Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
15
CHAPTER 2
IDENTIFICATION OF MARINE STREPTOMYCES SP
STRAIN EPD 27
2.1 INTRODUCTION
Actinobacteria are well known for their ability to produce
secondary metabolites (Balagurunathan 2004). Actinobacteria are filamentous
in nature and comprise key antibiotic producers (Waksman 1968 and
Williams and Cross 1971). Streptomyces is the most prolific genus of
actinobacteria as it is responsible for the production of 80% of known
antibiotics and bioactive compounds for pharmaceutical industry (Dhevagi
and Poorani 2008).
For several decades, terrestrial actinobacteria have proved to be
good source of antibiotics. The pharmaceutical industry has isolated and
screened millions of terrestrial Streptomyces for their biologically active
metabolites including antibiotics, antitumour compounds and enzymes
(Gontang et al 2007, Moore et al 2005, Newman and Gragg 2004). However,
the rate of discovery of new metabolites from terrestrial actinobacteria is
diminishing and new sources of therapeutic compounds need exploration
(Adinarayana et al 2006, Das et al 2006). Marine sources are highly attracted
for the probability of discovering novel actinobacteria for pharmaceutical
industry (Bull et al 2000). Marine actinobacteria have been widely recognized
as a potential source of new drug candidates in recent years (Fiedler et al
2005). They can produce structurally unique metabolites which are not found
16
in their terrestrial counterparts due to their extreme living conditions within
the marine environment (Kwon et al 2006, Miller et al 2007).
Anticancer agents of marine actinobacteria were first reported by
Fenical (1993). They also suggested that marine sediments are the rich source
for the isolation of marine adapted actinobacteria. Das et al (2006) proposed
that marine actinobacteria are a new promising source for antitumour agents.
Antitumour metabolites of actinobacteria in marine sediments of China were
reported by Liang et al (2009).
Marine actinobacteria research is developing strongly in several
countries with a distinct focus on anticancer agents but in India it is still in its
infancy (Balagurunathan 2004). Search for therapeutic enzymes are currently
under progress in order to meet the increasing demand in new medicines
especially for cancer due to its rapid development of resistance for drugs.
Moreover the high toxic profile of drugs and their undesirable side effects
increases the demand of anticancer enzymes with high therapeutic efficiency
(Demain and Sanchez 2009). As described in earlier section 1.3.5, recent
studies have shown that marine actinobacteria are found to be a good source
for therapeutic L-asparaginase (Dhevendaran and Annie 1999, Dhevagi and
Poorani 2006, Gupta et al 2007, Sahu et al 2007, Dhevagi and Poorani 2008).
However these studies have been completed only upon the isolation
of marine actinobacteria from marine environment for screening of
L-asparaginase potentials. Due to the lack of standards for the classification
and identification of new strains of marine actinobacteria, they were identified
by classical method. This method includes a series of studies on cultural,
morphological and biochemical characteristics of the new strains. It is time
consuming and also is accompanying many difficulties due to differences in
physical and biochemical characteristics of the same strain grown in different
habitats. A number of developments in the molecular biology techniques and
17
methods have helped to overcome this problem. One such method, 16S rRNA
gene analysis has been widely used in the identification system. The high
conservation of the 16S rRNA genes in prokaryotes, retained the rRNA gene
structure and function homology in the process of biological evolution. At the
same time, the gene is also mutated in different degrees, and these changes
helped to keep up with the evolutionary distance (Jiao and Liu 2001).
Therefore 16S rRNA gene sequence analysis gradually improved the
identification of marine actinobacteria. In recent years, a combination
approach has been used in authentic identification of marine actinobacteria
(Kokare et al 2004, Lu et al 2009, Liang et al 2009).
One of the main objectives of the present investigation was
isolation of a high L-asparaginase potential marine actinobacteria from
sediments of Parangipettai, East coast region of India and its authenticity
based on a combination approach. In this chapter, the procedures and
techniques used for the identification of marine Streptomyces sp strain EPD
27 and the results obtained are discussed.
2.2 MATERIALS AND METHODS
The methodology of this chapter is sequentially organized as
isolation of marine actinobacteria from sediments, screening of the isolates
for their L-asparaginase production, selection of a high L-asparaginase
potential strain and identification of the potential strain at genus level are
presented as follows.
2.2.1 Sample Collection
The marine sediment samples were collected from three different
sites of Parangipettai, East coast region of India (Lat.11º 42‟ N; Long 79º
46‟ E) during the month of January 2007. The samples were collected using
18
alcohol rinsed Peterson-grab and were transferred to a new polythene bags
using sterile spatula. Then the samples were transported to the laboratory for
further actinobacterial analysis (Dhevendaran and Annie 1999).
2.2.2 Isolation of Marine Actinobacteria
Sediment samples were air dried and enriched as follows. One gram
of sediments from each sample was transferred to 100 ml of nalidixic acid
(NA) supplemented seawater complex broth and starch casein broth in a
250 ml conical flask. This was incubated at 30 ºC in a shaker cum incubator
(Orbit, NEOLAB) at a speed of 120 rpm for 7 days (Ellaiah and Reddy 1987,
Balagurunathan and Subramanian 2001).
The enriched cultures were inoculated in different selective media
such as seawater complex agar (SWA), starch casein agar (SCA), Kuster‟s
agar (KA), and glucose asparagine agar (GAA) supplemented with
cycloheximide 50 µg /ml and nalidixic acid 30 µg /ml. The above cultures
were incubated at 30 ºC in a shaker cum incubator at a speed of 120 rpm for 7
days for the isolation of actinobacteria. Single separated colonies were
selected, subcultured and maintained in starch casein slants at 4 ºC until
further use (Benny and Kurup 1991, Rathnakala and Chandrika 1993, Hakvag
et al 2008).
2.2.3 Screening of the Strains for L-asparaginase Activity
A combined screening procedure such as qualitative and
quantitative assays was used for the determination of L-asparaginase activity
of marine actinobacteria and for the selection high L-asparaginase potential
strain.
19
2.2.3.1 Qualitative assay for the determination of L-asparaginase
activity
A total of thirty four marine actinobacteria were isolated from the
samples. All the strains were named as EPD (E. Poorani Dhevagi) strains such
as strain EPD 1 to EPD 34. They were screened for their L-asparaginase
activity by rapid plate assay method described by Gulati et al (1997). This is a
qualitative assay which determines the capability of L-asparaginase activity of
bacteria. The strains were streaked on the modified M9 agar plates and
incubated at 30 ºC for 7 days. M9 medium was modified by supplementation
L-asparagine as a sole carbon source for the growth of strains and by addition
of three drops of phenol red indicator dye (pH 7). The strains that grew well
in the medium were able to change colour of the medium from yellow to pink
due to the production of ammonia and were considered as active strains. The
mechanism behind this reaction is the substrate L-asparagine is cleaved to
L-aspartic acid and ammonia by the intracellular enzyme L-asparaginase
which is produced by the active strain. Due to production of ammonia leading
to alkaline pH, the colonies with pink zones were considered as
L-asparaginase producing active strains and were selected (Gulati et al (1997).
2.2.3.2 Quantitative assay for the determination of L-asparaginase
activity
The selected active strains were EPD2, EPD7, EPD11, EPD19,
EPD24, EPD27 and EPD33. The active strains were inoculated into glucose
asparagine broth (pH 7.0) and were incubated at 30 ºC in a shaker cum
incubator at a speed of 120 rpm for 7 days. The growth of actinobacteria was
measured as dry weight and the L-asparaginase activity was measured by the
method followed by Imada et al (1973). The cultures were centrifuged (Model
C: 24 BL, REMI) at 10000 rpm for 15 min. Cell pellets were collected and
washed twice with 0.05 M Tris buffer (pH 8.6), suspended in ice cold buffer
20
for two hours (twice the volume of the cell pellet) followed by sonication at 5
cycles for 3 min by using Sonicator (Model 102 C, Brandson). Pale white
lysates obtained were subjected to centrifugation at 10000 rpm at 4 ºC for 20
min and supernatant fluids were collected. This was considered as crude
enzyme preparation and was used to determine the L-asparaginase activity.
L-asparaginase was routinely assayed by nesslerization method
(Imada et al 1973). This is a quantitative assay which determines the amount
of L-asparaginase production by each strain. The reaction was started by
adding 0.5 ml of crude enzyme solution with 0.5 ml of 4 M L-asparagine and
0.5 ml of 0.05 M Tris buffer (pH 8.6). The mixture was incubated at 37 ºC for
30 min. After incubation, the reaction was stopped by the addition of 0.5 ml
of 1.5 M Trichloroacetic acid (TCA). It was centrifuged at 10000 rpm at 4 ºC
for 10 min and the supernatant was collected. One ml of supernatant fluid was
diluted to 5 ml with distilled water and ammonia was released from the
supernatant by the addition of 0.2 ml of Nessler‟s reagent. It was allowed to
stand at 25 ºC for 10 min and the absorbance of supernatant was measured
using UV- visible spectrophotometer (SL 159, Elico) at a wave length of
450 nm. The amount of ammonia liberated in the reaction mixture was
determined from a calibration curve prepared with standard ammonium
chloride solutions following the same procedure. One unit (IU) of enzyme
activity was defined as the amount of enzyme that catalyzed liberation of
1 µmol of ammonia min-1
under standard conditions.
2.2.3.3 Selection of high L-asparaginase potential strain
Based on the amount of enzyme production in quantitative assay, a
high L-asparaginase potential strain was selected for further authentic
identification (Dhevagi and Poorani 2006, Khamna et al 2009).
21
2.2.4 Identification of the Potential Strain
The strain EPD 27 was selected as the potential strain for further
identification. A combination approach which includes classical and
molecular methods was used for the identification.
2.2.4.1 Classical method
Classical method includes the cultural, morphological and
biochemical studies of a strain for initial classification. The characteristics of
strain EPD 27 were studied in accordance to Bergey‟s Manual of Systematic
Bacteriology (Lechevalier 1989). The strain EPD 27 was grown in starch
casein broth for the following cultural and morphological studies.
2.2.4.2 Gram staining
A bacterial smear was prepared, the air-dried and fixed using heat.
Crystal violet stain was flooded on the smear and kept for 30 min. It was
washed with running water and was incubated with iodine for 60 sec. Then
the smear was washed again with running water and with 95% ethyl alcohol
and kept aside for 30 sec. The counter stain saffranin was added, incubated
for 30 sec and observed under microscope. Cells which undergo
decolorization are referred to as Gram negative and it shows counter stain,
cells which retain purple colour are referred as Gram positive.
2.2.4.3 Motility
The motility of the strain was analyzed by hanging drop method.
The bacterial culture prepared was placed on the cover slip, petroleum jelly
was applied on the corners of the cover slip. It was covered with a depression
slide and was observed under oil immersion microscope. The cells which
show actual motility in water molecules are referred as motile and the cells
22
that show vibratory movement due to their bombardment by the water
molecules are referred as non motile.
2.2.4.4 Acid fast Staining
Acid fast property of the strain was analyzed by Ziehl-Neelson
method. A bacterial smear was prepared, carbol fuchsin stain was flooded on
the smear and fixed using heat. It was decolorized with alcohol by incubation
for 20 sec and was washed with running water. The counter stain methylene
blue was added and incubated for 20 min. It was observed under oil
immersion microscope. The cells which observe the counter stain were
referred as non acid fast and the cells which retain red colour were referred as
acid fast.
2.2.4.5 Biochemical studies
The following biochemical studies were described in accordance to
Bergey‟s Manual of Systematic Bacteriology (Lechevalier 1989). The
biochemical characteristics of the strain EPD 27 were studied by using starch
casein broth and slant cultures.
2.2.4.6 Catalase test
The slant culture was treated with few drops of hydrogen peroxide,
appearance of immediate effervescence of the culture indicated the presence
of catalase enzyme and was considered as positive reaction. Absence of the
effervescence indicated absence of catalase enzyme and was considered as
negative reaction.
23
2.2.4.7 Methyl red test
A loopful of culture was inoculated into methyl red and Voges
Proskeur (MR-VP) broth and incubated at 30 ºC for 48 h. Few drops of
methyl red solution were added to the culture. A bright red colour of the
culture indicated the high amount of acid production and was considered as
methyl red positive reaction and the yellow colour of the culture indicated the
absence of acids and was considered as methyl red negative reaction.
2.2.4.8 Voges-Proskeur (VP) test
A loopful of culture was inoculated into MR-VP broth and
incubated at 30 ºC for 48 h. The culture was treated with 1 ml of 40%
potassium hydroxide and 3 ml of 5% solution of alpha-naphthol in absolute
ethanol. A deep pink colour of the culture indicated the presence of acetoin
which was considered as VP positive reaction and no colour change in the
culture indicated the absence of acetoin and so it was considered as VP
negative reaction.
2.2.4.9 Oxidase test
The culture slant was treated with oxidase disc. A purple blue
colour change of the culture indicated the presence of oxidase enzyme which
was considered as oxidase positive reaction and no colour change in the
culture indicated the absence of the enzyme oxidase so it was considered as
oxidase negative reaction.
2.2.4.10 Nitrate reduction test
A loopful of culture was inoculated into trypticase nitrate broth and
incubated at 30 ºC for 96 h. The culture was treated with 0.1 ml of a reagent
containing equal volume of sulfanilic solution and alpha-naphthylamine
24
solution followed by zinc powder. A red colour of the culture indicated the
presence of the enzyme nitrates and was considered as positive reaction
whereas no colour change of the culture indicates the absence of nitrates and
was considered as negative reaction.
2.2.4.11 Gelatin hydrolysis
The culture was inoculated into nutrient gelatin tubes and incubated
at 30 ºC for 28 h. The liquefaction of gelatin in the culture tubes indicated the
presence of gelatinase enzyme and was considered as positive reaction.
Absence of gelatin liquefaction in the tubes indicated the absence of the
enzyme gelatinase and was considered as negative reaction.
2.2.4.12 Casein hydrolysis
The culture was streaked on the skim milk agar plates and
incubated at 30 ºC for 48 h. A clear zone around the colonies indicated the
presence of proteinase and was considered as positive reaction. The colonies
remained opaque indicated the absence of the enzyme proteinase and was
considered as negative reaction.
2.2.4.13 Starch hydrolysis
The culture was streaked on the starch agar plates and incubated at
30 ºC for 48 h. The culture was treated with few drops of iodine solution, a
clear zone around the colonies indicated the presence of the enzyme amylase
and was considered as positive reaction. The colonies remained opaque
indicated the absence of the enzyme amylase and was considered as negative
reaction.
25
2.2.4.14 Tyrosine hydrolysis
The culture was streaked on the tyrosine agar plates and incubated
at 30 ºC for 48 h. A clear zone around the colonies indicated the presence of
the enzyme tyrosinase and was considered as positive reaction whereas the
colonies remained opaque indicated the absence of enzyme and was
considered as negative reaction.
2.2.4.15 Utilization of carbon sources
The culture was inoculated into 50 ml of basal medium modified
with various carbon sources such as glucose, sucrose, fructose, mannitol,
rhamnose and inositol in 100 ml conical flasks were incubated at 37 ºC for
48 h. Growth of the cultures indicated the utilization of the respective carbon
source and considered as positive reaction whereas the poor growth indicated
the negative reaction.
2.2.5 Molecular Method
16S rRNA gene analysis was performed for confirmation of the
strain at genus level. The methodology includes standard molecular
techniques and their protocols are presented in this section.
2.2.5.1 Genomic DNA isolation
The potential strain EPD 27 was grown on starch casein broth at 30
ºC for 5 days in a shaker incubator at 200 rpm to obtain vegetative cells. The
culture was harvested by centrifugation at 5000 rpm for 10 min. The cell
pellets were used for genomic DNA extraction using QIAGEN DNA isolation
kit (Qiagen, Valencia, CA) in accordance with the manufacturer‟s instruction.
The extracted genomic DNA was resolved in 1% agarose gel as 1, 1.5 and
2 µl respectively along with そ DNA/Hind III DNA marker (MBI Fermentas).
26
Further the genomic DNA suspended in 100 µl of elution buffer (10 mmol l-1
Tris-Cl, pH 8.5) was quantified by measuring OD at 260 nm (Sambrook et al
1989).
2.2.5.2 Amplification of 16S rDNA gene
Polymerase Chain Reaction (PCR) amplification of 16S rRNA gene
was performed with 100 ng of genomic DNA. 16S rRNA gene was amplified
from total DNA by using universal bacterial primers, forward 27 (FP 27 5‟ to
3‟ AGAGTTTGATCCTGGCTCAG) and reverse 1492 (RP 1492 5‟ to 3‟
ACGGCTACCTTGTTACGACTT) in accordance with the method described
by Nagger et al (2006). The PCR amplification was performed in a 20 µl
reaction mixture containing 100 ng of template DNA, 20 µmol of primers,
200 µM dNTPs, 1.5 mM MgCl2, 1U of Taq DNA polymerase (MBI
Fermentas) and 2 µl of 10X Taq polymerase buffer.
Amplification was carried out with an initial denaturation at 95 ºC
for 5 min followed by 35 cycles of denaturation at 94ºC for 45 sec, annealing
at 56 ºC for 45 sec, extension at 72 ºC for 1 min and final extension at 72 ºC
for 5 min using thermocycler (model-iCycler, Bio-Rad Laboratories, CA).
Following thermal cycling, the PCR products were loaded in 1% agarose gel.
Size of the amplicons was assessed by comparison with 100 bp plus DNA
marker (MBI Fermentas) (Sambrook et al 1989).
2.2.5.3 PCR product purification
The amplified 16S rRNA gene fragment was gel purified by using
QIAquick gel extraction kit following the standard protocols as supplied by
the manufacturer (Qiagen, Valencia, CA). The purification involved the
addition of high salt binding buffer to the PCR mix and application on to the
QIAquick spin column and centrifugation. The unbound DNA was removed
27
by the addition of wash buffer and centrifugation at 10000 rpm for 2 min. The
PCR products were eluted using elution buffer and centrifugation.
2.2.5.4 Ligation and transformation
The purified PCR products were ligated into pGEM T Easy vector
in accordance to protocol supplied by the manufacturer (Promega
Corporation, Madison, USA). Ligation of the PCR products to the vector was
carried out using T4 DNA ligase, ligation buffer and vector, all supplied by
the manufacturer. The ligation was carried out at 4 ºC overnight. After the
ligation, it was transformed into high efficiency competent E. coli DH5g cells
and plated on Luria Burtani (LB) medium containing ampicillin (50 µg ml-1
),
X-Gal (5-bromo-4-chloro-3-indoyl-く-D-galactopyranoside; 20 µg ml-1
) and
IPTG (isopropyl-く-D-thiogalacto pyranoside; 0.1 mmol ml-1
) and incubated at
37 ºC for overnight. After incubation, recombinant colonies were selected
using blue/white screening. The transformed white colonies were selected for
the extraction of recombinant plasmid DNA (Sambrook et al 1989).
2.2.5.5 Plasmid isolation from the clones
Each of the white colonies were resuspended in a volume of 5ml
LB broth containing ampicillin (50 mg/ml-1
) and incubated at 37 ºC overnight.
The cells were centrifuged at 10000 rpm for 1 min and the supernatant was
discarded. Each pellet was resuspended in 400 たl lysis buffer (50 mM
Glucose, 2mM Tris/HCl, 10 mM EDTA) and vortexed for 5-10 sec. This was
incubated at room temperature for 10 min. To this, 400 たl freshly prepared
NaOH/SDS (0.2 M NaOH, 20% SDS) was suspended and mixed thoroughly
then it was left on ice for 10 min, it was added with 300 たl cold (4 ºC) 7. 5 M
NH4 OAc (pH 7. 6), incubated on ice for 10 min, and then centrifuged for
10 min at 10, 000 rpm at room temperature. The pellet was added with
1000 たl of 2 M NH4 OAc (pH 7.4), mixed thoroughly, and was left at room
28
temperature for 10 min and then centrifuged, further 650 たl isopropanol was
added to this and mixed. The mixture was left at room temperature for 10 min
and then centrifuged for 10 min at 10, 000 rpm. The supernatant was
discarded and 100 たl of 2 M NH4 OAc (pH 7.4) was added to the pellet and
mixed thoroughly, it was left on ice for 10 min and then centrifuged for
10 min at room temperature. The supernatant was collected and to this 110 たl
isopropanol was added. This was left at room temperature. The suspension
was centrifuged at 10000 rpm for 10 min at room temperature and the
resultant pellet was collected. The pellet was washed with 1 ml of 70%
ethanol and air dried. Then the pellet was dissolved in 25 たl of distilled water
for further use. The plasmids were visualized by comparison with 1 kb DNA
ladder (MBI Fermentas) in agarose gel electrophoresis (Sambrook et al 1989).
2.2.5.6 DNA sequencing and data analysis
The presence of insert DNA encoding 16S rRNA gene in the
plasmid was further confirmed by sequencing. The purified plasmid was
sequenced by automated DNA sequencer (Model 3100, Applied Biosystems,
USA).
After sequencing, the sequences were analyzed using the basic
local alignment search tool (BLAST) software http://www.ncbi.nlm.nih.gov/
blast. The partial 16S rDNA sequences of strain EPD 27 was used to search
the GenBank database with BLAST N algorithm to identify the related
sequence and were aligned generating a complete alignment of 16S rDNA
sequences of selected members of the family Streptomycetaceae by using
Clustal X (Thompson et al 1997). The neighbor-joining (NJ) plot method was
used to generate boostrap values for aligned sequences were incorporated into
(from 1000 resamplings) and phylogenetic analyses were conducted in
MEGA4 (Tamura et al 2007).
29
2.3 RESULTS AND DISCUSSION
2.3.1 Prevalence of Actinobacteria in Marine Sediments of
Parangipettai
Recently marine actinobacteria received increasing attention for
anticancer agents (Olano et al 2009). Marine sediments of Parangipettai, East
coast region of India are found to be contained wide range of salinities and
organic content Sivakumar et al (2005). Previous studies have shown that
marine sediments of Parangipettai are good source for the isolation of novel
marine actinobacteria for bioactive compounds (Ellaiah and Reddy 1987,
Balagurunathan 2004, Poorani et al 2009). This has prompted for the
systematic study on marine actinobacteria for new L-asparaginase. Marine
sediments of Parangipettai were investigated and found to be a rich source of
marine actinobacteria to screen for high potential L-asparaginase producers.
The prevalence of marine actinobacteria in sediments of Parangipettai was
analyzed using three sediment samples. All the samples were found to yield
considerable number of marine actinobacteria. A total of thirty four strains
were isolated by an enrichment method. It was found to be an increased count
of marine actinobacteria while comparing with the results of Balagurunathan
and Subramanian (2001) which showed only 51 strains from 10 sediment
samples. Counts of the actinobacteria population did not vary according to the
samples and this might be due to the influences of organic content of
sediments. Similar observation was reported by Ellaiah and Reddy (1987).
The prevalence of marine actinobacteria population in sediments of
Parangipettai is shown in Table 2.1.
30
Table 2.1 Prevalence of actinobacteria population in marine sediments of
Parangipettai grown in different selective media
Sample Sample site
(within 1 km) Aerial mass colour
Marine actinobacteria in
selective media (x104/g
-1)
SWA SCA KA GAA
Sediment Parangipettai White, grayish white 13 17 11 12
Sediment Parangipettai White, grayish white 09 19 18 12
Sediment Parangipettai White, grayish white 07 19 14 14
2.3.2 Isolation and Morphology of EPD Strains
In general, the colonies appeared after seven days of incubation but
sometimes they took only five days, depending on the medium and the choice
of enrichment method and selective media. The choice of enrichment of
sediments mainly influences the counts of actinobacteria from sediments.
Supplementation of NA in different selective media was found to be effective
in the isolation of marine actinobacteria. It reduced the contamination of other
bacteria especially Gram negative bacteria. Typically, the colonies were
elevated, round margin, smooth surface, limited spreading and covered with
white aerial mycelia. The colonies were found to be white in colour while
they grew in starch casein medium otherwise grayish white in glucose
asparagine medium. It was observed that among the media, starch casein
medium was found to be suitable for growth and sporulation of marine
actinobacteria. In addition, starch casein agar yielded well developed colonies
within five days than the other media. The growth of the strain EPD 7 as
white colonies on starch casein agar after five days of incubation is shown in
Figure 2.1.
31
Figure 2.1 Colonies of strain EPD 7 on starch casein agar after five
days of growth at 30 ºC
While observing the literature, grey and white pigmented colonies
are found to be common in sediments of West coast region of India
(Rathnakala and Chandrika 1993, Dhevendaran and Annie 1999) and East
coast region of India (Dhevagi and Poorani 2006, Sahu et al 2007). This
suggests that the wide spread of actinobacteria in marine sediments of East
and West coast regions of India.
Seawater complex agar, Kuster‟s agar and Glucose asparagine agar
media were found to be good for the initial isolation of EPD strains from
sediments. Sea water complex agar contained ferric phosphate as a phosphate
source alone but it requires the supplementation of sterile seawater,
antibacterial and antifungal agents for the isolation of EPD strains. Kuster‟s
medium contained all the carbon, nitrate and phosphate sources good for the
isolation of EPD strains but the growth was found to less when compared to
glucose asparagine medium and starch casein medium. The growth of strain
EPD 7 as grey and white colonies on glucose asparagine agar after seven days
of incubation is shown in Figure 2.2.
32
Colonies of the EPD strains appeared slowly in glucose asparagine
agar when compared to that of starch casein agar however it yielded high
counts of actinobacteria than other media. Starch casein medium was found to
be the best medium for growth and development of marine actinobacteria
(Dhevagi and Poorani 2006, Gupta et al 2007).
Figure 2.2 Colonies of strain EPD 7 on Glucose asparagine agar after
seven days of growth at 30 ºC
The cultural and morphological characteristics of the EPD strains
have led to assume that all the strains could belong to the genus Streptomyces.
Similar assumption has been made for marine Streptomyces which are
isolated from sediments of Parangipettai (Balagurunathan and Subramanian
2001, Sivakumar et al 2005, Gupta et al 2007, Dhevagi and Poorani 2006,
Sahu et al 2007, Poorani et al 2009).
2.3.3 L-asparaginase Activity of EPD Strains
Out of thirty four strains, the strains such as EPD2, EPD 7, EPD 11,
EPD 19, EPD 24, EPD 27 and EPD 33 showed good L-asparaginase activity
33
and were considered as active strains. Among the active strains, the strain
EPD 27 showed high L-asparaginase activity as shown in the Figure 2.3. This
may be due to the fact that the strain utilizes the L-asparagine faster than the
other strains.
Figure 2.3 L-asparaginase activity of the strain EPD27 on modified M9
medium
Twenty one percentage of the isolates showed L-asparaginase
activity and was found to be higher when compared to results of Dhevendaran
and Annie (1999) which showed only 8%. This suggests that marine
sediments of Parangipettai were found to be suitable for the isolation of
L-asparaginase potential marine actinobacteria. L-asparaginase activity of the
active strains was further quantified for the selection of a potential strain
among them.
2.3.4 Selection of the High L-asparaginase Potential Strain EPD 27
Quantitative assay which determines the amount of enzyme
production by the L-asparaginase active strain. The crude extract prepared
34
from the cell pellets of active strains was found to be suitable for the
determination of intracellular L-asparaginase. The amount of L-asparaginase
production by active strains was determined using Imada et al (1973) method
(Figure 2.4).
0
0.5
1
1.5
2
2.5
3
EPD 2 EPD 7 EPD 11 EPD 19 EPD 24 EPD 27 EPD 33
Actinobacterial strains
µm
ol
am
mo
nia
/ml/
h
Figure 2.4 L-asparaginase production by the active strains
The strain EPD 27 was found to have produced high amount of
L-asparaginase about 2.7 IU followed by the strains EPD 19 and EPD 7.
Hence the strain EPD 27 was selected as the potential strain for further
identification.
2.3.5 Identification of Potential Strain EPD 27
Identification of marine Streptomyces is tedious (Lu et al 2009).
The International Streptomyces Project (ISP) was established by Shirling and
Gottlieb (1966) with an aim to describe and classify extant type strains of
Streptomyces using traditional tests under standardized conditions. The ISP
35
criteria are highly intended for identification of the genus Streptomyces from
other genera of the taxa actinobacteria. In addition, the criteria are specially
designed to distinguish the actinobacteria which had been assumed as
Streptomyces (Bull and Stach 2007). In recent years, a combination approach
that includes classical and molecular methods is widely used to distinguish
the genera of marine actinobacteria and to improve the authenticity (Kokare
et al 2004, Lu et al 2009). Therefore, a combination approach was adopted for
the identification of potential strain EPD 27.
2.3.6 Initial Identification of Strain EPD 27
The cultural, morphological and biochemical characteristics of the
strain EPD 27 were studied in starch casein medium and the results obtained
are summarized in Table 2.2. The colonies of the strain EPD 27 appeared
within 5 days as grayish white in colour with round margin as shown in the
Figure 2.5.
Figure 2.5 Colonies of strain EPD 27 on starch casein agar after five
days of growth at 30ºC
36
The strain EPD 27 was grown well at temperatures ranging from
28 ºC to 60 ºC and at wide range of pH 5 to 10. It was able to tolerate high
concentration of NaCl. The cultural, morphological and biochemical
characteristics of the strain EPD 27 also were similar to that of S. griseofuscus
except the utilization of mannitol and asparagine. Liquefaction of gelatin,
degradation of nitrate, hydrolysis of starch and casein were found to be
positive. Utilization of sucrose, mannitol, rhamnose and inositol were
negative. Based on these observations the strain EPD 27 was initially
classified within the species of marine Streptomyces.
Table 2.2 Cultural, morphological and biochemical characteristics of
strain EPD 27
Properties Strain EPD 27
Cultural and Morphological
characteristics
Gram staining +
Motility Non motile
Acid fast -
Aerial mass colour Grayish white
Nature of the colony Round margin,
Growth Amorphous
Reverse side pigment Not distinctive
Other characteristics of the colony Edge white with grayish centre
pH 5-10
Temperature 28-40
NaCl concentration 0-60 gms per L-1
Biochemical characteristics
Catalase -
Oxidase -
Nitrate reduction +
37
Table 2.2 (Continued)
Properties Strain EPD 27
Methyl red +
Voges Proskeur -
Gelatin utilization +
Starch degradation +
Casein hydrolysis +
Utilization of carbon sources
Glucose +
Sucrose -
Fructose +
Mannitol -
Rhamnose -
Inositol -
Utilization of nitrogen sources
Asparagine +
Glutamine -
Tyrosine +
+ Positive results - Negative results
2.3.7 Molecular Confirmation of Strain EPD 27
The strain EPD 27 was further identified by 16S rRNA gene
analysis since it is a highly reliable technique for the confirmation of new
strain at genus level. 16S rRNA gene analysis is found to be advantageous for
the determination of indigenous Streptomyces population in a marine
environment (Mincer et al 2002, Jensen et al 2005, Das et al 2006, Bull and
Stach 2007). The genomic DNA of the strain EPD 27 in 1% agarose gel was
analyzed with そ DNA/Hind III marker (MBI Fermentas). The clear bands
38
obtained indicate the presence of intact DNA without RNA contamination in
all the three DNA preparations (Figure 2.6). Further the lane 3 contained a
higher amount of DNA which yielded a clear visible band than the other two
lanes. It was observed that the extracted DNA was suitable for PCR
amplification for 16S rDNA gene.
.
Figure 2.6 Total DNA of the strain EPD 27 resolved in 1% agarose gel
(Lane M: そ DNA/Hind III DNA marker (MBI Fermentas), Lane 1: 1
µl of genomic DNA, Lane 2: 1.5 µl of genomic DNA, Lane 3: 2 µl of
genomic DNA).
The expected size of the PCR product of Streptomyces 16S rRNA
gene is 1 kb. PCR products in 1% agarose gel indicates the presence of 16S
rRNA gene fragment of the strain EPD 27 (Figure 2.7) was confirmed with
100 bp DNA marker (MBI Fermentas). The PCR amplified 16S rRNA gene
fragment of the strain EPD 27 was found to be 0.9 kb (Figure 2.7 lanes 1, 2
and 3).
M 1 2 3
39
Figure 2.7 Amplicon of 16S rRNA gene fragment of strain EPD 27
resolved in 1 % of agarose gel
(Lane M: 100 bp DNA marker (MBI Fermentas), Lane 1: 1 µl of
amplicons, Lane 2: 1.5 µl of amplicons, Lane 3: 2 µl of amplicons).
For further confirmation of the strain EPD 27, it was sequenced
hence cloning was performed prior to sequencing. The extracted recombinant
plasmid DNA from three clones was analyzed with 1 kb DNA marker (MBI
Fermentas) as shown in Figure 2.8.
Figure 2.8 DNA profile of the recombinant plasmids for 16S rRNA
gene fragment of strain EPD 27
(Lane M: 1 kb DNA ladder (MBI Fermentas) Lane 1: 1µl of plasmid
Lane 2: 2 µl of plasmid Lane 3: 2 µl of plasmid)
0.9 kb
M 1 2 3
40
2.3.8 Sequence Analyses
The sequence of 16S rRNA gene fragment (0.9 kb) of the strain
EPD 27 consisting 939 nucleotides was submitted to the GenBank (National
Centre for Biotechnological Information, USA) and obtained the accession
number FJ951436. BLASTN provided the sequence data which are having
the close sequence similarity to strain EPD 27. It was found that strain EPD
27 showed a highest sequence similarity of about 99.4% with other species of
the genus Streptomyces as shown in Table 2.3.
Table 2.3 Similarity level of 16S rRNA gene sequence of strain EPD27
with other species of Streptomyces
Strain Representative species Accession no. Similarity %)
EPD27 Streptomyces sp. GU220453 99.4
EPD27 Streptomyces sp. EU864311 99.4
EPD27 Streptomyces sp. EU797798 99.4
EPD27 Streptomyces costaricanus FJ799179 99.4
EPD27 S. phaeogriseichromatogenes. AJ391813 99.4
EPD27 Streptomyces griseofuscus AB184206 99.4
EPD27 Streptomyces galbus X79325 98.4
EPD27 Streptomyces lanatus DQ462655 98.3
EPD27 Streptomyces antibioticus AB184729 97.1
EPD27 Streptomyces sp. DQ904559 97
EPD27 Streptomyces spectabilis AB18439 95.6
EPD27 Streptomyces hygroscopicus GQ390361 83.6
2.3.9 Phylogenetic Analysis
The evolutionary history was inferred using the Neighbor-Joining
method by Saitou and Nei (1987). The optimal tree with the sum of branch
41
length = 0.21160887 is shown in Figure 2.9. The phylogenetic tree was
linearized assuming equal evolutionary rates in all lineages (Takezaki et al
2004). The tree was drawn to scale, with branch lengths in the same units as
those of the evolutionary distances used to infer the phylogenetic tree.
Figure 2.9 Neighbor-joining phylogenetic tree based on 16S rRNA gene
sequences showing the position of strain EPD 27 and related
strain. Boostrap values calculated from 1000 resample
using neighbor-joining are shown as the respective nodes
when the calculated values were 50% or greater
42
A phylogenetic analysis of the partial 16S rDNA sequence of the
strain EPD 27 was performed to reveal the taxonomic relationship between
the different subgroups (Figure 2.9). The strain EPD 27 showed 99.4%
identical and was placed within the other Streptomyces confirming its genus.
However, despite the profound similarity (99.4%) between the nucleotide
sequence of the 16S rRNA gene of the Streptomyces griseofuscus and other
species of Streptomyces, it can only hypothesize that any two Streptomyces
strains are identical when a 100% similarity is detected. Further resolution at
species level requires additional molecular data. Therefore, the discovered
marine strain was identified as marine Streptomyces sp strain EPD 27.
2.4 CONCLUSION
These findings suggest that marine sediments of Parangipettai, East
coast region of India is suitable for the isolation of marine actinobacteria with
L-asparaginase activity. Marine Streptomyces are observed to be the wide and
persistent populations of marine actinobacteria in sediments of Parangipettai.
Grey and white pigmented indigenous marine Streptomyces are found to be
common in sediments of East coast region of India. The qualitative and
quantitative assays for the screening of L-asparaginase activity were found to
be effective in rapid screening and selection of the potential strain. The
combination approach was found to be advantageous for the authentic
identification of new strains of marine Streptomyces. Further the discovery of
high L-asparaginase potential marine Streptomyces sp strain EPD 27 could be
a novel source for L-asparaginase.