR' l 3

Oe

0 MSNT /TPSCL,NMI II . -~~ RO-~...;_ - - ~ - I OR

OR' 6

0

II RO-P-OR' >

I H

<;! l Global oxidation

0

II RO-P- OR'

I 10 0 6

Scheme 1. Different chemistries for oliqonucleotide synthesis (contd)

N Phosphite triester method ·

RO---. p---. Cl r

OR'"

+ R"OH ) RO-P-OR"

I OR··

1 I 12 13 0

12; 'w'eter oxidation . pfl OR" --4-) RO- -

I OR ..

3l.Phosphoremidite method 14

Tetrazole RO- P- NRR + R"OH

I ) RO-P- OR"

I OR'" OR'"

0 11 II 16

12/Weter oxidation --+} RO _p_ OR"

I OR""

1~

2.1.3. Techniques for oligonucleotide synthesis:

Solution phase synthesis:

In this method of synthesis all reactions are carried out

in homogeneous solutions (Chaudhari et.al., 1984). The first step

of condensation is followed by deprotection at the 5 1 -end. The

resulting product is purified ·by chromatography and the next

cycle is continued. This is achieved by two ways; either by

linear coupling or block coupling.

Linear coupling: 3 1 condensation 5 1 deprotection,

a) 5 1 x-B-p + HO-A HO -BpA purification

next cycle ~

Block coupling:

condensation

b) x-FpEpDp + HO-CpBpA ~ x-FpEpDpCpBpA ) etc . where X= 5 1 protecting group and p= protected phosphate group.

Solid phase synthesis:

In this methodology (Gait 1984, Gassen and Lang 1982) the 3 1-

terminal nucleoside which is pre-linked to a polymer support, is

condensed with a sui table 5 1 -protected monomer. The resulting

dinucleotide product is retained on the solid support and the

excess unreacted reagents are removed by solvent washings. Puri-

33

fication at each step is not performed but is done at the end of

the synthesis.

5 1 -deprotection

0--Ax

)(p}ApB-OH

----~ 0-A-OH

contd.

condensation 5 1 deprotection

---:')~(E}--ApBx >

The main differences in solid phase and solution phase synthesis

are described in table 2.

PRESENT WORK

In the following sections of this chapter, chemical

synthesis, purification and characterization of short oligo­

nucleotides d(CACGTG), d(CACCGTG) and d(CACGGTG) by solution

phase phosphotriester chemistry and 37-mer DNAs by solid phase

phosphoramidite procedures are described.

2.2. RESULTS AND DISCUSSION

2.2.1. Preparation of protected mononucleotides:

The monomers required for the solid phase synthesis are the

protected deoxynucleotides (1-4, scheme 2) which were prepared

(Rajendrakumar et. al., 1985) by one-pot transient protection

method of Ti et. al. , ( 1982) . The unprotected deoxynucleosides

(dA, de, dG) were first treated with trimethylchlorosilane in

pyridine to mask the 5 1 - and 3 1 -hydroxyl groups, immediately

followed by reaction with benzoyl chloride (for dA, dC) or

isobutyryl chloride (for dG) to obtain N-acyl-3 1 ,5'-bis

34

Table. 2 Differences between solid phase and solution phase oligonucleotide synthesis.

Feature

Ease

Skill

Scale

Length limitations

Purity

Time

Cost

Solution phase Solid phase

Manual Semi-automatic or automatic

Organic chemistry Not essential expertise required

Large scale Yields microgram to a milligt~ Yields > mg amounts

Upto hexamer satisfactory, >100 mer possible block coupling for > 6

i)

ii)

Purification at every step-yields high purity DNA Good for structural studies by NMR, X-ray

Slow 150min/1 nucleotide

addition

Low

i) Accumulation of trun-cated sequences

ii) Ideal for molecular biology applications

Fast 12min/l nucleotide

addition

High

51

ROC:;J.H2 8

I

1 I 4

OR1

1.8= A

R

2.8= c

3. 8=

13, R, = R2= Cl

l-4withR'=H 14,R,=00,R2=N0' 8 Oame •• · '0

5- · . . -R'=H . e as 1-4. With R- -C-OH

9-12.sam . R -C-CH2-CH2 II 1-4. With -II 15-IS.same as 0 0

Scheme. 2

trimethylsilyl deoxynucleosides. The hydrolysis of silyl groups

was then effected in a few minutes with aqueous ammonia to obtain

the N-acyl-2'-deoxynucleosides (9-12) in 85-90% yields. These

were converted into their respective N-acyl,5'-0-(4,4'-dimethoxy

trityl),2'-deoxynucleocides (5-8) by treatment with 4-4'-dimeth­

oxytrityl chloride in pyridine and the products were purified by

flash chromatography on silicagel H. This one-flask procedure of

preparing the N-acyl,5'-0-protected nucleosides is more

convenient and quicker than the conventional method of peracyla­

tion-selective hydrolysis (Narang et.al., 1980).

The above N, 0-protected deoxynucleosides (5-8) were phos­

phorylated at the 3'-hydroxyl group by the procedure of Effimov

et.al., (1982). Here the phosphorylating agent is the 4-chloro­

phenyl phosphoryl pyridinium derivative (14) which is generated

in situ by simple addition of an equimolar amount of water to 4-

chlorophenyl phosphorodichloridate (11) in pyridine. The latter

reagent was prepared by reaction of 4-chlorophenyl with phos­

phorous oxychloride (Owen et.al., 1974) and purified by vacuum

distillation. This procedure of phosphorylation of nucleosides is

more convenient as compared to the use of bifunctional phosphory­

lating agents such as triazole or tetrazole activated 4-chloro­

phenyl phosphates (Narang et.al., 1980) and yields of phospho­

diesters isolated as triethylammonium salts (1-4) are

satisfactory. This method of phosphorylation is also devoid of

35

side products due to base modifications, especially o6 and o4

phosphorylations in dG. and dT respectively. The crude nucleotide

monomers were purified on a short column of silica gel and

detected as UV and trityl positive spots on TLC plates.

2.2.2. Solution phase synthesis:

d(CACGTG), d(CACCGTG), d(CACGGTG) were synthesised

(Raj endrakumar et. al. , 1987) by solution phase phosphotriester

methodolgy. Each synthetic cycle consists of three consecutive

steps; (i) Condensation (ii) deprotection and (iii) purification.

During the first step (scheme 3) a 3'-terminal block such as~ is

condensed with a 3 '-(2-chlorophenyl) phosphate ester of a 5'0

and N-protected 2 '-deoxyribonucleotide £.

used is either MSNT or TPSCl in

The condens ~ng agent

combination with N

methylimidazole (Effimov et.al., 1982). The reaction as

monitored by TLC over silica gel was essentially complete within

15min. The 5',3'-0-protected dinucleotide 1, product of the first

step is then deprotected at the ~'-position in the second step.

This is achieved by treatment of the~ dinucleotide l with a

solution of phenyl dihydrogen phosphate in chloroform-ethanol. A

deep orange colour is produced instantaneously due to the

liberated dimethoxytrityl cation. After work-up, the product ~

was taken to the third step of cycle for rapid purification over

silica gel. The column was eluted with 1-2 bed volumes of

36

chloroform to remove non-nucleotidic impurities such as

dimethoxytritanol liberated during the deprotection. The desired

product was then rapidly eluted with anhydrous THF-pyridine

(3:1) and recovered from the eluant. After drying, this was used

as the 5'-hydroxyl component for initiating the next cycle. All

reactions were conveniently monitored by TLC over silica gel. The

phosphate monomer~ added at every cycle have low rf value (0.04-

0.05) and show up as orange-red spots (trityl positive) on TLC

after acid-spray. The 5 '-hydroxy component cannot be visualised

in a similar way; however, when heated after the acid spray, it

shows up as a dark spot. The phosphate component ~ is always

taken in slight excess (1.2 equivalents) over the 5 1 -hydroxy

component to drive the reaction to completion. The solvent used

in first three cycles was acetonitrile since reactions in this

solvent are faster as compared to pyridine. Further, because of

the low solubility of the 5 1 -hydroxyl component in acetonitrile,

the solvent used was pyridine. Beyond the trinucleotide stage,

the phosphate components are taken in 1.4-equivalents excess over

the hydroxyl component to drive the reaction to completion. The

completion of the condensation is signalled by the total

disappearance of 1 and appearance of a higher rf trityl-positive

spot due to ]_. It should be mentioned that for the eventual

success of this method tha 5 1 -hydroxy component should totally

disappear at every step; otherwise it would be very difficult to

37

DHTRO~O· T H H

H · Cl

2

o=~-@ .. L

Et NHO 3

TPSCl/MSNT ,NMI

CH CN/Pyr 3

)

+

""lc(~6ibu RT, 15 min

H~

!

ibu DHTr-0~0 ·s

· H H H

0 Cl

o=~-@ -' .. 0Et3

NH

y NEXT CVCLE

DMTRD~T

0 Cl .. ~ o=P~

~Vuoa;fb" .~ "r--r OBZ

B)Ph H 0 PIn CHC1 3 2 3un ice

b)Silir:B gel Column

HO~O T H H

H

0 Cl

o=~-@ . ~~61bu

DBZ 4

Scheme 3: Solution Phase Phosphotriester method for (l(CACG TG)

separate it from the product since both have very close r f

values. The 5'-deprotection of the product ~ is done with phenyl

dihydrogen phosphate. The reaction with this reagent in addition

to being faster, seems to cause less depurination as compared to

other detri tylating agents such as benzene sulphonic acid or

dichloroacetic acid. This reaction was also easily assayed by TLC

as the trityl-positive product l. is converted into a slightly

slower moving trityl-negative product. The liberated tritanol

moves with the solvent front in the TLC. The end product of the

cycle .1 is purified by rapid column chromatography over silica

gel (Chaudhari et.al., 1984). It can be seen from table 3 that

the total time required for the first synthetic cycle is about

150 min. The four other cycles required for synthesis of a

hexamer were carried in a similar way. When the assembly is

complete the 5 1 -hydroxy end is deprotected followed by treatment

with acetic anhydride to acetylate the free hydroxy end. This

avoids the general procedure of treatment of completely

deprotected oligomer with acetic acid and thereby minimising the

losses. The acetylated oligomer was deprotected by the procedure

described in scheme 4.

The treatment of the protected oligonucleotide with oximate

reagent removes the o-chlorophenyl protecting group from all

phosphates. Concentrated ammonia deprotects all N-acyl groups on

bases and the 5'-acetyl group on sugar. The resulting product is

38

Table 3 Time required for the steps in solution phase synthesis.

Step \.ol01'k Time in (min)

Step 1 Reaction 15 Workup 15

Step 2 Reaction 10 Workup 10

Step 3 Column 60-80

Total - 150 minjcycle

Scheme 4: Deprotection procedure

d(HOC~ZA~pzC~G:~u\flbu_Bz)

~ Acetic anhydride-pyridine

d(A O-CBzABzCBz6 IbuTGibu_ 8 ) t p I' :y:2.:itrobe:zaldoxime·THG

d(AcO-CBzABzCBzGibuTGibu_Bz)

~ Cone. NH 3 , 17h, 60°C.

d(CACGTG)

d Ac ABz CBz

6 Ibu

p

= = =

= Deoxy = Acetyl

6-N-Benzoyl-2 1 -deoxyadenosine 4-N-Benzoyl-2 1 -deoxycytidine 2-N-Isobutryl-2'-deoxyguanosine

= Phosphate groups protected by 2-chlorophenyl

a completely deprotected oligonucleotide along with various non­

nucleotide impurities (deprotecting agents etc.). The latter are

removed by passing the mixture over a gel filtration column

(Sephadex G-15) where the crude product elutes in void volume.

This is almost 90-95% pure and for biophysical studies, it was

further purified by FPLC (described later). Using this method

several milligrams of hexamer and heptamers were synthesised in

high purity as required for NMR and X-ray studies.

2.2.3. Solid phase synthesis:

Several 37 base operator DNAs related to P22 Mnt operator

(Fig.l) were synthesised on Pharmacia Gene Assembler by phosphor­

amidite chemistry. The steps involved in the assembly of oligo-

- nucleotides (scheme 5) were carried out automatically by a micro­

processor are They are: (i) condensation (ii) oxidation (iii)

capping and ( i v) 5 '-deprotection. This cycle is repeated. Each

step is interspersed with solvent washings to remove excess

reagents. A peristaltic pump delivers reagents and solvents at a

specified flow rate during specified timings. The time period of

delivery of each reagent is indicated in table 4. For successful

synthesis, some precautions are to be taken during the

synthesis. These are (i) use of absolutely dry solvents (aceto­

nitrile and dichloroethane) since the internucleotide bond

formation in phosphoramidites is inhibited by even trace amounts

39

3701 3702

37C1 37C2

37!1 3712

37TI1 37U2

37.!2"1 3712:2

1 I -- . 3 TCTCAATAGGTCCACGG~GACCTGTATTGTGAGGTG ---- . ----- .

AGAGTTATCCAGGl~CCACCTGG~CATAACACTCCAC

TCTCAATA~GTCCACAGTtGGACCTGTATTGTGAGGTG AGA.GTTATCCAGGtrGTCAcCTG~ATAACACTCCAC -·-

TCTCAATAGGTCTAC~G~§_GACCTG TATTGTGAGGTG AGAGTTATCCAGATGCCACCTGGACATAACACTCCAC

TCTCAATAGGTCTACGGTAGACCTGTATTGTGAGGTG . '

AGAGTTATCCAGATGCCATCTGGACATAACACTCCAC

TCTCAATAAGTCCACGG~GGACCTGTATTGTGAGGTG

AGAGTT AT!CAGGTGCCACCTGG!ACAT AACACTCCAC

TCTCAATAA5TCCACGGTGGACATGTATTGTGAGGTG • AGAGTTATTCAGGTGCCACCTGTACATAACACTCCAC

Fig.l. 37 base pair DNA sequences synthesised for Mnt re pressorinteraction

studies. Presence of A vall restriction site is indicated by broken line. 37 base

pair DNAs differ in having number of restriction sites. 37o and 37c has 2

restriction sites, 371 and 37III have one site each and 37II and 37IV- no sites.

DMTRO~O B H . H

H . 0

I 0= P-OCH CH CN

1 . 2 2 2 N

/' R R 1 2

+

. Jl . H HO~O B

1 H - 0

s ®

Tetrezole

>

DMTRO~O B H H

H 0 I

o=P.....;oCH CH CN 1 2 2

0~0 B H H

3 H

0

~ CD

a)Iin Cl-1 CN and Weter 2 3

b) Ac 0 in Pyridine 2

c) 3%DCA

H1QB H H H

0 I

0= P- OCH CH CN 1 2 2

0~ 0

s CD

CVCLE REPEAT

Scheme 5: Solidphase synthesfs using Phosphoramidite method

Table 4 Reagent/Solvent delivery timings in solid phase synthesis

Reagent

1. Ethylenedichloride wash

2. Detrilylation 3% DCA/EDC

3. Acetonitrite wash

4. Tetrazole

5. Amidite (0.1 M soln.)

6. Tetrazole (0.5 M soln.)

7. Acetonitrite

8. Recycle during coupling

9. Acetonitrite wash

10. Capping A

11. Capping B

12. Acetonitrite wash

13. Oxidation

14. Acetonitrite

Capping solution A Capping solution B

Oxidation solution

Time Flow mljmin

1.3 2.5

2.0 2.5

1 2.5

0.1 1.0

0.1 0.5

0.1 1.0

0.2 2.0

3 2.5

0.3 2.5

0.1 X 2 0.5

0.1 X 2 0.5

0.3 2.5

0.1 2.5

1.0 2.5

6% DMAP in acetonitrite 20% Ac2o in acetonitritej collid1ne 0.01M Iodine (.50g Iodine in 130ml acetonitrite, 12ml collidine, 60ml water)

of water ( ii) high purity reagents (monomers, oxidation and

capping solutions). After the coupling and oxidation reactions

but before deprotection in each step, capping is done at the 5'­

end to arrest the growth of the unreacted chains. In addition,

capping reagents also react with trace amounts of water to keep

the reaction medium dry. The coupling efficiency as monitored by

trityl assay (UV detector) was over 95% at each step. At the end

of the synthesis global deprotections are achieved by treatment

with concentrated ammonia followed by gel filtration to remove

non-nucleotidic impurities. All the 37-mer sequences shown in

figure 1 were synthesised on 0. 2 mmole scale, with an overall

yield of approximately 5 A~about 10%).

2.2.4. Purification of oligonucleotidess:

The purification of all the synthesised oligonucleotides was

performed using two procedures.

( i) Large scale purification of hexamer and heptamers on Fast

protein liquid chromatography (FPLC) using Mono Q anion

exchange column.

( ii) Small scale purification of long oligomers on denaturing

polyacrylamide gel electrophoresis (PAGE).

Mono Q column on FPLC is ideal for purification of milligram

amounts of oligonucleotides. The purification of self

complementary and G rich oligonucleotides by chromatographic

40

procedures often poses problems due to possible secondary struc­

tures and aggregation behaviours. This was overcome by carrying

out separations at pH 11 at which all the hydrogen bonds (source

of secondary structures) are broken down leading to single

strands. The FPLC column, Mono Q is stable at this pH and has

good loading capacity for performing preparative separations (in

mg amounts) . Crude products obtained in the solution phase

synthesis are almost always 90-95% pure as shown by analytical

anion exchange chromatography of d(CACGTG) (Fig.2a). However, for

structural studies this material was further purified. Purified

material was checked finally by reverse phase chromatogrpahy on

FPLC (Fig. 2b). The FPLC patterns for 2 heptamer sequences are

shown in fig.3a,3b; 4a,4b. Further, these sequences were 5' end­

labelled using ~32 P] ATP and analysed on denaturing

polyacrylamide gel (Fig.5) where they showed single bands.

37 base operator DNAs synthesised were purified on

preparative polyacrylamide gel electrophoresis on 1.5mm thickness

gels. The product band visualised by UV light was cut and the

oligonucleotide recovered from the excised gel. This procedure is

ideal for long oligomers and also for obtaining very pure

material.

41

0-20 I I I I I I

I I I

0-16 1-,_

I I

I - I E _) c: "t

0·12 1-,,'' -I() "'

N "' ,

"' 0 .. "' 0 , - , , (/) "' -OJ 0-08 1- , ,..-<( /

,

"' , , /

0-04 1- , / -/

"' "' /

I I I __, \..

I I 0 8 16 20 32

TIME ( min l

0-5 I I r

I I

0-4 1- :-I - I

E I c: I "t 0-3 I_ I() -· I N I

0 _J 0 ---- ------C/)

0·2 ----- -- -OJ I <( I

I

I I

I 0·1 1- I -

I I

I , \.... I

0 I 1 I I

8 16 24 32 TIME (min l

Fig.2a. FPLC analysis of d(CACGTG). Ion exchange chromatography on

Mono Q anion exchange column. Buffer A, O.OlM NaOI-I (pll II). B_.

0.0 I MNaOH (pH 11 ), 1M NaCl.

b) Reverse phase chromatography (on RPC C8 column) of purified

hexamer.Buffec A. O.lM Ammonium acetate. BufferB, O.lM Ammonium

acetate and 40% Acetonitrile.

1·0

a

0·8 1--E c v 10 C\1 0·6 1-

0. 0 -(/) m 0·4 f-<(

I

0·2 I

f- I I

I

/ I

I I

I I

I I

I I

I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I

f\ "\...

I I I I

10 20 30 40 TIME (min)

I ·0 .---"---------~r-----.,

-E c v 10

0·8 f-

C\1 0·6 f-0 0 -(/)

~ 0·4-

b

I

I I

I

I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I I

I

0·21- / h ~,',' _,___.,,J \

I I I I,

10 20 30 40 TIME (min)

Fig.3. FPLC analysis of d(CACCGTG), d(CACGGTG).Ion exchange chro

matography (Mono Q anion exchange column) of · crude heptamers

a)d(CACCGTG) b) d(CACGGTG). Buffer A~ O.OlM NaOH (pi-Ill),

Buffer.B,O.OIM NaOH (pi-Ill), 1M NaCI.

0·5 0 I

I I

I

0-4 I 1- I -E

I I

I c:: I

¢ I I() I

0·3 (\J I- ,I "' 0 "' "' 0 - ~ "' / ,"'

(/)

co 0·2 4:

"' "' "'

"' "' I-"' ,

"' "' "' "' "' ~

~

"' "' ~ , 1- / __..) \ ~

~

0·1

~ ~ ,

~ I l I I _l

7 12 18 24 30. TIME (min)

Fig.4. FPLC analysis of purified heptamers.Reverse phase chromatography

on RI'C C X column-(a) d(CACCGTG) (b) d(CACGGTG). Buffer!\ O.lM

Ammonium acetate. Buffer B, O.lM Ammonium acetate 40% acetonitrile.

2 3 4 5

Fig 5. Denaturing polyacrylamide (14%) gel analysis of labelled heptarners d(CACCGTG) and d(CACGGTG). Lane one is oligo@1112-18 markers and lanes two and three are octarner markers. Lane 4 is d(CACGGTG) and lane 5 is d(CACCGTG). .

2.2.5. Characterization of oligonucleotides:

The synthesised hexamer and heptamer sequences were

characterised by NMR spectroscopy (chapter III) . This spectre-

scopy helped in identification of all the bases in the oligomers

and also their sequence along the chain. Thus no further

sequencing was necessary for hexamer and heptamer sequences.

As indicated in figure 1, operator fragments 37° to 37IV

differ in having restriction endonuclease sites for enzyme Ava

II. It can be seen that 37° and 37c have two sites 37I and 37III I

have one site each and 37II and 37IV have no sites. All the

operator DNAs are labelled in a double stranded form and hence

the two 5 1 -hydroxyl ends will have 32 P label. Ava II digesti~n of

such DNA yielded four fragments for 37° and 37c, two fragments

for 37I and 37III and no fragments for 37II and 37IV (Fig. 6).

This pattern of restriction digestion of 37 base operator DNAs

partially confirms the sequences synthesised. Further

confirmation is obtained by Maxam-Gilbert chemical modification

sequencing.

Maxam-Gilbert sequencing procedure is ideal for short oligo-

nucleotides. Figures 7 and 8 show the Maxam-Gilbert chemical

modification reactions and subsequent cleavage of such modified

DNAs to obtain the sequence information of 37 01,37 02,37 C1,37

C2 (of Fig.1). Four reactions of G,A+G,C,C+T are performed on

42

M

Fig.6. A vall restriction enzyme digestion analysis of 37 base pair DNA sequences on denaturing polyacrylamide (14%) gel. Double stranded DNA labelled on either end and used for digestion with Ava II.

G­A­G-T­T­A-

{l= c­A-G-

3702

G

Fig.7. Maxam-Gilbert sequence analysis of37ol, 37o2 on denaturing poly­acrylamide gel (14%) Base corresponding to each band represented on the side. Base specific reactions are indicated on top.

T A

' T c c A G G T

G ' i c

c T

A

c-

37C2

G A+G C· C+T

37CI 1- -

r-1 ----J I

G A+G C C+T

}

-T

-A

-A

Fig.8. Maxam-Gilbert sequence analysis of 37cl, 37c2. Base corresponding to each band represented on the side . Base replacements in 37cl , 37c2 corresponding to 37ol, 37o2 are indicated by arrow.

each of the DNAs. The base corresponding to each band is

represented on the side of the photograph. It should be mentioned

that dimethylsulphate reaction of G is very specific, but other

reactions of A+G, C and C+T are partly non-specific. Thus for a

given base, in addition to an intense band of corresponding

reaction, a faint band also appears for other reactions but .the

base can be identified from the intense band. Bands corr~~ponding

to all the bases in each sequence are clear except in region

bracketed in figures 7 and 8. Here three bands merge slightly

which can be read from the different exposures of the

autora~iogram. This merging is probably because of the secondary

structure possible in this region due to the self complementary­

sequence. Few bases on : : 5~ - ~_. end cannot be read because of the

lack of resolution in this region. The single base difference in

different 37 base DNAs is clearly indicated by an arrow in the

figure 8.

Thus the proof of the synthesised sequences is derived from

Ava II restriction digestion and Maxam-Gilbert sequencing.

2.3. EXPERIMENTAL PROCEDURES

2.3.1. Materials:

2'de~xynucleotides,44'dimethoxytrityl chloride (DMTrCl,

2, 4, 6-triisopropyl-benzenesulphonyl chloride (TPSCl), 4-

dimethylaminopyridine and triazole were purchased from Sigma,

43

U.S.A. TPSCl was recrystallised from hexane before use.

Mesitylene sulphonyl-3-nitro-1,2,4-triazole was synthesised

according to reported procedure (Gait 1984).

Trimethylchlorosilane, phenyl dichlorophosphate, N-methyl

imidazole and dichloroacetic acid (DCA) were procured from Fluka,

Switzerland. Pyridine GR (E.Merck, India) was refluxed and

distilled over ninhydrin followed by distillation over KOH.

Dichloroethane extrapure (E.Merck, India) and acetonitrile (HPLC

grade Spectrochem, India) were refluxed over CaH2 . Silica gel H

(BDH, India) was used for column purification of monomers. Silica

gel G (BDH, India) coated plates were used for analysis of

protected nucleosides and nucleotides. Purification by column

chromatography in oligonucleotide synthesis was done using Merck

Keiselgel 60 (Art 9385) and TLC was carried out on precoated

fluorescent silica gel plates (Merck.Art 5554). Spots on TLC were

visualised using UV light and a spray of 60% perchloric acid­

ethanol (3;2). In the case of trityl derivatives, perchloric

acid-ethanol spray indicated orange spots whereas in non­

tritylated derivatives, black spots appeared upon heating after

acid spray.

2.3.2. Preparation of protected monomers

Preparation of N-acylnuc1eosides:

6-N-benzoyl-2'-deoxyadenosine: (9-12, Scheme 2)

2 '-Deoxyadenosine ( 1. 3g, 5mmol) dried by coevaporation with

44

pyridine was suspended in 25ml of dry pyridine and treated with

3.2ml (25mmol) of trimethylchlorosilane. The mixture was stirred

for 15min and to this was added 3. Oml (25mmol) of

benzoylchloride. The reaction mixture was maintained at room

temperature for 2hr. after which it was cooled in an ice bath and

the reaction was quenched with 10ml of water. After 5min it was

treated with 10ml of 29% aqueous ammonia at room temperature for

30min, the mixture was evaporated to dryness and the residue was

dissolved in 100ml of water. It was washed once with diethyl

ether and the aqueous layer on cooling yielded 1.5gm (90%) of 6-

N-benzoyl,2'-deoxyadenosine.

4-N-benzoyl-2'-deoxy cytidine: (10, Scheme 2)

2'-Deoxy cytidine (i.20g, 5mmol), in a reaction similar to

the above with trimethylchlorosilane (3.2ml) followed by benzoyl

chloride (3.0ml) in pyridine, (25ml) and on work-up yielded 1.5g

(Yield 92%) of 4-N-benzoyl-2'-deoxycytidine.

2-N-isobutyryl-2'-deoxyguanosine: (12, Scheme 2)

This was prepared from 2 '-deoxy-guanosine ( 0. 7g, 5mmol) ,

trimethylchlorosilane (3.2ml) and isobutyrylchloride (4.0ml) by a

procedure similar to that of above. The product was crystallised

from water to obtain 1.0g (70% yield).

45

General procedure for N-acyl-5'-0-dimethoxytrityl deoxynucleo­

sides:

The N-acyl,2'-deoxynucleoside (5mmol) was dissolved in

anhydrous pyridine (15ml) and the solution was evaporated to

dryness. The solid was dissolved in pyridine (lOml) and treated

with 4,4'-dimethoxytritylchloride (1.7g, 5mmol). The mixture was

shaken in the dark for 4 hrs in a sealed flask during which

period pyridine hydrochloride separated out. TLC (silica gel)

analysis in chloroform : ethanol (9:1 vjv) showed the reaction to

be complete as trityl and UV tests showed one positive spot with

higher rf than the starting compound. Methanol (lml) was added to

the mixture and extracted with chloroform (3x40ml). The organic

layer was washed with 1M aqueous sodium bicarbonate (25ml) and

evaporated to dryness, resulting in a gummy mass. This was

chromatographed by the short column method on silica gel-H under

N2 atmosphere (1.5psi) and eluted with dichloromethane containing

1% triethylamine and increasing amounts of ethanol. The product

started eluting around 5% ethanol concentration as monitored by

TLC and the appropriate fractions were combined and concentrated.

The residue was dissolved in dichloromethane (lOml) and

precipitated by slow addition into a solution of 150ml of

ether:heptane (1:1 vjv) containing 1% triethylamine when the

trityl derivatives separated out as amorphous white powder.

46

General procedure for N-acyl-5'-0-(4,4'-dimethoxytrityl) 3'0-

(41chlorophenyl) phosphate triethylammonium salts: (1-4, Scheme 2)

N-acyl-5'-0-methoxytrityl-deoxynucleoside (lmmol) was

suspended in anhydrous pyridine (25ml) and the mixture was

evaporated to a final volume of lOml. 4-Chlorophenyl

phosphorodichloridate (5mmol) was added to pyridine (lOml)

contained in a glass reaction vessel fitted with a sintered disc

and a stopcock and while cooling, water (5mmol, 90ul) was added

into the reaction vessel. On leaving the mixture at room

temperature for lOmin, pyridine hydrochloride separated out. It

was filtered into the reaction flask containing the nucleosides

in pyridine under N2 atmosphere. The mixture was concentrated to

lOml and after 30min at room temperature, the phosphorylation was

found to be complete as shown by TLC. The reaction was stopped by

the addition of 1M triethylammonium bicarbonate (TEAB, 15ml) at

0°C. It was extracted into chloroform (2x75ml), washed with O.lM

TEAB and coevaporated to an oil with pyridine. This was then

chromatographed over silica gel-H by the short column method

using 1% triethylamine in dichloromethane and increasing amounts

of ethanol. The phosphorylated product eluted as triethyl

ammonium salt around 10% ethanol in dichloromethane. The

appropriate fractions were pooled and concentrated and the

product was precipitated as amorphous white power from

47

dichloromethane solution by adding slowly into ether:hexane (1:1

vjv).

2.3.3. Preparation of 3 1 -0-Benzoyl Guanosine (Denny et.al., 1982):

5'-0-Dimethoxytrityl N-benzoyl guanosine (3.7g, 6.9mmol) was

dissolved in dry pyridine ( 15ml) and benzoyl chloride ( 1. Olml,

llmmol) was added dropwise to the stirred solution below 10°C.

After one hour at 20°C, the mixture was poured into ice-water

(200ml) and extracted with chloroform. The solvent was evaporated

and the residue azeotroped with toluene to remove traces of

pyridine and dissolved in ice-cold 2% benzene sulfonic acid in

chloroform/methanol 7;3 v;v. After 10 minutes at o0 c the solution

was washed with 5% aqueous NaHco3 (2x100ml) followed by water.

Removal of water and crystallization of residue from ethanol gave

pure product (Yield 2g, 85%).

2.3.4. Preparation of Phenyl Dihydrogen Phosphate:

Phenol (23g, 0.12mmol) and phosphoryl chloride (62ml,

0. 64mmol) were heated together under reflux in presence of a

catalyst- anhydrous aluminium chloride (30mg). After two hours

of refluxing the products were cooled and distilled to give

phenyl phosphorodichloridate (48g, 0.1mol) b.p 84°C at 0.1torr.

Phenyl phosphorodichloridate (48g, O.lmol) was placed in a

round bottomed flask with a reflux condenser and heated to 80°C

and water (7.5ml, 0.4lmmol) was added dropwise while stirring the

48

contents. After one hour reaction, the products were evaporated

to dryness under reduced pressure and the crystalline compound

that was left was recrystallised from chloroform (11g, 60% yield

m.p 99-100°).

2.3.5. synthesis of d(CACGTG):

The general protocol of the solution phase chemical

synthesis is illustrated by the following procedure for the

chemical synthesis of d(CACGTG).

Step (1): The phosphodiester block DMT-T-p (~, 140mg, 0.18mmole)

and the 3 '-terminal nucleoside (1. HO-dG-Bz, 72 mg, o .15mmole)

were dried by coevaporation (2 times) and dissolved in dry aceto­

nitrile (1ml/0.1mmole of 1.,) under anhydrous conditions and

treated with the condensing agent ( 0. 4 5mmole, TPSCl, 14 Omg or

MSNT, 133mg) and 1-methylimidazole (0.9mmole, 72ul). The reaction

mixture was stirred at room temperature. The reaction, followed

by TLC was essentially complete within lOmin. Excess reagents

were destroyed by treatment with aq. NaHC03 and the product was

extracted into chloroform (3x20ml). The chloroform layer was

washed with water (lOml) and dried (over Na2so4 ) .The organic

layer was concentrated under reduced pressure to yield a

colourless foamy material of the protected dinucleotide }_. The

total time to complete step 1 was 30min. The product was taken to

step 2 without any characterization.

49

Step (2): The material from step 1 was dissolved ~n chloroform­

methanol (95:5, vjv, 6ml), cooled at 10°C and treated with solid

phenyl dihydrogen phosphate (260mg, 1.5mmole). An instantaneous

orange-red colour was produced. After 5-10min (checked by TLC)

the reaction mixture was diluted with chloroform (20ml) and

washed with . aq. NaHco 3 . The dried organic layer on evaporation

gave a foamy material which was purified by step 3 to give ~.

Step ( 3) : The material from step 2 was dissolved in chloroform

(1.5ml) and loaded uniformly over a short column (2cm i.d.) of

Merck silica gel (8g). The column was washed with chloroform

(20ml), when a pale yellow band separated and eluted out. This

was then followed by elution with anhydrous tetrahydrofuran-

pyridine (3:1, v;v, 40ml) when the desired product, was obtained

in the eluant. This was recovered after evaporation under reduced

pressure and repeatediy coevaporated with dichloromethane. The

product (TpGibu_Bz, 120 mg, 90% yield) was dried over P2o5-KOH

in a vacuum desicator and used for initiating the next cycle.

Four more cycles were carried out similarly according to the

conditions shown in table 5. After the final cycle, the product

obtained was subjected to a sequence of reactions (described

later) to yield the completely deblocked d(CACGTG).

50

Table 5 Reaction conditions for synthetic cycles in synthesis of d(CACGTG)

3' -component (mg, mmole)

d(T G61 -Bz) p (115, 0.13)

d(G\b~ ~~W.-Bz) (140, 0.1)

. ·w il.u d(c.'f d .fTpG -Bz) (140, 0.08)

5 •- component (mg, mmole)

Condensing agent

(mg, mmole)

N-Methyl­imidazole (ul, mmole)

n,., DMT-dG-S&. TPSCl 62; 0. 78 (140, 0.15) (117, 0.39)

DMT-dc;8z. (130, 0.14)

DMT-dj7-( 106, 0. 11)

DMT-dCiz. (72, 0.08)

TPSCl (90, 0.3)

MSNT (71, 0.24)

MSNT (45, 0.15)

48; 0.6

38; 0.48

25; 0.3

Product (mg, yield)

d(G1~TpG -Bz> (144,80%)

A:L ·t.u } '-4 d(c-p d r TpG -Bz) (140, 70%)

. ·w d( c.sz A8

z. c& G"~TpG -Bz > P r p L

(144, 70%)

2.3.6. Synthesis of d(CACCGTG), d(CACGGTG):

The above heptamer sequences were also assembled in a

similar manner. After initial two nucleotides addition to 3'

blocked guanosine, the resulting HO-GpTpG (500mg, 0.3mmole) was

divided into two halves (0.15mmole each) and further building of

heptamers was carried out. Thus one half of Ho-GpTpGBz (250mg,

0.15mmole) used for d(CpApCpCpGpTpG) and another half used for

d(CpApCpGpGpTpGp). Step wise conditions used in different steps

are in tables 6 a,b.c.

2.3.7. Deprotection of hexamer and heptamers: (scheme 4)

d(AcO-CpApCpGpTpG-Bz):

d(CpApCpGpTpG-Bz)

( 0. 6ml) and pyridine

(140mg) was treated with acetic anhydride

(1.5ml) at room temperature for 2h. The

reaction mixture was poured into ice-water and stirred for lOmin.

It was then extracted into chloroform (25ml), washed with aq.

NaHC03 and dried over Na 2so4 . The organic layer on concentration

gave a foamy acetate product (130mg; 92%).

d(CACGTG):

The acetate obtained above was dissolved in dioxane-water

(l:lvjv, lOml) and treated with syn-2-nitrobenzaldoxime (400mg)

followed by tetramethylguanidine ( 0. 27ml) . The reaction mixture

was kept at room temperature for 14h and then heated at 60°C for

3h. It was lyophilized and then treated with concentrated ammonia

51

Table 6a Reaction conditions for Trimer dbuT dbu - Bz p p

3'-component 5'-component Condensing (mg, mmole) (mg, mmole) agent

(mg, mmole)

ibu Ho-G -Bz DMT-T 452; 1.5 p

(240, 0.5) (240, 0.5)

ibu Ho-T G -Bz DMT-dbu p p

(400, 0.4) (165, 0.5) 361, 1.2

N-Methyl- Product imidazole (mg, yield) (ul, mmole)

0.2; 7.8 (T dbu_Bz) p

(450, 0.4)

74; 098 dbuT dbuBz .P p

. ibu ibu Table 6b Reaction conditions for Heptamer d(CACCGTG) from Tnmer G T G p p

3'-component (mg, mmole)

dbuT dbu_Bz p p

250, 0.15

CBzdbuT dbu_82 p -p p

250, 0.12

CBzCBzdbuT dbu82 p p p p

250, 0.098

ABzcBzcBzdbuT dbu_82 p p p p p p

180, 0.06

5'-component (mg, mmole)

DMT-Cp

184, 0.21

DMT-Cp

175, 0.204

DMT-Ap

187, 0.19

DMT-Cp

105, 0.12

Condensing agent

(mg, mmole)

TPSCI

180, 0.6

TPSCI

181, 0.61

TPSCI

181, 0.6

TPSCI

108, 0.36

N-Methyl­imidazole (ul, mmole)

72; 0.9

96, 1.2

96, 1.2

57.6, 0. 72

Product (mg, yield)

C dbuT db~ 6z. p p

250, 0.12

CBzCBzdbuT db~Bz.. p p p p

250, 0.098

A BzCBzcBzdbuT G -Bz p p p p p

180, 0.06

CBz A CBzdbuT G -Bz p p p p p

100, 0.025

Table 6c Reaction conditions for synthesis of he pta mer d(CACGGTG) from trimer dbuT dbu -Bz p

3'-component (mg, mmole)

Ho-dbuT dbuBz p p

250, 0.15

Ho-dbudbuT dbuBz p p p

k\O..:~BzdbuT dbu82 p p p 320, 0.105

Ho-A BzcBzdbudbuT dbuBz p p p p p

tSo,o·o!;

51-component (mg, mmole)

DMT-dbu p

241, 0.26

DMT-C82

p

199, 0.20

B% DMT-Ap

187, 0.2

DMT-C~2

88, 0.1

Condensing N-Methyl-agent imidazole

(mg, mmole) (ul, mmole)

TPSCI 145, 1.82

314, 0.45

TPSCI 112, 1.4

240, 0.816

TPSCl 112, 1.4

240, 0.8

TPSCl 96, 1.2

150, 0.5

Product (mg, yield)

HodbudbuT dbu -BZ p p p

300, 0.12

CBzdbudbuT dbuBZ p p p p

320, 0.105

B B "b "b Gibu A zC zd ud uT: -S-z..

p p p p f'

180, 0.05

CB~A B~cB:Gi~ud~ulpdb_:Is:o. 90, 0.024

(30ml) in a sealed flask for 20h at 60°C. The ammonia was evapo­

rated and the product was passed through a Sephadex G-15 column

(bed volume 120ml) and eluted with 20% methanol-water. The eluted

fractions were monitored by UV detector and the major peak

eluting in the void volume was lyophilized. The residue was then

purified over FPLC to obtain d(CACGTG) (70mg, 30% overall yield).

d(CACCGTG), d(CACGGTG):

Protected heptamers d(CpApCpCpGpTpG), d(CpApCpGpGpTpG) were

subjected to deprotection steps similar to hexamer and purified

over FPLC [yield d(CACCGTG)=14mg and d(CACGGTG)=9mg].

2.3.8. Synthesis of operator DNA sequences:

37 base length DNAs which correspond to native operator and

modified operator sequences (Fig .1) were synthesised by solid

phase phosphoramidite synthesis on an automatic gene assembler.

The general scheme of synthesis is indicated in scheme 5.

The sequential ·active nucleotide' addition on to nucleoside on

solid support, solvent washings after coupling, r 2 oxidation,

capping with acetic anhydride and further 5' DMTr deprotection

was carried out under the microprocessor control which delivers

reagents using a peristaltic pump to specified timings. The

sequence of bases that are to be added from 3 '-5' end can be

programmed. The timings and sequence of reagents additionjwashing

is indicated in table 4. The most critical point in automatic

52

synthesis is the purity and dryness of solvents (acetonitrile,

dichloroethane) and mononucleotides (NN' diisopropylamino, p -

cyano-ethyl phosphoramidites). Solvents are refluxed vigorously

over CaH2 for a minimum of 24h and then freshly distilled before

synthesis and kept over activated molecular sieves 0

( 3A ) 100

gmjlit. Residual moisture in nucleotides and solvents was taken

care by keeping them over molecular sieves during synthesis.

Complete deprotection was achieved by treating with

concentrated ammonia (25%) in a sealed tube for 17hrs at 60°C.

General yields from a synthesis using 0. 2umole nucleotide as

starting material are about 5 ~of the final oligonucleotide

(overall yield of 10%)

2.3.9. Purification of oligonucleotides:

Oligonucleotides, d(CACGTG), d(CACCGTG), d(GTGGCAC} were

purified using a Mono Q an ion exchange preparative column on

FPLC ( Pharmacia) After loading sample onto an equilibrated

column, a gradient was generated using two buffers. Buffer A -

0. 01 M NaOH pH 11 and Buffer B - 0. 01M NaOH pH 11, NaCl 1M.

Figures 2 and 3 illustrate runs on the Mono Q (5/5) column. The

major peak from each was collected, neutralised to pH 7 using

dilute HCl and the resulting solution dried and desalted over

Sephadex G-15 column. The purified compounds were checked for

53

purity on an analytical reverse phase RPC column (5/5) on FPLC

and 8M urea denaturing acrylamide gel (Fig.2b and 4).

Purification of 37 base DNA's were performed using 7M urea

14% acrylamide gel (1.5mm thick) of size of sequencing gels (38cm

long). 37 base DNA approximately move with xylene cyanol so the

loading buffer contained only deionised formamide with 1mM EDTA.

Buffer containing bromophenol blue and xylene cyanol was run in

an adjacent lane to mark the migration of DNA. Samples were

electrophoresed at 1600 volts for 3-4hrs. DNA was visualised by

placing a fluorescent TLC plate under the gel and DNA viewed by

UV torch. The slowest moving band was excised taking care that

the n-1 band do not contaminate the 37-mer. The gel was crushed

and incubated with sterile water containing 5mM EDTA at 37° c

overnight. DNA was removed from gel by repeated extractions, the

extract dried and EDTA removed by passing through a spun column

(Sephadex G-25} two times. DNA were later labelled, size marked

and checked for purity. Sequences were confirmed by restriction

digestion (Fig. 6). The 37 basepair native operator DNA has two

Avail restriction sites in the 17 basepair operator.

2.3.10. Characterization of oligonucleotides

Restriction endonuclease digestion:

5 '-hydroxyl labelled double stranded 37 basepair operator

fragments (37°to 37 1 v) in medium salt concentration buffer (lOmM

54

tris, 10mM MgC1 2 , 50mM NaCl) were treated with Avaii (2 units

each) at 37°C for one hour. The reaction was stopped with 1ul of

0.5M EDTA, part of the reaction mixture (10ul) was dried ,added

to the loading dye containing formamide. This sample was heated

in boiling water for 3 min and cooled on ice and loaded onto 14%

polyacrylamide, 7M urea gel. When the bromophenol dye moved 3/4th

distance on 38cm long (0.4mm thick) gel, the gel was dried and

autoradiographed overnight.

Maxam Gilbert sequencing:

Chemical modification reactions of 3 7 base DNAs was

performed according to modified Maxam Gilbert procedure (Maxam

and Gilbert 1979 and Pharmacia user bulletin). The detailed

procedure of G, A+G, C, C+T reactions are described in table 7.

After the modification reactions and strand cleavage the samples

were dried added with formamide dye, heated in boiling water bath

for 3 min and loaded on to 14% polyacrylamide gel. When the

bromophenol blue has moved 3/4th distance on the gel 38cm long

gel ( 0. 4mm thick) , the gel was dried and autoradiographed

overnight.

Oligonucleotides d(CACGTG), d(CACCGTG), d(CACGGTG) and 37-

mers were made into duplexes and used for structural studies and

Mnt repressor interaction studies which are described in the next

two chapters.

55

Table 7: Maxam-Gilbert Sequencing reactions

~

32 P DNA 80000 cpm in Sul water OMS 160ul buffer

1ul OMS

Incubate 4S sec. at 37°C

30ul 1M NaoAC pH 4.S stop soln.

Sul (Sug) CT DNA 800ul ice cold ethanol

Chill -70°C half

Spin 1SOOO rpm 20 min 4°C

decant ethanol

Pellet+30ul water

120ul ethanol

hr

Chill -70°C half hr

Spin 1SOOO rpm 20 min, 4°C

Decant ethanol, Dry

32 P DNA 1,20000 cpm in 20ul water

32 P DNA 80000 cpm in Sul water

3ul piperidine formate 1Sul 5M Nacl (made fresh)

Incubate 12 min. at 37°C

Dry in speedvac

SOul water-dry

SOul water Dry

SOul 1M piperidine

30ul hydraz i ne h.,t"iG~~

Incubate 18 min. at 37°C

Keep in ice add SOul water

Sul CT DNA

480ul ice cold ethanol

chill -70° half hr.

Spin 15,000 rpm 20 min 4°C

decant ethanol

Pellet+30ul water

120ul ethanol

Chill -70°C half hr

Spin 1SOOO rpm 20 min, 4°C

Decant ethanol, Dry

Seal the cap with teflon tape

C+T -32P DNA 1,20000 cpm in 20ul water

30ul hydrazine·hydrate

Incubate 1Smin. at 37°C

~ILl 0 .3M NaoAC S '4.l C T D N A ( Sc.q>

420ul ice cold ethanol

Chill -70°C half hr

Spin lf,ooo rem Pellet+30ul water

120ul ethanol

PPt

Decant ethanol

Dry

Heat to 90°C for 30min on heating block with weight on the samples Dry in Savant speedvac SOul water,Dry SOul water,Dry Dissolved in formamide dye Count and loaded onto sequencing gel