CelG From Clostridium Cellulolyticum a Multi Domain Endoglucanase Acting Efficiently on Crystalline Cellulose

8/8/2019 CelG From Clostridium Cellulolyticum a Multi Domain Endoglucanase Acting Efficiently on Crystalline Cellulose

1/7

JOURNAL OF BACTERIOLOGY,0021-9193/97/$04.000

Nov. 1997, p. 65956601 Vol. 179, No. 21

Copyright 1997, American Society for Microbiology

CelG from Clostridium cellulolyticum: a Multidomain EndoglucanaseActing Efficiently on Crystalline Cellulose

LAURENT GAL,1 CHRISTIAN GAUDIN,1* ANNE BELAICH,1 SANDRINE PAGES,1

CHANTAL TARDIF,

1,2AND

JEAN-PIERRE BELAICH

1,2

Laboratoire de Bioenergetique et Ingenierie des Proteines, IBSM, Centre National dela Recherche Scientifique,1 and Universite de Provence,2 Marseille, France

Received 9 June 1997/Accepted 15 August 1997

The gene coding for CelG, a family 9 cellulase from Clostridium cellulolyticum, was cloned and overexpressedin Escherichia coli. Four different forms of the protein were genetically engineered, purified, and studied: CelGL(the entire form of CelG), CelGcat1 (the catalytic domain of CelG alone), CelGcat2 (CelGcat1 plus 91 aminoacids at the beginning of the cellulose binding domain [CBD]), and GST-CBDCelG (the CBD of CelG fused toglutathione S-transferase). The biochemical properties of CelG were compared with those of CelA, an endo-glucanase from C. cellulolyticum which was previously studied. CelG, like CelA, was found to have an endocutting mode of activity on carboxymethyl cellulose (CMC) but exhibited greater activity on crystallinesubstrates (bacterial microcrystalline cellulose and Avicel) than CelA. As observed with CelA, the presence ofthe nonhydrolytic miniscaffolding protein (miniCipC

1) enhanced the activity of CelG on phosphoric acid

swollen cellulose (PASC), but to a lesser extent. The absence of the CBD led to the complete inactivation of theenzyme. The abilities of CelG and GST-CBDCelG to bind various substrates were also studied. Although theentire enzyme is able to bind to crystalline cellulose at a limited number of sites, the chimeric proteinGST-CBDCelG does not bind to either of the tested substrates (Avicel and PASC). The lack of independencebetween the two domains and the weak binding to cellulose suggest that this CBD-like domain may play aspecial role and be either directly or indirectly involved in the catalytic reaction.

Clostridium cellulolyticum is a mesophilic anaerobic bacte-rium which is able to grow on cellulose as the sole carbonsource. The bacterium degrades this substrate by secretingseveral enzymes. Five cellulase-encoding genes (celA, celC,

celD, celF, and celG) have been entirely sequenced, and an-other (celE) has been partially sequenced (1, 4, 9, 27, 30). Fourof them, celA, celC, celD, and celF, have been overexpressed in

Escherichia coli, and the biochemical properties of the recom-

binant proteins have been completely characterized (10, 11, 28,31). CelA, CelC, CelD, and CelF contain a catalytic core be-longing to glycosyl hydrolase families 5, 8, 5, and 48, respec-tively (15), and a dockerin domain which is involved in thebinding to the scaffolding protein CipC (24, 28). These en-zymes are actually subunits of the cellulosome complex (12).

celG, a gene located downstream ofcelC in the large cel genecluster (1, 3, 4), codes for a 76-kDa protein harboring a cata-lytic domain belonging to glycosyl hydrolase family 9, which isfollowed by a putative cellulose binding domain (CBD) show-ing similarities with family III CBDs (7). The CBD is in turnfollowed by a dockerin domain specific to cellulosomal hydro-lases (2).

In the present study, genetic engineering was carried witha view to producing in E. coli (i) the mature form of CelG,

called CelGL (catalytic domain, putative CBD, and dockerindomain); (ii) the catalytic domain alone, called CelGcat; and(iii) a chimeric protein composed of glutathione S-transfer-ase (GST) fused to the putative CBD of CelG, called GST-CBDCelG. These proteins were purified to homogeneity, andtheir biochemical properties were investigated. The degrada-tion patterns of various substrates observed for CelG at various

concentrations were compared with those of CelA. The differ-ent genetically engineered forms of CelG were tested to de-termine whether they bind to substrates such as phosphoricacid swollen cellulose (PASC), Avicel, and bacterial micro-crystalline cellulose (BMCC). The synergistic action between atruncated form of CipC (miniCipC1) and CelGL or CelA2(entire CelA [11] and [24]) was also monitored.

MATERIALS AND METHODS

Bacterial strains and plasmids. C. cellulolyticum ATCC 35319 was used as thesource of genomic DNA. E. coli DH5 (Bethesda Research Laboratories) wasused as the host for pGEX-5X-2 (Pharmacia) derivatives and pET-22b() (No-

vagen) derivatives. E. coli BL21(DE3) (Novagen) was used as the host for thepET-22b() derivative expression vector. C. cellulolyticum was grown anaerobi-cally at 32C on basal medium supplemented with cellobiose as the carbon andenergy source, and chromosomal DNA was obtained as previously described(25). E. coli was grown at 37C in Luria-Bertani (LB) medium supplemented withampicillin (100 g/ml) when required.

Production of wild-type and various forms of CelG in E. coli. The variousgenetic constructions which lead to the production of CelG and to various formsof the protein are summarized in Fig. 1. The region of the celG gene betweennucleotides 109 and 1441 that encodes the mature catalytic domain of CelG(defined by performing sequence comparison with other family 9 cellulases) wasamplified by PCR with primers containing restriction site (NdeI at the start of thegene and XhoI at the end) to facilitate the in-frame cloning into the expression

vector. The oligonucleotide primer sequences were 5 CATCATATGGGAACA

TATAACTATGGAGAA 3 (primer 1, upstream) and 5 CCGCTCGAGAATCGGATCTCCGCCAGA 3 (primer 2, downstream). The region of the celG genebetween nucleotides 109 and 2175, which encodes the entire mature CelG, wasamplified by PCR with primer 1 (upstream) and primer 3 (downstream; 5 GG

ACTCGAGGCCTTGAGGTAATTGGGT 3), which contains a XhoI site at theend of the sequence. These two PCR products were cloned into pMOSBlue

vector (Amersham). Two recombinant plasmids, pLA1 and pLA2, correspondingto PCR experiments 1 and 2, respectively, were selected, and the inserts weresequenced to check that no mutations occurred during the PCR amplification.

After digestion of pLA1 with NdeI and XhoI, the DNA fragment encoding theprotein was cloned in frame into NdeI/XhoI-digested pET-22b(), in whichunique BglII restriction site was previously deleted. The coding sequence of thecatalytic domain of CelG was fused in frame with a downstream sequenceencoding six histidine residues (His tag). The recombinant plasmid obtained wasnamed pLB1. The encoded part of CelG (CelGcat1) ended (C terminus) at I480

* Corresponding author. Mailing address: Laboratoire de Bioener-getique et Ingenierie des Proteines, CNRS, 31, Chemin JosephAiguier, 13402 Marseille Cedex 20, France. Phone: (33) (0) 4 91 16 4299. Fax: (33) (0) 4 91 71 33 21. E-mail: [email protected].

6595


2/7

FIG.

1.

ConstructionoftheplasmidsusedtoexpressCelG

andvariousderivativerecombinantproteins.SS,

signal

sequence;CD,

catalyticdomain;D,

dockerindom

ain.

6596 GAL ET AL. J. BACTERIOL.


3/7

followed by the His tag. Since an NdeI site was located on the 3 end ofcelG (Fig.1), the DNA insert of pLA2 was digested with restriction enzymes BglII and XhoIand cloned in frame into BglII/XhoI-digested pLB1, yielding the recombinantplasmid pLC1. The coding sequence ofcelG was fused in frame as for pLB1 witha downstream sequence encoding the His tag. Plasmid pLC1 was digested byrestriction enzymes NcoI and XhoI, leading to the deletion of a 475-bp DNAfragment coding for the last 155 amino acids (aa) of CelGL, corresponding tohalf of the CBD and the entire dockerin domain. The linker 5 CATGGGATGTTC 3/5 TCGAGAACATCC 3 was inserted to replace the His tag of the

vector in frame. The plasmid obtained was named pLC1-T. The protein thus

obtained (CelGcat2) is 91 aa longer than CelGcat1, which contains only thecatalytic domain (Fig. 1). pLB1, pLC1, and pLC1-T were routinely kept in E. coliDH5. E. coli BL21(DE3) was used only for production of the recombinantproteins.

The soluble proteins were produced as follows. Cells were grown at 37C withshaking in LB medium (2 liters) supplemented with glycerol (12 g/liter) andampicillin (100 g/ml) until the optical density at 600 nm (OD600) reached 2.They were stored on ice for 3.5 h and then at 15C for a further 30 min withoutshaking. Isopropyl--D-thiogalactopyranoside (IPTG) was added to a final con-centration of 10 M, and the cell culture was kept at 15C with shaking for 17 h.

At this stage, the OD600 was about 6. The cells were harvested by centrifugation(5,000 g, 15 min), resuspended in 80 ml of ice-cold 30 mM Tris-HCl buffer, pH8 (THB), and broken twice in a French press. The crude extract was centrifugedat 10,000 g for 15 min, and the supernatant was loaded onto a 30-ml Ni-nitrilotriacetic acid column (Novagen) previously equilibrated with THB. Thecolumn was washed with the same buffer and then with THB supplemented with10 mM imidazole. His-tagged CelG was eluted with a 50 mM imidazole solutionin THB. The eluate was dialyzed and concentrated by ultrafiltration to 20 ml inan Amicon concentrator with a 30K PTTK Millipore membrane and then loaded

onto a Q-Sepharose fast-flow column (30-ml bed volume; 18 by 2.5 cm; Phar-macia). The active fraction was eluted with THB200 mM NaCl at a flow rate of3 ml/min and dialyzed as described above. The entire purification procedure wascarried out at 4C.

Genetic construction encoding the chimeric protein GST-CBDCelG and pro-

duction in E. coli. The region of the celG gene between nucleotides 1444 and1947, which encodes the putative CBD of CelG, was amplified by PCR withprimers containing BamHI and XhoI restriction sites. The primer sequences used

were 5 CGTGGGATCCCCAACTTCAAGGCTATCGAA 3 (upstream; prim-er 4) and 5 CCCGCTCGAGTTAGGGTTCGTTACCGAATACTT 3 (down-stream; primer 5). The latter primer introduces a stop codon before the XhoIsite. The PCR product was digested with BamHI and XhoI and cloned into thecorresponding sites of the pGEX-5X-2 vector, yielding plasmid pLD1. E. coliDH5 was used as the recipient strain for the recombinant plasmid. The PCRproduct and the junction with the GST gene were sequenced. The strain wasgrown in LB medium supplemented with ampicillin (100 g/ml) and glycerol(12 g/liter) and incubated at 37C until the OD600 reached 1.5. IPTG was thenadded to a final concentration of 0.1 mM, and incubation continued at 25C fora further 12 h. The cells were harvested, suspended in phosphate-buffered saline

(PBS; 10.1 mM Na2HPO4, 1.8 mM KH2PO4, 0.14 M NaCl, 2.7 mM KCl buffer[pH 7.3]), and broken in a French press. The crude extract was harvested at10,000 g, and the supernatant was loaded on a glutathione-Sepharose 4Bcolumn (Pharmacia). After two washes with PBS, the protein of interest waseluted with reduced glutathione. Sodium dodecyl sulfate-polyacrylamide gelelectrophoresis was performed to check the homogeneity of GST-CBDCelG, andthe enzymatic activity of the GST moiety was monitored.

Other recombinant proteins used. MiniCipC1 was produced and purified asdescribed by Pages et al. (24). CelA2 (entire CelA) and CelA3 (CelA without thedockerin domain) were produced and purified as previously described (11, 29).

Protein quantification. The protein concentrations were determined as de-scribed by Lowry et al. (18), with fraction V bovine serum albumin (BSA; Merck)as the standard.

Substrates used. Carboxymethyl cellulose, medium viscosity (CMC; Sigma),barley glucan (Megazyme), laminarin (Sigma), xylan (Sigma), and lichenan (Sig-ma) were prepared as 1% (wt/vol) solutions in 25 mM potassium phosphatebuffer, pH 7.0 (PPB). Avicel (Merck) was used at various concentrations from1 to 10% (wt/vol) in PPB. PASC was prepared from Avicel as described byWalseth (36); its concentration was estimated by performing dry weight mea-

surements and suitably adjusted to obtain a final concentration of 1% (wt/vol) inPPB. BMCC was a generous gift from C. Boisset and B. Henrissat (CERMAV,Grenoble, France); its concentration was adjusted to 0.2% (wt/vol) in PPB.

p-Nitrophenol (pNP)-glucose (pNPG) and pNP-cellobiose (pNPC) were pur-chased from Sigma, and cellodextrins were purchased from Merck.

Enzyme assays. Carboxymethyl cellulase activity was assayed by mixing 1 ml ofenzyme solution at appropriate concentration with 4 ml of CMC solution at 37C(final concentration of CMC, 0.8%). Aliquots of 1 ml were collected at specificintervals and stored on ice, and the reducing sugar contents were determined bythe ferricyanide method of Park and Johnson (26). One international unit (IU)corresponds to 1 mol ofD-glucose equivalent released per minute. Since barleyglucan and laminarin solutions strongly react with the Park-Johnson ferricyanidereagents, the enzymatic activities on these two substrates were therefore moni-tored by using 50-l (barley glucan) or 10-l (laminarin) aliquots made up to1 ml with PPB before measurement of the reducing sugars.

Insoluble sugars such as xylan, Avicel, and lichenan were used at a finalconcentration of 0.8% (wt/vol) (BMCC was used at 0.16%) in PPB. Aliquots of1.5 ml were collected at specific intervals and centrifuged at 5,000 g for 5 minat 4C. The reducing sugar content of 1 ml of supernatant was determined asdescribed above.

Chromogenic substrates such as pNPG and pNPC were used at 0.1% (wt/vol)in PPB. The enzymatic activities were determined at 37C by monitoring the pNPreleased at 400 nm.

To determine the degradation patterns of natural cellodextrins ranging fromdegree of polymerization (DP) 6 to DP 2, 200-l aliquots of a cellodextrin

solution (from 0.1 to 2.5 g/l in PPB diluted five times) were mixed at 37C withenzyme (from 16 to 200 g/ml, final concentration). Aliquots of 75 l werecollected at various times, heated at 90C for 5 min, and filtered, and 50 l wasloaded onto a Resex-oligosaccharide column (20 by 1 cm; Interchim) heated at50C for high-pressure liquid chromatography analysis (Varian). The mobilephase was water, and the flow rate was 0.25 ml/min. The sugars were detected

with an R.I.4 refractive index detector (Varian), and the collected data wereanalyzed by means of an LC Star workstation from Varian. The retention timesof the cellodextrins were determined by loading onto the column a mix contain-ing 5 g of DP 1 to DP 6 cellodextrins in the same buffer as described above. Thesame method was also used to identify the sugars released by CelG (from 25 to400 g/ml, final concentration) on Avicel, PASC, and laminarin (0.8% [finalconcentration] in each case); 50-l aliquots of the reaction mixture were loadedonto the column.

Binding assays. The experiments were performed as described previously (12).Various quantities of protein were incubated with various quantities of Avicel for30 min in PPB, under slow shaking at 4C in 1-ml final volume, and thencentrifuged at 5,000 g for 15 min. In the case of CelGL and GST-CBDCelGbinding assays, the free protein fraction was estimated from the residual enzy-

matic activity in the supernatant, and BSA (1 mg/ml) was added to the reactiontube to prevent any nonspecific interactions from occurring. In the case ofCelGcat, the protein concentration in the supernatant was determined by theLowry method, and therefore no BSA was added. In all experiments, the boundfraction was estimated by subtracting the protein concentration of the freefraction in the supernatant from the initial protein concentration.

Viscosimetric assays. Viscosimetric assays were performed by monitoring theflow time of the 0.8% CMC solution incubated with various quantities of enzymeat different times. The relative fluidity Fwas determined by using the formulaF [T0/(T0 T0)] [T0/(T T0)], where T0 is the flow time measured forthe buffer, T0 is the flow time of the CMC solution without enzyme, and Tis theflow time of the CMC solution with enzyme. The relative fluidity was plotted

versus the reducing sugar content released.Synergistic assays. In all the assays, a final PASC concentration of 0.8% was

used. In the assays with the miniCipC1-CelGL or miniCipC1-CelA2 complex, theproteins were mixed together in equimolar (0.02 M miniCipC1 and 0.02 MCelGL or CelA2) amounts or with a 500-fold excess of miniCipC1 (10 MminiCipC1 and 0.02 M CelGL or CelA2) at 4C for 5 min prior to incubation

with the substrate. In the assay with the cellulose pretreated with miniCipC1, the

substrate was incubated with 0.46 nmol of miniCipC1 per mg of substrate for30 min at room temperature. The substrate was then extensively washed withwater in order to remove miniCipC1, equilibrated with buffer, and then used totest the activity of CelGL or CelA2. Aliquots were pipetted at specific intervals,and the reducing sugar contents were determined as described above.

RESULTS

Production of the entire and various forms of CelG. Toprevent the formation of inclusion bodies which commonlyoccurred when the large form of CelG was produced frompLC1 at 37C with 1 mM IPTG, wide ranges of growth andinduction conditions were tested. Inductions were performedat an OD600 of 1 or 2 for various times ranging from 2 to 17 hand at various temperatures ranging from 15 to 37C. IPTGconcentrations ranging from 1 M to 1 mM were also tested.

The optimum conditions for the production of soluble recom-binant proteins were obtained by inducing the culture at anOD600 of 2 with 10 M IPTG and incubating the cells at 15Cfor 17 h. The same conditions were subsequently used to pro-duce the various forms of CelG (CelGL, CelGcat1, and Cel-Gcat2) in E. coli.

Purification of CelGL. Samples of 30 g (wet weight) of cellswere used for purification as described in Materials and Meth-ods. The purification pathway is summarized in Table 1. Thispurification was performed as fast as possible in order to pre-

vent the C-terminal degradation which usually occurs with C.cellulolyticum cellulases (10, 11, 28). From 2 liters of culture, 29

VOL. 179, 1997 CelG FROM C. CELLULOLYTICUM 6597


4/7

mg of active CelGL protein purified to homogeneity was ob-tained. The results of N-terminal microsequencing of this frac-tion (i.e., GTYNY) matches the sequence deduced from thenucleotide sequence. The recombinant protein has an appar-ent mass of 76 kDa on sodium dodecyl sulfate-polyacrylamidegel electrophoresis, which is in good agreement with its theo-retical mass (76.109 kDa). The apparent pI of CelGL is 4.6.

This protein is inactivated by storage at 70 or 20C andtherefore must be stored at 4C with 0.3% NaN3. Under theseconditions, in 1 to 2 weeks, and as previously observed forCelA (11), CelC (10), and CelF (28), a partial hydrolysis oc-curs, yielding a mixture of the entire protein and a shortened

protein which lacks the dockerin domain. Using the propertiesof the His tag present in the entire CelG, we separated the twoforms on a nickel column. The shortened protein was thereforenamed CelGS. Contrary to what was observed with CelA (11),CelC (10), and CelF (28), the loss of the dockerin domain hadno effect on the activity of CelG on the various tested sub-strates. Since no subsequent proteolysis was observed, CelGS

was further used to make comparisons with CelA3, a previouslyengineered dockerinless form of CelA (29).

Catalytic properties of CelGL. The specific activities ofCelGL toward various substrates were tested. The results aresummarized in Table 2. The highest specific activities wereobtained with barley glucan and CMC. CelGL showed no ac-tivity toward laminarin, xylan, and chromogenic substratessuch as pNPG or pNPC but was able to degrade lichenan,

Avicel, PASC, BMCC, and natural cellodextrins with DP rang-ing from 6 to 3.The apparent Km and Vmax of CelGL toward CMC medium

viscosity and Avicel were found to be 8.7 g/liter and 2,000IU/mol and 17.8 g/liter and 5 IU/mol, respectively. The K

m

and Vmax of CelGL toward cellopentaose (DP 5) are 1.7 g/literand 670 IU/mol.

The optimum pH and temperature are pH 7.0 and 50C.These values are similar to those obtained with the other

cellulases ofC. cellulolyticum characterized thus far (10, 11, 28,31).The pattern of cellodextrin degradation by CelGL is sum-

marized in Fig. 2. The final products of degradation are cello-biose and glucose. Since the activity of CelGL toward cello-dextrins depends on the DP, the best substrate is cellohexaose.The degradation of G4 and G3 was relatively slight comparedto that of G6 or G5.

The sugars released upon incubation of CelGL with PASCor Avicel PH101 were identical; i.e., G5 and G4 were releasedin an initial phase (0 to 30 min), and then G3, G2, and G1accumulated in a subsequent phase (after 2 to 3 h of incuba-tion).

Catalytic properties of CelGcat. The catalytic domain ofCelG (CelGcat1) was produced and purified to estimate itsdegree of dependence on other domains. Various concentra-tions of this protein were used to test CMC, Avicel, and PASCdegradation. In any case, the fact that no reducing sugars werereleased indicates that this polypeptide was inactive on thesesubstrates. The catalytic domain, however, appeared to be cor-rectly marked out in view of the only family 9 crystal structurepublished so far (three-dimensional structure of CelD from C.thermocellum, [17]). In the case of CelD, the catalytic residueE555 was followed by the last helix (I558 to A569). In CelG,E455 corresponds to E555 of CelD, and the sequence betweenC458 and A469 may correspond to the last helix of the cata-lytic domain. The celG gene was truncated to code for a pro-tein containing the first 479 residues, being therefore 10 resi-dues longer than the catalytic domain expected to lie fromresidues G1 to A469, as suggested by the crystal structure ofCelD (17). A longer peptide, containing in addition the first 91

aa of the putative CBD, CelGcat2, was produced and purifiedin the same way. It was slightly active on CMC (0.5 IU/mol ofprotein, corresponding to about 1/2,000 of the activity ofCelGL). It emerged clearly that the catalytic domain cannotefficiently hydrolyze CMC and that more than half of thesecond domain of the protein is required to obtain a fullyactive enzyme.

Binding assays. We tested the binding of CelGL, CelGcat1,and GST-CBDCelG to PASC, Avicel, and BMCC. NeitherGST-CBDCelG nor CelGcat1 was able to bind to these sub-strates, even over a wide range of substrate and protein con-centrations. The entire protein, CelGL, was able to bind to

FIG. 2. Degradation pattern of cellodextrins by CelGL. Products of degra-dation of cellodextrins ranging from cellotriose (G3) to cellohexaose (G6) wereidentified and quantified by high-pressure liquid chromatography. From theircompositions, the cleavage sites were deduced. The bold, thin, and dashedarrows correspond to the main, second, and third sites of cleavage, respectively.

TABLE 1. Purification of CelGL from E. coli extract

FractionCMCasea

activity(IU)

Protein(mg)

CMCasesp act

(IU/mg)

Yield(%)

Purifi-cation(fold)

Crude extract 1,045 3,038 0.34 100 1Ni-nitrilotriacetic acid 344 75 4.6 33 13.5Q-Sepharose 309 29 10.6 29.5 31.2

a

CMCase, carboxymethyl cellulase.

TABLE 2. Specific activities of CelGL toward various substrates

Substratea Bond typeSp act

(IU/mol)

% Activityof the bestsubstrate

Barley glucan -1,4, -1,3 1,350 100.0CMC medium viscosity -1,4 1,170 86.7Lichenan -1,4, -1,3 140 10.4PASC -1,4 38 2.8Avicel -1,4 5 0.4BMCC -1,4 9 0.7Laminarin -1,3 NDb NDXylan -1,4 ND NDpNPG -1,4 ND NDpNPC -1,4 ND ND

a Concentrations used were 0.8% except for BMCC (0.16%) and pNPG andpNPC (0.1%).

b ND, no detectable activity.



5/7

Avicel. A reciprocal plot using a 5% (final concentration) so-lution of Avicel (data not shown) indicated the existence of twoclasses of sites, characterized by the following parameters: Kdof 0.12 M and 4 nmol of sites/g of Avicel; and K

dof 7.4 M

and 95 nmol of sites/g. These properties seem to reflect abinding weaker than that of the CBD of miniCipC1, which wasfound (on 0.5% Avicel solution) to have a number of sites ashigh as 280 nmol/g and a K

dof 0.13 M (25).

Comparison between the catalytic properties of CelGS andCelA3

. The activities of CelGS and CelA3 were compared onCMC, PASC, Avicel, and BMCC. In each assay, various quan-tities of proteins were incubated with the substrate and theactivities were calculated as described in Materials and Meth-ods. The specific activity of CelA3 on CMC (11) was higher

than that of CelGS. Viscosimetric assays on CMC incubatedfor various times with high concentrations of CelGS or CelA3

yielded similar profiles (Fig. 3). It is clear that both enzymeshave the same endo mode of action. Nevertheless, CelGS andCelA3 exhibited quite different insoluble cellulose degradationactivities, as shown in Fig. 4. On PASC, which is cellulose witha low degree of crystallinity, CelA3 exhibited greater activitythan CelGS. The activities on Avicel and BMCC, which are

more crystalline than PASC, were also monitored. On Avicel,CelGS and CelA3 had similar initial degradation rates (Fig. 4Band 5); but the degradation process of CelGS continued longerthan that of CelA3. A study using a wide range of concentra-tions of the two enzymes and long incubation times confirmedthis observation (Fig. 5). With CelGS, there seemed to bemore sites on Avicel that were accessible for hydrolysis than inthe case of CelA3. When Avicel was incubated with bothCelGS and CelA3, no synergism was observed. Therefore nei-ther enzyme seems to generate additional hydrolyzable sitesfor the other. On BMCC, which is one of the most crystallinesubstrates available, the activity of CelGS was 20-fold higherthan that of CelA3. The sites present on BMCC were appar-ently not accessible or not easily accessible by CelA3, whereasCelGS degraded this substrate efficiently and extensively (Fig.

4C). Moreover, the rate of BMCC hydrolysis by CelG wasfaster than that of Avicel (Table 2 and Fig. 4).

Effects of miniCipC1 on CelGL activity. Evidence was re-cently obtained (25) that the presence of the nonhydrolyticminiscaffolding protein (miniCipC1) enhances the activity ofCelA (both CelA2 and CelA3) on insoluble celluloses. To com-pare the activities of CelGL and CelA2 on PASC in presenceof miniCipC1, two sets of experiments were carried out. First,the specific activity of both enzymes bound to miniCipC1 wasmonitored and compared with that of each of the enzymesalone. Incubation with 0.02 M miniCipC1 yielded a 1.3-foldenhancement of the specific activity of CelA2 but had no effecton the specific activity of CelGL. When a 500:1 ratio ofminiCipC1 to enzyme was used, the specific activity of CelA2

was markedly (6.7-fold) enhanced, whereas with CelGL, only a

1.7-fold increase was observed. The action of miniCipC1 onsubstrate (25) was therefore not as beneficial to CelGL as toCelA2. To check this assumption, the substrate was incubated

with miniCipC1 before addition of CelA2 or CelGL. A 2.7-foldincrease in the specific activity of CelA2, similar to that previ-ously observed by Pages et al. (25), was recorded; the increase

FIG. 3. Changes in relative fluidity of the CMC solution (8 g/liter) versusreducing sugars released during CMC hydrolysis by CelGS at 0.018 (F) and 0.036nmol/ml (E) and by CelA3 at 0.015 (s) and 0.030 nmol/ml ().

FIG. 4. Comparison between cellulase activities of CelGS (s) and CelA3 () on PASC (8 g/liter; A), Avicel (8 g/liter; B), and BMCC (1.6 g/liter; C). RS, reducingsugars.



6/7

was 1.5-fold in the case of CelGL. These results suggest thatcomplex formation has various effects on cellulase activity,probably due to differences in the mode of action of the en-zymes, and that the new sites exposed on the substrate by theaction of miniCipC1 do not enhance the activity of CelGL asmuch as for CelA2.

DISCUSSION

The catalytic properties of CelG were tested on varioussubstrates and compared with those of the other C. cellulolyti-

cum cellulases characterized so far (10, 11, 28). Like CelA andCelC, CelG can be considered an endoglucanase, since theenzyme hydrolyzes CMC, its preferential substrate, with a lin-ear correlation between the reducing sugars released and theincrease in the relative fluidity of the CMC solution similar tothat observed with CelA (Fig. 3). CelG differs from CelA andCelC, however, in that it shows significantly greater activitytoward crystalline cellulose, especially BMCC. The level ofdegradation of BMCC by CelA was very low, and the reactionstopped after 1 h, whereas CelG efficiently hydrolyzed thissubstrate and continued to do so at the same rate for at least6 h. The activity on crystalline substrates was similar to thatobserved with CelF. CelG is slightly more active, however, thanthe processive endocellulase CelF on BMCC (28). The effi-ciency of CelG on both soluble and crystalline cellulose mightreflect an important role for this protein in cellulolytic pro-cesses. This double efficiency was previously found for twoclosely related cellulases, CelZ (Avicelase I) from C. sterco-

rarium (6) and CenB from Cellulomonas fimi (34). In the caseof C. stercorarium, it seems that the synergism between only

two components (CelZ and CelY) can explain the completesolubilization of crystalline cellulose by this organism (5, 8).

Comparisons between the sequence of CelG and those ofother cellulases showed that this enzyme is a multidomainprotein composed of a family 9 catalytic domain followed by aputative family III CBD and a dockerin domain. Only theentire form (CelGL) and the form which has lost its dockerindomain (CelGS) were able to hydrolyze cellulosic substratesand to bind to Avicel. The binding to Avicel occurred at onlya relatively small number of sites however, and CelG cannot bepurified by means of the cellulose affinity chromatography pro-cess commonly used in the case of enzymes harboring the

CBD. Although it appeared to be trimmed correctly, the cat-alytic domain alone was unable to hydrolyze CMC, Avicel, orPASC and to bind cellulose. A very weak hydrolytic activity

was measured on CMC when the first 91 aa of the putativeCBD were conserved. On the other hand, the chimeric proteinGST-CBDCelG was unable to bind to either Avicel or PASCunder conditions where the CBDs of the scaffolding proteinsCipA and CipC, which are also family III CBDs, showed astrong affinity for these substrates (22, 25). It therefore appearslikely that the catalytic domain and the putative CBD of CelGmay not be independent and that both may be required tomaintain the catalytic activity and the binding properties.Structural studies will be necessary to fully understand theinteractions between the two domains.

The putative CBD of CelG (CBDCelG) exhibits strong ho-mologies with family III CBDs. In the study by Tormo et al.

(35), sequence comparisons on family III CBDs showed thatthis family could be subdivided into three subfamilies. Subfam-ilies IIIa and IIIb are relatively closely related compared tosubfamily IIIc in which CBDCelG can be classified. Scaffoldingproteins CipA from C. thermocellum (13), CbpA from C. cel-

lulovorans (32), and CipC from C. cellulolyticum (24) possess asubfamily IIIa CBD which binds very efficiently to cellulose. Ithas been established (25) that the CBD of CipC plays a doublerole: it anchors CipC to the substrate and has disrupting effectson the cellulose, leading to the exposure of new sites that canbe hydrolyzed by the cellulolytic enzymes. The C-terminalCBDs of CelZ from C. stercorarium, which was demonstratedto bind very efficiently to cellulose (16), CelI from C. thermo-

cellum (14), and both CBDs of CelA from Caldocellum sac-charolyticum (33) belong to subfamily IIIb. The exact function

of the subfamily IIIc CBDs is not clear, however. In the case ofthe family 9 cellulases harboring subfamily IIIc CBD, only thecellulosomal enzyme CelF from C. thermocellum (23) possessesa single CBD as does CelG from C. cellulolyticum. The othercellulases such as CenB from C. fimi (19), CelZ from C. ster-

corarium (16), and CelI from C. thermocellum (14) containanother CBD belonging to subfamily IIIb (CelZ and CelI) orto family II (CenB). Although subfamily IIIc CBD of CenBalone was reported to be able to bind to cellulose (20), it seemsthat the role of this domain cannot be restricted to this bindingproperty; previous studies mentioned that it is required forfull activity (20) and that it constitutes with the catalytic core

FIG. 5. Comparison between the Avicel degradation observed at various concentrations of CelGS (F) and CelA3 (s). RS, reducing sugars released after 6 and 24 hof incubation of enzymes with the substrate.



7/7

a compact protease-resistant module (21). One hypothesis isthat the subfamily IIIc CBDs may have diverged from subfam-ilies IIIa and IIIb and that the main role of this domain is notthat of anchoring the enzyme to the substrate. This evolution-ary divergence may have affected the three-dimensional struc-ture of the domain, since polyclonal antibodies raised againstCBDCelG failed to cross-react with CBDCipC (12). The twocellulosomal enzymes, CelF from C. thermocellum and CelG,

which contain a subfamily IIIc CBD, bind to cellulose via thesubfamily IIIa CBD of the scaffolding protein, whereas in non-cellulosomal enzymes, the subfamily IIIc CBD is accompaniedby other CBDs which were shown to efficiently bind to cellu-lose. In the case of CelG, the presence of this domain mightconfer on the protein the ability to degrade crystalline sub-strates.

As previously described (12), CelG is a component of thecellulosome of C. cellulolyticum. Two other genes, celH and

celJ, have been recently sequenced in our laboratory (3), andthe corresponding proteins CelH and CelJ exhibit a pattern oforganization similar to that of CelG, i.e., a family 9 catalyticdomain followed by a subfamily IIIc CBD and a dockerindomain. This redundancy among enzymes of the same typecould be of importance for the complete solubilization of the

crystalline cellulose. We now plan to carry out further studieson the latter proteins and their interactions with the othercomponents of cellulosomes.

ACKNOWLEDGMENTS

We are grateful to E. A. Bayer for providing information about thestructure of family III CBDs and for helpful discussions. We areindebted to J. Blanc and H.-P. Fierobe for critical reading of theEnglish manuscript.

This research was supported by grants from the Centre National dela Recherche Scientifique, the Universite de Provence, the EEC (BIO-TECH contract BIO-CT-94-3018), and the Region Provence-Alpes-Cote dAzur.

REFERENCES

1. Bagnara-Tardif, C., C. Gaudin, A. Belaich, P. Hoest, T. Citard, and J.-P.Belaich. 1992. Sequence analysis of a gene cluster encoding cellulases fromClostridium cellulolyticum. Gene 119:1728.

2. Beguin, P., J. Millet, and J.-P. Aubert. 1992. Cellulose degradation by Clos-tridium thermocellum: from manure to molecular biology. FEMS Microbiol.Lett. 79:523528.

3. Belaich, A., C. Gaudin, L. Gal, S. Page s, C. Tardif, and J.-P. Belaich. 1997.Unpublished data.

4. Belaich, J.-P., C. Tardif, A. Belaich, and C. Gaudin. The cellulolytic systemof Clostridium cellulolyticum. J. Biotechnol., in press.

5. Bronnenmeier, K., H. Adelsberger, F. Lottspeich, and W. L. Staudenbauer.1996. Affinity purification of cellulose-binding enzymes of Clostridium ster-

corarium. Bioseparation 6:4145.6. Bronnenmeier, K., and W. L. Staudenbauer. 1990. Cellulose hydrolysis by a

highly thermostable endo-1,4--glucanase (Avicelase I) from Clostridiumstercorarium. Enzyme Microb. Technol. 12:431436.

7. Coutinho, J. B., N. R. Gilkes, R. A. J. Warren, D. G. Kilburn, and R. C.Miller, Jr. 1992. The binding ofCellulomonas fimi endoglucanase C (CenC)to cellulose and Sephadex is mediated by the N-terminal repeats. Mol.

Microbiol. 6:12431252.8. Creuzet, N., J.-F. Berenger, and C. Frixon. 1983. Characterization of exo-glucanase and synergistic hydrolysis of cellulose in Clostridium stercorarium.FEMS Microbiol. Lett. 20:347350.

9. Faure, E., A. Belaich, C. Bagnara, C. Gaudin, and J.-P. Belaich. 1989.Sequence analysis of the Clostridium cellulolyticum endoglucanase-A-encod-ing gene, celCCA. Gene 84:3946.

10. Fierobe, H.-P., C. Bagnara-Tardif, C. Gaudin, F. Guerlesquin, P. Sauve, A.Belaich, and J.-P. Belaich. 1993. Purification and characterization of endo-glucanase C from Clostridium cellulolyticum. Catalytic comparison with en-doglucanase A. Eur. J. Biochem. 217:557565.

11. Fierobe, H.-P., C. Gaudin, A. Belaich, M. Loutfi, E. Faure, C. Bagnara, D.Baty, and J.-P. Belaich. 1991. Characterization of endoglucanase A fromClostridium cellulolyticum. J. Bacteriol. 173:79567962.

12. Gal, L., S. Pages, C. Gaudin, A. Belaich, C. Reverbel-Leroy, C. Tardif, and

J.-P. Belaich. 1997. Characterization of the cellulolytic complex (cellulo-some) produced by Clostridium cellulolyticum. Appl. Environ. Microbiol.63:903909.

13. Gerngross, U. T., M. P. Romaniec, T. Kobayashi, N. S. Huskisson, and A. L.Demain. 1993. Sequencing of a Clostridium thermocellum gene (cipA) en-coding the cellulosomal SL-protein reveals an unusual degree of internalhomology. Mol. Microbiol. 8:325334.

14. Hazlewood, G. P., K. Davidson, J. I. Laurie, N. S. Huskisson, and H. J.Gilbert. 1993. Gene sequence and properties of CelI, a family E endoglu-canase from Clostridium thermocellum. J. Gen. Microbiol. 139:307316.

15. Henrissat, B., and A. Bairoch. 1996. Updating the sequence-based classifi-cation of glycosyl hydrolases. Biochem. J. 316:695696.

16. Jauris, S., K. P. Rucknagel, W. H. Schwarz, P. Kratzsch, K. Bronnenmeier,and W. L. Staudenbauer. 1990. Sequence analysis of the Clostridium sterco-

rarium celZ gene encoding a thermoactive cellulase (Avicelase I): identifi-cation of catalytic and cellulose-binding do mains. Mol. Gen. Genet. 223:258267.

17. Juy, M., A. G. Amit, P. M. Alzari, R. J. Poljak, M. Claeyssens, P. Be guin, andJ.-P. Aubert. 1992. Three-dimensional structure of a thermostable bacterialcellulase. Nature 357:8991.

18. Lowry, O. H., N. J. Rosebrough, A. L. Farr, and R. J. Randall. 1951. Proteinmeasurements with the Folin phenol reagent. J. Biol. Chem. 193:265275.

19. Meinke, A., C. Braun, N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and R. A.Warren. 1991. Unusual sequence organization in CenB, an inverting endo-glucanase from Cellulomonas fimi. J. Bacteriol. 173:308314.

20. Meinke, A., N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., and R. A. Warren.1991. Multiple domains in endoglucanase B (CenB) from Cellulomonas fimi:functions and relatedness to domains in other polypeptides. J. Bacteriol.173:71267135.

21. Meinke, A., M. Schmuck, N. R. Gilkes, D. G. Kilburn, R. C. Miller, Jr., andR. A. Warren. 1992. The tertiary structure of endo--1,4-glucanase B(CenB), a multidomain cellulase from the bacterium Cellulomonas fimi.Glycobiology 2:321326.

22. Morag, E., A. Lapidot, D. Govorko, R. Lamed, M. Wilchek, E. A. Bayer, and Y. Shoham. 1995. Expression, purification, and characterization of the cel-lulose-binding domain of the scaffolding subunit from the cellulosome ofClostridium thermocellum. Appl. Environ. Microbiol. 61:19801986.

23. Navarro, A., M. C. Chebrou, P. Beguin, and J.-P. Aubert. 1991. Nucleotidesequence of the cellulase gene celF of Clostridium thermocellum. Res. Mi-crobiol. 142:927936.

24. Pages, S., A. Belaich, C. Tardif, C. Reverbel-Leroy, C. Gaudin, and J.-P.Belaich. 1996. Interaction between the endoglucanase CelA and the scaf-folding protein CipC of the Clostridium cellulolyticum cellulosome. J. Bac-teriol. 178:22792286.

25. Pages, S., L. Gal, A. Belaich, C. Gaudin, C. Tardif, and J.-P. Belaich. 1997.Role of scaffolding protein CipC of Clostridium cellulolyticum in cellulosedegradation. J. Bacteriol. 179:28102816.

26. Park, J. T., and M. J. Johnson. 1949. A submicrodetermination of glucose.

J. Biol. Chem. 181:149151.27. Reverbel-Leroy, C., A. Belaich, A. Bernadac, C. Gaudin, J.-P. Belaich, and C.Tardif. 1996. Molecular study and overexpression of the Clostridium cellu-

lolyticum celFcellulase gene in Escherichia coli. Microbiology 142:10131023.28. Reverbel-Leroy, C., S. Pages, A. Belaich, J.-P. Belaich, and C. Tardif. 1997.

The processive endocellulase CelF, a major component of the Clostridiumcellulolyticum cellulosome: purification and characterization of the recombi-nant form. J. Bacteriol. 179:4652.

29. Roig, V., H.-P. Fierobe, V. Ducros, M. Czjzek, A. Be laich, C. Gaudin, J.-P.Belaich, and R. Haser. 1993. Crystallization and preliminary X-ray analysisof the catalytic domain of endoglucanase A from Clostridium cellulolyticum.J. Mol. Biol. 233:325327.

30. Shima, S., Y. Igarashi, and T. Kodama. 1991. Nucleotide sequence analysisof the endoglucanase-encoding gene, celCCD, of Clostridium cellulolyticum.Gene 104:3338.

31. Shima, S., Y. Igarashi, and T. Kodama. 1993. Purification and properties oftwo truncated endoglucanases produced in Escherichia coli harbouring Clos-tridium cellulolyticum endoglucanase gene celCCD. Appl. Microbiol. Bio-technol. 38:750754.

32. Shoseyov, O., M. Takagi, M. A. Goldstein, and R. H. Doi. 1992. Primarysequence analysis of Clostridium cellulolyticum cellulose binding protein A.Proc. Natl. Acad. Sci. USA 89:34833487.

33. Teo, V. S., D. J. Saul, and P. L. Bergquist. 1995. celA, another gene codingfor a multidomain cellulase from the extreme thermophile Caldocellum

saccharolyticum. Appl. Microbiol. Biotechnol. 43:291296.34. Tomme, P., E. Kwan, N. R. Gilkes, D. G. Kilburn, and R. A. J. Warren. 1996.

Characterization of CenC, an enzyme from Cellulomonas fimi with bothendo- and exoglucanase activities. J. Bacteriol. 178:42164223.

35. Tormo, J., R. Lamed, A. J. Chirino, E. Morag, E. A. Bayer, Y. Shoham, andT. A. Steitz. 1996. Crystal structure of a bacterial family-III cellulose-bindingdomain: a general mechanism for attachment to cellulose. EMBO J. 15:57395751.

36. Walseth, C. S. 1952. Occurrence of cellulase in enzyme preparations frommicroorganisms. TAPPI 35:228233.


Documents

CelG From Clostridium Cellulolyticum a Multi Domain Endoglucanase Acting Efficiently on Crystalline Cellulose