Cell Host & Microbe

Article

The Calcium-Dependent ProteinKinase CPK28 Buffers Plant Immunityand Regulates BIK1 TurnoverJacqueline Monaghan,1 Susanne Matschi,2 Oluwaseyi Shorinola,1,3 Hanna Rovenich,1,4 Alexandra Matei,1,5

Cecile Segonzac,1,6 Frederikke Gro Malinovsky,1,7 John P. Rathjen,1,8 Dan MacLean,1 Tina Romeis,2 and Cyril Zipfel1,*1The Sainsbury Laboratory, Norwich Research Park, NR4 7UH Norwich, UK2Department of Plant Biochemistry, Dahlem Centre of Plant Sciences, Freie Universitat Berlin, 14195 Berlin, Germany3Present address: Department of Crop Genetics, John Innes Centre, Norwich Research Park, NR4 7UH Norwich, UK4Present address: Laboratory of Phytopathology, Wageningen University, 6708 PB Wageningen, The Netherlands5Present address: Max Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany6Present address: Institute of Agriculture and Environment, Massey University, Palmerston North 4410, New Zealand7Present address: DNRF Center DynaMo, Copenhagen Plant Science Center, Department of Plant and Environmental Sciences,

Faculty of Science, University of Copenhagen, 1871 Frb. C, Denmark8Present address: Research School of Biology, Australian National University, Acton 0200, Australia

*Correspondence: cyril.zipfel@tsl.ac.ukhttp://dx.doi.org/10.1016/j.chom.2014.10.007

SUMMARY

Plant perception of pathogen-associated molecularpatterns (PAMPs) triggers a phosphorylation relayleading to PAMP-triggered immunity (PTI). Despiteincreasing knowledge of PTI signaling, how immunehomeostasis is maintained remains largely un-known. Here we describe a forward-genetic screento identify loci involved in PTI and characterizethe Arabidopsis calcium-dependent protein kinaseCPK28 as a negative regulator of immune signaling.Genetic analyses demonstrate that CPK28 at-tenuates PAMP-triggered immune responses andantibacterial immunity. CPK28 interacts with andphosphorylates the plasma-membrane-associatedcytoplasmic kinase BIK1, an important convergentsubstrate of multiple pattern recognition receptor(PRR) complexes. We find that BIK1 is ratelimiting in PTI signaling and that it is continuouslyturned over to maintain cellular homeostasis.We further show that CPK28 contributes to BIK1turnover. Our results suggest a negative regula-tory mechanism that continually buffers immunesignaling by controlling the turnover of this keysignaling kinase.

INTRODUCTION

Innate immunity is characterized by the ability of cells to sense

invading pathogens and initiate robust defense responses. In

plants, this is achieved through a multilayered surveillance sys-

tem involving both surface-localized and cytosolic immune re-

ceptors (Dodds and Rathjen, 2010). The first layer is mediated

by plasma-membrane-localized pattern recognition receptors

(PRRs) that bind pathogen-associated molecular patterns

Cell Host &

(PAMPs) leading to PAMP-triggered immunity (PTI) (Zipfel,

2014). One of the earliest physiological changes following PRR

activation is a rapid burst of reactive oxygen species (ROS),

mediated in Arabidopsis by the NADPH oxidase RBOHD (Nuhse

et al., 2007; Torres et al., 2002; Zhang et al., 2007). PRR activa-

tion additionally triggers activation of mitogen-activated protein

kinases (MAPKs) and calcium (Ca2+)-dependent protein kinases

(CDPKs), resulting in the expression of defense genes (Tena

et al., 2011). These and other responses result in broad-spec-

trum basal disease resistance (Dangl et al., 2013; Dodds and

Rathjen, 2010).

All known plant PRRs are receptor kinases (RKs) or receptor-

like proteins (RLPs) that form larger complexes with additional

proteins at the plasma membrane (Bohm et al., 2014; Macho

and Zipfel, 2014). RKs contain a cytosolic kinase domain and

a variable ectodomain featuring leucine-rich repeats (LRRs),

LysM motifs, or other ligand-binding domains. Classical PRRs

include the Arabidopsis LRR-RKs FLS2 and EFR that bind bac-

terial flagellin (or the minimal epitope flg22) and elongation factor

Tu (EF-Tu; or the minimal epitope elf18), respectively (Gomez-

Gomez and Boller, 2000; Zipfel et al., 2006). In Arabidopsis,

fungal chitin is perceived by the LysM-RK CERK1 (Liu et al.,

2012; Miya et al., 2007; Wan et al., 2008). Additional

PRRs perceive endogenous damage-associated molecular pat-

terns (DAMPs) released under stress conditions (Zipfel, 2014).

For example, the small endogenous peptide AtPep1 binds

Arabidopsis LRR-RKs PEPR1 and PEPR2, triggering immune re-

sponses (Krol et al., 2010; Yamaguchi et al., 2010; Yamaguchi

et al., 2006).

Immediately following ligand binding, FLS2, EFR, and PEPR1

associate with the LRR-RK BAK1/SERK3 and related SERK pro-

teins (Chinchilla et al., 2007; Heese et al., 2007; Liebrand et al.,

2014; Postel et al., 2010; Ranf et al., 2011; Roux et al., 2011;

Sun et al., 2013). Complex formation leads to PRR and BAK1

phosphorylation, which initiates immune signaling (Schulze

et al., 2010; Schwessinger et al., 2011; Sun et al., 2013). Impor-

tantly, CERK1 homodimerizes upon chitin binding and does not

require BAK1 or SERK proteins for signaling (Gimenez-Ibanez

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 605

Figure 1. Restoration of PAMP Responses

in bak1-5 mob1

(A) ROS assay after treatment with 100 nM flg22,

100 nM elf18, or 1 mM AtPep1 expressed as rela-

tive light units (RLU) over time. Values are means ±

SDs (n = 8).

(B) Seedling growth in media containing 1 mM

flg22, 1 mM elf18, or 1 mM AtPep1 normalized

against growth without peptides. Relative values

are means + SD (n = 10). Significantly different

groups (p < 0.0001) are indicated with lower-

case letters based on ANOVA analysis. Experi-

ments were repeated at least three times with

similar results. Refer to Figure S1 for additional

information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

et al., 2009; Liu et al., 2012; Schulze et al., 2010; Shan et al.,

2008).

Plant receptor-like cytoplasmic kinases (RLCKs) have

emerged as key immune regulators acting immediately down-

stream of PRR complexes (Lin et al., 2013; Wu and Zhou,

2013). Multiple RKs in Arabidopsis, including FLS2, EFR,

PEPR1, CERK1, and BAK1, associate with the plasma-mem-

brane-associated RLCK BIK1 and related PBL proteins (Lin

et al., 2014; Liu et al., 2013; Lu et al., 2010; Zhang et al., 2010).

BIK1 is directly phosphorylated in vitro by FLS2, PEPR1, and

BAK1 and reciprocally phosphorylates BAK1 and FLS2 (Lin

et al., 2014; Liu et al., 2013; Lu et al., 2010; Xu et al., 2013; Zhang

et al., 2010). PAMP perception triggers hyperphosphorylation of

BIK1 (Benschop et al., 2007; Liu et al., 2013; Lu et al., 2010;

Zhang et al., 2010), which most likely activates the kinase to

phosphorylate downstream substrates. Recent work demon-

strated that BIK1 interacts with and phosphorylates RBOHD to

enable PAMP-triggered ROS production and stomatal immunity

(Kadota et al., 2014; Li et al., 2014). In addition to BIK1,

Arabidopsis PBL27 regulates chitin-induced MAPK activation

and callose deposition downstream of CERK1 (Shinya et al.,

2014). Furthermore, the RLCK BSK1 also associates with FLS2

and bsk1 mutant plants are impaired in flg22 signaling (Shi

et al., 2013).

Despite these recent advances, our knowledge of the

molecular events occurring downstream of PRR activation is

limited. In an effort to identify regulators of PTI, we designed

a sensitized forward-genetic screen in the immune-deficient

bak1-5 mutant background. The unique dominant-negative

bak1-5 mutant is characterized by a single amino acid substi-

tution in the kinase domain that renders BAK1 specifically

defective in immune signaling but does not affect its function

in brassinosteroid signaling or cell death control (Schwes-

singer et al., 2011). Using bak1-5 facilitated the recovery of

mutants with an enhanced PAMP-triggered ROS burst. Here,

606 Cell Host & Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc.

we describe two allelic mutants isolated

from our modifier of bak1-5 (mob)

screen caused by mutations in the

gene encoding the Ca2+-dependent

protein kinase CPK28. We show that

CPK28 facilitates BIK1 turnover and

negatively regulates BIK1-mediated im-

mune responses triggered by several

PAMPs. Our work reveals a regulatory mechanism that consti-

tutively buffers BIK1 turnover to ensure optimal immune

outputs.

RESULTS

mob Mutants Restore PAMP Responsiveness in bak1-5

To identify loci involved in PTI, we mutagenized bak1-5 with

ethyl-methyl sulfonate and screened the M2 for mob mutants

that regained responsiveness to flg22 in a ROS burst assay

adapted for agar plates (Figure S1A available online). Here

we focus on bak1-5 mob1, which partially restored flg22-,

elf18-, and AtPep1-triggered ROS compared to bak1-5 (Fig-

ure 1A). Prolonged exposure to these peptides is linked

to growth inhibition in wild-type seedlings (Gomez-Gomez

et al., 1999; Krol et al., 2010; Zipfel et al., 2006); however,

this effect is strongly impaired in bak1-5 (Roux et al., 2011;

Schwessinger et al., 2011). Although bak1-5 mob1 remained

insensitive to flg22 in seedling growth inhibition assays, sensi-

tivity to elf18 and AtPep1 was regained (Figure 1B). Thus,

mob1 restores signaling triggered by multiple immunogenic

peptides in bak1-5.

Genetic analysis of F2 progeny from bak1-5 mob1 back-

crossed to bak1-5 indicated that mob1 segregates as a single,

recessive locus (51/222 plants had regained elf18-triggered

ROS; x2 = 0.486; p = 0.4855). To establish complementation

groups, bak1-5 mob1 was crossed with other recessive

mob mutants, and F1 individuals were analyzed for seedling

sensitivity to AtPep1. One mutant, bak1-5 mob2, which also

restored PAMP-triggered ROS (Figure S1B) and seedling

growth inhibition (Figure S1C), was not able to complement

bak1-5 mob1 (Figure S1D). As segregation of AtPep1 sensi-

tivity was not observed in the F2 progeny of an independent

cross (80 individuals tested), we conclude that mob1 and

mob2 are allelic.

A

B

C

D

E

F

G

Figure 2. MOB1/MOB2 Encodes the Ca2+-

Dependent Protein Kinase CPK28

(A) Map position of mob1 on the bottom arm of

Chromosome 5 based on linkage analysis using

segregating F2 progeny from bak1-5 mob1

crossed to Ler-0.

(B) Illumina sequencing of bulked F2 segregants

from bak1-5 mob1 backcrossed to bak1-5 called

SNPs in three genes in the mapped region.

(C) Exact positions of SNPs in bak1-5 mob1.

Position: genomic position (in bp); Ref: base

sequence in bak1-5; Seq: base sequence in bak1-

5 mob1; AGI: gene number; Gene: gene name;

Change: amino acid residue substitution.

(D and E) Positions of CPK28 mutations in mob1

and mob2 indicating both genomic and peptide

transitions.

(F and G) Seedling growth assay on MS media

containing 100 nM elf18 (F) or 1 mM AtPep1 (G)

normalized against growth in control media.

Relative values are means + SD (n = 10). Signifi-

cantly different groups (p < 0.0001) are indicated

with lower-case letters based on one-way ANOVA

analysis.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

MOB1/MOB2 Encodes the Ca2+-Dependent ProteinKinase CPK28To identify the causative mutations in mob1 and mob2, we

combined classical map-based cloning with whole-genome

sequencing. We mapped mob1 to the bottom arm of Chro-

mosome 5 between markers MPA24 (26.3 Mbp) and K9I9

(26.9 Mbp) using linkage analysis of F2 segregants from bak1-5

mob1 (in Col-0) crossed to Ler-0 (Figure 2A). In parallel, we

bulked F2 segregants from bak1-5 mob1 backcrossed to bak1-

5 and sequenced the mutant and parental genomes using

Illumina High-Seq. Four nonsynonymous C-T transitions were

uniquely identified in three genes located within the mapped re-

gion of bak1-5 mob1 (Figure 2B); two were in CPK28/At5g66210

(Figures 2C and 2D) and the others were in AtC3H68/At5g66270

and MAN7/At5g66460 (Figure 2C). Sanger sequencing of

genomicCPK28, AtC3H68, andMAN7 in bak1-5 mob2 identified

a homozygous nonsynonymous G-A transition in CPK28 (Fig-

ure 2E) but no SNPs in AtC3H68 or MAN7. The mutations in

bak1-5 mob1 resulted in a CPK28 protein with amino acid sub-

stitutions S245L and A295V (Figure 2D), while the mutation in

bak1-5 mob2 resulted in an early stop codon predicted to result

in a truncated protein (Figure 2E).

To confirm that we had isolated mutant alleles of CPK28, we

stably transformed bak1-5 mob1 plants with genomic CPK28

and found that two independent bak1-5 mob1/pCPK28:CPK28

transgenic lines complemented seedling insensitivity to elf18

and AtPep1 (Figures 2F and 2G). We also obtained cpk28-1

and cpk28-3 insertion alleles (Figure S2A) and crossed

them to bak1-5. Similar to bak1-5 mob1, bak1-5 cpk28-1 and

bak1-5 cpk28-3 seedlings regained sensitivity to AtPep1 (Fig-

ure S2B). Thus, the phenotypes observed in the allelic mutants

mob1 and mob2 are caused by mutations in CPK28. We

renamed these alleles cpk28-4 and cpk28-5, respectively

(Figure S2A).

Cell Host &

CPK28 was previously shown to regulate vegetative stage

transition (Matschi et al., 2013). We obtained cpk28-4 and

cpk28-5 single mutants by crossing to Col-0 and observed

rosette development over a 47 day timeframe. Like cpk28-1

and cpk28-3, mature cpk28-4 and cpk28-5 mutants displayed

a stage transition defect but were phenotypically indistinguish-

able from Col-0 in the juvenile phase (Figure S2C).

Loss of CPK28 Results in Enhanced PAMP-TriggeredSignaling and Antibacterial ImmunityTo assess the role of CPK28 in PTI, we characterized PAMP-

induced responses in cpk28-1 and cpk28-3. Both alleles

produced significantly more ROS compared to Col-0 after treat-

ment with flg22, elf18, AtPep1, or chitin (Figure 3A), indicating

enhanced responsiveness to a broad range of PAMPs. This was

an induced response, as untreated cpk28 plants did not produce

apoplastic ROS (Figure S2D). The cpk28 mutants additionally

displayed enhanced sensitivity to elf18 and AtPep1 in seedling

growth inhibition assays, while intriguingly, sensitivity to flg22

wasnotaffected (Figure3B). Thismay reflect thresholddifferences

in seedling growth inhibition and ROS assays mediated by

different PRRs. In parallel to the ROS burst, PRR activation also

triggers MAPK cascades (Segonzac et al., 2011; Xu et al., 2014;

Zhang et al., 2007). We observed slightly enhanced PAMP-trig-

gered MPK4/11 activation in the cpk28 mutants compared to

Col-0 (Figure S2E), while MPK3/6 activation was unaffected.

Importantly, ligand-dependent association between FLS2

and BAK1 was maintained in the cpk28 mutants (Figure S2F).

Furthermore, accumulation of BAK1 and FLS2 was similar in all

genotypes (Figure S2F), as was basal expression of FLS2,

EFR, CERK1, BAK1, BIK1, and RBOHD (Figure S2G).

As PTI signaling results in resistance against pathogens,

we surface-inoculated plants with the virulent bacterium

Pseudomonas syringae pv. tomato (Pto) DC3000 and monitored

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 607

Figure 3. Loss of CPK28 Results in Enhanced PTI Signaling and Antibacterial Immunity

(A) ROS assay following treatment with 100 nM flg22, 100 nM elf18, 1 mM AtPep1, or 100 mg/ml chitin. Values are means ± SD (n = 8).

(B) Seedling inhibition in media containing 100 nM flg22, 100 nM elf18, or 1 mM AtPep1. Relative values are means + SD (n = 10).

(C) Growth of the virulent bacterium Pto DC3000 3 days postinfection (dpi) with a bacterial suspension of 108 cfu/ml. Values are means + SD (n = 4). All

experiments were repeated at least three times with similar results. Significant differences are designated by asterisks (***p < 0.0001; **p < 0.005; n.s. is not

significant) based on unpaired Student’s t tests comparing the means to Col-0. Refer to Figures S2 and S3 for additional information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

bacterial titers after 3 days. We observed significantly restricted

bacterial growth incpk28mutants compared toCol-0 (Figure 3C),

indicating that enhanced PTI signaling in cpk28 mutants results

in increased immunity.

CPK28 belongs to Arabidopsis CDPK subgroup IV and is

closely related to CPK16 and CPK18 (Boudsocq and Sheen,

2013; Hamel et al., 2014) (Figure S3A). Publically available micro-

array data (Schmid et al., 2005; Winter et al., 2007) indicates that

whileCPK28 is expressed in many tissue types,CPK16 is almost

exclusively expressed in pollen, and CPK18 does not appear to

be expressed in any tissues (Figure S3B). Consistently, the elf18-

and AtPep1-triggered ROS burst was not affected in cpk16 and

cpk18 insertion alleles compared to Col-0 (Figures S3C and

S3D). We therefore do not expect biological redundancy among

these CDPKs.

CPK28 Kinase Activity Is Required to Attenuate PTISignalingThe cpk28-4 mutations S245L and A295V are located within the

kinase domain of CPK28 (Figure 4A). To test if these residues

are important for kinase activity,wepurifiedwild-type andmutant

CPK28 variants N-terminally tagged with maltose-binding

protein (MBP) fromEscherichia coli andperformed kinase assays

in vitro. Wild-type MBP-CPK28 readily incorporated radioactive

phosphate, while the catalytically dead variantMBP-CPK28D188A

(Matschi et al., 2013) did not (Figure 4B), indicating that CPK28

autophosphorylates in vitro. The cpk28-4 mutant variant MBP-

CPK28S245L/A295V was unable to incorporate radioactive phos-

608 Cell Host & Microbe 16, 605–615, November 12, 2014 ª2014 Els

phate, suggesting compromised kinase function (Figure 4B). To

determine the contribution of S245 and A295 to CPK28 kinase

activity, we individuallymutated both residues and could demon-

strate that MBP-CPK28A295V was catalytically inactive, while

MBP-CPK28S245L retained enzymatic activity (Figure 4B). We

conclude that residueA295 is important forCPK28 kinase activity

in vitro.

To determine if kinase activity is necessary for CPK28 function

in PTI signaling, we stably transformed cpk28-1 plants with wild-

type or mutant CPK28 variants driven by the 35S promoter

and C-terminally tagged with yellow fluroescent protein (YFP)

and tested two independent lines for complementation.

Importantly, all transgenic lines expressed the recombinant pro-

teins to comparable levels (Figure S4A). Both the wild-type

35S:CPK28-YFP and mutant variant 35S:CPK28S245L-YFP com-

plemented enhanced elf18- and AtPep1-triggered ROS in

cpk28-1, while the kinase-dead variants 35S:CPK28D188A-YFP,

35S:CPK28S245L/A295V-YFP, and 35S:CPK28A295V-YFP did not

(Figures 4C and S4B). Therefore, kinase activity is necessary

for CPK28 function in PTI, and the A295V substitution is causa-

tive of the cpk28-4 phenotype.

CDPKs are modular proteins, containing a highly conserved

kinase domain, an autoinhibitory pseudosubstrate domain,

multiple Ca2+-binding EF-hand motifs, and a variable N-terminal

domain (Liese and Romeis, 2013). To determine if CPK28 kinase

activity is sufficient for its function in PTI, we tested if a constitu-

tively active variant of CPK28, containing only the variable

N-terminal domain and the kinase domain (thus referred to as

evier Inc.

A B

C

Figure 4. CPK28 Kinase Activity Is Required to Attenuate PTI Signaling

(A) CPK28 protein organization illustrating the kinase domain, autoinhibitory domain (AID), and Ca2+-binding domain. A multiple sequence alignment generated

using ClustalW and Boxshade II of the region containing the cpk28-4 (red) and cpk28-5 (blue) residue transitions across Arabidopsis CDPKs. Divergent (white),

similar (gray), and conserved (black) residues are indicated.

(B) Autoradiograph showing incorporation of radioactive phosphate in recombinant MBP-CPK28 compared to mutant variants in vitro. Membranes were stained

with Coomassie brilliant blue (CBB) as a loading control.

(C) ROS assay following treatment with 100 nM elf18 in Col-0 and cpk28-1 compared to transgenic lines generated in cpk28-1. All constructs are driven by 35S

and C-terminally tagged with YFP (‘‘35S:CPK28-YFP’’) with the indicated mutations. Values represent means of total photon counts over 60 min + SD (n = 8).

Significantly different groups (p < 0.05) are indicated with lower-case letters based on one-way ANOVA analysis. These experiments were repeated at least three

times with similar results. Refer to Figure S4 for additional information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

‘‘VK’’), could complement cpk28-1. Indeed, 35S:CPK28VK-YFP

(Matschi et al., 2013) complemented enhanced elf18- and

AtPep1-triggered seedling inhibition (Figure S4C) and ROS burst

(Figure S4D) in cpk28-1. Together, these results indicate that

CPK28 kinase function is necessary and sufficient for its function

in PTI signaling.

Overexpression of CPK28 Inhibits PTI Signaling andImmunityWe next tested the physiological effects of ectopically overex-

pressingCPK28. We generated CPK28-OE lines by transforming

Col-0 with 35S:CPK28-YFP and selected two independent lines

with strongly increased CPK28 expression for analysis (Fig-

ure S5A). Both CPK28-OE1 and CPK28-OE4 were morphologi-

cally similar to Col-0, although CPK28-OE1 was slightly smaller

(Figure S4B). Remarkably, both CPK28-OE lines exhibited a

severely reduced ROS burst after treatment with flg22, elf18,

AtPep1, or chitin (Figure 5A). Both CPK28-OE lines were signifi-

cantly less sensitive to both elf18 and AtPep1 in seedling

growth assays but remained as sensitive as Col-0 to flg22 (Fig-

ure 5B). In addition, PAMP-induced activation of MPK4/11 was

reduced in the CPK28-OE lines compared to Col-0 (Figure S5C),

as was elf18-triggered expression of the marker genes FRK1,

At1g51890, and NHL10 (Figure S5D).

Cell Host &

Importantly, FLS2-BAK1 complex formation was comparable

between Col-0 and the CPK28-OE lines (Figure S5E), and the

overexpression of CPK28 did not result in impaired steady-state

expression of several relevant defense genes (Figure S5F).

The CPK28-OE lines additionally supported significantly

higher bacterial growth compared to Col-0 after spray-infection

with Pto DC3000 (Figure 5C). Accordingly, the CPK28-OE lines

were impaired in flg22-induced stomatal closure (Figure S5G).

Together, these results indicate that overexpression of CPK28

impairs PTI signaling and immunity.

CPK28 Associates to the Plasma Membrane viaMyristoylationAnalysis of cpk28-1/35S:CPK28-YFP tissue using confocal mi-

croscopy revealed that CPK28-YFP localizes to the plasma

membrane (Figure S6A). Similar to many CDPKs, CPK28 con-

tains a predicted N-terminal myristoylation motif at position G2

(Boudsocq and Sheen, 2013). To determine if CPK28 localization

is the consequence of myristoylation, we created a G2A variant

and transiently expressed 35S:CPK28G2A-YFP in Nicotiana

benthamiana alongside 35S:CPK28-YFP. The mutant variant

clearly lost membrane localization (Figure S6B), indicating that

CPK28 is targeted to the plasma membrane via myristoylation

on residue G2.

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 609

Figure 5. Overexpression of CPK28 Inhibits PTI Signaling and Antibacterial Immunity

(A) ROS assay following treatment with 100 nM flg22, 100 nM elf18, 1 mM AtPep1, or 100 mg/ml chitin. Values are means ± SD (n = 8).

(B) Seedling inhibition assay in media containing either 100 nM flg22, 100 nM elf18, or 100 nM AtPep1. Relative values are means ± SD (n = 10).

(C) Growth of the virulent bacterium Pto DC3000 3 dpi with a bacterial suspension of 108 cfu/ml. Values are means ± SD (n = 4). Significant differences are

designated by asterisks (***p < 0.0001; **p < 0.005; *p < 0.01; n.s. is not significant) based on unpaired Student’s t tests comparing the means to Col-0. All

experiments were repeated at least three times with similar results. Refer to Figure S5 for additional information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

CPK28 Associates with and Phosphorylates BIK1Our genetic analyses indicated a broad effect on BAK1-depen-

dent (flg22, elf18, and AtPep1) and BAK1-independent (chitin)

signaling cascades, suggesting that CPK28 may target a down-

stream regulator of several PRR complexes.

The plasma-membrane-associated kinase BIK1 is a key regu-

lator required for signaling through several PRRs.We thus tested

whether CPK28 and BIK1 could associate by coexpressing

35S:CPK28-YFP and 35S:BIK1-HA in N. benthamiana and

conducting coimmunoprecipitation (coIP) assays. A signal for

BIK1-HA was clearly observed in the CPK28-YFP immunopre-

cipitate (Figure S6C), indicating that CPK28 and BIK1 can asso-

ciate. We confirmed this association in Arabidopsis transgenic

plants expressing pBIK1:BIK1-HA and 35S:CPK28-YFP gener-

ated through crossing (Figure 6A).

As BIK1 associates with the FLS2-BAK1 complex (Lu et al.,

2010; Zhang et al., 2010) and the NADPH oxidase RBOHD

(Kadota et al., 2014; Li et al., 2014), we were interested to

know if CPK28 also associates with these proteins. We found

that FLS2 and BAK1 did not associate with CPK28-YFP in coIP

assays using cpk28-1/35S:CPK28-YFP tissue treated with or

without flg22 (Figure S6D). However, association was observed

between FLAG-RBOHD and CPK28-YFP when coexpressed in

N. benthamiana (Figure S6E). Notably, CPK28 associates with

RBOHD and BIK1 before and after treatment with flg22 (Figures

6A, S6C, and S6E), suggesting that CPK28 constitutively associ-

ates with the BIK1/RBOHD complex but not with FLS2 or BAK1.

610 Cell Host & Microbe 16, 605–615, November 12, 2014 ª2014 Els

Because BIK1 acts upstream of RBOHD and is required for

its function (Kadota et al., 2014; Li et al., 2014), we focused

on characterizing the interaction between CPK28 and BIK1.

To test if CPK28 can phosphorylate BIK1, we performed

in vitro kinase assays. MBP-CPK28 trans-phosphorylated both

the wild-type MBP-BIK1 protein and the catalytically inactive

variant MBP-BIK1K105A/K106A (Lu et al., 2010) (Figure 6B). Impor-

tantly, MBP-BIK1K105A/K106A did not incorporate radioactive

phosphate on its own or when incubated with the kinase-dead

variant MBP-CPK28D188A, indicating that trans-phosphorylation

was the consequence of incubation with CPK28. These results

suggest that CPK28 associates with and phosphorylates BIK1.

BIK1 Accumulation Is Regulated by CPK28 and the 26SProteasomeWe noted that overexpression of BIK1 in Col-0/pBIK1:BIK1-HA

plants (Kadota et al., 2014; Zhang et al., 2010) (Figure S7A)

resulted in a strongly enhanced elf18- and AtPep1-triggered

ROS burst (Figures 7A, 7D, S7B, and S7D), agreeing with its

role as a key positive regulator of RBOHD (Kadota et al., 2014;

Li et al., 2014). We generated CPK28-OE1/pBIK1:BIK1-HA lines

though crossing and found that the increased burst after elf18 or

Pep1 treatment was almost completely suppressed (Figures 7A

and S7B), supporting a role for CPK28 in negatively regulating

BIK1-mediated signaling. Interestingly, we found that while

PAMP-triggered BIK1-HA hyperphosphorylation was main-

tained, BIK1-HA protein accumulation was strongly reduced in

evier Inc.

Figure 6. CPK28 Associates with and Phosphorylates BIK1

(A) CoIP assay before and after treatment with 200 nM flg22 for 10 min. WB

analysis using a-GFP and a-HA on total protein extracts (‘‘input’’) and on eluted

proteins after IP with a-GFP magnetic beads.

(B) Autoradiograph showing incorporation of radioactive phosphate in the

indicated recombinant proteins following kinase assays in vitro. Both experi-

ments were repeated three times with similar results. CBB stains are included

as controls. Refer to Figure S6 for additional information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

CPK28-OE1/pBIK1:BIK1-HA compared to control plants (Fig-

ure 7B). BIK1 transcript levels were comparable between

CPK28-OE1/pBIK1:BIK1-HA and Col-0/pBIK1:BIK1-HA (Fig-

ure S7A), indicating that reduced BIK1-HA accumulation is

caused either by reduced protein synthesis or increased protein

turnover. BAK1 accumulation was not affected (Figure 7B), sug-

gesting that the overall translational machinery is functional.

Thus, reduced BIK1-HA accumulation in CPK28-OE1/pBIK1:

BIK1-HA is probably due to increased protein degradation.

A common protein degradation pathway is mediated by the

ubiquitin/proteasome system (Nelson et al., 2014). Chemical

inhibition of the proteasome using MG-132 (Rock et al., 1994)

resulted in strongly enhanced accumulation of BIK1 in both

Col-0/pBIK1:BIK1-HA and CPK28-OE1/pBIK1:BIK1-HA, while

BAK1 accumulation was unaffected (Figure 7C). Moreover, we

observed laddering of BIK1-HA in MG-132-treated samples

(Figure S7C), indicative of polyubiquitination.

We next generated cpk28-1/pBIK1:BIK1-HA lines through

crossing. These plants were hyperresponsive to elf18 and

AtPep1 in ROS burst assays, indicating additive genetic effects

of cpk28-1 andBIK1 overexpression (Figures 7D andS7D).While

BIK1 expression was similar between Col-0/pBIK1:BIK1-HA and

cpk28-1/pBIK1:BIK1-HA (Figure S7E), higher BIK1 accumulation

was detected in cpk28-1/pBIK1:BIK1-HA (Figure 7E). Impor-

tantly, BAK1 levels were unaffected in these lines (Figure 7E).

Our results suggest that CPK28 constitutively regulates BIK1

accumulation, thereby buffering the amplitude of PTI signaling.

DISCUSSION

The temporal and physical dynamics of receptor complexes,

together with phosphorylation initiated by kinases within these

complexes, underpin ligand-triggered signaling events that

must be tightly controlled (Lemmon and Schlessinger, 2010;

Cell Host &

Scott and Pawson, 2009). This is particularly true for immune re-

sponses whose suboptimal or supraoptimal induction can have

detrimental effects on cellular homeostasis and survival (Kondo

et al., 2012; Sasai and Yamamoto, 2013). In this study, we iden-

tified CPK28 as a negative regulator of plant immunity. We show

that CPK28 interacts with and phosphorylates BIK1, a key regu-

latory kinase associated with PRR complexes and involved in

PAMP-triggered signal transduction. We find that BIK1 is contin-

uously degraded by the 26S proteasome and that CPK28 con-

tributes to BIK1 turnover. Our results reveal a regulatory mecha-

nism that ensures an optimal amplitude of immune responses.

CDPKs contain a Ca2+-binding domain and represent a unique

subclass of kinases found in plants, green algae, and some

protists (Hamel et al., 2014; Hrabak et al., 2003). Available

biochemical and structural data suggest that Ca2+ binding to

CDPKs results in a conformational change that releases autoin-

hibition and exposes the active site (Harper et al., 2004; Liese

and Romeis, 2013). PAMP perception results in a Ca2+ influx

that is thought to contribute to immune signaling through

activation of Ca2+-binding proteins such as CDPKs (Romeis

and Herde, 2014). Several CDPKs have been implicated in

response to biotic and abiotic stresses, mostly as positive regu-

lators (Boudsocq and Sheen, 2013; Romeis and Herde, 2014).

In-gel kinase assays demonstrated that PAMP perception

results in phosphorylation of multiple CDPKs (Boudsocq et al.,

2010). In particular, CPK5 and related CDPKs CPK4, CPK6,

and CPK11 participate in immunity and phosphorylate the

NADPH oxidase RBOHD (Boudsocq et al., 2010; Dubiella

et al., 2013; Gao et al., 2013; Kadota et al., 2014). In contrast,

we find that CPK28 is a negative regulator of PTI signaling.

All of our experiments were performed using juvenile cpk28

plants, which are indistinguishable from wild-type plants up to

5 weeks postgermination (Figure S2C). Previous work showed

that mature cpk28 plants accumulate high levels of anthocyanin

and exhibit severely reduced stem elongation linked to impaired

gibberellic acid biosynthesis (Matschi et al., 2013). A similar

observation was noted in N. attenuata plants silenced for

NaCDPK4 and NaCDPK5, two CDPKs orthologous to CPK28

(Heinrich et al., 2013; Yang et al., 2012). Juvenile NaCDPK4/

NaCDPK5-silenced plants overaccumulate defense-related

metabolites, including jasmonic acid, when treated with oral se-

cretions from the insect herbivore Manduca sexta and exhibit

enhanced resistance against insect feeding (Yang et al., 2012).

Inactivation of the Medicago truncatula CPK28 ortholog

MtCDPK1 has also been linked to enhanced defense responses,

causing reduced root colonization by both the mycorrhizal fun-

gusGlomus versiforme and the rhizobial symbiontSinorhizobium

meliloti (Ivashuta et al., 2005). Together with our characterization

of cpk28 mutants, which exhibit enhanced PAMP-triggered

responses, it is tempting to speculate that CPK28 orthologs

broadly function as negative regulators of immunity across plant

species, potentially by regulating RLCKs.

Negative regulation of PRR complexes attenuates PTI

signaling. In the absence of PAMPs, complex formation between

FLS2 and BAK1 is inhibited by the BAK1-associated LRR-RK

BIR2 (Halter et al., 2014). BAK1 is additionally negatively

regulated by a specific PP2A isoform whose activity is inhibited

upon PAMP perception (Segonzac et al., 2014). Following PAMP

perception, ligand-bound FLS2 is endocytosed (Robatzek et al.,

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 611

Figure 7. BIK1 Accumulation Is Regulated

by CPK28 and the 26S Proteasome

(A) ROS assay following treatment with 100 nM

elf18. Values are means ± SD (n = 8).

(B) WB analysis of BIK1-HA before and after

treatment with 100 nM elf18 for 20 min.

(C) WB analysis of BIK1-HA after treatment for 8 hr

with either 1% DMSO (�) or 100 mM MG-132 (+).

(D) ROS assay following treatment with 100 nM

elf18. Values are means ± SD (n = 8).

(E) WB analysis of BIK1-HA before and after

treatment with 100 nM elf18 for 20 min. All mem-

branes were probed with a-BAK1 and stained with

CBB as loading controls. Densiometry values

(representing means ± SE from three independent

experiments) are plotted beneath the blots; a-HA

band intensities were normalized against a-BAK1

band intensities from the same samples. Asterisks

indicate statistical significance (*p < 0.05; **p <

0.005; ***p < 0.0001) based on an unpaired

Student’s t test comparing the means to the con-

trol. All experiments were repeated at least three

times with similar results. Refer to Figure S7 for

additional information.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

2006) and degraded by the E3 ubiquitin ligases PUB12 and

PUB13 (Lu et al., 2011). Our results suggest that CPK28-medi-

ated phosphorylation of BIK1 facilitates its turnover, possibly

by influencing its ubiquitination and consequent degradation

via the 26S proteasome (Figure S7F). CPK28-mediated phos-

phorylation may result in the recruitment of a currently unknown

E3 ligase leading to BIK1 degradation. Potential candidates

include PUB22, PUB23, and PUB24, which have been shown

to negatively control PAMP-induced ROS and PTI marker gene

expression in Arabidopsis (Trujillo et al., 2008). Future research

will indicate if this working model is correct.

BIK1 has emerged over the last few years as a key convergent

signaling component downstream of multiple PRRs. Consis-

tently, BIK1 and related proteins are required for signaling medi-

ated by multiple PAMPs and immunity against bacterial and

fungal pathogens (Laluk et al., 2011; Liu et al., 2013; Lu et al.,

2010; Veronese et al., 2006; Zhang et al., 2010). In addition,

BIK1 and related proteins are direct substrates of two unrelated

bacterial effector proteins, the P. syringae cysteine protease

AvrPphB (Zhang et al., 2010) and the Xanthomonas campestris

uridine 50-monophosphate transferase AvrAC (Feng et al.,

2012), illustrating the key role played by BIK1 in immune

signaling. We found that increasing BIK1 levels (either in Col-0/

pBIK1:BIK1-HA or cpk28-1 plants) results in enhanced PTI

signaling, suggesting that BIK1 is rate limiting. Since BIK1

directly activates RBOHD (Kadota et al., 2014; Li et al., 2014),

612 Cell Host & Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc.

reduced BIK1 levels (as observed upon

CPK28 overexpression) would result in

a reduced pool of activated RBOHD

and an impaired ROS burst (Figure 5A).

We therefore propose that by regulating

BIK1 levels, CPK28 buffers immune

signaling to tailor the appropriate ampli-

tude of immune outputs. Future work

will aim to uncover the details surround-

ing the interplay between phosphorylation and ubiquitination in

BIK1 turnover and how this regulation is controlled upon PAMP

perception. Of particular interest will be the identification of

BIK1 residues that are specifically phosphorylated by CPK28

to affect its turnover, in contrast to residues phosphorylated by

the PRR complex that lead to BIK1 activation.

EXPERIMENTAL PROCEDURES

Growth Conditions and Plant Materials

Arabidopsis thaliana plants were grown on soil as one plant per pot in

controlled rooms maintained at 20�C–22�C with a 10 hr photoperiod or as

seedlings on sterile Murashige and Skoog (MS) media supplemented with vi-

tamins and 1% sucrose (Duchefa) in similar rooms with a 16 hr photoperiod.

Assays using soil-grown plants were performed 3 to 4 weeks postgermination

(wpg) prior to reproductive transition, while assays using plate-grown seed-

lingswere performed 2wpg. T-DNA insertionmutants cpk28-1 (GABI_523B08)

and cpk28-3 (WiscDsLox_264D03) were obtained from the European Arabi-

dopsis Stock Centre in Nottingham (NASC) and genotyped to homozygosity

using allele-specific primers. The bak1-5 mutant was previously described

(Schwessinger et al., 2011), as were Col-0/pBIK1:BIK1-HA (Kadota

et al., 2014; Zhang et al., 2010), cpk28-1/35S:CPK28-YFP, and cpk28-1/

35S:CPK28D188A-YFP (Matschi et al., 2013). We generated plants containing

multiple homozygous transgenes through crosses and allele-specific genotyp-

ing in subsequent generations. Agrobacterium tumefaciens strains GV3101-

pMP90 or GV3101-pMP90RK were used for stable and transient plant trans-

formation. Stable lines with single inserts, as indicated by 3:1 segregation on

selection plates in the T2, were carried forward to homozygosity in the T3and used for further analysis. Please refer to the Supplemental Information

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

for details about additional plant lines, genotyping primers, molecular cloning

methods, and transient transformation of N. benthamiana.

Identification of mob Mutants

Bak1-5 seeds were mutagenized with ethyl-methyl sulfonate (Sigma Aldrich).

Roughly 40,000 M2 seeds were surface sterilized and sown on 1% MS agar

plates alongside Col-0 controls (Figure S1A). After stratification for 3 days at

4�C, the plates were transferred to light for 9 days. Seedlings were then

submerged in elicitor solution containing 100 nM flg22, 1 mM of the luminol

derivative L-012 (Wako Chemicals), and 200 mg/ml horseradish peroxidase

(Sigma Aldrich). The ROS burst was qualitatively scored over 45 min using

a charge-coupled device camera fitted to a computer monitor (Photek Ltd.,

East Sussex). Positive seedlings were rinsed with water, transferred to soil,

retested as adult plants, and confirmed in subsequent generations.

Map-Based Cloning and Whole-Genome Sequencing

The bak1-5 mob1 mutant (in Col-0) was crossed to Ler-0. Approximately

1,000 F2 segregants were genotyped for bak1-5 using the Col-0/Ler-0 indel

markers F17M5 and T16L1, which flank the BAK1 locus. Homozygous

bak1-5 segregants were phenotyped for mob1, and linkage analysis was

performed using an array of genome-wide markers designed in-house or by

the Arabidopsis Mapping Platform (Hou et al., 2010). For whole-genome

sequencing, F2 plants from bak1-5 mob1 crossed to bak1-5 were scored

for elf18-induced ROS and seedling inhibition, and positive segregants

were bulked prior to isolation of genomic DNA. The Beijing Genomics Institute

(Hong Kong) prepared Illumina-adapted libraries and sequenced bak1-5

mob1 as well as bak1-5 as a reference using the High-Seq 2000 platform.

We identified unique SNPs in the bak1-5 mob1 genome through comparison

with the reference sequence. Further details are available in the Supplemental

Information.

Bioassays

Peptide sequences for flg22, elf18, and AtPep1 have been previously

described (Felix et al., 1999; Huffaker et al., 2006; Kunze et al., 2004) and

were synthesized by EZBiolab (Indiana). Chitin was purchased from Sigma

Aldrich. PAMP-triggered ROS burst, seedling growth inhibition, MAPK activa-

tion, and pathogen assays were performed as previously described (Schwes-

singer et al., 2011). Minor modifications are outlined in the Supplemental

Information.

Immunoprecipitation and Western Blots

Proteins were extracted from frozen plant tissue in buffer containing 50 mM

Tris-HCl (pH 7.5), 150 mM NaCl, 10% glycerol, 5 mM dithiothreitol, 1% pro-

tease inhibitor cocktail (Sigma Aldrich), 2 mM Na2MoO4, 2.5 mM NaF,

1.5 mM activated Na3VO4, 1 mM phenylmethanesulfonyl fluoride and 1%

Igepal, and normalized using Bradford Reagent (Biorad). The following

beads were used for coIPs as indicated: a-rabbit Trueblot agarose beads

(eBioscience), a-GFP mMACs magnetic beads (Miltenyi Biotec), and GFP-

Trap agarose beads (ChromoTek). After the IP, beads were washed at least

three times in buffer containing 1x TBS, 1% protease inhibitor cocktail

(Sigma Aldrich), and 0.5% Igepal. When indicated, 1% DMSO or 100 mM

MG-132 (Calbiochem) was vacuum infiltrated into leaves 7 hr prior to harvest-

ing. Samples were boiled for 5 min in Laemmli sample buffer (LSB) and sub-

ject to SDS-PAGE and western blot (WB) analysis. WB quantification was

performed using ImageJ software (http://imagej.net/). Please refer to the

Supplemental Information for details about all antibodies used in WBs.

In Vitro Kinase Assays

MBP-BIK1 and MBP-CPK28 variants were expressed and purified from

Escherichia coli strain BL21 using constructs outlined in the Supplemental In-

formation. A total of 2 mg of kinase protein and 2 mg of substrate protein (or sim-

ply 2 mg of kinase protein for autophosphorylation assays) were incubated

together for 30 min with gentle shaking at 30�C in buffer containing 50 mM

Tris-HCl (pH 7.5), 25 mM MnCl2, 5 mM dithiothreitol, 5 mM cold ATP, and

183 KBq radioactive [32P]-g-ATP. Samples were denatured in LSB at 70�Cfor 10 min. Following SDS-PAGE, the proteins were transferred to polyvinyli-

dene difluoride membranes, and incorporation of radioactive ATP was

analyzed using a phosphoimager (Fuji Film FLA-5000).

Cell Host &

Statistical Analyses

Statistically significant groups were determined by Students’ t tests or

one-way ANOVAs, followed by Tukey’s multiple comparison post hoc test

using GraphPad Prism 5.1 (http://www.graphpad.com/scientific-software/

prism/).

SUPPLEMENTAL INFORMATION

Supplemental Information includes seven figures and Supplemental Experi-

mental Procedures and can be found with this article online at http://dx.doi.

org/10.1016/j.chom.2014.10.007.

ACKNOWLEDGMENTS

We thank Vardis Ntoukakis and Yasuhiro Kadota for critically reading the

manuscript and all members of the Zipfel laboratory for helpful discussions,

invaluable advice, and technical knowledge. We thank Matthew Smoker and

Jodie Pike for creating transgenic lines and the JIC horticultural staff for

growing plants and maintaining growth facilities. This research was funded

by grants from The Gatsby Foundation and The European Research Council

to C.Z., TheGermanResearch Foundation to T.R., and TheGatsby Foundation

and the UK Biotechnology and Biological Sciences Research Council (grant

BB/E017134/1) to J.P.R. and C.Z. J.M. was the recipient of a Long-Term

Fellowship from the European Molecular Biology Organization, O.S. is part

of the JIC/TSL Rotation PhD Programme, H.R. was funded by an Erasmus

Mundus Scholarship, and A.M. was funded by an Erasmus-SMP grant from

the German Academic Exchange Service.

Received: May 17, 2014

Revised: August 11, 2014

Accepted: September 11, 2014

Published: November 12, 2014

REFERENCES

Benschop, J.J., Mohammed, S., O’Flaherty, M., Heck, A.J., Slijper, M., and

Menke, F.L. (2007). Quantitative phosphoproteomics of early elicitor signaling

in Arabidopsis. Mol. Cell. Proteomics 6, 1198–1214.

Bohm, H., Albert, I., Fan, L., Reinhard, A., and Nurnberger, T. (2014). Immune

receptor complexes at the plant cell surface. Curr. Opin. Plant Biol. 20, 47–54.

Boudsocq, M., and Sheen, J. (2013). CDPKs in immune and stress signaling.

Trends Plant Sci. 18, 30–40.

Boudsocq, M., Willmann, M.R., McCormack, M., Lee, H., Shan, L., He, P.,

Bush, J., Cheng, S.H., and Sheen, J. (2010). Differential innate immune signal-

ling via Ca(2+) sensor protein kinases. Nature 464, 418–422.

Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T., Jones,

J.D., Felix, G., andBoller, T. (2007). A flagellin-induced complex of the receptor

FLS2 and BAK1 initiates plant defence. Nature 448, 497–500.

Dangl, J.L., Horvath, D.M., and Staskawicz, B.J. (2013). Pivoting the plant

immune system from dissection to deployment. Science 341, 746–751.

Dodds, P.N., and Rathjen, J.P. (2010). Plant immunity: towards an integrated

view of plant-pathogen interactions. Nat. Rev. Genet. 11, 539–548.

Dubiella, U., Seybold, H., Durian, G., Komander, E., Lassig, R., Witte, C.P.,

Schulze, W.X., and Romeis, T. (2013). Calcium-dependent protein kinase/

NADPH oxidase activation circuit is required for rapid defense signal propaga-

tion. Proc. Natl. Acad. Sci. USA 110, 8744–8749.

Felix, G., Duran, J.D., Volko, S., and Boller, T. (1999). Plants have a sensitive

perception system for the most conserved domain of bacterial flagellin.

Plant J. 18, 265–276.

Feng, F., Yang, F., Rong, W., Wu, X., Zhang, J., Chen, S., He, C., and Zhou,

J.M. (2012). A Xanthomonas uridine 50-monophosphate transferase inhibits

plant immune kinases. Nature 485, 114–118.

Gao, X., Chen, X., Lin, W., Chen, S., Lu, D., Niu, Y., Li, L., Cheng, C.,

McCormack, M., Sheen, J., et al. (2013). Bifurcation of Arabidopsis NLR

immune signaling via Ca2+-dependent protein kinases. PLoS Pathog. 9,

e1003127.

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 613

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

Gimenez-Ibanez, S., Hann, D.R., Ntoukakis, V., Petutschnig, E., Lipka, V., and

Rathjen, J.P. (2009). AvrPtoB targets the LysM receptor kinase CERK1 to pro-

mote bacterial virulence on plants. Curr. Biol. 19, 423–429.

Gomez-Gomez, L., and Boller, T. (2000). FLS2: an LRR receptor-like kinase

involved in the perception of the bacterial elicitor flagellin in Arabidopsis.

Mol. Cell 5, 1003–1011.

Gomez-Gomez, L., Felix, G., and Boller, T. (1999). A single locus determines

sensitivity to bacterial flagellin in Arabidopsis thaliana. Plant J. 18, 277–284.

Halter, T., Imkampe, J., Mazzotta, S., Wierzba, M., Postel, S., Bucherl, C.,

Kiefer, C., Stahl, M., Chinchilla, D., Wang, X., et al. (2014). The leucine-rich

repeat receptor kinase BIR2 is a negative regulator of BAK1 in plant immunity.

Curr. Biol. 24, 134–143.

Hamel, L.P., Sheen, J., and Seguin, A. (2014). Ancient signals: comparative

genomics of green plant CDPKs. Trends Plant Sci. 19, 79–89.

Harper, J.F., Breton, G., and Harmon, A. (2004). Decoding Ca(2+) signals

through plant protein kinases. Annu. Rev. Plant Biol. 55, 263–288.

Heese, A., Hann, D.R., Gimenez-Ibanez, S., Jones, A.M., He, K., Li, J.,

Schroeder, J.I., Peck, S.C., and Rathjen, J.P. (2007). The receptor-like kinase

SERK3/BAK1 is a central regulator of innate immunity in plants. Proc. Natl.

Acad. Sci. USA 104, 12217–12222.

Heinrich, M., Hettenhausen, C., Lange, T., Wunsche, H., Fang, J., Baldwin, I.T.,

and Wu, J. (2013). High levels of jasmonic acid antagonize the biosynthesis

of gibberellins and inhibit the growth of Nicotiana attenuata stems. Plant J.

73, 591–606.

Hou, X., Li, L., Peng, Z., Wei, B., Tang, S., Ding, M., Liu, J., Zhang, F., Zhao, Y.,

Gu, H., and Qu, L.J. (2010). A platform of high-density INDEL/CAPS markers

for map-based cloning in Arabidopsis. Plant J. 63, 880–888.

Hrabak, E.M., Chan, C.W., Gribskov, M., Harper, J.F., Choi, J.H., Halford, N.,

Kudla, J., Luan, S., Nimmo, H.G., Sussman, M.R., et al. (2003). The

Arabidopsis CDPK-SnRK superfamily of protein kinases. Plant Physiol. 132,

666–680.

Huffaker, A., Pearce, G., and Ryan, C.A. (2006). An endogenous peptide signal

in Arabidopsis activates components of the innate immune response. Proc.

Natl. Acad. Sci. USA 103, 10098–10103.

Ivashuta, S., Liu, J., Liu, J., Lohar, D.P., Haridas, S., Bucciarelli, B.,

VandenBosch, K.A., Vance, C.P., Harrison, M.J., and Gantt, J.S. (2005).

RNA interference identifies a calcium-dependent protein kinase involved in

Medicago truncatula root development. Plant Cell 17, 2911–2921.

Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V.,

Jones, J.D., Shirasu, K., Menke, F., Jones, A., and Zipfel, C. (2014). Direct

regulation of the NADPH oxidase RBOHD by the PRR-associated kinase

BIK1 during plant immunity. Mol. Cell 54, 43–55.

Kondo, T., Kawai, T., and Akira, S. (2012). Dissecting negative regulation of

Toll-like receptor signaling. Trends Immunol. 33, 449–458.

Krol, E., Mentzel, T., Chinchilla, D., Boller, T., Felix, G., Kemmerling, B., Postel,

S., Arents, M., Jeworutzki, E., Al-Rasheid, K.A., et al. (2010). Perception of the

Arabidopsis danger signal peptide 1 involves the pattern recognition receptor

AtPEPR1 and its close homologue AtPEPR2. J. Biol. Chem. 285, 13471–

13479.

Kunze, G., Zipfel, C., Robatzek, S., Niehaus, K., Boller, T., and Felix, G. (2004).

The N terminus of bacterial elongation factor Tu elicits innate immunity in

Arabidopsis plants. Plant Cell 16, 3496–3507.

Laluk, K., Luo, H., Chai, M., Dhawan, R., Lai, Z., and Mengiste, T. (2011).

Biochemical and genetic requirements for function of the immune response

regulator BOTRYTIS-INDUCED KINASE1 in plant growth, ethylene signaling,

and PAMP-triggered immunity in Arabidopsis. Plant Cell 23, 2831–2849.

Lemmon, M.A., and Schlessinger, J. (2010). Cell signaling by receptor tyrosine

kinases. Cell 141, 1117–1134.

Li, L., Li, M., Yu, L., Zhou, Z., Liang, X., Liu, Z., Cai, G., Gao, L., Zhang, X.,

Wang, Y., et al. (2014). The FLS2-associated kinase BIK1 directly phosphory-

lates the NADPH oxidase RbohD to control plant immunity. Cell Host Microbe

15, 329–338.

Liebrand, T.W., van den Burg, H.A., and Joosten, M.H. (2014). Two for all: re-

ceptor-associated kinases SOBIR1 and BAK1. Trends Plant Sci. 19, 123–132.

614 Cell Host & Microbe 16, 605–615, November 12, 2014 ª2014 Els

Liese, A., and Romeis, T. (2013). Biochemical regulation of in vivo function

of plant calcium-dependent protein kinases (CDPK). Biochim. Biophys. Acta

1833, 1582–1589.

Lin, W., Ma, X., Shan, L., and He, P. (2013). Big roles of small kinases: the com-

plex functions of receptor-like cytoplasmic kinases in plant immunity and

development. J. Integr. Plant Biol. 55, 1188–1197.

Lin, W., Li, B., Lu, D., Chen, S., Zhu, N., He, P., and Shan, L. (2014). Tyrosine

phosphorylation of protein kinase complex BAK1/BIK1 mediates Arabidopsis

innate immunity. Proc. Natl. Acad. Sci. USA 111, 3632–3637.

Liu, T., Liu, Z., Song, C., Hu, Y., Han, Z., She, J., Fan, F., Wang, J., Jin, C.,

Chang, J., et al. (2012). Chitin-induced dimerization activates a plant immune

receptor. Science 336, 1160–1164.

Liu, Z., Wu, Y., Yang, F., Zhang, Y., Chen, S., Xie, Q., Tian, X., and Zhou, J.M.

(2013). BIK1 interacts with PEPRs to mediate ethylene-induced immunity.

Proc. Natl. Acad. Sci. USA 110, 6205–6210.

Lu, D., Wu, S., Gao, X., Zhang, Y., Shan, L., and He, P. (2010). A receptor-like

cytoplasmic kinase, BIK1, associates with a flagellin receptor complex to

initiate plant innate immunity. Proc. Natl. Acad. Sci. USA 107, 496–501.

Lu, D., Lin,W., Gao, X.,Wu, S., Cheng, C., Avila, J., Heese, A., Devarenne, T.P.,

He, P., and Shan, L. (2011). Direct ubiquitination of pattern recognition recep-

tor FLS2 attenuates plant innate immunity. Science 332, 1439–1442.

Macho, A.P., and Zipfel, C. (2014). Plant PRRs and the activation of innate

immune signaling. Mol. Cell 54, 263–272.

Matschi, S., Werner, S., Schulze, W.X., Legen, J., Hilger, H.H., and Romeis, T.

(2013). Function of calcium-dependent protein kinase CPK28 of Arabidopsis

thaliana in plant stem elongation and vascular development. Plant J. 73,

883–896.

Miya, A., Albert, P., Shinya, T., Desaki, Y., Ichimura, K., Shirasu, K., Narusaka,

Y., Kawakami, N., Kaku, H., and Shibuya, N. (2007). CERK1, a LysM receptor

kinase, is essential for chitin elicitor signaling in Arabidopsis. Proc. Natl. Acad.

Sci. USA 104, 19613–19618.

Nelson, C.J., Li, L., and Millar, A.H. (2014). Quantitative analysis of protein

turnover in plants. Proteomics 14, 579–592.

Nuhse, T.S., Bottrill, A.R., Jones, A.M., and Peck, S.C. (2007). Quantitative

phosphoproteomic analysis of plasma membrane proteins reveals regulatory

mechanisms of plant innate immune responses. Plant J. 51, 931–940.

Postel, S., Kufner, I., Beuter, C., Mazzotta, S., Schwedt, A., Borlotti, A., Halter,

T., Kemmerling, B., and Nurnberger, T. (2010). The multifunctional leucine-rich

repeat receptor kinase BAK1 is implicated in Arabidopsis development and

immunity. Eur. J. Cell Biol. 89, 169–174.

Ranf, S., Eschen-Lippold, L., Pecher, P., Lee, J., and Scheel, D. (2011).

Interplay between calcium signalling and early signalling elements during

defence responses to microbe- or damage-associated molecular patterns.

Plant J. 68, 100–113.

Robatzek, S., Chinchilla, D., and Boller, T. (2006). Ligand-induced endocytosis

of the pattern recognition receptor FLS2 in Arabidopsis. Genes Dev. 20,

537–542.

Rock, K.L., Gramm, C., Rothstein, L., Clark, K., Stein, R., Dick, L., Hwang, D.,

and Goldberg, A.L. (1994). Inhibitors of the proteasome block the degradation

of most cell proteins and the generation of peptides presented on MHC class I

molecules. Cell 78, 761–771.

Romeis, T., and Herde, M. (2014). From local to global: CDPKs in systemic

defense signaling upon microbial and herbivore attack. Curr. Opin. Plant

Biol. 20, 1–10.

Roux, M., Schwessinger, B., Albrecht, C., Chinchilla, D., Jones, A., Holton, N.,

Malinovsky, F.G., Tor, M., de Vries, S., and Zipfel, C. (2011). The Arabidopsis

leucine-rich repeat receptor-like kinases BAK1/SERK3 and BKK1/SERK4 are

required for innate immunity to hemibiotrophic and biotrophic pathogens.

Plant Cell 23, 2440–2455.

Sasai, M., and Yamamoto, M. (2013). Pathogen recognition receptors: ligands

and signaling pathways by Toll-like receptors. Int. Rev. Immunol. 32, 116–133.

Schmid, M., Davison, T.S., Henz, S.R., Pape, U.J., Demar, M., Vingron, M.,

Scholkopf, B., Weigel, D., and Lohmann, J.U. (2005). A gene expression

map of Arabidopsis thaliana development. Nat. Genet. 37, 501–506.

evier Inc.

Cell Host & Microbe

CPK28 Buffers BIK1-Mediated Plant Immunity

Schulze, B., Mentzel, T., Jehle, A.K., Mueller, K., Beeler, S., Boller, T., Felix, G.,

and Chinchilla, D. (2010). Rapid heteromerization and phosphorylation of

ligand-activated plant transmembrane receptors and their associated kinase

BAK1. J. Biol. Chem. 285, 9444–9451.

Schwessinger, B., Roux, M., Kadota, Y., Ntoukakis, V., Sklenar, J., Jones, A.,

and Zipfel, C. (2011). Phosphorylation-dependent differential regulation of

plant growth, cell death, and innate immunity by the regulatory receptor-like

kinase BAK1. PLoS Genet. 7, e1002046.

Scott, J.D., and Pawson, T. (2009). Cell signaling in space and time: where pro-

teins come together and when they’re apart. Science 326, 1220–1224.

Segonzac, C., Feike, D., Gimenez-Ibanez, S., Hann, D.R., Zipfel, C., and

Rathjen, J.P. (2011). Hierarchy and roles of pathogen-associated molecular

pattern-induced responses in Nicotiana benthamiana. Plant Physiol. 156,

687–699.

Segonzac, C., Macho, A.P., Sanmartın, M., Ntoukakis, V., Sanchez-Serrano,

J.J., and Zipfel, C. (2014). Negative control of BAK1 by protein phosphatase

2A during plant innate immunity. EMBO J. 33, 2069–2079.

Shan, L., He, P., Li, J., Heese, A., Peck, S.C., Nurnberger, T., Martin, G.B., and

Sheen, J. (2008). Bacterial effectors target the common signaling partner

BAK1 to disrupt multiple MAMP receptor-signaling complexes and impede

plant immunity. Cell Host Microbe 4, 17–27.

Shi, H., Shen, Q., Qi, Y., Yan, H., Nie, H., Chen, Y., Zhao, T., Katagiri, F., and

Tang, D. (2013). BR-SIGNALING KINASE1 physically associates with

FLAGELLIN SENSING2 and regulates plant innate immunity in Arabidopsis.

Plant Cell 25, 1143–1157.

Shinya, T., Yamaguchi, K., Desaki, Y., Yamada, K., Narisawa, T., Kobayashi,

Y., Maeda, K., Suzuki, M., Tanimoto, T., Takeda, J., et al. (2014). Selective

regulation of the chitin-induced defense response by the Arabidopsis recep-

tor-like cytoplasmic kinase PBL27. Plant J. 79, 56–66, http://dx.doi.org/10.

1111/tpj.12535.

Sun, Y., Li, L., Macho, A.P., Han, Z., Hu, Z., Zipfel, C., Zhou, J.M., and Chai, J.

(2013). Structural basis for flg22-induced activation of the Arabidopsis FLS2-

BAK1 immune complex. Science 342, 624–628.

Tena, G., Boudsocq, M., and Sheen, J. (2011). Protein kinase signaling net-

works in plant innate immunity. Curr. Opin. Plant Biol. 14, 519–529.

Torres, M.A., Dangl, J.L., and Jones, J.D. (2002). Arabidopsis gp91phox

homologues AtrbohD and AtrbohF are required for accumulation of reactive

oxygen intermediates in the plant defense response. Proc. Natl. Acad. Sci.

USA 99, 517–522.

Trujillo, M., Ichimura, K., Casais, C., and Shirasu, K. (2008). Negative regulation

of PAMP-triggered immunity by an E3 ubiquitin ligase triplet in Arabidopsis.

Curr. Biol. 18, 1396–1401.

Veronese, P., Nakagami, H., Bluhm, B., Abuqamar, S., Chen, X., Salmeron, J.,

Dietrich, R.A., Hirt, H., and Mengiste, T. (2006). The membrane-anchored

Cell Host &

BOTRYTIS-INDUCED KINASE1 plays distinct roles in Arabidopsis resistance

to necrotrophic and biotrophic pathogens. Plant Cell 18, 257–273.

Wan, J., Zhang, X.C., Neece, D., Ramonell, K.M., Clough, S., Kim, S.Y.,

Stacey, M.G., and Stacey, G. (2008). A LysM receptor-like kinase plays a crit-

ical role in chitin signaling and fungal resistance in Arabidopsis. Plant Cell 20,

471–481.

Winter, D., Vinegar, B., Nahal, H., Ammar, R., Wilson, G.V., and Provart, N.J.

(2007). An ‘‘Electronic Fluorescent Pictograph’’ browser for exploring and

analyzing large-scale biological data sets. PLoS ONE 2, e718.

Wu, Y., and Zhou, J.M. (2013). Receptor-like kinases in plant innate immunity.

J. Integr. Plant Biol. 55, 1271–1286.

Xu, J., Wei, X., Yan, L., Liu, D., Ma, Y., Guo, Y., Peng, C., Zhou, H., Yang, C.,

Lou, Z., and Shui, W. (2013). Identification and functional analysis of phosphor-

ylation residues of the Arabidopsis BOTRYTIS-INDUCED KINASE1. Protein

Cell 4, 771–781.

Xu, J., Xie, J., Yan, C., Zou, X., Ren, D., and Zhang, S. (2014). A chemical

genetic approach demonstrates that MPK3/MPK6 activation and NADPH

oxidase-mediated oxidative burst are two independent signaling events in

plant immunity. Plant J. 77, 222–234.

Yamaguchi, Y., Pearce, G., and Ryan, C.A. (2006). The cell surface leucine-rich

repeat receptor for AtPep1, an endogenous peptide elicitor in Arabidopsis, is

functional in transgenic tobacco cells. Proc. Natl. Acad. Sci. USA 103, 10104–

10109.

Yamaguchi, Y., Huffaker, A., Bryan, A.C., Tax, F.E., and Ryan, C.A. (2010).

PEPR2 is a second receptor for the Pep1 and Pep2 peptides and contributes

to defense responses in Arabidopsis. Plant Cell 22, 508–522.

Yang, D.H., Hettenhausen, C., Baldwin, I.T., and Wu, J. (2012). Silencing

Nicotiana attenuata calcium-dependent protein kinases, CDPK4 and

CDPK5, strongly up-regulates wound- and herbivory-induced jasmonic acid

accumulations. Plant Physiol. 159, 1591–1607.

Zhang, J., Shao, F., Li, Y., Cui, H., Chen, L., Li, H., Zou, Y., Long, C., Lan, L.,

Chai, J., et al. (2007). A Pseudomonas syringae effector inactivates MAPKs

to suppress PAMP-induced immunity in plants. Cell Host Microbe 1, 175–185.

Zhang, J., Li, W., Xiang, T., Liu, Z., Laluk, K., Ding, X., Zou, Y., Gao, M., Zhang,

X., Chen, S., et al. (2010). Receptor-like cytoplasmic kinases integrate

signaling from multiple plant immune receptors and are targeted by a

Pseudomonas syringae effector. Cell Host Microbe 7, 290–301.

Zipfel, C. (2014). Plant pattern-recognition receptors. Trends Immunol. 35,

345–351.

Zipfel, C., Kunze, G., Chinchilla, D., Caniard, A., Jones, J.D., Boller, T., and

Felix, G. (2006). Perception of the bacterial PAMP EF-Tu by the receptor

EFR restricts Agrobacterium-mediated transformation. Cell 125, 749–760.

Microbe 16, 605–615, November 12, 2014 ª2014 Elsevier Inc. 615

Cell Host & Microbe, Volume 16

Supplemental Information

The Calcium-Dependent Protein

Kinase CPK28 Buffers Plant Immunity

and Regulates BIK1 Turnover

Jacqueline Monaghan, Susanne Matschi, Oluwaseyi Shorinola, Hanna Rovenich, Alexandra Matei, Cécile Segonzac, Frederikke Gro Malinovsky, John P. Rathjen, Dan MacLean, Tina Romeis, and Cyril Zipfel

B

A C

~40,000 M2 seeds sown on agar plates

M1 generation bulked in small pools

EMS-mutagenesis of bak1-5

9-day-old seedlings submerged in

flg22 elicitor solution and ROS

measured with a CCD camera

900+ mutants with regained ROS

transferred to soil and grown for 3 weeks

flg22- and elf18-induced ROS measured

in 2 leaf discs from each mutant

M3 progeny of 100+ mutants harvested

1º Screen

flg22-, elf18- and AtPep1-triggered ROS

measured in M3 generation

2º Screen

3º Screen

10 mob mutants taken for further study

a

b

a

a

a a

b b

b

flg22

elf18

AtPep1

D

flg22

elf18

AtPep1

Figure S1 (Related to Figure 1): The modifier of bak1-5 screen and characterization of bak1-5

mob2.

(A) Outline of the mob screen. (B) ROS assay following treatment with 100 nM flg22, 100 nM elf18, or

1 μM AtPep1. Values are means ± standard deviation (n=8). (C) Seedling inhibition assay after growth

in media containing 1 μM flg22, 1 μM elf18 , or 1 μM AtPep1 normalized against growth in control

media. Relative values are means + standard deviation (n=6). Significantly different groups (p <

0.0001) are indicated with lower-case letters based on one-way ANOVA analysis and Tukey’s multiple

comparison post-test. (D) Seedling growth in control media or media containing 1 μM AtPep1. The

bak1-5 mob1 x bak1-5 mob2 cross was repeated once and the F2 was similarly tested. All other

experiments were repeated at least three times with similar results.

water

A

B

D

AtPep1

b

a a a a

C

E

G

F

Figure S2 (Related to Figure 3): Loss of CPK28 results in enhanced PTI signaling.

(A) Gene structure of CPK28/At5g66210 showing the positions of exons (boxes), introns (lines), T-

DNA insertion alleles, and mob mutations. (B) Seedling inhibition in media containing 1 μM AtPep1.

Relative values are means + standard deviation (n=10). Significantly different groups (p < 0.0001) are

indicated with lower-case letters based on one-way ANOVA analysis and Tukey’s multiple

comparison post-test. (C) Rosette morphology and shoot elongation in the indicated genotypes at 22,

35, and 47 days after germination under long-day (LD) conditions (16 h light/ 8 h dark), as well as 40

days under short-day (SD) conditions (10 h light/14 h dark). (D) Basal ROS assay using water. Values

are means ± standard deviation (n=8). (E) Western blot (WB) using α-p42/p44-erk against

phosphorylated MPK6, MPK3, and MPK4/11 over a time-course following treatment with 100 nM

flg22, 100 nM elf18, 1 μM AtPep1 or 100 μg/mL chitin. Membranes were stained with CBB as a

loading control. (F) Co-immunoprecipitation (IP) assay between FLS2 and BAK1 before and after

treatment with 200 nM flg22 for 10 minutes. WB analysis using the native antibodies α-FLS2 and α-

BAK1 on total protein extracts (‘input’) and on eluted proteins after IP with α-BAK1/Trueblot. (G)

Quantitative real-time RT-PCR analysis of FLS2, EFR, CERK1, BAK1, BIK1, and RBOHD expression

in the indicated genotypes. Values are means + standard deviation (n=3), relative to ACTIN2.

CPK16 (At2g17890)

CPK18 (At4g36070)

CPK28 (At5g66210)

CPK subgroup IVA

B

C

D elf18 AtPep1

b b

a a a ac a

a a a ac a

Figure S3 (Related to Figure 3): Analysis of Arabidopsis CDPK sub-group IV.

(A) CPK28 is closely related to CPK16 and CPK18. The tree is based on ones generated in

(Boudsocq and Sheen, 2012; Hamel et al., 2014) and shown here for illustrative purposes only. (B)

Expression values of CPK16, CPK18, and CPK28 in different Arabidopsis tissue types based on

publically available microarray data, accessed through eFP browser (Winter et al., 2007). (C) Gene

structure of CPK16/At2g17890 and CPK18/At4g36070 showing the positions of exons (boxes),

introns (lines) and T-DNA insertion alleles (triangles). (D) ROS assay following treatment with 100 nM

elf18 or 1 μM AtPep1. Values represent means of total photon counts over 60 minutes + standard

deviation (n=8). Significantly different groups (p < 0.05) are indicated with lower-case letters based on

one-way ANOVA analysis and Tukey’s multiple comparison post-test. This assay was repeated twice

with similar results.

A

B

a

b

a

c b

b

a a

c bc

AtPep1

elf18

AtPep1

C D

elf18

AtPep1

b

b

b

b

a a

a a

a

a a

c

Figure S4 (Related to Figure 4): CPK28 kinase activity is necessary and sufficient for its

function in PAMP signaling.

(A) WB analysis using α-GFP on total protein extracts from the transgenic lines analysed in Fig 4C

and Fig S4B indicate similar accumulation of wild-type and mutant variants. All constructs are driven

by 35S and C-terminally tagged with YFP (‘35S-CPK28-YFP’) with the indicated mutations.

Membranes were stained with CBB as a loading control. (B) ROS assay following treatment with 1 μM

AtPep1 in Col-0 and cpk28-1 compared to transgenic lines generated in cpk28-1. All constructs are

driven by 35S and C-terminally tagged with YFP (‘35S-CPK28-YFP’) with the indicated mutations.

Values represent means of total photon counts over 60 minutes + standard deviation (n=8). (C)

Seedling inhibition in media containing 100 nM elf18 or 1 μM AtPep1 in Col-0 and cpk28-1 compared

to a homozygous cpk28-1/35S:CPK28VK-YFP transgenic line. Relative values are means + standard

deviation (n=8). (D) ROS assay following treatment with 100 nM elf18 or 1 μM AtPep1. Values

represent means of total photon counts over 60 minutes + standard deviation (n=8). Significantly

different groups (p < 0.05) are indicated with lower-case letters based on one-way ANOVA analysis

and Tukey’s multiple comparison post-test. These assays were repeated three times with similar

results.

A

B

D

*** ***

C

FRK1 At1g51890 NHL10

E

F

G

*** n.s. *

Figure S5 (Related to Figure 5): Characterization of CPK28-OE lines.

(A) CPK28 expression is strongly enhanced in both CPK28-OE1 and CPK28-OE4, as indicated by

quantitative real-time PCR. Values are means + standard deviation (n=3), relative to ACTIN2.

Asterisks indicate statistical significance (*** p < 0.0001) determined by Student’s t-test compared to

Col-0. (B) Rosette morphology and shoot elongation in the indicated genotypes at 22, 35, and 47 days

after germination under long-day (LD) conditions (16 h light/ 8 h dark). (C) Western blot (WB) using α-

p42/p44-erk against phosphorylated MPK6, MPK3, and MPK4/11 before and after 10 minutes

treatment with 100 nM flg22, 100 nM elf18, 1 μM AtPep1 or 100 μg/mL chitin. Membranes were

stained with CBB as a loading control. (D) Quantitative real-time RT-PCR of FRK1, At1g51890 and

NHL10 after treatment with 100 nM elf18 in the indicated genotypes. Values are means + standard

deviation (n=3), relative to U-BOX. (E) Co-immunoprecipitation (IP) assay of FLS2-BAK1 complex

formation after treatment with 200 nM flg22 for 10 minutes. WB analysis using the native antibodies α-

FLS2 and α-BAK1 on total protein extracts (‘input’) and on eluted proteins after IP with α-

BAK1/Trueblot agarose beads. (F) Quantitative real-time RT-PCR of FLS2, EFR, CERK1, BAK1,

BIK1, and RBOHD expression in the indicated genotypes. Values are means + standard deviation

(n=3), relative to ACTIN2. (G) Stomatal aperture measurements in the indicated genotypes after

treatment with 5 μM flg22 for 1 hr. Values represent means + standard deviation (n=15-30 stomata).

Asterisks indicate statistical significance (*** p < 0.0001, * p < 0.01, n.s. is not significant) determined

by Student’s t-test comparing the mock and flg22 treatments. All experiments were repeated at least

three times with similar results.

A

C

B

D E

Figure S6 (Related to Figure 6): CPK28 localizes to the plasma membrane and associates with

BIK1 and RBOHD.

(A) Confocal microscopy of cells from cpk28-1/35S:CPK28-YFP plants in isotonic (water) and

hypertonic (2.5% NaCl) conditions. Arrows indicate CPK28-YFP signal at the detaching membrane

due to plasmolysis. (B) Confocal microscopy of N. benthamiana leaves co-expressing free mCherry

with 35S:CPK28-YFP or 35S:CPK28G2A-YFP. Arrows indicate cytoplasmic streaming. (C) Co-

immunoprecipiation (co-IP) assay showing that CPK28-YFP and BIK1-HA associate in Nicotiana

benthamiana, irrespective of treatment with 200 nM flg22 for 10 minutes. Western blot (WB) analysis

using α-GFP and α-HA on total protein extracts (‘input’) and on eluted proteins after IP with α-GFP

magnetic beads. (D) WB analysis using α-FLS2, α-BAK1 and α-GFP on total protein extracts (‘input’)

and on eluted proteins after IP with either GFP-Trap beads or α-BAK1/Trueblot beads from cpk28-

1/35S:CPK28-YFP transgenic plants. (E) Co-IP assay showing that CPK28-YFP and FLAG-RBOHD

associate in N. benthamiana, irrespective of treatment with 200 nM flg22 for 10 minutes. WB analysis

using α-GFP and α-FLAG on total protein extracts (‘input’) and on eluted proteins after IP with α-GFP

magnetic beads. All experiments were repeated three times with similar results.

a a

b

b

A B

a

a

BIK1

BIK1

AtPep1

AtPep1

C D E

F

Col-0

CPK28-OE1

Col-0/pBIK1:BIK1-HA

CPK28-OE1/pBIK1:BIK1-HA

Col-0

cpk28-1

Col-0/pBIK1:BIK1-HA

cpk28-1/pBIK1:BIK1-HA

Figure S7 (Related to Figure 7): BIK1 accumulation is regulated by CPK28 and the 26S

proteasome.

(A) BIK1 expression as demonstrated by quantitative real-time RT-PCR. Values are means +

standard deviation (n=3), relative to U-BOX. (B) ROS assay following treatment with 1 μM AtPep1.

Values are means ± standard deviation (n=8). (C) Western blot (WB) of BIK1-HA after 8 hours

treatment with 1% DMSO (-) or 100 µM MG-132 (+). Black arrows indicate typical BIK1-HA migration

and grey arrows mark laddering indicative of poly-ubiquitination. The lower blot is a short exposure

similar to what is shown in Figure 7C and the upper blot is a long exposure from the same membrane.

CBB staining is included as a loading control. (D) ROS assay following treatment with 1 μM AtPep1.

Values are means ± standard deviation (n=8). (E) BIK1 expression as demonstrated by quantitative

real-time RT-PCR. Values are means + standard deviation (n=3), relative to U-BOX. Significantly

different groups (p < 0.0001) are indicated with lower-case letters based on one-way ANOVA analysis

and Tukey’s multiple comparison post-test. All experiments were repeated three times with similar

results. (F) Conceptual model illustrating that CPK28 negatively regulates PAMP signaling and

contributes to BIK1 turnover. Our data suggest that a currently unknown E3 ligase mediates BIK1

ubiquitination and continual degradation to ensure optimal immune outputs. We propose that CPK28

may have additional, currently unknown, targets.

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Genetic analysis

To determine heritance, bak1-5 mob1 and bak1-5 mob2 were back-crossed to bak1-

5. Segregating F2 plants were scored based on elf18-induced ROS or seedling

inhibition. Both mutations were found to be recessive, as 23% and 17% of the F2

populations, respectively, contained plants with the mob phenotype. All assays in

Figures 1, 2 and S1 were conducted using F3 generation backcrossed bak1-5 mob1

or bak1-5 mob2 plants. Allelism was determined by crossing bak1-5 mob1 with bak1-

5 mob2 and analysing the F1 for non-complementation, and further confirmed

through an independent cross.

Whole-genome sequencing

222 F2 plants from the cross bak1-5 mob1 with bak1-5 were scored for elf18-induced

ROS. 51 plants with increased ROS were identified and confirmed in the F3

generation to restore elf18-ROS and elf18-seedling inhibition. 5 seedlings from each

of the positive F3 parents were bulked and ground to a fine powder in liquid nitrogen.

Tissues were equilibrated in buffer containing 50 mM Tris-HCl (pH 8.0), 200 mM

NaCl, 2 mM EDTA for 30 min at 37°C with occasional mixing, and for a further 20 min

at 37°C with 0.2 mg/mL RNAse. Roughly 10 ng of genomic DNA was then extracted

using a standard chloroform/phenol method and re-suspended in 1x TE. Illumina

sequencing of the bak1-5 mob1 genome sequence resulted in 43.96 million 90 bp

paired-end reads with a mean insert size of 350 bp; > 98.8% of reads aligned to the

TAIR10 Arabidopsis reference sequence. Average coverage over the nuclear

chromosomes was 49.53. Paired-end reads were aligned to the TAIR10 reference

assembly using BWA v 0.6.1 with default settings (Li and Durbin, 2009). BAM files

were generated using SAMTools v 0.1.8 (Li et al., 2009) and SNPs were called using

the mpileup command. Reads with mapping quality scores less than 20 and

individual bases with sequence quality less than 20 were ignored. Positions

considered for single nucleotide polymorphisms (SNPs) must have had a minimum

coverage of 6 and a maximum of 250. SNPs called at positions where the reference

base was unknown were excluded. Resulting pileup files contained a list of SNPs

and their genomic positions; comparing these to SNPs identified in the bak1-5

control, we were able to identify SNPs unique to bak1-5 mob1. These SNPs were

confirmed in the original bak1-5 mob1 mutant and in backcrossed lines by Sanger

sequencing of PCR amplicons. We then Sanger sequenced the three candidate

genes in the allelic mutant bak1-5 mob2. All primer sequences are listed below.

Molecular cloning

A Gateway-compatible genomic CPK28 fragment containing the entire intergenic

sequence (285 bp) upstream of the translational start codon and including the

endogenous stop codon was amplified from Arabidopsis Col-0 genomic DNA using

Phusion Taq polymerase (New England Biolabs) and cloned into pENTR using the

D/Topo kit (Invitrogen). Additional CPK28 pENTR clones were engineered for

translational fusions using products amplified from Col-0 cDNA containing the

endogenous start codon and with or without the endogenous stop codon. Cauliflower

Mosaic Virus (CaMV) 35S promoter-driven C-terminally tagged yellow fluorescent

protein (YFP) fusions were created after recombination by LR Clonase II (Invitrogen)

into the pXCSG-YFP vector (Matschi et al., 2013). PCR-based site-directed

mutagenesis of CPK28 was achieved though overlapping primers containing the

desired point mutation(s). Primer sequences are listed below. All clones were verified

by Sanger sequencing. BIK1 entry clones were obtained from Jian-Min Zhou,

previously described in (Zhang et al., 2010). 35S promoter-driven BIK1 constructs C-

terminally tagged with 3x hemagglutinin (HA) were generated after recombination by

LR Clonase II (Invitrogen) into the pGWB14 vector (Nakagawa et al., 2007).

35S:FLAG-RBOHD constructs were previously described (Kadota et al., 2014). In-

Fusion (Clontech) compatible fragments were amplified using Phusion Taq

polymerase (New England Biolabs) from entry vectors and cloned into pOPIN-M

(Berrow et al., 2007) to create N-terminal maltose-binding protein (MBP) fusions for

expression in E. coli strain BL21, as previously described (Kadota et al., 2014).

Supplemental plant materials

T-DNA insertion mutants cpk16-1 (Salk_052257), cpk16-2 (Salk_020716), cpk28-1

(Salk_061352) and cpk18-2 (GABI_071G03) were obtained from the European

Arabidopsis Stock Centre in Nottingham, UK (NASC) and genotyped to

homozygosity using allele-specific primers listed below.

Oxidative burst

Eight leaf discs (4 mm diameter) per genotype were collected in 96-well plates and

allowed to recover overnight in sterile water. The water was then removed and

replaced with an eliciting solution containing 17 mg/mL luminol (Sigma Aldrich), 200

µg/mL horseradish peroxidase (Sigma Aldrich), and an appropriate concentration of

the desired PAMP. Luminescence was recorded over a 40 – 60 minute time period

using a charge-coupled device camera (Photek Ltd., East Sussex UK).

Seedling growth inhibition

Seeds were surface-sterilized and sown on 1% MS agar plates. After stratification for

3 d at 4ºC, the plates were transferred to light for 4 d. Seedlings were then

transferred to single wells in 48-well plates containing liquid MS media and an

appropriate concentration of the desired PAMP. 10-12 days later, individual seedlings

were gently blotted dry and weighed using a precision scale (Sartorius).

MAPK activation

Seeds were surface-sterilized and sown on 1% MS agar plates. After stratification for

3 d at 4ºC, the plates were transferred to light for 4 d. Seedlings were then

transferred as two seedlings per well in 24-well plates containing liquid MS media.

10-12 d later, seedlings were elicited over a 30-min time course and ground in liquid

nitrogen. Proteins were extracted in buffer containing 50 mM Tris-HCl (pH 7.5), 10

mM MgCl2, 15 mM EGTA, 100 mM NaCl, 1 mM NaF, 1 mM Na2MoO4, 0.5 mM

activated Na3VO4, 30 mM glycerol 2-phosphate, 0.1% Igepal, 0.5 mM

phenylmethanesulfonyl fluoride, 1x protease inhibitor cocktail (Sigma Aldrich), 100

nM calyculin A (New England Biolabs), and 2 mM dithiothreitol. Samples were

normalized using Bradford Reagent (Biorad), boiled for 5 min in Laemmli sample

buffer and subject to SDS-PAGE and western blot analysis.

Bacterial infections

Pseudomonas syringae pv. tomato DC3000 cultures were grown overnight at 28°C in

liquid LB media containing rifampicin. The cells were collected by gentle

centrifugation and resuspended in 10 mM MgCl2 containing 0.02% Silwet L77 to

OD600 = 0.2 (108 colony forming units per mL). This bacterial suspension was then

sprayed onto 4-5 week old plants until run-off and plants were covered with vented

lids for 3 d. Four microfuge tubes containing three leaf discs (4 mm diameter) from

different plants per genotype were collected in 10 mM MgCl2 and homogenized using

a drill-adapted pestle. Serial dilutions were plated on LB agar containing rifampicin

and colonies were counted manually 2 d later.

Stomatal aperture measurements

Stomatal aperture was measured after treatment with 5 μM flg22 for 1 hr, as

previously described (Macho et al., 2012).

Transient expression in N. benthamiana

Nicotiana benthamiana plants were grown on soil as one plant per pot and used for

transient transformation at 5 weeks post germination. Agrobacterium tumefaciens-

mediated transient transformation of N. benthemiana was performed by infiltrating

leaves with OD600=0.2 of each construct along with the silencing suppressor P19.

Bacteria were prepared in buffer containing 10 mM MgCl2, 10 mM MES and 150 μM

acetosyringone for 3 hours at room temperature prior to infiltration. Samples were

collected 3 d after infiltration.

Western blots

Antibodies used in western blots were as follows: α-GFP (Santa Cruz and/or Roche);

α-mouse-HRP (Sigma Aldrich); α-HA-HRP (Roche); α-rabbit-HRP (Sigma Aldrich), α-

rabbit-TrueBlot-HRP (eBioscience), α-FLAG-HRP (Roche), and α-p42/p44-erk (Cell

Signalling Tech). Polyclonal α-BAK1 and α-FLS2 antibodies were previously

described (Gimenez-Ibanez et al., 2009; Schulze et al., 2010).

Primers used in this study

Primer Name Primer Sequence (5'-3')

Col-0/Ler mapping: flanking bak1-5

IV_16.2_T16L1_F GGGGCAATGTATTTTACAC

IV_16.2_T16L1_R ACTTCCAGCACCAGCTCAC

IV_16.2_F17I5_F CAGCTACACGTTGGCTACA

IV_16.2_F17I5_R GTTTACATCGTCTGCAAATA

Col-0/Ler mapping: flanking mob1

V_23.6_MQJ2_F ATTCTCCGTAGACCACAG V_23.6_MQJ2_R TCAACAGACTCCGCATACT V_26.3_MPA24_F AGGTCAGATCGCTGAGAA V_26.3_MPA24_R TCAAAAATGGCTAATCAAG V_26.9_K9I9_F TGGACTTGAATAGTTAGGCTGTCT

V_26.9_K9I9_R ATTACCAGTACTTAATAAAATGAT

SNP confirmation sequencing

V_2218100_F CATGTTACTTGATTCGGGAA

V_2218100_R GCTGCTTCTCTCTACATGCT

V_26457834-8077_F AGATTCGCCTCTAAAGGCTA

V_26457834-8077_R TTCTCTAACCCACGCATGTG

V_26474069_F CGTTGAGAACTTGATCAATG

V_26474069_R GAGGATCTGTTTCAGTTCGC

V_26540593_F GGTGTTCAGTTTAGTCTCAA

V_26540593_R GCCTTCTTGCCTCAGCTAAC

Sequencing genomic CPK28

CPK28seq_1F CAGTTAAAATTCTCAGAAAT

CPK28seq_1R CTCAACAGCAATAGGAAGAACCAT

CPK28seq_2F GCATCCTCTGCTCTGCTTTGAGGTC

CPK28seq_2R TGATAGCTAGTACTAACCTGGTTTGATA

CPK28seq_3F AGATTCGCCTCTAAAGGCTA

CPK28seq_3R TTCTCTAACCCACGCATGTG

CPK28seq_4F GTATGCTTTCGAGTACTAAAGTTAG

CPK28seq_4R AACATGTAGAGCTGCTGCTACAAACT

CPK28seq_5F TTGTGTACTTGTATCTTTGCT

CPK28seq_5R CTATCGAAGATTCCTGTGAC

Sequencing genomic AtC3H68

AtC3H68seq_1F ATGATGAAGAAAACGAAGAAA

AtC3H68seq_1R CAATGGTGGGCGTTTCCATTTGAT

AtC3H68seq_2F GTAAAGTTGTTTCTTAGTGAT

AtC3H68seq_2R CAGTTTCAAGTGGTTTACCTTTC

AtC3H68seq_3F GCTTCTGCAGCTTTGTCTGC

AtC3H68seq_3R AGGATCTGTTTCAGTTCGCGCTGAC

AtC3H68seq_4F GAGGATTCTTACACAGCT

AtC3H68seq_4R TTACGATCCAAACTTGAGTCTCT

Sequencing genomic MAN7

MAN7seq_1F ATGAAGCTTCTGGCTCTGTTT

MAN7seq_1R TAACGCAAAATCCAAACC

MAN7seq_2F GATCTTGTGGCCAAGTTTTGA

MAN7seq_2R GCAGCCATTTCAGTAATC

MAN7seq_3F GACTCTGTTACTTGTCTAG

MAN7seq_3R CTGGTTTCTTCATTGATTTA

MAN7seq_4F CCAGACTCAAGCGAGCAAT

MAN7seq_4R TCAGTTATTGATTTTGTGACCT

Molecular Cloning and Site-Directed Mutagenesis of CPK28

CPK28_GWY_nopro_F CACCATGGGTGTCTGTTTCTCCGCCA

CPK28_GWY_stop_R CTATCGAAGATTCCTGTGAC

CPK28_GWY_ownpro_F CACCCAGTTAAAATTCTCAGAAAT

CPK28_GWY_nostop_R TCGAAGATTCCTGTGACCTGCAG

CPK28_S245L_F CAGATCAGGGCCTGAATTAGATGTATGGAGCATTGGTGTG

CPK28_S245L_R CACACCAATGCTCCATACATCTAATTCAGGCCCTGATCTG

CPK28_A295V_F GCAACTATAAGTGACAGCGTCAAAGATTTTGTGAAAAAGT

CPK28_A295V_R ACTTTTTCACAAAATCTTTGACGCTGTCACTTATAGTTGC

CPK28_pOPIN_F AAGTTCTGTTTCAGGGCCCGATGGGTGTCTGTTTCTCCGCCA

CPK28_pOPIN_R ATGGTCTAGAAAGCTTTATCGAAGATTCCTGTGACCTGCAG

Genotyping cpk28, cpk16 and cpk18 mutant lines

GABI523B08_F GCGGCGGATTCTTTGACTAA

GABI523B08_R AGTACACAACGGCTCATTATGAA

WiscDSLox264D03_F CAGTTCTATCCCAAAAAGGCC

WiscDSLox264D03_R TCCAGCCCTTACTAGGGTTTC

Salk052257_F ATCAATCGCATCAAACTGGTC

Salk052257_R TATGCGAGGGTGGTGAATTAC

Salk020716_F AATCAACCGAAGAAGATTCGC

Salk020716_F AAGTCCACGAATCCATCTGTG

Salk061352_F TGAATGGCCAACGCTAATAAC

Salk061352_F AGCATTTGTCTCACCACAACC

GABI071G03_F TCCTTCTTTCACCCATGAATG

GABI071G03_F TACAAGCTTTAGGTGGGCATG

Quantitative real-time RT-PCR

FLS2_F ACTCTCCTCCAGGGGCTAAGGAT

FLS2_R AGCTAACAGCTCTCCAGGGATGG

EFR_F CGGATGAAGCAGTACGAGAA

EFR_R CCATTCCTGAGGAGAACTTTG

CERK1_F AAGTGGAGGTTTGGGTGGTGCCG

CERK1_R ACAGCCCCAAAACCACCTTGCCC

BAK1_F GACAACCGCAGTGCGTGGGA

BAK1_R TCGCGAGGCGAGCAAGATCA

BIK1_F TGGGCTCGACCGTACCTCACA

BIK1_R CGGGCGCGACTTGGGTTCAA

RBOHD_F CGAATGGCATCCTTTCTCAATC

RBOHD_R GTCACCGAGAGTGCGGATATG

CPK28_F GGAACTTCGAATGCACACGGGG

CPK28_R GCAGGGCTTGGTGCTCTCTGTG

FRK1_F ATCTTCGCTTGGAGCTTCTC

FRK1_R TGCAGCGCAAGGACTAGAG

At1g51890_F CCAGTTTGTTCTGTAATACTCAGG

At1g51890_R CTAGCCGACTTTGGGCTATC

NHL10_F TTCCTGTCCGTAACCCAAAC

NHL10_R CCCTCGTAGTAGGCATGAGC

ACTIN2_F TCCCTCAGCACATTCCAGCAGAT

ACTIN2_R AACGATTCCTGGACCTGCCTCATC

UBOX_F TGCGCTGCCAGATAATACACTATT

UBOX_R TGCTGCCCAACATCAGGTT

SUPPLEMENTAL REFERENCES

Boudsocq, M., and Sheen, J. (2012). CDPKs in immune and stress signaling. Trends Plant Sci 18, 30-40.

Berrow, N.S., Alderton, D., Sainsbury, S., Nettleship, J., Assenberg, R., Rahman, N., Stuart, D.I., and Owens, R.J. (2007). A versatile ligation-independent cloning method suitable for high-throughput expression screening applications. Nucleic Acids Res 35, e45.

Gimenez-Ibanez, S., Hann, D.R., Ntoukakis, V., Petutschnig, E., Lipka, V., and Rathjen, J.P. (2009). AvrPtoB targets the LysM receptor kinase CERK1 to promote bacterial virulence on plants. Curr Biol 19, 423-429.

Kadota, Y., Sklenar, J., Derbyshire, P., Stransfeld, L., Asai, S., Ntoukakis, V., Jones, J.D., Shirasu, K., Menke, F., Jones, A., et al. (2014). Direct Regulation of the NADPH Oxidase RBOHD by the PRR-Associated Kinase BIK1 during Plant Immunity. Mol Cell 54, 43-55.

Li, H., and Durbin, R. (2009). Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754-1760.

Li, H., Handsaker, B., Wysoker, A., Fennell, T., Ruan, J., Homer, N., Marth, G., Abecasis, G., Durbin, R., and Subgroup, G.P.D.P. (2009). The Sequence alignment/map (SAM) format and SAMtools. Bioinformatics 25, 2078-2079.

Macho, A.P., Boutrot, F., Rathjen, J.P., and Zipfel, C. (2012). Aspartate oxidase plays an important role in Arabidopsis stomatal immunity. Plant Physiol 159, 1845-1856.

Matschi, S., Werner, S., Schulze, W.X., Legen, J., Hilger, H.H., and Romeis, T. (2013). Function of calcium-dependent protein kinase CPK28 of Arabidopsis thaliana in plant stem elongation and vascular development. Plant J 73, 883-896.

Nakagawa, T., Kurose, T., Hino, T., Tanaka, K., Kawamukai, M., Niwa, Y., Toyooka, K., Matsuoka, K., Jinbo, T., and Kimura, T. (2007). Development of series of gateway binary vectors, pGWBs, for realizing efficient construction of fusion genes for plant transformation. J Biosci Bioeng 104, 34-41.

Schulze, B., Mentzel, T., Jehle, A.K., Mueller, K., Beeler, S., Boller, T., Felix, G., and Chinchilla, D. (2010). Rapid heteromerization and phosphorylation of ligand-activated plant transmembrane receptors and their associated kinase BAK1. J Biol Chem 285, 9444-9451.

Zhang, J., Li, W., Xiang, T., Liu, Z., Laluk, K., Ding, X., Zou, Y., Gao, M., Zhang, X., Chen, S., et al. (2010). Receptor-like cytoplasmic kinases integrate signaling from multiple plant immune receptors and are targeted by a Pseudomonas syringae effector. Cell Host Microbe 7, 290-301.