Click here to load reader
Upload
kellsie
View
38
Download
0
Tags:
Embed Size (px)
DESCRIPTION
CHAPTER 12 DNA and RNA. Essential Questions. How do genes work? What are they made of and how do they determine the characteristics of organisms? Are genes single molecules or are they longer structures made up of many molecules?. 12-1 DNA. Griffith and Transformation - PowerPoint PPT Presentation
Citation preview
Nerve activates contraction
CHAPTER 12DNA and RNAEssential QuestionsHow do genes work?What are they made of and how do they determine the characteristics of organisms?Are genes single molecules or are they longer structures made up of many molecules?
12-1 DNAGriffith and Transformation1928, Frederick Griffith, investigated pneumoniaTwo different pneumonia bacteriaColonies with rough edges- harmlessColonies with smooth edges- pneumonia
RoughSmooth
Smooth
Smooth
Rough
Transformation- when a bacteria picks up foreign DNA. This changes the bacteria.
Griffiths hypothesis- 1) some factor was transmitted from the heat-killed cells to the harmless living cells. 2) This factor must contain information that would change the harmless cells into disease-causing cells. 3) This factor could be passed onto offspringOswald Avery, 1944
Smooth
Rough
Destroy: ProteinsLipidsCarbohydratesRNAOswald Avery, 1944
Smooth
Rough
Destroy: DNA
Averys conclusionDNA must store and transmit genetic information from one generation to the nextHershey-Chase ExperimentAlfred Hershey and Martha Chase, 1952What transmits hereditary information: DNA or proteins?Bacteriophage- a virus that infects bacteriaComposed of DNA or RNA coreProtein coat
A bacteriophage will inject virus DNA or RNA into a bacteria. The viral genes will use the cell to make more viruses and also destroy the cell.
Components and Structure of DNA
Components Structure of DNA5-carbon sugarsDeoxyribosePhosphatesNitrogenous bases
Components Structure of DNANucleotide:5-carbon sugar (deoxyribose) PhosphateNitrogenous base
Nitrogenous basesPurines (2 rings):AdenineGuaninePyrimidines (1 ring):CytosineThymine
Chargaffs RuleErwin Chargaff% of Guanine = % of Cytosine% of Adenine = % of ThymineSourceATGCStreptococcus29.831.620.518.0Yeast31.332.918.717.1Herring27.827.522.222.6Human30.929.419.919.8Rosalind FranklinEarly 1950sUsed x-ray diffraction to Study the structure of DNA
James Watson and Francis Crick1953 created a model to explain the structure of DNA
They used Franklins photographs
Double Helix2 strands wrapped around each other
Nucleotides are linked togetherG bind to CT binds to ABases are connected to opposite bases by hydrogen bondsG to C by three bondsT to A by two bonds
12-2 Chromosomes and DNA ReplicationDNAProkaryotes- one single chromosome, DNA is circular
Eukaryotes- multiple chromosomes, DNA is linear
DNA LengthE. Coli4,600,000 base pairs4,000 genes1.6mm longHuman DNA3,000,000,000 base pairs35,000 genes2 meters longChromatin- substance of tightly packed DNA and protein
Histones- protein that DNA is coiled aroundNucleosome- histone with DNA wrapped around it
What do histones and nucleosomes do?Histones: DNA held tightly= turned offDNA held loosely= turned onNucleosomes: aid in folding and packing of DNA
DNA ReplicationProkaryotes- one site to begin replication
DNA ReplicationProkaryotes- two complete complementary DNA strands created.
DNA ReplicationEukaryotes- multiple sites along the linear DNA strand begin replicationDNA ReplicationComplementary bases are added to the template strand.
CATGTGATCATAGATA- template strandDNA ReplicationComplementary bases are added to the template strand.CATGTGATCATAGATA- template strandGTACACTAGTATCTAT- copied strand
DNA ReplicationDNA is unwound by an enzyme- HelicaseHelicase breaks the hydrogen bonds between bases
Replication bubble- Where the helicase unwinds the DNA to begin copying
Replication fork-The end of the bubble where DNAis being unwound.
DNA ReplicationDNA polymerase- an enzyme that adds new nucleotides on the complementary strandDNA polymerase- proof reads the new strand to make sure no mistakes are made. It ensures that the right base is added on the complementary strand.
CATGTGATCATAGATA- template strandGTACACT- copied strand
TGTTTTTAAAAACCCCCCGGGGGGG12-3 RNA and Protein SynthesisGenes- coded DNA instructions that control the production of proteins within the cell
The Structure of RNASimilarities between RNA and DNABoth are composed of nucleotides (5-carbon sugar, phosphate, nitrogenous base)Differences between RNA and DNA
1. 5-carbon sugar is ribose (not deoxyribose)
Differences between RNA and DNA
2. Usually single stranded (not double stranded)
Differences between RNA and DNA
3. Contains uracil instead of thymine
Types of RNAMessenger RNA (mRNA)
Contains instructions for assembling amino acids into proteinsLong single strand of RNA
Types of RNARibosomal RNA (rRNA)
Proteins and rRNA make up ribosomes
Amino acids are linked together to make proteins at the ribosome.
Types of RNATransfer RNA (tRNA)
A molecule that carries an amino acid to a ribosome in order to make a protein
TranscriptionTranscription- Transcribing a DNA sequence into an RNA sequenceRNA polymerase- separates DNA strands and copies one strand of the DNA. It creates a complementary strand of RNA.
How does RNA polymerase know where to copy?RNA polymerase starts copy by binding to promoter- a specific sequence of DNA RNA polymerase stops copying when it reaches a terminator- a specific sequence of DNA
TranscriptionRNA polymerase creates a mRNA (messenger RNA). The mRNA strand is complementary for the DNA sequence from which it was copied. It has U instead of T.RNA- GUACCAUGAUCAUGDNA- CATGGTACTAGTACmRNA editingThe mRNA is edited:5 Cap- A cap is added to the front. It includes a Guanine and three phosphates. Poly A Tail- A tail is added to the end. It is a long string of A nucleotides.
5 G-P-P-P- CAGUAGAUCAUGA-AAAAAAAA
mRNA editingThe mRNA is edited:Introns- parts of the mRNA that are cut outExon- parts of the mRNA that are left in
5 G-P-P-P- CAGUCGUACUAUGACACUAGAUCAUGA-AAAAAAAA5 G-P-P-P- CAGUC UGACAC AUGA-AAAAAAAA5 G-P-P-P- CAGUCUGACACAUGA-AAAAAAAA
mRNA editing
Genetic CodeThere are 20 amino acidsA string of amino acids forms a proteinAmino acids are held together by peptide bonds.A polypeptide is another name for a protein
aminoacid- aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacid-aminoacidGenetic CodeThe sequence of mRNA can be translated into an amino acid sequence.The mRNA sequence is divided into groups of three nucleotides.Three nucleotides = codon
Genetic CodeEach codon is equal to a certain amino acid.
UCGCACGGUUCG-CAC-GGUSerine-Histidine-Glycine
Genetic CodeThere are 4 bases (C,A,U,G)Each codon is 3 bases long.64 possible codon combinations (4x4x4)There are 64 codons but only 20 amino acids
Genetic CodeMultiple codons are linked to the same amino acid. There is one start codon- AUGThere are three stop codons- UAA, UAG, UGA
AUG-xxx-xxx-xxx-xxx-xxx-xxx-xxx-xxx-UAAStartStopTranslationTranscription- creating a mRNA sequence that is complementary to a DNA sequence.Translation- creating an amino acid sequence (protein) from a mRNA sequence.
TranslationTranscription: mRNA is transcribed from DNA in the nucleusmRNA is edited and then goes into the cytoplasam
Translation: 1. mRNA attaches to a ribosomeTranslation2. A tRNA brings an amino acid to the ribosomeA tRNA has an anticodonThe anticodon is the complementary sequence of a codon
tRNA anitcodon:UACmRNA codon: AUG
tRNA anitcodon:UACAAGUUUmRNA codon: AUG UUC AAA3. The tRNA with the correct anticodon will bind to the codon on the mRNA4. The tRNA will release its amino acid
tRNA anitcodon:UACAAGUUUmRNA codon: AUG UUC AAA5. The amino acid from the tRNA will create a peptide bond with the amino acid next to it.
tRNA anitcodon:UACAAGUUUmRNA codon: AUG UUC AAA6. The empty tRNA will leave the ribosome to pickup another amino acid.7. Amino acids will continue to be added until a stop codon on the mRNA is reached.
12-4 MutationsMutation- change in the genetic material
Are all mutations bad?
12-4 MutationsGene Mutations- Change in the sequence of the DNA of one or a few nucleotides
Chromosome Mutations- Change in the structure of the chromosome and usually involves many genes
Gene Mutations-Point Mutation- a change in one nucleotide of the DNASubstitution- changing one nucleotide for another
CATGACTAGGCAATTAGGC originalCATGACTACGCAATTAGGC mutationGene Mutations- Point Mutation- Insertion- adding one nucleotideCAT-GAC-TAG-GCA-ATT-AGG originalCAT-GAC-TAG-GCCA-ATT-AGG mutation
Deletion- removing one nucleotideCAT-GAC-TAG-GCA-ATT-AGG originalCAT-GAC-TAG-GC-ATT-AGG mutation
What are the consequence of mutations?DNA AAAAAGAATmRNA UUUUUCUUAProtein PhePheLeu
Silent mutation- does not change the amino acidSubstitution mutation can change a proteinCAT-GAC-TAG-GCA-ATA-AGG original DNACAT-GAC-TAC-GCA-ATA-AGG mutation DNA
CAT-GAC-TAG-GCA-ATA-AGG original DNAGUA-CUG-AUC-CGU-UAU-UCCoriginal mRNAVal----Leu----Ile---Arg---Tyr---Seroriginal protein
CAT-GAC-TAC-GCA-ATA-AGG mutation DNAGUA-CUG-AUG-CGU-UAU-UCCmutant mRNA Val----Leu---Met---Arg---Tyr---Sermutant protein
Insertion or Deletion mutations cause frame shiftFrame shift- a change in the reading frame of the codons caused by an insertion or deletion mutation
CAT-AAG-GAC-TAG-GCA-ATA-AGG original DNAC T-AAG-GAC-TAG-GCA- ATA-AGG mutation DNACTA-AGG-ACT-AGG-CAA-TAA-GG mutation DNA
Insertion or Deletion mutations cause frame shiftCAT-AAG-GAC-TAG-GCA-ATA-AGG original DNACTA-AGG-ACT-AGG-CAA-TAA-GG mutation DNA
CAT-AAG-GAC-TAG-GCA-ATA-AGG original DNAGUA-UUC-CUG-AUC-CGU-UAU-UCC original mRNAVal----Phe---Leu----Ile---Arg---Tyr---Ser original protein
CTA-AGG-ACT-AGG-CAA-TAA-GG mutation DNA GAC-UCC-UGA-UGC-GUU-AUU-CC mutant mRNA Asp--Ser- Stopmutant protein
Chromosomal MutationsMutations of Chromosomes:Deletion- Removal of a chromosome segment
Chromosomal MutationsMutations of Chromosomes:Duplication- More than one copy of a chromosome segment
Chromosomal MutationsMutations of Chromosomes:Inversion- Rearrangement of a chromosome segment
Chromosomal MutationsMutations of Chromosomes:Translocation- Movement of a chromosome segment to another chromosome
Chromosomal Mutations
Phases of Meiosis4N2N2N2N2N2NNNNNErrors in meiosis
Sometimes chromosomes do not separate correctly.Errors in meiosisHaploid- one set of chromosomesDiploid- two sets of chromosomes
Polyploidy- an organism with an extra set of chromosomesTriploid- three sets of chromosomesTetraploid- four sets of chromosomes
PolyploidyPolyploidy is more common in plants than animals.Polyploid plants are often stronger and larger than diploid plants.12-5 Gene Regulation97% of DNA does not code for a functional proteinNon-coding DNAUsed for structure and regulation of genesGenes can be turned on or offOn- RNA polymerase binds to the DNA, a mRNA copy is made (transcription), the mRNA is translated into an amino acid sequence (protein)Off- RNA polymerase does not bind to the DNA. No protein is made
Why are genes turned on or off?If a protein is not needed- the cell does not want to waste energy making it.PromoterPromoter- where RNA polymerase binds to begin transcription
RNA promoterStart Trans. Stop Trans.
---PPPPPP----GGGGGGGGGGGGGGGGGGG--Lac operonOperon- a group of genes that work togetherE. coli can use lactose as a source of food.
RNA promoterLactose genes
---PPPPPP----LLLLLL---LLLLLL--LLLLLL--
Lac operonIf there is lactose present- it transcribes and translates the lactose processing genesIf there is not lactose- it does not transcribe and translate the lactose processing genesHow does E. coli control the transcription of the lac genes?Operator- a site on the DNA where a repressor protein can bind. This prevents the transcription of the DNA by RNA polymerase
PPPP---OOOO--LLLL-----LLLLLL----LLLLLLHow does E. coli control the transcription of the lac genes?Lactose binds to the repressor protein and causes it to be removed so RNA polymerase can transcribe the lactose genes.
PPPP---OOOO--LLLL-----LLLLLL----LLLLLL
Eukaryotic Gene RegulationEukaryotic cells do not have operonsTATA Box- a DNA sequence 30 base pairs long, with T and A. It is in front of the gene sequence.
-------TATATATA--GGGGGGGGGGGGGGG----
Eukaryotic Gene RegulationPromoter sequences regulate genes in eukaryotesAccelerate transcription- cause the RNA polymerase to bind to the DNA quickly and oftenStop transcription- prevents the RNA polymerase from binding to the DNA
---PPPPP----TATATATA----GGGGGGGGGGGGG----Eukaryotic Gene RegulationWhy do cells need to control transcription?Prokaryotes- do not want to waste energy by producing unnecessary proteinsEukaryotes-????Eukaryotic Gene RegulationWhy do cells need to control transcription?Prokaryotes- do not want to waste energy by producing unnecessary proteinsEukaryotes-different cells must produce different proteins
Different cells in an eukaryote all have the same DNA.Liver cells must produce only the proteins necessary to be a liver cell
Development and DifferentiationDifferentiation- cells become specialized in structure and functionHox genes- control the differentiation of cells and tissues in the embryo
Hox gene mutationsCauses developmental abnormalities
Hox genes are very similar in different organisms.The same type of gene controls the development of the same type of structure.