Chapter 13: DNA Technology

With all our knowledge of DNA and genes, is there any way to manipulate DNA?

• Genetic Engineering – form of applied genetics in which

genes/DNA are manipulatedEx. Genetic engineers believe they can improve

the foods we eat. Tomatoes are sensitive to frost. This shortens their growing season. Fish, on the other hand, survive in very cold water. Scientists identified a particular gene which enables a flounder to resist cold and used the technology of genetic engineering to insert this 'anti-freeze' gene into a tomato.

DNA Technology

Science involved in the ability to manipulate genes/DNA

Purpose:

1. Treat diseases (Cystic fibrosis)

2. Treat genetic disorders (hemophilia, diabetes)

3. Improve food crops (better tasting veggies, longer shelf life, fungus resistance)

4. Improve human life in general (vaccines…)

How is it all done?

Recombinant DNA TechnologySteps in the process:

                    -I. Isolation of DNA = extraction - II. Copying DNA with PCR

                    -III. Cutting DNA with restriction enzymes

                    -IV. Comparing DNA with gel eletrophoreisis

OR – V. use as vectors in recombinant DNA

I. Isolate DNA.

• Remove tissue from organism

(You will do this in your DNA extraction lab)

• Store at 4°C

PCR – Polymerase Chain Reaction

A genetic copy machine

• The polymerase chain reaction (PCR) is a rapid way of amplifying (duplicating) specific DNA sequences from a small sample of DNA.

II. Copy DNA - PCR

• Polymerase Chain Reaction

• Uses DNA sample, DNA polymerase from T. aquaticus (hot springs)

• Think of this process as a molecular

copying machine

III. Cutting DNA - Restriction Restriction enzymesenzymes

– Enzymes that can cut at particular locations in the DNA- DNA engineering today is totally dependent on restriction enzymes -Restriction enzymes are endonucleases - Think of them as molecular scissors

What are restriction enzymes?

• Bacterial enzymes – used to cut DNA Different bacterial strains express different restriction enzymes

• The names of restriction enzymes are derived from the name of the bacterial strain they are isolated from

• Cut (hydrolyze) DNA into defined and REPRODUCIBLE fragments

• Basic tools of gene cloning

Names of restriction endonucleases

• Titles of restriction enzymes are derived from the first letter of the genus + the first two letters of the species of organism from which they were isolated.

• EcoRI -  from Escherichia coli • BamHI - from Bacillus amyloliquefaciens• HindIII - from Haemophilus influenzae • PstI -  from Providencia stuartii • Sau3AI - from Staphylococcus aureus • AvaI -  from Anabaena variabilis

Source microorganism Enzyme Recognition SiteEnds produced

Arthrobacter luteus Alu I AGCT BluntBacillus amyloiquefaciens H Bam HI GGATCC Sticky

Escherichia coli Eco RI GAATTC Sticky

Haemophilus gallinarum Hga I GACGC(N)5 Sticky

Haemophilus infulenzae Hind III AAGCTT Sticky

Providencia stuartii 164 Pst I CTGCAG Sticky

Nocardia otitiscaviaruns Not I GCGGCCGC Sticky

Staphylococcus aureus 3A Sau 3A GATC Sticky

Serratia marcesans Sma I CCCGGG Blunt

Thermus aquaticus Taq I TCGA Sticky

Restriction enzymes recognize a specific short nucleotide sequence

• For example, EcoRI recognizes the sequence

• 5‘- G/ A A T T C -3'

• 3'- C T T A A /G -5'

Examples of restriction enzymes and the sequences they cleave

•Palindromes – same base pairing forward and backwards

Let’s try some cutting:

• Using this piece of DNA, cut it with Eco RI

• G/AATTC

• GACCGAATTCAGTTAATTCGAATTC

• CTGGCTTAAGTCAATTAAGCTTAAG

• GACCG/AATTCAGTTAATTCG/AATTC

• CTGGCTTAA/GTCAATTAAGCTTAA/G

What results is:

• GACCG AATTCAGTTAATTCG AATTC

• CTGGCTTAA GTCAATTAAGCTTAA G

Sticky end Sticky end - tails of DNA – easily bind to other DNA strands

Blunt & Sticky ends

• Sticky ends – Creates an overhang. BamH1

• Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

IV. Gel Electrophoreisis• V. Analysis of DNA

DNA fingerprinting – – Banding pattern of the fragments of cut

DNA on a special gel medium (agarose)

Purpose for DNA fingerprinting • Comparing banding

patterns to determine hereditary relationships between people

• Comparing banding patterns of 2 different species to determine evolutionary relationship

• Compare samples of blood or tissue for forensic purposes (who done it?)

•Very accurate method of accessing DNA – 99.99%•Odds – 1 in 1,000,000,000• Does not work with identical twins•Use strands of DNA that have a lot of VNTRs

How is it done?• VNTR analysis – variable number tandem repeats - we

each have non-coding segments on our DNA. Fragment lengths varies with each person

1. Extract DNA sample from blood or tissues

2. Cut DNA using restriction enzymes. Separate fragments by gel electrophoresis – separates DNA fragments by the # of base pairs (length of the fragment) and charge

3. Place DNA sample into wells in the agarose gel – molecular sieve

4. Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+)5.The larger fragments will not migrate that far. The small fragments will go the furthest

5. Stain gel and bands in a dye or use a radioactive probe to analyze the banding

Now that you have the desired gene or piece of DNA, what do you do with it?

• V. Recombinant DNA– Transfer of isolated gene to another

organism with the purpose of having the organism transfer the gene to another.

– Use bacterial plasmids

1. The same restriction enzyme used to cut the desired gene, is used to splice the plasmid

2. Donor gene (desired gene) is then spliced or annealed into the plasmid

3. Plasmid is then returned to bacterium and reproduces with donor gene in it.

4. Bacterium with donor gene can transfer donor genes to organisms it infects.

How this works to help humans • Looking at the gene that produces insulin for the

treatment of diabetes:1. Isolate insulin gene from a healthy human2. Using a restriction enzyme, cut out insulin

producing gene3. Cut bacterial plasmids with same restriction enzyme4. Introduce human insulin producing gene to

bacterial plasmid5. Bacterial plasmid takes up gene - recombinant DNA6. Bacterial plasmid reproduces and starts expressing

insulin produce gene7. Insulin is produced and harvested from bacteria.

• What has been produced is Recombinant DNA - DNA with genes from other organisms

• Transgenic organisms have introduced DNA from another species in them

Practical Use of DNA technology

• Pharmaceutical products – insulin, HBCF (human blood clotting factor)

• Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies

• Altering viral genomes – makes them no longer pathogenic – now a vaccine

• Increasing agricultural yields –– New strains of plants – GMO – Genetically Modified GMO – Genetically Modified

organismorganism. Try this one!!– Insect resistant plants – Insert gene that digests larvae

when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem

– Disease resistance – Fungal resistance in tomatoes, corn, soybean

– Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding

– Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils

– Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil

• Improve quality of produce

- Slow down the ripening process – ship when unripened, to market when ripe

- Enhance color of produce

- Reduce hairs or fuzz on produce

- Increase flavor

Why GM Foods?Why GM Foods?

Safety and Environmental Issues• All food products are regulated by the:

Food and Drug Administration – FDA• Nat’l Institutes of Health Recombinant DNA

Advisory Committee and the Department of Agriculture (USDA)

• Environmental Protection Agency (EPA)• All set standards for safety procedures and

require permits and labeling (not in US though). Look for a 8 before the product code. 84011 – GMO banana

• Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to. FDA does not require that on a label

Gene Therapy • Treatment of a genetic

disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme.

• Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary

• Has not been proven to be successful in the long term

Hello Dolly!

CLONING