Embed Size (px)
Citation preview
A
1tAtTmd©
K
1
t2ap
itkvmM
ubi
1d
Journal of Clinical Virology 42 (2008) 326–334
Challenges in designing a Taqman-based multiplex assayfor the simultaneous detection of herpes simplex virus
types 1 and 2 and Varicella-zoster virusManfred Weidmann ∗, Katrin Armbruster, Frank T. Hufert
Institute of Virology, University of Gottingen, Kreuzbergring 57, 37075 Gottingen, Germany
Received 30 November 2006; received in revised form 30 January 2008; accepted 3 March 2008
bstract
To optimise molecular detection of herpesviruses an internally controlled multiplex Taqman-PCR for the detection of Herpes simplex virus(HSV1), Herpes simplex virus 2 (HSV2) and Varicella-zoster virus (VZV) was developed. The selection of the dye combination working on
he ABI 7700 cycler for this multiplex PCR revealed crosstalk phenomena between several combinations of reference dyes and reporter dyes.final dye combination with CY5 as reference dye and FAM/JOE/TXR as reporter dyes was selected. The influence of the concentration of
he internal positive control (IPC) concentration on the quantitative results of HSV1, HSV2 and VZV positive patient samples was analysed.
he results indicate that high IPC concentrations are detrimental for the sensitivity of the multiplex assay and that the presence of the IPColecule narrows the dynamic range of the duplex PCRs between any of the virus PCRs and the IPC-PCR. The optimised multiplex assayetecting HSV1, HSV2 and VZV using 103 IPC molecules showed a performance and sensitivity comparable to that of the individual assays.2008 Elsevier B.V. All rights reserved.
dynami
tsd
tfa
staPtta
eywords: Herpesvirus; Multiplex Taqman-PCR; Internal positive control
. Introduction
In a routine clinical setting the main differentials for asep-ic encephalitis are Herpes Simplex Viruses Type 1 and Type(HSV-1, HSV-2) Varicella-zoster virus (VZV) Enterovirus
nd in immunocompromised individuals especially AIDSatients Cytomegalovirus CMV.
These viruses can cause a variety of clinical symptoms,ncluding central nervous system disease such as meningi-is and severe encephalitis, skin and mucousal infections anderatoconjunctivitis. In immunocompromised patients theseiruses can lead to severe clinical outcome including pneu-onia (VZV) and disseminated infections (Antunes, 2004;uir and van Loon, 1997; Townsend and Scheld, 1998).Effective therapy of HSV and VZV infections is possible
sing antiviral drugs such as aciclovir. However, therapy muste initiated very early after onset of disease to decrease lethal-ty and to minimize the number of patients sustaining persis-
∗ Corresponding author. Tel.: +49 551 395872; fax: +49 551 394471.E-mail address: [email protected] (M. Weidmann).
Pfwaia
386-6532/$ – see front matter © 2008 Elsevier B.V. All rights reserved.oi:10.1016/j.jcv.2008.03.005
cs; Dye combinations; ABI 7700
ent neurological damage (Whitley et al., 1998). In fact theuspicion of herpesvirus encephalitis alone, leads to imme-iate therapy backed up by rapid confirmatory diagnostics.
Similarly for CMV encephalitis immediate therapy is ini-iated using ganciclovir and in the case of resistant strainsoscarnet. For Enteroviruses there is only symptomatic ther-py (Biron, 2006; Khurana et al., 2005; Tyler, 2004).
The introduction of real-time PCRs has improved the sen-itivity and specificity of virus diagnostics. The efficiency ofhe PCR laboratory can be increased even more by adaptingll assays for DNA viruses to one PCR protocol and to one RT-CR protocol for all RNA viruses. This setup allows parallel
esting with a whole range of assays on one cycler. Apart fromhe above strategy, multiplex PCR, appears a most favourablepproach to this kind of task. Several multiplex real-timeCRs have been described. Some of these papers howeverollow the concept of using several distinct probes all tagged
ith the same fluorescent dye for parallel assays (Klein etl., 2001; Tucker et al., 2001) or duplex PCRs either detect-ng two specific targets (Sen and Asher, 2001) or a targetnd an internal positive control (IPC) (Aberham et al., 2001;
f Clinica
Srapoocadpimc
2
2
tibci
2
umryarsa
2
EGaHoamAtiV
2
s
(EC(TiUus5ptG
2
frgpctsos+wd
2
Gda
wa1tTbrt(tdoTMA
M. Weidmann et al. / Journal o
chwaiger and Cassinotti, 2003; Welti et al., 2003). Multiplexeal-time PCRs should be able to distinguish and identify themplified targets by distinct fluorescent dyes attached to therobes used. The overlapping fluorescence emission spectraf the dyes used and the small detection bands of the cyclersn the market however clearly limit the number of dyes thatan be mixed in one assay. We here present a multiplex PCRssay using 4 Taqman probes with 3 dyes plus one referenceye to detect either Herpes simplex 1 virus, or Herpes sim-lex 2 virus or Varicella-zoster virus while co-amplifying annternal positive control. The effect of the amount of IPC
olecule used on the quantitative results from encephalitisases is described.
. Material and methods
.1. Clinical samples
The samples were the same as in our previous publica-ion (Weidmann et al., 2003). A total of 106 clinical samplesncluding: 41 CSF, 28 swabs from unknown skin disease, 24iopsies, 9 vitreal body samples, 3 blood samples and 1 bron-hoalveolar lavage. The samples were mainly obtained frommmunocompromised subjects.
.2. DNA extraction
DNA was extracted from 140 �l of clinical specimenssing the QIAmp DNA extraction kit (Qiagen, Hilden, Ger-any) according to the manufacturer instructions. DNA was
ecovered in 50 �l of water and 5 �l were immediately anal-sed by real-time PCR, while the remaining 45 �l were storedt −20 ◦C and reused during a period of 6 months. A three-oom flow system to separate amplification mix preparation,ample preparation and amplification was implemented tovoid carry over contamination.
.3. Primers and probes
Primers and probes were designed using the Primerxpress 1.0 software (Applied Biosystems, Weiterstadt,ermany). Target amplicons were chosen from the nested
mplicons of the gD gene of HSV 1 and the gG gene ofSV-2, used for routine diagnostics for several years inur laboratory (Aurelius et al., 1991, 1993). For VZV themplicon target was newly designed in a conserved poly-erase region in reference to published VZV sequencesB059828-31 and X04370 (Weidmann et al., 2003). To study
he specificity of the PCR assays we investigated 15 clinicalsolates of HSV-1, 12 isolates of HSV-2, and 11 isolates ofZV. No cross-detection was observed.
.4. Dyes and calibration
The 5′ reporter dyes of the Taqman probes FAM (emissionpectra peak (Em = 515 nm), JOE (Em = 548 nm), TAMRA
o6rt
l Virology 42 (2008) 326–334 327
Em = 579 nm), A590 (Em = 590 nm), TEXRED (TXR,m = 615 nm), were combined with the 3′ quencher DAB-YL and synthesised by TibMolbiol, Germany. The CY5
Em = 670 nm) probe was synthesised by, Operon, Germany.he ABI PRISM 7700 cycler (Applied Biosystems) was cal-
brated for dyes TXR, BLUE (Em = 636 nm, Megabases Inc.,SA), A590 (Em = 590 nm, TibMolbiol, Germany), CY5sing 1 �M thymidine-sixmer “mini-probes” also synthe-ised by TibMolbiol with the respective dyes attached to the′-end and Fluorescein attached at the 3′-end and. These minirobes were used for spectral calibration just as the dyes ofhe spectral calibration kit (Applied Biosystems, Weiterstadt,ermany) at 60 ◦C/2 min.
.5. DNA-standards
For each PCR assay we cloned the amplicon target-DNAragment into the vector pCRII using the TA cloning kit (Invit-ogen, Breda, Netherlands). The following plasmids wereenerated: pCRIIHSV1 containing 70 bp of the gD gene;CRHSV2 containing 111 bp of the gG gene and pCRIIVZVontaining 63 bp of the VZV DNA polymerase gene. Forhe internal positive control a 97 bp amplicon was synthe-ised by TIBMOLBIOL containing the upstream sequencesf HSV2UP and VZVUP binding sites flanking a GAPDHequence. This amplicon was ligated into pBluescript SK/−. Standards of 104–100 genome molecules per 5 �l waterere prepared from linarized plasmids for each assay. Cross-etection of the amplicons was not observed.
.6. Development of the multiplex PCR assay
Monitoring the signals in the negative controls of SYBRREEN real-time PCR assays, was used to reduce primerimer formation by titrating the primer concentrations of eachssay from 300nM down to 50 nM in 50 nM steps.
To test the various dye combinations multiplex-PCRas done in a 25 �l volume using 100 nM of all primers
nd probes. The mixture also contained 200 �M dNTPs,.25 U AmpliTaq Gold, 5 mM MgCl2, in 50 mM Kcl, 10 mMris–HCl (pH8.3), 0.01 mM EDTA, 0.05% gelatine, 0.01%ween20. To increase sensitivity 2 �g of the single strandinding protein GP32 (Roche, Germany) were added pereaction (Abu Al-Soud and Radstrom, 2000). The final mul-iplex PCR was performed using 50 nM CY5 reference dyeCY5′-TTTTTT-3′-FAM), and the optimal concentrations forhe other ingredients were titrated to 300 nM of the IPCriving primers VZVUP and HSV2UP and 100 nM of allther primers and probes, 600 �M dNTPs and 3.75 U Ampli-aq Gold. The buffer and the concentrations of GP32 andgCl2 remained the same. The temperature profile on theBI-PRISM 7700 (Applied Biosystems, USA) consisted
f activation at 95 ◦C/10 min and 40 cycles of 95 ◦C/15 s,0 ◦C/60 s. Primers and probes as listed in Table 1. PCReactions were performed in triplicates. To minimize con-amination of the PCR flow in the laboratory with the IPC
328 M. Weidmann et al. / Journal of Clinical Virology 42 (2008) 326–334
Table 1Primer and probes used for real-time PCR assay
Virus Primer or probe Sequence (5′ → 3′) Tm (◦C)
HSV-1 HSV1UP CGGCCGTGTGACACTATCG 60HSV1DP CTCGTAAAATGGCCCCTCC 60HSV1P JOE-CCATACCGACCACACCGACGAACC-DABCYL 70
HSV-2 HSV2UP CGCTCTCGTAAATGCTTCCCT 60HSV2DP TCTACCCACAACAGACCCACG 60HSV2P JOE-CGCGGAGACATTCGAGTACCAGATCG-DABCYL 70
VZV VZV UP CGGCATGGCCCGTCTAT 60VZV DP TCGCGTGCTGCGGC 60VZV P FAM-ATTCAGCAATGGAAACACACGACGCC-DABCYL 70IPCP TXR-CAAGCTTCCCGTTCTCAGCCT-DABCYL 63
H k accesA ftwareS
pPsmlcrs
teduvr
3
3
aeids
actsc
mwdTmi
3
qfdaCr
TS
V
HHVI
S
SV-1 gene bank accession no: E00401, J02217, K02372; HSV-2 gene banB059828-31, X04370. The TM was calculated using the PrimerExpress soK +/− is outlined in the last line of the table.
lasmid, the IPC molecule concentration was added to theCR mastermix. The quantitative data from testing patientamples were obtained for parallel runs using 103 and 104 IPColecules. For unbiased quantification of the patient samples
evied with parallel IPC amplification, an external standardurve from amplification without IPC was used. Quantitativeesults are given as detected (i.e. per PCR reaction) or per mlerum throughout the paper.
The CT value results of a standard run without IPC detec-ion at a fixed threshold were exported into an excel sheet forach virus assay. The standard correlation of each virus waserived from the data and the formulae of the standard curvessed to calculate the quantitative results from the exported CTalue data at the same threshold of the patient sample PCRuns with IPC amplification.
. Results
.1. Real-time PCR assays
Existing specific, sensitive and efficient real-time PCRssays for HSV1, HSV2 and VZV (Table 2) (Weidmann
t al., 2003) were combined with a synthetic internal pos-tive control assay. Just one additional probe is needed toetect a GAPDH sequence flanked by HSV2UP and VZVUPequences on a recombinant plasmid (Table 1).b2pc
able 2ensitivity and efficiency of individual assays
irus assay Sensitivity in single assay Efficiency in single assay
SV1 10 1.83SV2 10 1.83ZV 10 1.93
PC 10
ensitivity given in molecules detected. Efficiency was derived from the slope of th
sion no: AF141854-58, AJ303204, Z86099; VZV gene bank accession no:based on the Rychlik algorithm. The synthetic IPC ligated into pBluescript
We evaluated the formation of primer dimers in the singlessays using SYBR GREEN. We titrated the primer con-entrations and checked for signals due to primer dimers inhe negative controls. We found that primer dimer signalsubsided at 100 nM of the primers (data not shown) and theombined the assays to the multiplex mixture.
Next, we compared the sensitivity of each assay in theultiplex mixture to the sensitivity as a single PCR. To do soe performed the individual PCRs on their respective stan-ard molecule ranges using the complete multiplex mixture.he sensitivities of the assays were reduced by 1 log10 in theultiplex mixtures in comparison to the performance of the
ndividual single assays (Table 2).
.2. Dye combinations
To reduce background fluorescence emitted by theuencher TAMRA, the dark quencher DABCYL was usedor all Taqman probes. We set out testing various reporterye combinations for Taqman probes, beginning with ROXs a reference, latter switching to reference dyes BLUE andY5 (Fig. 1A). We first tried to use TAMRA as an additional
eporter dye (Nasarabadi et al., 1999) resulting in the com-
ination of reporter dyes (1) FAM (VZV), (2) JOE (HSV1,), (3) TAMRA (IPC), and reference dye ROX. In IPC-PCRositive reactions we observed a loss of TAMRA’s fluores-ence (Fig. 2A). This led to a very low TAMRA signal (�RnSensitivity in multiplex assay Efficiency in multiplex assay
102 1.8102 1.93102 1.93102 1.63
e standard curve according to the equation E = 10(−1/slope).
M. Weidmann et al. / Journal of Clinical Virology 42 (2008) 326–334 329
Fig. 1. Choice of dyes used for multiplexing. (A) Tested probe and refer-ence dye combinations. Upper panel of table: virus specific probe dyes (FAM(VZV), JOE (HSV1, 2)) and several IPC probe dyes. Lower panel of table:reference dyes. Dyes, in a column between which crosstalk was observed aremarked in grey; Em = peak of fluorescence emission spectrum. (B) Fluores-cA
vrfitweefleAnoTa3aaitptbCT
Fig. 2. Effects of multiplexing dyes on the ABI 7700. (A–D) Crosstalkobserved between IPC probe dye and reference dye in the multicomponentanalysis view of the SDS 1.6 software. The graphs plot time against fluo-rescence intensities of the selected dyes. All multicomponent views showa derived from a positive IPC-PCR only reaction. In all cases no interac-tion was observed in the negative control. (A) FAM/JOE/TAMRA reporterdyes and reference dye ROX, effect: TAMRA’s fluorescence intensitydrops, (B) FAM/JOE/TAMRA reporter dyes and reference dye BLUE, (C)FAM/JOE/TXR reporter dyes and reference dye BLUE, (D) FAM/JOE/A590rr
rFAM, JOE, TXR and CY5 finally yielded a combination
ence emission spectra of final selection. F = FAM, J = JOE, T = TAMRA,= A590, R = ROX, TR = TXR, B = BLUE, C = CY5.
alue of 0.2 at 106 molecules detected) deemed too low foreliable analysis. In all following experiments we aimed atnding the ideal combination for the 3rd reporter dye and for
he reference dye. We replaced the reference dye with BLUEhose emission spectrum peak at 636 nm shifts up from the
mission peak of ROX by 34 nm (Fig. 1A). Contrary to ourxpectations we saw a surprising strong crosstalk in whichuorescence energy appeared to be transferred from the ref-rence dye BLUE to the reporter dye TAMRA (Fig. 2B).
loss of fluorescence intensity in BLUE was accompa-ied by a concomitant increase in the fluorescence energyf TAMRA. When using the reporter dye TXR instead ofAMRA crosstalk occurred between the reference dye BLUEnd TXR (Fig. 2C). To separate the excitation spectrum of therd reporter dye and emission spectrum of the reference dyes far apart as possible we used the experimental dye A590s a reporter dye and CY5 as reference dye. When calibrat-ng the ABI 7700 for CY5 the emission spectrum appearedo peak at 650 nm instead of 670 nm. A CY5 labelled IPC-robe was not detectable. Nevertheless we were able to usehe CY5 reference with which the cycler had been calibrated
ut again observed crosstalk, this time from reference dyeY5 to reporter dye A590 (Fig. 2D). Similarly reporter dyeAMRA’s fluorescence was fed by the energy emitted fromitc
eporter dyes and reference dye CY5, effect in (B–D): concurrent growth ofeporter dye and loss of reference dye fluorescence intensity.
eference dye CY5 (data not shown). The combination of
n which no crosstalk was observed (Fig. 1A and B). Fil-ers for these dyes are available for the ABI 7500 real-timeycler.
3 f Clinica
3
pgefiiwTd
csuaIe
FCq
dm
twuoe1asAad32.46 ± 0.99 representing 1612 ± 770 molecules detected.
30 M. Weidmann et al. / Journal o
.3. Final mixture and testing of patient material
When testing the dye mixtures we always included allrimers and probes into the PCR mixtures testing each tar-et plasmid in parallel to the IPC plasmid, to evaluate howach assay might be affected by the switch of dyes. In thenal mixture the IPC-signal was wobbly indicating problems
n the enzymatic kinetics of the reaction. It stabilised whene titrated the nucleotide concentration to 600 �M and theaq-Polymerase to 3.75 U per reaction mixture and the IPCriving primers to 300 nM.
Once the complete multiplex setup had been finalised wehecked to find the minimum concentration of IPC moleculestably detected in such a multiplex mixture. This was testedsing plasimd standards for the individual virus PCRs in par-
llel to, 102, 103, 104 molecules of the IPC-plasmid standard.t turned out that at 103 molecules the IPC-PCR was the low-st concentration of IPC molecules, which could be reliablyig. 3. Influence of IPC concentration of quantitative results from patient samples.SF samples. Left panel: results obtained with 104 IPC molecules, right panel: resuantitative results (see text).
Wii
l Virology 42 (2008) 326–334
etected. The intra-assay variability of the IPC-PCR at 102
olecules was too high.We proceeded to assess how the concentration of the IPC
arget might affect the performance of the specific assayshen used to quantify patient samples. To test this wesed DNA extracted from patient material, which previ-usly had been tested positive by single PCR (Weidmannt al., 2003). We compared the multiplex PCR assay using04 and 103 molecules of the IPC target. To receive mostccurate non-biased quantification results, we used externaltandard curves created for each target virus without IPC.cross all virus tests the 104 IPC concentration was detected,
t CT 28.66 ± 0.87 representing 11,185 ± 4732 moleculesetected. The 103 IPC concentration was detected at CT
(A–C) Quantitative results for (A)16 VZV, (B) 16 HSV1 and (C) 3 HSV2ults obtained with 103 IPC molecules. The bars represent the mean of the
e did not observe one case of IPC-PCR failure due tonhibitors. But we found that the amount of the IPC targetndeed affected the quantitative results of the virus detection.
f Clinica
Ts1os
FapVpvri(mwP((t
n6
M. Weidmann et al. / Journal o
he mean of the HSV1 copy numbers detected in the patientamples shifted from 381.4 (median 42.5) in the presence of
04 molecules IPC to 3182 (median 1250) in the presencef 103 molecules IPC, representing a mean increase of sen-itivity by 0.92 log10. Similarly the mean of the VZV copyig. 4. Sensitivity of the multiplex assay. (A) Dynamic range of parallelmplification of virus target and 103 IPC molecules. Sorted quantitativeatient sample results with their simultaneously detected IPC value. (�)irus molecules detected calculated as virus molecules/ml for presentationurposes, (�) IPC molecules detected (not per ml), note that for the final 3irus values there are no IPC signals. (B and C) Comparison of quantitativeesults for the detection of VZV (8 CSF samples) and HSV1 (6 CSF samples)n a single PCR and in a multiplex PCR using either103 (multiplex I) or 104
multiplex II) IPC molecules in the mixture. The bar always depicts theean of the molecules detected. The median of the VZV molecules detectedere: 72 (single PCR), 103 (multiplex PCR (IPC 103)), and 32 (multiplexCR (IPC 104)). The median of the HSV1 molecules detected were: 2427single PCR), 2076 (multiplex PCR (IPC 103)), and 267 (multiplex PCRIPC 104)). There were too few samples and data points for HSV2 for thisype of comparison.
c1mot3t1bmsma
4
mfaPsidttwi1trttdn
4
voec(onosbvcd
l Virology 42 (2008) 326–334 331
umbers shifted from 171.8 (median 33.65) to 708.9 (median01) representing a mean increase of sensitivity by 0.62 log10.
The competition between the IPC-PCR and the spe-ific virus PCR led to the loss of the IPC signal when04 IPC molecules were used while trying to detect 104
olecules of HSV2 (Fig. 3C, left panel). The dynamic rangef the sensitivity of virus detection in patient samples inhe presence of 103 molecules of the IPC ranged from 4 to201 molecules detected (4 × 103/ml to 3.2 × 107/ml, respec-ively). Above that virus copy number, parallel detection of03 IPC molecules dropped out (Fig. 4A). The highest num-er of virus molecules detected was 9721 (9.7 × 107/ml). Theultiplex assay with 103 IPC molecules has a comparative
ensitivity to the single virus assay as the comparison of theean and median of the quantitative results shows (Fig. 4B
nd C).
. Discussion
The diagnosis of aseptic meningo-encephalitis calls forolecular testing of HSV1, HSV2, VZV, Enteroviruses and
or CMV in CSF samples drawn from patients (Townsendnd Scheld, 1998; Tyler, 2004). CSF samples can inhibitCR assays making an internal positive control necessary. Weelected dyes eligible for multiplexing in pairs of two (duplex-ng) that would not interfere with each other and the referenceye to fit into the analysis window from 500 nm to 660 nm ofhe ABI PRISM 7700 real-time PCR cycler. We also wantedo be independent of the marketing of VIC by PerkinElmer,hich curtails the amount of dyes one can use for multiplex-
ng once the cycler software is upgraded to SDS 1.7. The60 nm fluorescence analysis window of the ABI 7700 andhe need for a reference dye to normalise fluorescence signalseduces the amount of reporter dyes that can be used and weherefore excluded the CMV and the Enterovirus PCR fromhe multiplex mixture. Additionally we assigned the sameye to HSV1 and HSV2 since therapeutic intervention doseot differ for both viruses.
.1. Testing dyes for multiplexing on the ABI 7700 cycler
For the multiplex analysis we used the multicomponentiew, which allows to differentially monitor the developmentf fluorescence emitted during the course of the PCR. Wexpanded the choice of dyes and reduced background fluores-ence by using the non-fluorescent chromophore DABCYLKreuzer et al., 2001; Nazarenko et al., 1997) as a quencherf the Taqman probes. We tested a variety of dye combi-ations and encountered several cases of crosstalk, whichccurred either constitutively in each well or sporadically iningle wells. The most extreme case of crosstalk occurred
etween BLUE and TXR, leading to sporadic highly ele-ated fluorescene read outs off �Rn > 50.000 for TXR, whichorrupted the analysis software. Depending on the involvedyes crosstalk resulted in artificial fluorescence loss (Fig. 2A)
3 f Clinica
ofcad
4
oqa2q(mdst4catDupiW7e
fiswpsuiVtiuiu(ufmSe
4
(e
dt2Whcmats
4s
osoa
dvvfltnhiIttoed
sodibpa(aa
hcpHd
32 M. Weidmann et al. / Journal o
r gains for the reporter dyes and loss of the normalisationunction of the reference dye (Fig. 2B–D). The crosstalk diffi-ulties most obviously result from emission spectra overlapsnd the incompatible algorithm of the software that cannotistinguish the signals leading to mistakes in the analysis.
.2. Separation of emission peaks in multiplex analysis
So far three papers have been published describing the usef the combination of FAM-, TET-, VIC-labelled TAMRA-uenched Taqman probes normalised with ROX (Corless etl., 2001; Peter et al., 2001; Sharma and Dean-Nystrom,003). In another FAM-, TET-, JOE-labelled TAMRA-uenched Taqman probes normalised with ROX are usedFrancois et al., 2003). These papers however present noulticomponent data. The emission spectra peaks of the 3
yes FAM, TET, VIC span 35 nm, those of FAM, TET, JOEpan 33 nm. Consequently the spectral overlaps are largerhan the overlaps of the spectra of A590 and BLUE spanning6 nm or TXR and BLUE spanning 33 nm. Our data indicaterosstalk for the latter two combinations and data presented inreal-time PCR discussion group point to crosstalk between
he dyes VIC and FAM using the ABI 7700 (Douek, 2002;ouek, personal communication). The question remains whysers of 3-dye-combinations whose fluorescence emissioneaks are cramped into a nm range equivalent to our crosstalk-ng two-dye-combinations have not reported similar effects.
e recommend that when using Taqman probes on the ABI700, multicomponent analysis should always be used toxclude false positives and to verify multiplexing results.
The gaps in between the emission spectra peaks of ournal selection FAM, JOE, TXR, CY5 of 33 nm, 55 nm, 71 nm,eem to reduce the amount of spectral overlap to an extenthich allows multiplexing without crosstalk effects. Sup-ort for the use of large enough gaps between the emissionpectra comes from multiplex developments using Molec-lar Beacons labelled FAM/(TET/HEX)/TXR/CY5 on the-cycler and the Smartcyler (Templeton et al., 2003a,b, 2004;arma-Basil et al., 2004). The dye selections are comparable
o our dye selections as the emission spectra of JOE peaksn between TET and HEX. The advantage of using Molec-lar Beacons of course being that an internal reference dyes not needed even on the ABI 7700 cycler as shown by these of Molecular Beacons labelled FAM/TET/TAMRA/RHDVet et al., 1999). In a recent publication the advantage ofsing systems that do not need an internal dye reference evenor Taqman probes has been used to develop multiplex Taq-an probe assays using FAM/(TET/HEX)/TXR/CY5 on themartcyler II (Ward and Bej, 2006) and on the i-cycler (Gracet al., 2003).
.3. Internal positive control
Only a few published multiplex assays include an IPCGrace et al., 2003; Hobson-Peters et al., 2007; Templetont al., 2003a,b; Ward and Bej, 2006). Most IPCs have been
p(as
l Virology 42 (2008) 326–334
eveloped for duplex assays as plasmid-based mimic con-rols containing an inserted foreign sequence (King et al.,003; Schwaiger and Cassinotti, 2003; Westcott et al., 2003;idada et al., 2001). The mimic control of the assay presented
ere is driven by the two upstream primers of the virus spe-ific HSV2 and the VZV amplicons already present in theixture to reduce primer dimer formation. Since plasmids
re naked nucleic acids they are however inferior as extrac-ion control to described non-human viruses added to patientamples before extraction (Niesters, 2001, 2002).
.4. Dynamics of virus and IPC detction in patientamples
We tested patient material using 104 and 103 moleculesf the IPC per assay. The quantitative data clearly demon-trate, that too high IPC concentrations lead to a reductionf molecules detected in the patient samples (Fig. 3A and B)nd therefore may lead to false negatives virus detection.
At the upper limit using 103 IPC molecules expanded theynamic range to allow stable amplification of the high titreirus molecules (Fig. 3C), beyond parallel detection of 107
irus molecules IPC signal dropped out (Fig. 4A). The reasonor the IPC-PCR to collapse instead of the virus PCR mayie in the reduced efficiency of the IPC-PCR as compared tohe virus PCRs (Table 2) (Niesters, 2001). From the diag-ostic point of view the collapse of the IPC signal due to aigh virus load rather than the collapse of the virus signals an advantage. Our results point out that the choice of thePC concentration itself can have a far greater influence onhe quantitative result than the mean of the IPC signal varia-ion (Gruber et al., 2001; Niesters, 2001). The concentrationf the IPC molecule should be as low as possible but highnough to produce a stable signal with a tolerable standardeviation.
At the lower limit we noted that although the analyticalensitivity of the multiplex assay was reduced (Table 2), nonef the low viral load samples in the range of 10–100 moleculesetected, were missed by the multiplex assay. The possibil-ty of false negative virus PCR however cannot be excludedut may be very rare since the majority of the CSF sam-les carry a viral load well above the sensitivity minimums indicated by the median results of the tested CSF samplesHSV1 = 1250, HSV2 = 32,000, VZV = 601, see Fig. 3A–Cnd Fig. 4B and C). It remains unclear whether the alterednalytical sensitivity has a relevant clinical impact.
In summary it can be said that the use of CY5 as a referenceas enabled us to create a reliable 3-reporter dye internallyontrolled multiplex Taqman-PCR. Its performance is com-arable to the performance of the individual VZV, HSV1,SV2 PCR assays and it has the potential to simplify CSFiagnostics significantly as has been suggested by recently
ublished multiplex assays for the detection of HerpesvirusesBergallo et al., 2007; Hobson-Peters et al., 2007). Addition-lly we demonstrated that IPC concentration, may have aignificant impact on quantitative results.
f Clinica
A
tttTf
R
A
A
A
A
A
B
B
C
D
F
G
G
H
K
K
K
K
M
N
N
N
N
P
S
S
S
T
T
T
T
T
T
V
V
M. Weidmann et al. / Journal o
cknowledgements
We thank Melanie Feuerstein for excellent technical assis-ance. We are indebted to Olfert Landt from TibMolbiol forechnical advice and critically reading the manuscript. Part ofhis work was used for the PhD thesis of Katrin Armbruster.his work was supported in part by the Bundesministerium
ur Bildung und Forschung (BMBF) grant no. 01KI9951.
eferences
berham C, Pendl C, Gross P, Zerlauth G, Gessner M. A quantitative, inter-nally controlled real-time PCR Assay for the detection of parvovirus B19DNA. J Virol Methods 2001;92(2):183–91.
bu Al-Soud W, Radstrom P. Effects of amplification facilitators on diag-nostic PCR in the presence of blood, feces, and meat. J Clin Microbiol2000;38(12):4463–70.
ntunes F. Central nervous system AIDS-related diseases. Acta Neurochir2004;146(10):1071–4.
urelius E, Johansson B, Skoldenberg B, Staland A, Forsgren M. Rapiddiagnosis of herpes-simplex encephalitis by nested polymerase chain-reaction assay of cerebrospinal-fluid. Lancet 1991;337(8735):189–92.
urelius E, Johansson B, Skoldenberg B, Forsgren M. Encephalitis inimmunocompetent patients due to herpes-simplex virus Type-1 or Type-2as determined by type-specific polymerase chain-reaction and antibody-assays of cerebrospinal-fluid. J Med Virol 1993;39(3):179–86.
ergallo M, Costa C, Margio S, Sidoti F, Terlizzi ME, Cavallo R. Develop-ment of a multiplex polymerase chain reaction for detection and typingof major human herpesviruses in cerebrospinal fluid. Can J Microbiol2007;53(10):1117–22.
iron KK. Antiviral drugs for cytomegalovirus diseases. Antiviral Res2006;71(2–3):154–63.
orless CE, Guiver M, Borrow R, Edwards-Jones V, Fox AJ, Kaczmarski EB.Simultaneous detection of neisseria meningitidis, haemophilus influen-zae, and streptococcus pneumoniae in suspected cases of meningitis andsepticemia using real-time PCR. J Clin Microbiol 2001;39(4):1553–8.
ouek D., 2002. 7700 TAQMAN @ listserv.it.northwestern.edu nowreplaced by qpcrlistserver QPCR listserver.
rancois P, Pittet D, Bento M, Pepey B, Vaudaux P, Lew D, et al. Rapiddetection of methicillin-resistant staphylococcus aureus directly fromsterile or nonsterile clinical samples by a new molecular assay. J ClinMicrobiol 2003;41(1):254–60.
race MB, McLeland CB, Gagliardi SJ, Smith JM, Jackson III WE, BlakelyWF. Development and assessment of a quantitative reverse transcription-PCR assay for simultaneous measurement of four amplicons. Clin Chem2003;49(9):1467–75.
ruber F, Falkner FG, Dorner F, Hammerle T. Quantitation of viral DNAby real-time PCR applying duplex amplification, internal standardiza-tion, and two-color fluorescence detection. Appl Environ Microbiol2001;67(6):2837–9.
obson-Peters J, O’Loughlin P, Toye P. Development of an internallycontrolled, homogeneous polymerase chain reaction assay for the simul-taneous detection and discrimination of herpes simplex virus types 1 and2 and varicella-zoster virus. Mol Cell Probes 2007;21(1):24–30.
hurana RN, Charonis A, Samuel MA, Gupta A, Tawansy KA. Intravenousfoscarnet in the management of acyclovir-resistant herpes simplexvirus type 2 in acute retinal necrosis in children. Med Sci Monit
2005;11(12):CS75–8.ing DP, Reid SM, Hutchings GH, Grierson SS, Wilkinson PJ, Dixon LK,et al. Development of a TaqMan PCR assay with internal amplificationcontrol for the detection of African swine fever virus. J Virol Methods2003;107(1):53–61.
W
l Virology 42 (2008) 326–334 333
lein D, Leutenegger CM, Bahula C, Gold P, Hofmann-Lehmann R,Salmons B, et al. Influence of preassay and sequence variations onviral load determination by a multiplex real-time reverse transcriptase-polymerase chain reaction for feline immunodeficiency virus. J AcquirImmune Defic Syndr 2001;26(1):8–20.
reuzer KA, Bohn A, Lupberger J, Solassol J, le Coutre P, SchmidtCA. Simultaneous absolute quantification of target and control tem-plates by real-time fluorescence reverse transcription-PCR using4-(4′-dimethylaminophenylazo)benzoic acid as a dark quencher dye.Clin Chem 2001;47(3):486–90.
uir P, van Loon AM. Enterovirus infections of the central nervous system.Intervirology 1997;40(2–3):153–66.
asarabadi S, Milanovich F, Richards J, Belgrader P. Simultaneous detectionof TaqMan probes containing Fam and Tamra reporter fluorophores.Biotechniques 1999;27(6):1116–8.
azarenko IA, Bhatnagar SK, Hohman RJ. A closed tube format for ampli-fication and detection of DNA based on energy transfer. Nucleic AcidsRes 1997;25(12):2516–21.
iesters HG. Quantitation of viral load using real-time amplification tech-niques. Methods 2001;25(4):419–29.
iesters HG. Clinical virology in real time. J Clin Virol 2002;25(Suppl3):S3–12.
eter M, Gilbert E, Delattre O. A multiplex real-time PCR assay forthe detection of gene fusions observed in solid tumors. Lab Invest2001;81(6):905–12.
chwaiger M, Cassinotti P. Development of a quantitative real-time RT-PCR assay with internal control for the laboratory detection of tickborne encephalitis virus (TBEV) RNA. J Clin Virol 2003;27(2):136–45.
en K, Asher DM. Multiplex PCR for detection of enterobacteriaceae inblood. Transfusion 2001;41(11):1356–64.
harma VK, Dean-Nystrom EA. Detection of enterohemorrhagicEscherichia coli O157:H7 by using a multiplex real-time PCR assayfor genes encoding intimin and Shiga toxins. Vet Microbiol 2003;93(3):247–60.
empleton KE, Scheltinga SA, Sillekens P, Crielaard JW, van Dam AP,Goossens H, et al. Development and clinical evaluation of an internallycontrolled, single-tube multiplex real-time PCR assay for detection ofLegionella pneumophila and other Legionella species. J Clin Microbiol2003a;41(9):4016–21.
empleton KE, Scheltinga SA, van der Zee A, Diederen BM, van Krui-jssen AM, Goossens H, et al. Evaluation of real-time PCR for detectionof and discrimination between Bordetella pertussis, Bordetella paraper-tussis, and Bordetella holmesii for clinical diagnosis. J Clin Microbiol2003b;41(9):4121–6.
empleton KE, Scheltinga SA, Beersma MF, Kroes AC, Claas EC. Rapidand sensitive method using multiplex real-time PCR for diagnosis ofinfections by influenza a and influenza B viruses, respiratory syncy-tial virus and parainfluenza viruses 1, 2, 3 and 4. J Clin Microbiol2004;42(4):1564–9.
ownsend GC, Scheld WM. Infections of the central nervous system. AdvInternal Med 1998;43:403–47.
ucker RA, Unger ER, Holloway BP, Swan DC. Real-time PCR-based flu-orescent assay for quantitation of human papillomavirus types 6, 11, 16and 18. Mol Diagn 2001;6(1):39–47.
yler K. Herpes simplex virus infections of the central nervous system:encephalitis and meningitis, including Mollaret’s. Herpes 2004;11(Suppl2):57A–64A.
arma-Basil M, El-Hajj H, Marras SA, Hazbon MH, Mann JM, ConnellND, et al. Molecular beacons for multiplex detection of four bacterialbioterrorism agents. Clin Chem 2004;50(6):1060–2.
et JA, Majithia AR, Marras SA, Tyagi S, Dube S, Poiesz BJ, et al. Multiplex
detection of four pathogenic retroviruses using molecular beacons. ProcNatl Acad Sci USA 1999;96(11):6394–9.ard NL, Bej AK. Detection of vibrio parahaemolyticus in shellfish by useof multiplexed real-time PCR with TaqMan fluorescent probes. ApplEnviron Microbiol 2006;72(3):2031–42.
3 f Clinica
W
W
W
WDis 1998;26(3):541–53, quiz 554–545.
Widada J, Nojiri H, Kasuga K, Yoshida T, Habe H, Omori T. Quantification
34 M. Weidmann et al. / Journal o
eidmann M, Meyer-Konig U, Hufert FT. Rapid detection of herpes sim-plex virus and varicella-zoster virus infections by real-time PCR. J ClinMicrobiol 2003;41(4):1565–8.
elti M, Jaton K, Altwegg M, Sahli R, Wenger A, Bille J. Devel-opment of a multiplex real-time quantitative PCR assay to detect
Chlamydia pneumoniae. Legionella pneumophila and Mycoplasmapneumoniae in respiratory tract secretions. Diagn Microbiol Infect Dis2003;45(2):85–95.estcott DG, King DP, Drew TW, Nowotny N, Kindermann J, Hannant D,et al. Use of an internal standard in a closed one-tube RT-PCR for the
l Virology 42 (2008) 326–334
detection of equine arteritis virus RNA with fluorescent probes. Vet Res2003;34(2):165–76.
hitley RJ, Kimberlin DW, Roizman B. Herpes simplex viruses. Clin Infect
of the carbazole 1,9a-dioxygenase gene by real-time competitive PCRcombined with co-extraction of internal standards. FEMS Microbiol Lett2001;202(1):51–7.
