CB and TRPV actions on MDR1 expression in multidrug resistant

Short communication

CB2 and TRPV1 receptors mediate cannabinoid

actions on MDR1 expression in multidrug

resistant cells

Jonathon C. Arnold1, Phoebe Hone1, Michelle L. Holland1, John D. Allen2

1School of Medical Sciences (Pharmacology) and Bosch Institute, The University of Sydney, NSW 2006, Sydney,

Australia

2The Centenary Institute of Cancer Medicine and Cell Biology, NSW 2006, Sydney, Australia

Correspondence: Jonathon C. Arnold, e-mail: [email protected]

Abstract:

Background: Cannabis is the most widely used illicit drug in the world that is often used by cancer patients in combination with con-

ventional anticancer drugs. Multidrug resistance (MDR) is a major obstacle in the treatment of cancer. An extensively characterized

mechanism of MDR involves overexpression of P-glycoprotein (P-gp), which reduces the cellular accumulation of cytotoxic drugs

in tumor cells.

Methods: Here we examined the role of cannabinoid receptors and transient receptor potential vanilloid type 1 (TRPV1) receptors in

the effects of plant-derived cannabinoids on MDR1 mRNA expression in MDR CEM/VLB100 cells which overexpress P-gp due to

MDR1 gene amplification.

Results: We showed that both cannabidiol (CBD) and D9-tetrahydrocannabinol (D9-THC) (10 µM) transiently induced the MDR1

transcript in P-gp overexpressing cells at 4 but not 8 or 48 h incubation durations. CBD and THC also concomitantly increased P-gp

activity as measured by reduced accumulation of the P-gp substrate Rhodamine 123 in these cells with a maximal inhibitory effect

observed at 4 h that slowly diminished by 48 h. CEM/VLB100 cell lines were shown to express CB2 and TRPV1 receptors. D9-THC

effects on MDR1 expression were mediated by CB2 receptors. The effects of CBD were not mediated by either CB2 or TRPV1 recep-

tors alone, however, required activation of both these receptors to modulate MDR1 mRNA expression.

Conclusion: This is the first evidence that CB2 and TRPV1 receptors cooperate to modulate MDR1 expression.

Key words:

cannabinoids, P-glycoprotein, CB2, TRPV1

Introduction

Multidrug resistance (MDR) is a major obstacle in the

treatment of cancer. MDR reduces the sensitivity of

tumor cells to an array of structurally and functionally

unrelated compounds, often through repeated expo-

sure to cytotoxic agents [3, 28]. An extensively char-

acterized mechanism of MDR involves a 170 kDa ef-

flux transporter termed P-glycoprotein (P-gp) [13],

which reduces the cellular accumulation of diverse

cytotoxic drugs [8]. P-gp belongs to the superfamily

of adenosine triphosphate (ATP)-binding cassette

(ABC) transporters [9] and is encoded by the MDR1

gene [17, 27]. P-gp was discovered due to its role in

mediating MDR in cancer, however, it is also ex-

pressed in many tissues throughout the body where its

Pharmacological Reports, 2012, 64, 751�757 751

Pharmacological Reports2012, 64, 751�757ISSN 1734-1140

Copyright © 2012by Institute of PharmacologyPolish Academy of Sciences

modulation affects the pharmacokinetics of substrate

drugs including cannabinoids [23, 24].

Cannabis is the most widely used illicit drug in the

world and it is being increasingly used for medicinal

purposes. The widespread use of this drug raises the

question of whether plant-derived cannabinoids affect

MDR1 expression. This might have implications for

MDR and also the pharmacokinetics of co-administered

therapeutic drugs. We have shown that the most abun-

dant cannabinoid constituents, D9-tetrahydrocannab-

inol (D9-THC) and cannabidiol (CBD), inhibit P-gp

expression in the acute T lymphoblastoid leukemic

line CEM/VLB100 which overexpresses P-gp due to

MDR1 gene amplification [2, 12]. Here we examined

the role of cannabinoid and transient receptor poten-

tial vanilloid type 1 (TRPV1) receptors in the effects

of cannabinoids on MDR1 mRNA expression.

Materials and Methods

Cell lines

The CEM/VLB100 cell line over-expresses P-gp, as

a result of MDR1 gene amplification, yielding an ap-

proximate 200- to 800-fold resistance to VLB [12].

The cell line was grown in complete medium consist-

ing of RPMI-1640 supplemented with 10% (v/v) fetal

calf serum (FCS), 50 IU/ml penicillin and 50 mg/ml

streptomycin (all purchased from Invitrogen, Austra-

lia) in a humidified atmosphere of 5% CO2 at 37°C.

Cells were grown in 75 cm2 culture flasks maintained

at a density between 105 and 106 cells/ml, in exponen-

tial growth, and subcultured every 3–4 days. Viable

cells were counted on a hemocytometer using trypan

blue exclusion.

Drugs and drug treatment

D9-THC and CBD were purchased from Sigma-Aldrich

(Sydney, NSW) and Tocris Cookson Inc. (Sydney,

NSW), respectively, and prepared as described previ-

ously [10–12]. The selective CB2 receptor antagonist

SR 144528 (Sanofi-Aventis Pharmaceuticals, France)

and the selective TRPV1 receptor antagonist SB

366791 (Sapphire Biosciences, Australia) were stored

as stock solutions in ethanol and were diluted with

complete medium prior to each experiment. The final

ethanol concentration in the medium never exceeded

0.1%. Cells were treated in 25 cm2 culture flasks at

a cell density of 107 cells/ml with 10 µM CBD and/or

D9-THC or an equivalent volume of ethanol vehicle

(VEH), in each case diluted in complete medium and

incubated for 4, 8 or 48 h. In 4 h experiments where

cannabinoid receptor antagonists were also included,

they were added at the same time as the cannabinoids,

to a final concentration of 5 µM. For each drug treat-

ment and incubation time we repeated the experiment

at least 3 times in separate culture flasks. RNA was

extracted on each occasion and analyzed in triplicate

by real time reverse transcriptase polymerase chain

reaction (real time RT PCR).

RNA extraction and reverse transcription

Total RNA was isolated using the TRIzol reagent (In-

vitrogen, Australia). RNA was treated with DNase I to

remove any contaminating genomic DNA. The con-

centration of RNA was assessed using the Nanodrop

ND-1000 (NanoDrop Technologies Inc., USA). RNA

(2 µg) was reverse transcribed with moloney-murine

leukemia virus reverse transcriptase (Promega, Aus-

tralia), random hexamers and dNTPs.

Real time reverse transcriptase polymerase

chain reaction

The real-time reverse transcriptase polymerase chain

reaction (RT PCR) was performed in multiplex using

TaqMan Gene Expression Assay primer and probes

and TaqMan Universal PCR Master Mix (Applied

Biosystems, USA). Briefly, PCR was performed in

triplicate in standard 96-well plates containing 1.25 µl

of TaqMan MDR1 forward and reverse primers and

MGB FAM-labelled probe, 1.25 µl of the TaqMan en-

dogenous control 18s rRNA forward and reverse

primers and MGB VIC-labelled probe, 12.5 µl of

TaqMan universal PCR master mix, 1 µl of cDNA

template and 9 µl of diethyl pyrocarbonate (DEPC)-

treated water to give a total reaction volume of 25 µl

per well. The RT PCR products were amplified using

the ABI Prism 7000 Sequence Detection System (Ap-

plied Biosystems, USA). Thermal cycling conditions

were 50°C for 2 min, followed by 95°C for 10 min, 40

cycles of 95°C for 15 s, with a final annealing tem-

perature of 60°C for 60 s. TaqMan primers and probes

were designed to amplify a 67 bp region of the MDR1

mRNA sequence (NCBI Entrez nucleotide sequence

ID: NM_000927.3), and a 187 bp amplicon from the

752 Pharmacological Reports, 2012, 64, 751�757

18s rRNA mRNA sequence (NCBI Entrez nucleotide

sequence ID: X03205.1). A non-template control us-

ing DEPC-treated water instead of cDNA was used as

a negative control in each plate analyzed.

RT-PCR analysis of receptor expression

All receptor PCR reactions were performed using

0.05 × the final volume of template in reactions con-

sisting of 1 × HotStarTaq PCR buffer, 125 nM of each

primer, 100 nM dNTPs and 0.1 U/µl of HotStarTaq

DNA Polymerase. Thermal cycling conditions con-

sisted of an initial activation step of 95°C for 15 min,

followed by n cycles of 94°C for 45 s, annealing

temperature (Tm) °C for 20 s and 72°C for 30 s, with

a final cycle of 72°C for 5 min. Both the number of

amplification cycles (n), and the Tm were determined

for each primer set. Primers were designed based on

sequences available from the National Centre for Bio-

technology Information databases, using Primer 3

software [22]. Where alternatively spliced transcripts

of the gene exist, primers were designed across a re-

gion that is common to all variants. Specific reaction

conditions, primer sequences and amplicon sizes are

described in Table 1. We utilized a negative RT con-

trol which showed no signal upon amplification high-

lighting that our product derived from cDNA rather

than genomic DNA.

Rhodamine 123 accumulation assay of P-gp

activity

Cells were plated at 2 × 105/ml and 1/10th volume of

11X cannabinoids added to wells to a final concentra-

tion of 10 µM, 48, 8 or 4 h prior to harvest. Untreated

controls received 1/10th volume complete medium 4 h

prior to harvest. At harvest, cells were pelleted,

washed free of cannabinoids, and resuspended in

complete medium. Rhodamine 123 accumulation was

performed in triplicate. Aliquots of 0.5 ml (~4 × 105)

cells were transferred to 5 ml serology tubes pre-

loaded with 0.5 ml 1 µM Rhodamine 123 in complete

medium. The racked tubes were placed in a humidi-

fied CO2 incubator at 37°C for 60 min, with quick

mixing every 20 min, and then cooled in ice-water

slurry. Cells were pelleted by centrifugation at 2°C,

washed once with PBS containing 1% FCS and 1 mM

EDTA, resuspended in 0.3 ml of the same, and kept

on ice until analysis. Rhodamine 123 accumulation

was assayed by flow cytometry, using 488 nm excita-

tion and 530 nm fluorescence.

Data analysis

The changes in gene expression levels were evaluated

by relative quantification between cDNA templates

from drug-treated cells and their respective vehicle-

treated controls at each time point. The expression of

the housekeeping gene, 18s rRNA, was used as an en-


CB2 and TRPV1 mediate cannabinoid action on MDR1 expressionJonathon C. Arnold et al.

Tab. 1. National Centre for Biotechnology Information database accession number, primer sequences, annealing temperature (Tm), amplifica-tion cycle number (n) and amplicon sizes of CB1, CB2 and TRPV1 receptor mRNA

Accession (mRNA) Forward primer (5’-3’) Reverse primer (5’-3’) Tm (°C) n Amplicon size (bp)

cDNA DNA

Cannabinoid receptor (CB1)

NM_016083.3 aagaccctggtcctgatcct cgcaggtccttactcctcag 52 35 188 188

Cannabinoid receptor (CB2)

NM_001841 tagacacggacccctttttg ttctcccaagtccctcattg 57 35 243 243

Transient Receptor Potential Vanilloid (subtype 1) (TRPV1)

NM_080704 gcctggagctgttcaagttc tctcctgtgcgatcttgttg 56 35 177 177

b actin (ACTB)

NM_001101 ggacttcgagcaagagatgg agcactgtgttggcgtacag 55 30 234 329

dogenous control, to normalize the data between sam-

ples. Data were analyzed according to the mathemati-

cal model for relative quantification modified in ac-

cordance with ‘delta-delta method’ used by Applied

Biosystems [20]. Real-time RT PCR CT results were

analyzed using Sequence detection software version

1.2.3 (Applied Biosystems, USA) where baseline and

threshold parameters were kept constant between

plates. The relative expression ratios between treated

and vehicle control groups were statistically analyzed

using the non-parametric Mann-Whitney U test as an

equality of variance F-test showed that the variance

between experimental groups were heterogenous.

Rhodamine 123 accumulation was analyzed by one-

way ANOVA with the difference between untreated

cells and the 4, 8 and 48 h time-points tested explic-

itly by Tukey’s post-test (here, variances were homo-

geneous).

Results

We determined whether changes in MDR1 mRNA

levels occurred in the CEM/VLB100 cells in response

to treatment with cannabinoids for 4, 8 or 48 h. At 4 h,

both D9-THC and CBD (10 µM) significantly in-

creased MDR1 mRNA expression, by approximately

2.5 and 2.0 fold, respectively, over VEH-treated cells

(p < 0.05, Fig. 1A, B). The induction of the MDR1

transcript was short-lived as no significant effects

were observed at 8 or 48 h for either cannabinoid. The

functional consequences of MDR1 induction were

tested by cellular Rhodamine 123 accumulation; the

dye is a good P-gp substrate and its accumulation is

inversely related to P-gp efflux activity. The increased

MDR1 transcript levels in the cannabinoid-treated

cells were accompanied by reduced Rhodamine 123


Fig. 1. Effects of cannabinoids onMDR1 mRNA levels and P-gp function.The mean (± SEM) MDR1 mRNA ex-pression relative to vehicle-treatedCEM/VLB100 cells following treatmentfor 4, 8 and 48 h with (A) 10 µM D9-THCand (B) 10 µM CBD. (C, D) Conse-quent changes in cellular Rhodamine123 accumulation; relative to un-treated controls. The levels of MDR1

mRNA were normalized to the 18srRNA housekeeping gene. Statisticalsignificance is denoted by * p < 0.05,** p < 0.01 or *** p < 0.001 (n = 3–4 pergroup)

accumulation (Fig. 1C, D). The increased P-gp activ-

ity persisted longer than the elevated transcript level

as reduced Rhodamine 123 accumulation was ob-

served for all THC and CBD incubation times (that is

4, 8 and 48 h) compared to untreated controls. Such

an effect is consistent with P-gp protein having

a longer half-life than MDR1 transcript [1, 5, 21].

However, a maximal inhibitory effect on Rhodamine

123 accumulation was observed at 4 h which slowly

dissipated as Rhodamine 123 levels were significantly

higher at 48 h than the 4 h time-point for both THC

and CBD (p < 0.001 and 0.05, respectively).

The ability of D9-THC or CBD to modulate MDR1

mRNA levels raises the important question of whether

such effects are mediated by receptors. We assessed

the expression in CEM/VLB100 cells of some common

targets of cannabinoid drugs, namely CB1, CB2 and

TRPV1 receptors, using RT-PCR [19]. Both CB2 and

TRPV1 receptor mRNAs were found to be present in

these cells, but not CB1 receptor mRNA (Fig. 2). We

then attempted to block the induction of MDR1 by

CBD or D9-THC with receptor antagonists. The CB2receptor antagonist, SR 144528, effectively blocked

D9-THC-induced upregulation of MDR1 mRNA (p <

0.05, Fig. 3) whereas the TRPV1 receptor antagonist

SB 366791 had little, if any, effect. In contrast, the

combination of these antagonists was required to re-

verse CBD-mediated induction of MDR1 mRNA (p <

0.05, Fig. 3). Neither SR 144528, SB 366791 or their

combination significantly modulated MDR1 mRNA

in the absence of cannabinoid exposure compared to

VEH-treated CEM/VLB100 cells (83.33 ± 10.40,

184.30 ± 72.12, 79.67 ± 20.33; the mean ± SEM, re-

spectively).

Discussion

D9-THC and CBD were shown to modulate MDR1

gene expression by inducing the levels of transcript in

CEM/VLB100 cells. In the present study, 10 µM

D9-THC significantly increased the level of MDR1

mRNA at 4 h in CEM/VLB100 cells. The effect on

MDR1 mRNA expression was only short-lived as it

was not sustained at 8 or 48 h. The consequent in-

crease in P-gp activity, reflected in reduced Rhodam-

ine 123 accumulation, persisted longer, as expected

from the half-life of the protein [1, 5, 21]. Further, we



Fig. 3. Effect of cannabinoid receptor antagonists on cannabinoid in-duction of MDR1 mRNA. Graphs show the mean (± SEM) MDR1

mRNA expression, relative to vehicle-treated controls (VEH), ofCEM/VLB100 cells treated with (A) 10 µM D9-THC and (B) 10 µMCBD, co-administered with either VEH or 5 µM of the CB2 receptorantagonist SR 144528 and/or the TRPV1 receptor antagonist SB366791 for 4 h. The levels of MDR1 mRNA were normalized to the 18srRNA housekeeping gene. Statistical significance was determinedby comparing cannabinoid-antagonist relative to the cannabinoid-VEH control group (* p < 0.05, n = 3–4 per condition)

Fig. 2. The expression of CB1, CB2 and TRPV1 mRNA in MCF-7(+ve) and CEM/VLB100 (VLB) cells as determined by RT-PCR.b-Actin (ACTB) was used as a control for cDNA quality. Water wasused as a negative control (–ve). n = 2, single experiment shown

showed that CEM/VLB100 express CB2 and TRPV1

receptors but not CB1 receptors. The ability of the

cannabinoids to modulate MDR1 mRNA was depend-

ent on slightly different mechanisms, with the actions

of D9-THC mediated by the CB2 receptor alone,

whereas CBD’s effects required both CB2 and TRPV1

activation, as neither a CB2 or a TRPV1 antagonist

alone were effective in reversing CBD-induced

MDR1 mRNA upregulation.

In the present study, 10 µM D9-THC and CBD tran-

siently increased the level of MDR1 mRNA that cor-

related with increased functional P-gp activity as sup-

ported by reduced Rhodamine 123 accumulation in

CEM/VLB100 cells at 4 h but not 8 or 48 h. We have

previously demonstrated that CBD and D9-THC re-

duce the protein expression of P-gp in CEM/VLB100cells after 72 h exposure, which correlated with in-

creased Rhodamine 123 accumulation and enhanced

sensitivity of the cells to the cytotoxic actions of the

P-gp substrate, vinblastine [12]. Taken together with

the present results this suggests that THC and CBD

have opposing effects on P-gp expression and conse-

quent transport capacity that is dependent on incuba-

tion duration – that is short-term cannabinoid expo-

sure (4 h) transiently increases P-gp transport whereas

longer-term exposure (72 h) decreases P-gp activity.

The literature is replete with examples of cannabi-

noids having biphasic effects on various biological

measures e.g., [6, 18, 25, 26]. The mechanism respon-

sible for this biphasic action of cannabinoids on P-gp

expression and activity requires further investigation.

D9-THC binds to both CB1 and CB2 with similar af-

finities and behaves as a partial agonist at these recep-

tors [7, 14, 16, 19, 29], however, it does not bind

TRPV1 receptors [15]. Thus, given that only CB2 re-

ceptor mRNA was found expressed in CEM/VLB100

cells, it is not surprising that this receptor accounted

for all of D9-THC’s ability to upregulate MDR1

mRNA. Interestingly, CBD exhibited a more complex

profile, as only combination blockade of CB2 and

TRPV1 significantly inhibited CBD-induced MDR1

mRNA expression, and neither CB2 nor TRPV1 an-

tagonists were effective when tested alone. CBD, in

its (–)-enantiomeric form utilized here, lacks affinity

for CB1 and CB2 receptors, unlike its (+)-enantiomer

which displays significant affinity for both receptor

subtypes [4]. This raises the possibility that CBD’s ef-

fectiveness here is explained by CBD’s propensity to

inhibit endogenous fatty acid amide hydrolase and

elevate levels of the endocannabinoid anandamide.

This suggests that anandamide’s simultaneous activa-

tion of both CB2 and TRPV1 receptors [4] is necessary

for increased MDR1 mRNA expression following

CBD exposure. Here we provide the first evidence

showing that TRPV1 and CB2 receptors may cooper-

ate to affect MDR1 expression.

Acknowledgments:

This work was supported by a National Health and Medical

Research Council (NH&MRC) Project Grant and a NARSAD Young

Investigator Award awarded to JCA.

References:

1. Aleman C, Annereau JP, Liang XJ, Cardarelli CO, Taylor

B, Yin JJ, Aszalos A, Gottesman MM: P-glycoprotein,

expressed in multidrug resistant cells, is not responsible

for alterations in membrane fluidity or membrane poten-

tial. Cancer Res, 2003, 63, 3084–3091.

2. Beck WT, Mueller TJ, Tanzer LR: Altered surface mem-

brane glycoproteins in Vinca alkaloid-resistant human leu-

kemic lymphoblasts. Cancer Res, 1979, 39, 2070–2076.

3. Biedler JL, Riehm H: Cellular resistance to actinomycin

D in Chinese hamster cells in vitro: cross-resistance, ra-

dioautographic, and cytogenetic studies. Cancer Res,

1970, 30, 1174–1184.

4. Bisogno T, Hanus L, De Petrocellis L, Tchilibon S,

Ponde DE, Brandi I, Moriello AS, Davis JB et al.:

Molecular targets for cannabidiol and its synthetic ana-

logues: effect on vanilloid VR1 receptors and on the cel-

lular uptake and enzymatic hydrolysis of anandamide.

Br J Pharmacol, 2001, 134, 845–852.

5. Chin KV, Tanaka S, Darlington G, Pastan I, Gottesman

MM: Heat shock and arsenite increase expression of the

multidrug resistance (MDR1) gene in human renal carci-

noma cells. J Biol Chem, 1990, 265, 221–226.

6. Fan SF, Yazulla S: Biphasic modulation of voltage-

dependent currents of retinal cones by cannabinoid CB1

receptor agonist WIN 55212-2. Vis Neurosci, 2003, 20,

177–188.

7. Felder CC, Joyce KE, Briley EM, Mansouri J, Mackie K,

Blond O, Lai Y, Ma AL et al.: Comparison of the phar-

macology and signal transduction of the human cannabi-

noid CB1 and CB2 receptors. Mol Pharmacol, 1995, 48,

443–450.

8. Fojo A, Akiyama S, Gottesman MM, Pastan I: Reduced

drug accumulation in multiply drug-resistant human KB

carcinoma cell lines. Cancer Res, 1985, 45, 3002–3007.

9. Gottesman MM, Fojo T, Bates SE: Multidrug resistance

in cancer: role of ATP-dependent transporters. Nat Rev

Cancer, 2002, 2, 48–58.

10. Holland ML, Allen JD, Arnold JC: Interaction of plant

cannabinoids with the multidrug transporter ABCC1

(MRP1). Eur J Pharmacol, 2008, 591, 128–131.


11. Holland ML, Lau DT, Allen JD, Arnold JC: The multidrug

transporter ABCG2 (BCRP) is inhibited by plant-derived

cannabinoids. Br J Pharmacol, 2007, 152, 815–824.

12. Holland ML, Panetta JA, Hoskins JM, Bebawy M, Rou-

fogalis BD, Allen JD, Arnold JC: The effects of cannabi-

noids on P-glycoprotein transport and expression in mul-

tidrug resistant cells. Biochem Pharmacol, 2006, 71,

1146–1154.

13. Juliano RL, Ling V: A surface glycoprotein modulating

drug permeability in Chinese hamster ovary cell mutants.

Biochim Biophys Acta, 1976, 455, 152–162.

14. Karl T, Cheng D, Garner B, Arnold JC: The therapeutic

potential of the endocannabinoid system for Alzheimer’s

disease. Expert Opin Ther Targets, 2012, 16, 407–420.

15. Lam PM, McDonald J, Lambert DG: Characterization

and comparison of recombinant human and rat TRPV1

receptors: effects of exo- and endocannabinoids. Br

J Anaesth, 2005, 94, 649–656.

16. Long LE, Chesworth R, Huang XF, McGregor IS,

Arnold JC, Karl T: Transmembrane domain Nrg1 mutant

mice show altered susceptibility to the neurobehavioural

actions of repeated THC exposure in adolescence. Int

J Neuropsychopharmacol, 2012, 1–13.

17. Milojkovic M, Stojnev S, Jovanovic I, Ljubisavljevic S,

Stefanovic V, Sunder-Plassman R: Frequency of the

C1236T, G2677T/A and C3435T MDR1 gene polymor-

phisms in the Serbian population. Pharmacol Rep, 2011,

63, 808–814.

18. Parker LA, Kwiatkowska M, Burton P, Mechoulam R:

Effect of cannabinoids on lithium-induced vomiting in

the Suncus murinus (house musk shrew). Psychopharma-

cology (Berl), 2004, 171, 156–161.

19. Pertwee RG: The diverse CB1 and CB2 receptor phar-

macology of three plant cannabinoids: D9-tetrahydroca-

nnabinol, cannabidiol and D9-tetrahydrocannabivarin.

Br J Pharmacol, 2008, 153, 199–215.

20. Pfaffl MW: A new mathematical model for relative

quantification in real-time RT-PCR. Nucleic Acids Res,

2001, 29, e45.

21. Richert ND, Aldwin L, Nitecki D, Gottesman MM,

Pastan I: Stability and covalent modification of

P-glycoprotein in multidrug-resistant KB cells. Bio-

chemistry, 1988, 27, 7607–7613.

22. Rozen S, Skaletsky H: Primer3 on the WWW for general

users and for biologist programmers. Methods Mol Biol,

2000, 132, 365–386.

23. Schinkel AH, Mayer U, Wagenaar E, Mol CA, van

Deemter L, Smit JJ, van der Valk MA, Voordouw AC

et al.: Normal viability and altered pharmacokinetics in

mice lacking mdr1-type (drug-transporting)

P-glycoproteins. Proc Natl Acad Sci USA, 1997, 94,

4028–4033.

24. Spiro AS, Wong A, Boucher AA, Arnold JC: Enhanced

brain disposition and effects of D9-tetrahydrocannabinol

in p-glycoprotein and breast cancer resistance protein

knockout mice. PLoS One, 2012, 7, e35937.

25. Sulcova E, Mechoulam R, Fride E: Biphasic effects of

anandamide. Pharmacol Biochem Behav, 1998, 59,

347–352.

26. Tzavara ET, Wade M, Nomikos GG: Biphasic effects of

cannabinoids on acetylcholine release in the hippocam-

pus: site and mechanism of action. J Neurosci, 2003, 23,

9374–9384.

27. Ueda K, Cornwell MM, Gottesman MM, Pastan I,

Roninson IB, Ling V, Riordan JR: The mdr1 gene,

responsible for multidrug-resistance, codes for

P-glycoprotein. Biochem Biophys Res Commun, 1986,

141, 956–962.

28. Wang Z, Ravula R, Cao M, Chow M, Huang Y:

Transporter-mediated multidrug resistance and its modu-

lation by Chinese medicines and other herbal products.

Curr Drug Discov Technol, 2010, 7, 54–66.

29. Wong A, Gunasekaran N, Hancock DP, Denyer GS,

Meng L, Radford JL, McGregor IS, Arnold JC: The ma-

jor plant-derived cannabinoid D9-tetrahydrocannabinol

promotes hypertrophy and macrophage infiltration in

adipose tissue. Horm Metab Res, 2012, 44, 105–113.

Received: April 18, 2011; in the revised form: January 17, 2012;

accepted: February 2, 2012.



Documents

CB and TRPV actions on MDR1 expression in multidrug resistant