Candida auris phenotypic heterogeneity determines ... · 4 1 Introduction 2 C. auris is a nosocomial pathogen first identified in 2009 [1]. To date, this multidrug 3 resistant organism

1

Candida auris phenotypic heterogeneity determines pathogenicity in vitro 1

2

Jason L Brown1, Chris Delaney1, Bryn Short1, Mark C Butcher1, Emily 3

McKloud1, Craig Williams1,3, Ryan Kean1,2, Gordon Ramage1* 4

1 Glasgow Biofilm Research Network, Glasgow Dental School, School of Medicine, 5

College of Medical, Veterinary and Life Sciences, University of Glasgow, Glasgow, 6

UK, G12 8TA 7

2Department of Life Sciences, School of Health and Life Sciences, Glasgow 8

Caledonian University, Glasgow, UK, G4 0BA 9

3Microbiology Department, Lancaster Royal Infirmary & University of Lancaster 10

11

*Author for correspondence 12

[email protected] 13

14

Key words; 15

Candida auris, aggregate, host-pathogen interactions, in vitro skin model 16

17

18

19

20

21

22

(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The copyright holder for this preprintthis version posted April 23, 2020. . https://doi.org/10.1101/2020.04.20.052399doi: bioRxiv preprint

https://doi.org/10.1101/2020.04.20.052399

2

Abstract 1

Candida auris is an enigmatic yeast that provides substantial global risk in 2

healthcare facilities and intensive care units. A unique phenotype exhibited by 3

certain isolates of C. auris is their ability to form small clusters of cells known as 4

aggregates, which have been to a limited extent described in the context of 5

pathogenic traits. In this study, we screened several non-aggregative and 6

aggregative C. auris isolates for biofilm formation, where we observed a level of 7

heterogeneity amongst the different phenotypes. Next, we utilised an RNA-8

sequencing approach to investigate the transcriptional responses during biofilm 9

formation of a non-aggregative and aggregative isolate of the initial pool. 10

Observations from these analyses indicate unique transcriptional profiles in the two 11

isolates, with several genes identified relating to proteins involved in adhesion and 12

invasion of the host in other fungal species. From these findings we investigated for 13

the first time the fungal recognition and inflammatory responses of a three-14

dimensional skin epithelial model to these isolates. In these models, a wound was 15

induced to mimic a portal of entry for C. auris. We show both phenotypes elicited 16

minimal response in the model minus induction of the wound, yet in the wounded 17

tissue both phenotypes induced a greater response, with the aggregative isolate 18

more pro-inflammatory. This capacity of aggregative C. auris biofilms to generate 19

such responses in the wounded skin highlights how this opportunistic yeast is a high 20

risk within the intensive care environment where susceptible patients have multiple 21

indwelling lines. 22

23

Importance 24


https://doi.org/10.1101/2020.04.20.052399

3

Candida auris has recently emerged as an important cause of concern within 1

healthcare environments due to its ability to persist and tolerate commonly used 2

antiseptics and disinfectants, particularly when surface attached (biofilms). This 3

yeast is able to colonise and subsequently infect patients, particularly those that are 4

critically ill or immunosuppressed, which may result in death. We have undertaken 5

analysis on two different types of this yeast, using molecular and immunological tools 6

to determine whether either of these has a greater ability to cause serious infections. 7

We describe that both isolates exhibit largely different transcriptional profiles during 8

biofilm development. Finally, we show that the inability to form small aggregates (or 9

clusters) of cells has an adverse effect on the organisms immuno-stimulatory 10

properties, suggestive the non-aggregative phenotype may exhibit a certain level of 11

immune evasion. 12

13


https://doi.org/10.1101/2020.04.20.052399

4

Introduction 1

C. auris is a nosocomial pathogen first identified in 2009 [1]. To date, this multidrug 2

resistant organism has been identified in over 40 countries on 6 different continents, 3

providing a substantial global risk in healthcare facilities and intensive care units [2-4

4]. It is postulated that the emergence of C. auris may have coincided with climate 5

change based on its particular attributes, resulting in an thermotolerant organism 6

with the ability to persist in the environment before transmission to humans [5]. 7

A unique pathogenic trait exhibited by some isolates of C. auris is their ability to form 8

aggregates (Agg) [6-8]. Despite the well-documented prevalence of C. auris 9

worldwide, relatively little is known about the Agg phenotype of the organism. The 10

existence of four geographically and phylogenetically distinct clades of the organism 11

[2], and a fifth recently proposed [9], has restricted a definitive profiling of C. auris 12

pathogenic mechanism of these aggregates in regard to biofilm forming capabilities, 13

drug resistance pathways and interactions with the host. Of the publications that 14

exist, these have documented characteristic pathogenic traits for both phenotypes in 15

vitro and in vivo [6, 10, 11]. Others have shown that the Agg phenotype is inducible 16

under certain conditions [7, 8], whilst histological analyses of murine models have 17

shown that aggregates can accumulate in organs following C. auris infection [7, 12, 18

13]. Therefore, further studies are required to investigate this characteristic Agg 19

phenomenon in C. auris isolates to fully comprehend the pathogenic pathways of the 20

organism, and to understand how such mechanisms may differ from their non-Agg 21

counterparts. 22

Limited evidence also exists for studies investigating the interactions of C. auris with 23

components of the host, although several in vivo models have been employed to 24


https://doi.org/10.1101/2020.04.20.052399

5

document the virulence of C. auris. Of these, Galleria mellonella larvae infection 1

models and murine models of invasive candidiasis have shown varying survival rates 2

post-infection with C. auris [6, 8, 10, 12-15], reaffirming that genetic variability 3

amongst clades impacts the organisms virulence. However, such studies have been 4

limited in investigating the host immune response to the organism. Recently, 5

Johnson et al (2019) utilised a Zebrafish (Danio rerio) model to monitor C. auris-host 6

cell interactions in vivo. This work highlighted that C. auris (strain B11203 Indian 7

isolate phylogenetically part of the South Asian or India/Pakistan clade [2], which 8

appeared to exhibit a non-Agg phenotype) was resistant to neutrophil-mediated 9

killing, suggesting that the organism has the ability to persist incognito in the host 10

[16]. In vitro studies have shown interactions between C. auris and epithelial tissue, 11

emphasizing that the organism can persist on skin. In this study, Horton and 12

colleagues (2020) demonstrated that C. auris (B11203 strain, as above) formed 13

high-burden biofilms on porcine skin biopsies in the presence of an artificial sweat 14

medium [17]. To date, no studies have investigated the host inflammatory response 15

to the non-Agg and/or Agg phenotype. 16

In this study, we sought to investigate the level of heterogeneity amongst different 17

non-Agg and Agg isolates. We deemed this pertinent given that such traits of 18

heterogeneity amongst isolates have previously been described for other Candida 19

species, significantly impacting clinical outcomes and mortality rates [18]. To further 20

investigate this Agg versus non-Agg phenotype, transcriptome analyses were 21

performed on planktonic cells and biofilms of two selected isolates from the initial 22

pool. Upon completion of these analyses, we discovered that several genes 23

associated with cell membrane and/or cell wall proteins (e.g. cellular components) 24

were upregulated in the Agg biofilm. Such unique transcriptional profiles in respect to 25


https://doi.org/10.1101/2020.04.20.052399

6

the cellular components led us to investigate the host response following stimulation 1

with both C. auris phenotypes in vitro. For this, a two- and three-dimensional skin 2

wound model was employed to investigate the epithelial response to the Agg and 3

non-Agg isolates of C. auris. Both skin wound models exhibited different profiles to 4

both isolates indicating unique fungal recognition and/or host response to the Agg 5

and non-Agg phenotype. Interestingly, there was minimal response by the host to C. 6

auris without induction of the wound, suggestive the organism relies on loss of tissue 7

integrity to become invasive. 8

9

Methods 10

Microbial growth and standardisation 11

For in vitro biofilm biomass assessment, a pool of aggregating (Agg; n=12) and 12

single-celled, non-aggregative (non-Agg; n=14) C. auris clinical isolates (gifted by Dr 13

Andrew Borman and Dr Elizabeth Johnson, Public Health England, UK). All C. auris 14

isolates were stored in MicrobankTM beads (Pro-lab Diagnostics, UK) prior to use. 15

Each isolate was grown on Sabouraud dextrose (SAB) agar (Oxoid, UK) at 30˚C for 16

24-48 h then stored at 4˚C prior to propagation in yeast peptone dextrose (YPD; 17

Sigma-Aldrich, UK) medium overnight (16 h) at 30˚C, gently shaking at 200 rpm. 18

Cells were pelleted by centrifugation (3,000 x g) then washed two times in phosphate 19

buffered saline (PBS). Cells were then standardised to desired concentration 20

following counting using a haemocytometer, then resuspended in selected media for 21

each assay, as described within. 22

C. auris isolate phenotypes were determined visually by suspending one colony in 1 23

mL (PBS, Sigma-Aldrich, UK). Isolates were termed as ‘aggregators’ if the added 24


https://doi.org/10.1101/2020.04.20.052399

7

colony did not disperse upon mixing in PBS. For RNA sequencing and transcriptional 1

analysis of C. auris biofilms and co-culture systems, one Agg (NCPF 8978) and non-2

Agg (NCPF 8973) isolate was used. 3

4

Biofilm growth and biomass assessment 5

Fungal cells were adjusted to 1 x 106 cells/mL in Roswell Parks Memorial Institute 6

(RPMI) media (Sigma-Aldrich, UK) and biofilms formed for 4 or 24 hours at 37˚C in 7

flat-bottom wells of 96-well plates (Corning, UK). Appropriate media controls were 8

included on each plate to test for contamination. Following incubation, biofilms were 9

washed gently once in PBS to remove any non-adhered cells. The biomass of each 10

biofilm was determined via 0.05% crystal violet (CV) staining as described previously 11

[19]. Absorbance of the CV stain was measured spectrophotometrically at 570nm in 12

a microtiter plate reader (FLUOStar Omega, BMG Labtech, UK). 13

14

Monitoring the growth of Candida auris biofilms in real time 15

The xCELLigence real time cell analyser (RTCA, ACEA Bioscience Inc, San Diego, 16

CA) was used to monitor the formation of C. auris biofilms in real time using electron 17

impedance measurements (presented as cell index, CI) which is directly related to 18

cell attachment and proliferation. In brief, the E-plate containing 100 µL of pre-heated 19

RPMI medium was loaded into the RTCA which had been placed in the incubator 2 h 20

prior to the experiment to test media impedance and electrode connectivity. Cultures 21

of each C. auris isolate used in this study were standardised to 2 x 106 CFU/mL and 22

added to the E-plate in 100 µL aliquots in triplicate. Appropriate media controls 23

minus inoculum were also included in triplicate. Biofilm formation was measured over 24


https://doi.org/10.1101/2020.04.20.052399

8

24 hours with CI readings taken every 5 minutes. Normalised CI values were 1

exported from the RTCA software and analysed in GraphPad Prism (version 8; 2

GraphPad Software Inc., La Jolla, CA). More detailed descriptions for this technology 3

can be found elsewhere [20]. 4

5

Two-dimensional monolayer co-culture model 6

Adult human epidermal keratinocytes (HEKa) cells (Invitrogen, GIBCO®, UK) were 7

used for two-dimensional co-culture experiments. Frozen stocks of HEKa cells (1 x 8

106 cells/ml; passage number lower than 10) were revived and seeded in T-75 tissue 9

culture flasks (Corning, UK) in media 154 (Thermo-Fisher, UK) supplemented with 10

100 U/ml of pen/strep and human keratinocyte growth supplement (HKGS) (Thermo-11

Fisher, UK). The flasks were incubated at 37°C (5 % CO2) and media was changed 12

every 48 h until the cells reached 80-90% confluence [21]. Confluent cells were 13

passaged using 0.05% trypsin EDTA (Sigma-Aldrich, UK) and the enzymatic 14

reaction inhibited using trypsin neutralizer solution (Sigma-Aldrich, UK). Passaged 15

cells were then seeded into 24-well plates (Corning, UK) at final concentration 2 x 16

105 cells/ml. After 24 to 48 h the cells reached the adequate confluence for C. auris 17

co-culture experiments as described below. 18

19

Three-dimensional human epidermis co-culture model 20

Reconstituted human epidermis (RHE) used for 3D co-culture experiments was 21

purchased from Episkin (Skin Ethic™, Lyon, France http://www.episkin.com). RHE 22

was formed from normal human keratinocytes cultured on an inert polycarbonate 23

filter at the air-liquid interface, in a chemically defined medium grown to 17-day 24


https://doi.org/10.1101/2020.04.20.052399

9

maturity. This model is histologically similar to in vivo human epidermis. Upon arrival 1

and prior to experimental set-up, RHE was incubated with maintenance media in 24-2

well plates (Corning, UK) for 24 h, 5% CO2 at 37oC. Maintenance media was 3

replaced then the co-culture three-dimensional system was set up as described 4

below. 5

6

Wound model in two-dimensional and three-dimensional co-culture systems 7

HEKa cell monolayers were scratched using a similar method to as previously 8

described to mimic a wound model [22, 23]. Briefly, monolayers were grown to 9

confluence as described above then three parallel scratches were introduced across 10

the surface using a 100 μL pipette tip prior to inoculation with C. auris. For RHE, a 11

19-gauge needle was used to scratch the tissue. For all co-culture experiments, Agg 12

C. auris NCPF 8978 and non-Agg C. auris NCPF 8973 were grown as described 13

above, then standardised to 2 x 106/mL (multiplicity of infection of 10 to HEKa cells; 14

MOI 10, and as previously described for Candida-tissue co-culture [24]). For the two-15

dimensional system, 2 x 106/mL C. auris was prepared in 500µL supplemented 16

media 154 and added directly to the confluent HEKa cells. For the three-dimensional 17

co-culture model, 2 x 106/mL C. auris was prepared in 100µL of sterile PBS and this 18

suspension was added directly to the RHE tissue. All experiments were conducted 19

for 24 hr at 5% CO2. Infected non-scratched HEKa cells and RHE tissue were used 20

as controls e.g., no wound, and uninoculated co-cultured cells or tissues were also 21

included for all experiments. All control and wounded models were infected in 22

triplicate with both isolates of C. auris. 23

24


https://doi.org/10.1101/2020.04.20.052399

10

Histological staining of skin epidermis 1

Following co-culture with C. auris, epithelial tissue was carefully cut from the 0.5 cm2 2

insert using a 19-gauge needle and washed three times in sterile PBS to remove 3

non-adherent cells in a similar manner as previously described [25], as summarized 4

in the schematic in Figure 1. Tissue was then fixed in 10% neutral-buffered formalin 5

prior to embedding in paraffin. A Finnesse ME+ microtome (Thermo Scientific, UK) 6

was used to cut 2 μm sections and tissue sections stained with haematoxylin and 7

eosin, or with the fungal specific Periodic acid-Schiff (PAS) reagents and counter-8

stained with haematoxylin. 9

10

Epithelial cell viability 11

To assess any cytotoxic effects of C. auris on HEKa cells and RHE tissue, a Pierce 12

lactate dehydrogenase (LDH) Cytotoxicity Assay Kit (Thermo Scientific; UK) was 13

used according to the manufacturers’ instructions. Following co-culture, cell or tissue 14

spent media was assayed using the above kit to quantify the level of LDH release as 15

a measure of host cellular disruption. 16

17

Differential gene expression analysis 18

HEKa cells and RHE tissue following co-culture were lysed in RLT lysis buffer 19

(Qiagen Ltd, UK) containing 0.01% (v/v) β-2-mercaptoethanol (β2ME) before bead 20

beating. All RNA was extracted using the RNeasy Mini Kit according to 21

manufacturers’ instructions (Qiagen Ltd, UK) and quantified using a NanoDrop 1000 22

spectrophotometer [Thermo Scientific, UK]. RNA was converted to complementary 23


https://doi.org/10.1101/2020.04.20.052399

11

DNA (cDNA) using the High Capacity RNA to cDNA kit (Life Technologies, UK) as 1

per the manufacturer’s instructions. Gene expression was assessed using SYBR 2

GreenER based-quantitative polymerase chain reaction (qPCR) or RT2 profiler arrays 3

(Qiagen Ltd, UK). For SYBR GreenER based-qPCR analyses, the following PCR 4

thermal profiles was used; holding stage at 50˚C for 2 minutes, followed by 5

denaturation stage at 95˚C for 10 minutes and then 40 cycles of 95˚C for 3 seconds 6

and 60˚C for 15 seconds. qPCR plates were run on the StepOnePlus™ Real-Time 7

PCR System. The following primer sequences were used for SYBR GreenER based-8

qPCR analyses of host cells; GAPDH, forward primer, 5’ to 3’, 9

CAAGGCTGAGAACGGGAAG and reverse primer, 5’ to 3’, 10

GGTGGTGAAGACGCCAGT [26]; IL8, forward primer, 5’ to 3’, 11

CAGAGACAGCAGAGCACACAA and reverse primer, 5’ to 3’, 12

TTAGCACTCCTTGGCAAAAC [27]. For gene expression analyses of C. auris, 13

primers for adhesin gene ALS5 and proteinase gene SAP5 were used as follows; 14

ALS5; forward primer, 5’ to 3’, ATACCAGGGTCGGTAGCAGT and reverse primer, 15

5’ to 3’, CTATCTTCGCCGCTTGGGAT and SAP5; forward primer, 5’ to 3’, 16

GGATGCAGCTCTTCCTGGTT and reverse primer, 5’ to 3’, 17

CTTCCAGTTTGCGGTTGTGG. For other gene expression analyses of RHE tissue, 18

a custom designed RT2 Profiler PCR array was compiled containing primers for 19

genes associated with inflammation and fungal recognition or stimulation of host 20

tissue. For these arrays, the following thermal cycle was used on the MxProP 21

Quantitative PCR machine; 10 minutes at 95oC followed by 40 cycles of 15 seconds 22

at 95oC and 60 seconds at 60oC, and data assembled using MxProP 3000 software 23

(Stratagene, Netherlands). Expression levels for all genes of interest were 24

normalized to the housekeeping gene, β-actin for C. auris gene expression and 25


https://doi.org/10.1101/2020.04.20.052399

12

GAPDH for mammalian cells, according to the 2-ΔCt method, and then quantified 1

using the 2-ΔΔCt method [28]. 2

3

RNA sequencing 4

For RNA sequencing of C. auris biofilms, RNA was extracted from 24-h C. auris 5

biofilms as described previously [29]. In brief, biofilms were grown as above on 6

Thermanox coverslips (Thermo-Fisher, UK) in 24 well plates (Corning, UK). Biofilms 7

were removed from coverslips by sonication at 35 kHz for 10 minutes in a sonic bath 8

in 1 ml of PBS and the sonicate transferred to a 2.0 ml RNase-free bead beating 9

tube (Sigma-Aldrich, UK). Cells were homogenized in TRIzol ™ (Invitrogen, UK) with 10

0.5 mm glass beads using a BeadBug microtube homogeniser for a total of 90 11

seconds (Benchmark-Scientific, USA). RNA was then extracted as described above 12

using the RNeasy Mini Kit according to manufacturers’ instructions (Qiagen Ltd, UK). 13

Following extraction, RNA quality and quantity were determined using a Bioanalyzer 14

(Agilent, USA), where a minimum RNA integrity number and quantity of 7 and 2.5 µg, 15

respectively were obtained for each sample. Annotation of data following sample 16

submission to Edinburgh Genomics (http://genomics.ed.ac.uk/) was completed as 17

previously described [30]. Briefly, raw fastq reads were trimmed and aligned to the 18

Candida auris representative genome B8441 using Hisat2 [31]. Reads were then 19

processed and assembled de novo using the Trinity assembly pipeline [32]. Trinotate 20

and Blast2Go were utilised to assign gene IDs to homologous sequences using 21

BLAST and Interpro [33, 34]. Differential expression analysis was performed 22

according to DESeq2 pipeline and functional over representation was determined 23

using GOseq [35, 36] within R. Additionally visualisation of overrepresented 24


https://doi.org/10.1101/2020.04.20.052399

13

pathways were drawn within R. Raw data files for these analyses are deposited 1

under accession no. PRJNA477447 2

(https://www.ncbi.nlm.nih.gov/bioproject/477447). 3

4

Statistical analysis 5

Statistical analyses were performed using GraphPad Prism. Two-tailed paired or 6

unpaired Student’s t-tests were used to compare the means of two samples as 7

stated within, or one-way analysis of variance (ANOVA) to compare the means of 8

more than two samples. Tukey’s post-test was applied to the p value to account for 9

multiple comparisons of the data. P-values of <0.05 were considered statistically 10

significant. 11

12

Results 13

The Agg phenotype is a unique trait of C. auris, one that can influences the 14

organisms pathogenic traits in vitro and in vivo [6, 10, 11]. To corroborate these 15

previous observations, differences in early and late biofilm formation were assessed 16

between non-Agg and Agg isolates of C. auris. A total of 26 non-Agg and Agg C. 17

auris clinical isolates were screened during early (4 h) and mature (24 h) biofilm 18

growth stages (Figure 2A and B). Both sets of non-Agg and Agg C. auris isolates 19

formed biofilms in a time-dependant manner as assessed by crystal violet staining. 20

With the exception of NCPF 8993 (non-Agg) and NCPF 8996 (Agg), all isolates 21

formed biofilms with greater biomass after 24 hours culture compared to 4 hours 22

(Figure 2C and D). Although, the Agg phenotype tended to form biofilms with greater 23

biomass at both 4 h and 24 h, we observed no statistical differences when 24


https://doi.org/10.1101/2020.04.20.052399

14

collectively comparing all non-aggregating and aggregating isolates of C. auris at 1

either timepoint (Supplementary Figure 1A and B). From this data, it was clear that 2

some isolates formed biofilms with greater biomass than others, suggestive of a 3

certain level of heterogeneity between isolates of Agg and non-Agg phenotype, in 4

line with previous observations [6, 10, 37]. Similar trends of biofilm heterogeneity 5

were observed when monitoring biofilm formation via impedance measurements in 6

real time at both timepoints in non-Agg and Agg phenotype (Figure 2E-H and 7

Supplementary 1C and D). These data support corroboration of these unique 8

phenotypes. 9

To further study the pathogenic and biofilm-forming characteristics of Agg and non-10

Agg C. auris, transcriptional profiling of 24-hour planktonic vs biofilm phenotypes 11

was performed. For these studies, two clinical isolates from the initial pool tested 12

were selected for analysis (non-Agg NCPF 8973 and Agg NCPF 8978, indicated by 13

the red points in Figure 2). Firstly, we found that a total of 701 genes were 14

upregulated in planktonic and/or biofilm form of Agg compared to the non-Agg 15

phenotype, of which 450 genes were upregulated in the biofilm state (Figure 3A). 16

Conversely, less genes (430) were upregulated in non-Agg C. auris in the planktonic, 17

biofilm or both states compared to Agg C. auris counterparts, with 190 genes up-18

regulated in the biofilm form (Figure 3B). In order to understand the functional 19

processes related to differentially expressed genes, a cut-off of 2-fold up-regulation 20

was used for gene ontology (GO) analysis (adjusted P value of < 0.05). Up-regulated 21

genes in non-Agg vs. Agg C. auris biofilms normalized to planktonic cell expression 22

involved three functional classes; biological processes (BP), cellular components 23

(CC) and metabolic functions (MF) (Supplementary Figure 2A and B). Interestingly, 24

most genes upregulated in the Agg biofilm belonged to the CC functional class; over 25


https://doi.org/10.1101/2020.04.20.052399

15

40 genes related to membrane and cell wall constituents were upregulated in the 1

Agg form compared to the non-Agg phenotype (Figure 3C). Several genes 2

associated with fungal cell wall proteins were upregulated in the Agg biofilms 3

including TSA1, ECM33, MP65 and PHR1 (Supplementary Figure 2C). Moreover, 4

included in these 40 genes were members of the ALS family of adhesins such as 5

ALS1. On the contrary, in the non-Agg biofilms, the greatest changes in expression 6

were observed for genes belonging to functional classes of BP and MF 7

(Supplementary Figure 2C). Only a small number of genes belonging to cellular 8

components were upregulated in the non-Agg compared to Agg biofilm (Figure 3D). 9

The observed differences in the transcriptional profiles of genes belonging to the CC 10

of C. auris could impact the ability of the host to recognize the two phenotypes. Key 11

cellular components such as ALS proteins of other Candida species, such as 12

Candida albicans play important roles in aiding host colonization and orchestrating 13

the innate immune response [38, 39]. However, it is currently unknown whether 14

similar mechanisms exist for C. auris. Therefore, the following section investigates 15

whether a non-Agg or Agg phenotype dictates the response by the host to C. auris. 16

For this, a two- and three-dimensional skin epithelial model was employed to study 17

the host response to the two C. auris used above. For both co-culture skin systems, 18

a wound was induced to mimic the possible entry site of patients for C. auris in 19

healthcare environments. In the two-dimensional model containing adult human 20

epidermal keratinocytes (HEKa) cells, both isolates were significantly more cytotoxic 21

to host cells following induction of the wound (Figure 4A; **** p < 0.001). Intriguingly, 22

Agg C. auris was significantly more cytotoxic than non-Agg form in the wound model 23

(Figure 4A; §§ p < 0.01). It is noteworthy that wounded monolayers minus inoculum 24

were comparable to untreated monolayers (data not shown), suggestive that 25


https://doi.org/10.1101/2020.04.20.052399

16

induction of the wound did not induce cytotoxic effects on the cells. A similar trend in 1

cytotoxicity was observed between the two isolates in the three-dimensional model 2

(Episkin, SkinEthicTM reconstructed human epidermis; RHE) although this did not 3

reach statistical significance (Figure 4B). Interestingly, cytotoxicity of Agg and non-4

Agg C. auris were comparable in both co-culture models minus wounds. 5

To further study the host response in the three-dimensional system, a transcriptional 6

response was investigated using a RT2 profiler array containing primers specific for 7

genes associated with inflammatory responses and/or fungal recognition (Figure 8

4C). Upon investigation, it was evident that the greatest changes in gene expression 9

were observed in the wound models for both C. auris isolates. Importantly, induction 10

of the wound minus C. auris did not significantly alter the expression of any of the 11

genes arrayed. In the wound model, pro-inflammatory cytokines TNFα and IL1β (* 12

p<0.05) were significantly upregulated in RHE tissue cultured with non-Agg C. auris. 13

Conversely, the Agg phenotype of C. auris induced the greatest changes in RHE; the 14

expression of 8 of the 11 genes profiled (IL1β, *p<0.05; TNF, IL6, CAMP, ** p<0.01; 15

CFS2, CFS3, CLEC7A, *** p<0.001; TLR4, **** p<0.0001) were all significantly 16

upregulated following co-culture compared to the untreated tissue. 17

In the three-dimensional co-culture system, it was evident from histological and 18

fungal specific Periodic acid-Schiff (PAS) staining that the both isolates of C. auris 19

had adhered to the peripheral keratinised layer of the RHE tissue (Supplementary 20

Figure 3). Uninfected tissue displayed a well-organized multi-layered structure 21

characteristic of skin epidermis in vivo (Supplementary Figure 3A). However, in 22

infected tissue, there was no sign of C. auris infiltration into the tissue 23

(Supplementary Figure 3A and B) as seen with previous publications of skin tissue 24

infection models with invasive C. albicans [24, 40]. Unfortunately, loss of tissue 25


https://doi.org/10.1101/2020.04.20.052399

17

integrity in the wounded model rendered them unsuitable for histological staining 1

therefore at this juncture we were unable to visualize whether C. auris invaded the 2

tissue at the wound site. Nonetheless, given that the expression of several important 3

cell membrane and wall proteins are differentially regulated in non-Agg and Agg 4

phenotypes of C. auris biofilms, we finally wanted to assess the expression of two 5

key virulence factor genes belonging to the ALS and SAP families, respectively. 6

ALS5 and SAP5 were both up-regulated in the Agg phenotype compared to the non-7

Agg C. auris isolate in the three-dimensional tissue model (Figure 4D and 4E). Such 8

a response in the Agg isolate may begin to elucidate the mechanism by which this 9

phenotype generated a greater inflammatory response within the tissue. 10

11

Discussion 12

Results from this study further indicates that the Agg phenotype of C. auris 13

determines its pathogenicity in vitro. This phenotype, first reported by Borman et al 14

(2016), characterised in certain isolates by the formation of individual yeast cells 15

mixed with large aggregations in planktonic form [6]. This aggregating behaviour was 16

later shown to affect biofilm formation, antifungal susceptibility and virulence of the 17

organism [6, 10, 11, 37]. Moreover, aggregation has recently been found to be an 18

inducible trait triggered by sub-inhibitory concentrations of triazole and echinocandin 19

antifungals, suggestive that treatment regimens must be carefully considered to 20

combat C. auris dependant on its Agg phenotype [8]. In this study, we report a 21

previously described RNA-sequencing approach [30] in order to compare the 22

transcriptional responses of one non-Agg (NCPF 8973) and one Agg (NPCF 8978) 23

isolate of C. auris during formation of biofilms from planktonic cells. These analyses 24


https://doi.org/10.1101/2020.04.20.052399

18

indicated that several key cell membrane and cell wall components were upregulated 1

in Agg biofilms, many of which involved in cell adhesion to abiotic surfaces and host 2

cells. These observations led us to pose the question: how would the host respond 3

to the two phenotypes? As such, we document for the first time an investigation into 4

the host skin epithelial response to Agg and non-Agg C. auris. 5

Given the clear differences in virulence traits of the non-Agg and Agg phenotype, we 6

deemed it pertinent to study in greater detail the transcriptional profiles of one non-7

Agg and one Agg C. auris. These two isolates displayed the heterogeneity exhibited 8

by other Agg and non-Agg isolates, with the NCPF 8973 isolate forming a denser 9

biofilm after 24 h (as shown here in Figure 2 by the red data points, and elsewhere 10

[10]). However, irrespective of the biofilm-forming capabilities, transcriptome 11

analyses showed that an increased number of genes were upregulated in the Agg 12

compared to the non-Agg biofilms (450 vs 194 genes, respectively; Figure 3), 13

suggestive that the clustering of aggregated cells greatly impacts the transcriptome 14

of the organism during the formation of a biofilm. Of these differential responses in 15

the two biofilm phenotypes, a vast number of genes upregulated in the Agg biofilm 16

belonged to CC as assessed using GO analyses Specifically, several cell wall genes 17

were upregulated in the Agg phenotype e.g., TSA1, ECM33, MP65, ALS1 and 18

PHR1. In C. albicans, ECM33 and MP65 have been implemented as important 19

proteins in maintenance of fungal cell wall integrity, biofilm formation and stress 20

responses [41-43]. Furthermore, the ALS family of adhesin proteins and PHR family 21

of extracellular transglycosylases also function as important regulators of biofilm 22

formation in C. albicans [44, 45]. For example, loss of function of PHR and ALS 23

proteins results in impaired adhesion and biofilm development [46, 47]. It must be 24

noted here that such comparisons between findings on C. auris and C. albicans 25


https://doi.org/10.1101/2020.04.20.052399

19

biofilms must be taken with a certain degree of caution given the lack of true hyphal 1

formation of C. auris isolates grown in biofilms [6], although such a trait can be 2

induced under certain conditions [7, 14]. Nevertheless, such in-depth analyses, as 3

those documented herein, may begin to explain the mechanisms behind aggregate 4

formation in biofilms of some C. auris isolates. 5

Most of the aforementioned genes (TSA1, ECM33, MP65, ALS1 and PHR1) have 6

multiple functions in C. albicans pathogenicity, particularly in biofilm formation as 7

discussed above. In addition, most also play key roles in attachment and/or survival 8

within the host in other fungal species. For example, TSA1, which encodes for a 9

protein called thiol-specific antioxidant 1, has been identified in C. albicans and 10

Cryptococcus neoformans, and functions as an important stress response regulator 11

in unfavourable oxidative environments [48, 49]; potentially those generated by the 12

host[50]. In C. albicans, ECM33, MP65 and PHR1 have been shown to be important 13

genes necessary for production of proteins involved in adherence and invasion of 14

host cells [41-43, 46]. For example, in similar three-dimensional reconstituted skin 15

and oral epithelial co-culture models, heterozygous mutants of ECM33 and PHR1 16

displayed clear deficiencies in penetration of epithelial cell layers leading to reduced 17

tissue invasion and subsequent cellular damage [42, 46]. Finally, another gene 18

upregulated in Agg C. auris biofilms was ALS1, a member of the ALS family of 19

adhesin proteins. This cohort of adhesin proteins which contains at least 8 members 20

in C. albicans are well documented virulence factors, particularly in host-pathogen 21

interactions in vitro and in vivo [44, 51, 52]. Concerning the results shown in this 22

study, the role of ALS1, which encodes for the protein Als1p, in Candida-host 23

interactions remains unclear. As such, contradictory reports state a role for this 24

adhesion in attachment to epithelial cells. Kamai and colleagues (2002) showed that 25


https://doi.org/10.1101/2020.04.20.052399

20

heterozygous knockouts of ALS1 were unable to colonize oral tissues of mice in vivo 1

and ex vivo as efficiently as wildtype strains or knockouts coupled with the Als1p 2

reinstated [53]. On the contrary, it was shown that attachment of the C. albicans 3

ALS1 null mutant to oral epithelial cells was no different than wildtype controls, 4

suggestive its role in adhesion was not as important as other ALS family members 5

[54]. Nevertheless, as discussed briefly above, such comparisons between C. auris 6

and C. albicans interactions with host cells must be tentatively compared given the 7

differences in the morphological forms of the two species. In particular, the transition 8

from yeast to hyphae in C. albicans is essential for tissue invasion of mucosal 9

surfaces. For example, fungal invasion mechanisms have been identified that show 10

morphological changes from yeast, to pseudohyphae, to hyphae during the process 11

of adhesion and invasion in C. albicans in epithelial tissue [55, 56]. This process is 12

even essential for the discrimination of commensal and pathogenic forms of C. 13

albicans by the host [57]. Given its inability to form hyphae under normal 14

physiological conditions, how C. auris can invade epithelial tissue is unknown. It is 15

possible that the organism has adapted slightly different invasive mechanisms. 16

However, at this juncture, further studies are necessary to elucidate such 17

mechanisms. 18

It has been postulated that C. auris exhibits a level of immune evasion to bypass our 19

immunological defences [4]. Recent work by Johnson et al (2019) showed that C. 20

auris were resistant to neutrophil-mediated killing by failing to stimulate neutrophil 21

elastase trap (NET) formation both in vitro and in vivo in a zebrafish infection model 22

[16]. Another study found that viable C. auris did not induce an inflammatory 23

response in human peripheral blood mononuclear cells (PBMCs), although fungal 24

cells were recognized and engulfed by human monocyte-derived macrophages. 25


https://doi.org/10.1101/2020.04.20.052399

21

Conversely, such host responses were significantly greater against other Candida 1

species such as Candida tropicalis, Candida guilliermondii and Candida krusei [58]. 2

It is apparent from these studies that the host recognizes yet fails to generate an 3

effective immune response against C. auris. From the results described here, it is 4

evident that C. auris is not cytotoxic nor pro-inflammatory to intact skin epithelial cells 5

or epidermis tissue. Only following induction of a wound in these models did C. auris 6

elicit any significant response by the host. From this, it could be suggested that 7

under normal immunological conditions, the organism is non-invasive, and any 8

immune response from the host is minimal. These postulations have been confirmed 9

elsewhere, whereby immunocompetent mice were more resistant to C. auris 10

infection than immunocompromised mice [15]. Such findings have been seen in 11

humans; invasive C. auris infections generally occur in critically ill patients with 12

serious underlying medical conditions resulting in haematological deficiencies and/or 13

immunosuppression [59-61]. In the context of this study, the observed non-invasive 14

phenotype of C. auris may simply be due to lack of hyphal formation, whereby yeast 15

cells colonize the periphery of the skin yet do not invade the underlying layers unless 16

in the presence of a wound. Indeed, similar observations have been made 17

elsewhere. Horton et al (2020) recently showed that C. auris forms layers of cells on 18

the periphery of porcine skin ex vivo, however, these structures of C. auris are 19

devoid of pseudohyphae or hyphae [17]. 20

A limitation from previous studies is the failure investigate the host response to the 21

Agg phenotype expressed by certain isolates. We and others have previously shown 22

that the non-Agg isolate of C. auris are more virulent in G. mellonella larvae models 23

than the Agg counterparts, possibly resulting from enhanced dissemination rates of 24

the single cells [6, 10]. Here, the Agg NCPF 8978 isolate was considerably more 25


https://doi.org/10.1101/2020.04.20.052399

22

cytotoxic and pro-inflammatory than non-Agg NCPF 8973 in the two- and three- 1

dimensional skin models. At this juncture it is unknown why such a response occurs 2

in the host. Murine model of candidiasis have shown that C. auris can accumulate in 3

the kidney of the mice in the form of aggregates [7, 12, 13], suggestive that 4

aggregation may occur in vivo to enable persistence and survival. However, to date, 5

no studies have investigated the host response to such C. auris aggregates in vivo. It 6

could simply be that the Agg phenotype generates a cluster of cells with increased 7

pathogenic traits to induce a greater host response than single cells. This was 8

confirmed by the upregulation of two key adhesin and proteinase genes, ALS5 and 9

SAP5, in the Agg NCPF 8978 isolate compared to non-Agg NCPF 8973 in the skin 10

epidermis model. Interestingly, similar observations have been described in biofilm-11

dispersed single cells vs. aggregates in model bacteria such as Pseudomonas 12

aeruginosa. As such, dispersed aggregates of P. aeruginosa possess enhanced 13

antibiotic resistance traits, likely due to encapsulation by extracellular matrix, and 14

greater immune evasion techniques over dispersed single cells[62-64]. Conversely, it 15

could be argued that the single cell phenotype of C. auris exhibits a level of immune 16

evasion (as postulated elsewhere [16, 65]), which may explain the lack of response 17

by the host to this phenotype. Future studies must continue to investigate the unique 18

Agg phenotype of C. auris to fully clarify the organisms’ pathogenic mechanisms. 19

These investigations must consider interactions between C. auris and other 20

organisms that comprise the skin and/or wound microbiomes, which may function as 21

important beacons for host invasion of C. auris. 22

The identification of five geographically and phylogenetically distinct clades of C. 23

auris [2, 9], containing isolates capable of forming aggregates with enhanced drug 24

resistance, has meant that unravelling the pathogenic mechanisms employed by C. 25


https://doi.org/10.1101/2020.04.20.052399

23

auris in vitro and in vivo remains extremely difficult. This study has highlighted 1

different pathogenic signatures of Agg and non-Agg forms of C. auris in biofilms and 2

during host invasion in vitro. Of course, given the level of heterogeneity amongst 3

isolates, in-depth analyses from this work are limited to one Agg and one-Agg 4

isolate. As such, future studies must continue to investigate these unique phenotypic 5

traits of different Agg and non-Agg isolates of C. auris to fully understand the 6

persistence of this nosocomial pathogen in the healthcare environment, and whether 7

such traits are comparable amongst the diverse isolates. 8

9

Acknowledgements 10

The authors would like to thank the Glasgow Imaging Facility (University of Glasgow) 11

and Margaret Mullin for assistance in scanning electron microscopic techniques. The 12

authors would like to acknowledge funding support of the BBSRC Industrial 13

GlaxoSmithKline CASE PhD studentship for Christopher Delaney (BB/P504567/1). 14

15

Declaration of interest 16

The authors declare no conflicts of interest. 17

18

References 19

1. Kim, M.N., et al., Candida haemulonii and closely related species at 5 20

university hospitals in Korea: identification, antifungal susceptibility, and 21

clinical features. Clin Infect Dis, 2009. 48(6): p. e57-61. 22

2. Lockhart, S.R., et al., Simultaneous Emergence of Multidrug-Resistant 23

Candida auris on 3 Continents Confirmed by Whole-Genome Sequencing and 24

Epidemiological Analyses. Clin Infect Dis, 2017. 64(2): p. 134-140. 25

3. Kean, R. and G. Ramage, Combined Antifungal Resistance and Biofilm 26

Tolerance: the Global Threat of Candida auris. mSphere, 2019. 4(4). 27

4. Kean, R., et al., Candida auris: A Decade of Understanding of an Enigmatic 28

Pathogenic Yeast. J Fungi (Basel), 2020. 6(1). 29


https://doi.org/10.1101/2020.04.20.052399

24

5. Casadevall, A., D.P. Kontoyiannis, and V. Robert, On the Emergence of 1

Candida auris: Climate Change, Azoles, Swamps, and Birds. mBio, 2019. 2

10(4). 3

6. Borman, A.M., A. Szekely, and E.M. Johnson, Comparative Pathogenicity of 4

United Kingdom Isolates of the Emerging Pathogen Candida auris and Other 5

Key Pathogenic Candida Species. mSphere, 2016. 1(4). 6

7. Yue, H., et al., Filamentation in Candida auris, an emerging fungal pathogen 7

of humans: passage through the mammalian body induces a heritable 8

phenotypic switch. Emerg Microbes Infect, 2018. 7(1): p. 188. 9

8. Szekely, A., A.M. Borman, and E.M. Johnson, Candida auris Isolates of the 10

Southern Asian and South African Lineages Exhibit Different Phenotypic and 11

Antifungal Susceptibility Profiles In Vitro. J Clin Microbiol, 2019. 57(5). 12

9. Chow, N.A., et al., Potential Fifth Clade of Candida auris, Iran, 2018. Emerg 13

Infect Dis, 2019. 25(9): p. 1780-1781. 14

10. Sherry, L., et al., Biofilm-Forming Capability of Highly Virulent, Multidrug-15

Resistant Candida auris. Emerg Infect Dis, 2017. 23(2): p. 328-331. 16

11. Short, B., et al., Candida auris exhibits resilient biofilm characteristics in vitro: 17

implications for environmental persistence. J Hosp Infect, 2019. 103(1): p. 92-18

96. 19

12. Ben-Ami, R., et al., Multidrug-Resistant Candida haemulonii and C. auris, Tel 20

Aviv, Israel. Emerg Infect Dis, 2017. 23(1). 21

13. Fakhim, H., et al., Comparative virulence of Candida auris with Candida 22

haemulonii, Candida glabrata and Candida albicans in a murine model. 23

Mycoses, 2018. 61(6): p. 377-382. 24

14. Wang, X., et al., The first isolate of Candida auris in China: clinical and 25

biological aspects. Emerg Microbes Infect, 2018. 7(1): p. 93. 26

15. Xin, H., et al., Experimental Mouse Models of Disseminated Candida auris 27

Infection. mSphere, 2019. 4(5). 28

16. Johnson, C.J., et al., Emerging Fungal Pathogen Candida auris Evades 29

Neutrophil Attack. mBio, 2018. 9(4). 30

17. Horton, M.V., et al., Candida auris Forms High-Burden Biofilms in Skin Niche 31

Conditions and on Porcine Skin. mSphere, 2020. 5(1). 32

18. Rajendran, R., et al., Biofilm formation is a risk factor for mortality in patients 33

with Candida albicans bloodstream infection-Scotland, 2012-2013. Clin 34

Microbiol Infect, 2016. 22(1): p. 87-93. 35

19. Kean, R., et al., Candida albicans Mycofilms Support Staphylococcus aureus 36

Colonization and Enhances Miconazole Resistance in Dual-Species 37

Interactions. Front Microbiol, 2017. 8: p. 258. 38

20. Gutierrez, D., et al., Monitoring in Real Time the Formation and Removal of 39

Biofilms from Clinical Related Pathogens Using an Impedance-Based 40

Technology. PLoS One, 2016. 11(10): p. e0163966. 41

21. Tankersley, A., et al., Early effects of Staphylococcus aureus biofilm secreted 42

products on inflammatory responses of human epithelial keratinocytes. J 43

Inflamm (Lond), 2014. 11: p. 17. 44

22. Wright, C.S., et al., Connexin mimetic peptides improve cell migration rates of 45

human epidermal keratinocytes and dermal fibroblasts in vitro. Wound Repair 46

Regen, 2009. 17(2): p. 240-9. 47

23. Cory, G., Scratch-wound assay. Methods Mol Biol, 2011. 769: p. 25-30. 48

24. Schaller, M., et al., Models of oral and vaginal candidiasis based on in vitro 49

reconstituted human epithelia. Nat Protoc, 2006. 1(6): p. 2767-73. 50


https://doi.org/10.1101/2020.04.20.052399

25

25. Brown, J.L., et al., Biofilm-stimulated epithelium modulates the inflammatory 1

responses in co-cultured immune cells. Sci Rep, 2019. 9(1): p. 15779. 2

26. McKimmie, C.S., et al., Hemopoietic cell expression of the chemokine decoy 3

receptor D6 is dynamic and regulated by GATA1. J Immunol, 2008. 181(11): 4

p. 8171-81. 5

27. Ramage, G., et al., Antifungal, cytotoxic, and immunomodulatory properties of 6

tea tree oil and its derivative components: potential role in management of 7

oral candidosis in cancer patients. Front Microbiol, 2012. 3: p. 220. 8

28. Livak, K.J. and T.D. Schmittgen, Analysis of relative gene expression data 9

using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. 10

Methods, 2001. 25(4): p. 402-8. 11

29. Rajendran, R., et al., Integrating Candida albicans metabolism with biofilm 12

heterogeneity by transcriptome mapping. Scientific Reports, 2016. 6: p. 13

35436. 14

30. Kean, R., et al., Transcriptome Assembly and Profiling of Candida auris 15

Reveals Novel Insights into Biofilm-Mediated Resistance. mSphere, 2018. 16

3(4). 17

31. Kim, D., B. Langmead, and S.L. Salzberg, HISAT: a fast spliced aligner with 18

low memory requirements. Nat Methods, 2015. 12(4): p. 357-60. 19

32. Grabherr, M.G., et al., Full-length transcriptome assembly from RNA-Seq data 20

without a reference genome. Nat Biotechnol, 2011. 29(7): p. 644-52. 21

33. Conesa, A., et al., Blast2GO: a universal tool for annotation, visualization and 22

analysis in functional genomics research. Bioinformatics, 2005. 21(18): p. 23

3674-6. 24

34. Bryant, D.M., et al., A Tissue-Mapped Axolotl De Novo Transcriptome 25

Enables Identification of Limb Regeneration Factors. Cell Rep, 2017. 18(3): p. 26

762-776. 27

35. Young, M.D., et al., Gene ontology analysis for RNA-seq: accounting for 28

selection bias. Genome Biol, 2010. 11(2): p. R14. 29

36. Love, M.I., W. Huber, and S. Anders, Moderated estimation of fold change 30

and dispersion for RNA-seq data with DESeq2. Genome Biol, 2014. 15(12): p. 31

550. 32

37. Singh, R., et al., Biofilm formation by Candida auris isolated from colonising 33

sites and candidemia cases. Mycoses, 2019. 62(8): p. 706-709. 34

38. Mayer, F.L., D. Wilson, and B. Hube, Candida albicans pathogenicity 35

mechanisms. Virulence, 2013. 4(2): p. 119-28. 36

39. Richardson, J.P., J. Ho, and J.R. Naglik, Candida-Epithelial Interactions. J 37

Fungi (Basel), 2018. 4(1). 38

40. Schaller, M., et al., Invasion of Candida albicans correlates with expression of 39

secreted aspartic proteinases during experimental infection of human 40

epidermis. J Invest Dermatol, 2000. 114(4): p. 712-7. 41

41. Sandini, S., et al., The MP65 gene is required for cell wall integrity, adherence 42

to epithelial cells and biofilm formation in Candida albicans. BMC Microbiol, 43

2011. 11: p. 106. 44

42. Rouabhia, M., et al., Disruption of the ECM33 gene in Candida albicans 45

prevents biofilm formation, engineered human oral mucosa tissue damage 46

and gingival cell necrosis/apoptosis. Mediators Inflamm, 2012. 2012: p. 47

398207. 48


https://doi.org/10.1101/2020.04.20.052399

26

43. Gil-Bona, A., et al., The Cell Wall Protein Ecm33 of Candida albicans is 1

Involved in Chronological Life Span, Morphogenesis, Cell Wall Regeneration, 2

Stress Tolerance, and Host-Cell Interaction. Front Microbiol, 2016. 7: p. 64. 3

44. Hoyer, L.L. and E. Cota, Candida albicans Agglutinin-Like Sequence (Als) 4

Family Vignettes: A Review of Als Protein Structure and Function. Front 5

Microbiol, 2016. 7: p. 280. 6

45. Popolo, L., et al., The PHR Family: The Role of Extracellular 7

Transglycosylases in Shaping Candida albicans Cells. J Fungi (Basel), 2017. 8

3(4). 9

46. Calderon, J., et al., PHR1, a pH-regulated gene of Candida albicans encoding 10

a glucan-remodelling enzyme, is required for adhesion and invasion. 11

Microbiology, 2010. 156(Pt 8): p. 2484-2494. 12

47. Nobile, C.J., et al., Complementary adhesin function in C. albicans biofilm 13

formation. Curr Biol, 2008. 18(14): p. 1017-24. 14

48. Shin, D.H., et al., Characterization of thiol-specific antioxidant 1 (TSA1) of 15

Candida albicans. Yeast, 2005. 22(11): p. 907-18. 16

49. Missall, T.A., M.E. Pusateri, and J.K. Lodge, Thiol peroxidase is critical for 17

virulence and resistance to nitric oxide and peroxide in the fungal pathogen, 18

Cryptococcus neoformans. Mol Microbiol, 2004. 51(5): p. 1447-58. 19

50. Urban, C., et al., The moonlighting protein Tsa1p is implicated in oxidative 20

stress response and in cell wall biogenesis in Candida albicans. Mol 21

Microbiol, 2005. 57(5): p. 1318-41. 22

51. Hoyer, L.L., et al., Discovering the secrets of the Candida albicans agglutinin-23

like sequence (ALS) gene family--a sticky pursuit. Med Mycol, 2008. 46(1): p. 24

1-15. 25

52. Moyes, D.L., J.P. Richardson, and J.R. Naglik, Candida albicans-epithelial 26

interactions and pathogenicity mechanisms: scratching the surface. Virulence, 27

2015. 6(4): p. 338-46. 28

53. Kamai, Y., et al., Contribution of Candida albicans ALS1 to the pathogenesis 29

of experimental oropharyngeal candidiasis. Infect Immun, 2002. 70(9): p. 30

5256-8. 31

54. Murciano, C., et al., Evaluation of the role of Candida albicans agglutinin-like 32

sequence (Als) proteins in human oral epithelial cell interactions. PLoS One, 33

2012. 7(3): p. e33362. 34

55. Gow, N.A., et al., Candida albicans morphogenesis and host defence: 35

discriminating invasion from colonization. Nat Rev Microbiol, 2011. 10(2): p. 36

112-22. 37

56. Naglik, J.R., et al., Candida albicans interactions with epithelial cells and 38

mucosal immunity. Microbes Infect, 2011. 13(12-13): p. 963-76. 39

57. Tang, S.X., et al., Epithelial discrimination of commensal and pathogenic 40

Candida albicans. Oral Dis, 2016. 22 Suppl 1: p. 114-9. 41

58. Navarro-Arias, M.J., et al., Differential recognition of Candida tropicalis, 42

Candida guilliermondii, Candida krusei, and Candida auris by human innate 43

immune cells. Infect Drug Resist, 2019. 12: p. 783-794. 44

59. Emara, M., et al., Candida auris candidemia in Kuwait, 2014. Emerg Infect 45

Dis, 2015. 21(6): p. 1091-2. 46

60. Sarma, S., et al., Candidemia caused by amphotericin B and fluconazole 47

resistant Candida auris. Indian J Med Microbiol, 2013. 31(1): p. 90-1. 48

61. Schelenz, S., et al., First hospital outbreak of the globally emerging Candida 49

auris in a European hospital. Antimicrob Resist Infect Control, 2016. 5: p. 35. 50


https://doi.org/10.1101/2020.04.20.052399

27

62. Secor, P.R., et al., Entropically driven aggregation of bacteria by host 1

polymers promotes antibiotic tolerance in Pseudomonas aeruginosa. Proc 2

Natl Acad Sci U S A, 2018. 115(42): p. 10780-10785. 3

63. Kragh, K.N., et al., Role of Multicellular Aggregates in Biofilm Formation. 4

mBio, 2016. 7(2): p. e00237. 5

64. Cogan, N.G., et al., Predictive Computer Models for Biofilm Detachment 6

Properties in Pseudomonas aeruginosa. mBio, 2016. 7(3). 7

65. Nett, J.E., Candida auris: An emerging pathogen "incognito"? PLoS Pathog, 8

2019. 15(4): p. e1007638. 9

66. Erlandsen, S.L., et al., High-resolution visualization of the microbial glycocalyx 10

with low-voltage scanning electron microscopy: dependence on cationic dyes. 11

J Histochem Cytochem, 2004. 52(11): p. 1427-35. 12

13

Figure legends 14

Figure 1 – Schematic diagram depicting the experimental set up for the three-15

dimensional co culture of skin epidermis and Candida auris. A 17- day mature 16

reconstructed human epidermis (RHE) on 0.5 cm2 inserts was purchased from 17

Episkin (Skin Ethic™). Inserts were carefully lowered into 24- well plates containing 18

maintenance media supplied by the company (panel A). To assess the host 19

response to aggregative and non-aggregative C. auris, control and wounded tissue 20

was co-cultured with both isolates (NCPF 8973 and NCPF 8978) (panel B). A total of 21

2 x 106 fungal cells in 100 µL PBS was added to the tissue and incubated overnight 22

at 37oC, 5% CO2. For some tissues, prior to addition of fungal inoculum, three 23

scratch wounds were induced using a sterile 19 G needle across the surface of the 24

tissue. For visual representation of phenotype, scanning electron microscopy images 25

included in panel B from 24 h biofilms, clearly showing the differences in cellular 26

phenotypes between the two C. auris isolates. These images were taken at x 1000 27

magnification as viewed under a JEOL JSM-6400 scanning electron microscope 28

(samples processed as previously described [66]). 29


https://doi.org/10.1101/2020.04.20.052399

28

Figure 2 – Non-aggregative and aggregative Candida auris biofilm 1

heterogeneity. Biomass and impedance measurements were used as measures of 2

biofilm formation of 26 isolates of C. auris (n=14 for non-aggregative and n=12 for 3

aggregative phenotype). For biomass assessment, 1 x 106 fungal cells were seeded 4

in 96-well plates and biofilm developed for 4 h or 24 h prior to crystal violet staining. 5

Panels A and B show the differences in absorbance at 570nm of the non-6

aggregative and aggregative, at 4 h and 24 h, respectively. The heatmap shows the 7

average absorbance at 570nm for each individual isolate at both timepoints (C and 8

D). The formation of C. auris biofilms in real time was monitored using electron 9

impedance measurements on the xCELLigence real time cell analyser. Electron 10

impedance measurements are presented as cell index for all isolates, for biofilms 11

developed for 4 h and 24 h, respectively (E and F). The heatmap depicts the mean 12

cell index values for all non-aggregative (G) and aggregative (H) isolates. Red data 13

points indicate the two isolates selected for further analyses in this study (NCPF 14

8973 and NCPF 8978). Paired Student’s t-tests were used for statistical analyses 15

and significance between data determined at * p < 0.05 (** p < 0.01, *** p < 0.001, 16

**** p < 0.0001). 17

Figure 3 – Transcriptional profile of non-aggregative and aggregative Candida 18

auris during biofilm formation. RNA from planktonic cells and biofilms formed for 19

24 h of two isolates (NCPF 8973 and NCPF 8978) was used for RNA sequencing 20

and transcriptome analyses as described in the text. Venn diagrams in panels A and 21

B depict up-regulated genes in non-aggregative (A) or aggregative (B) phenotype in 22

either planktonic form (blue circle), biofilm form (red circle) or in both forms (blue and 23

red circle). In panels C and D, gene distribution of significantly upregulated genes in 24

biofilm forms were grouped for gene ontology analysis. Genes upregulated that 25


https://doi.org/10.1101/2020.04.20.052399

29

belong to the functional pathway cellular components are shown, whilst all other 1

pathways are included in supplementary Figure 2. A cut-off of 2-fold up-regulation 2

was used for gene ontology analysis using an adjusted P value of < 0.05. 3

Figure 4 – Cytotoxic and inflammatory effects of aggregative and non-4

aggregative Candida auris on skin epithelial models in vitro. For these analyses, 5

a two- and three-dimensional skin epithelial model was used as schematically 6

described in Figure 1. Firstly, cytotoxicity in the models were determined by 7

quantifying the amount of lactate dehydrogenase (LDH) released by the human adult 8

epidermal keratinocytes (HEKa) (A) and skin epidermis (B) following co-culture with 9

the aggregative (NCPF 8978) and non-aggregative (NCPF 8973) isolates of C. auris. 10

For this, data was presented as fold change relative to PBS control. To study the 11

host response to C. auris, a RT2 profiler array containing genes associated with 12

inflammation and fungal recognition was utilised to assess the transcriptional profile 13

of the skin epidermis following stimulation (C). Data in the heatmap presented as 14

Log2 fold change relative to PBS control. Finally, expression of two virulence genes, 15

ALS5 and SAP5 was determined in the isolates infected on the tissue, values 16

presented as % expression relative to the fungal specific house-keeping gene, β-17

actin (D and E). All epithelial cells or tissues were infected in triplicate and statistical 18

significance determined from raw data CT values using unpaired Student’s t-tests for 19

comparison of two variables or one-way ANOVA with Tukey’s multiple comparison 20

post-test for more than two variables (* p < 0.05, ** and §§ p < 0.01, *** p < 0.001, 21

**** p < 0.0001). 22


https://doi.org/10.1101/2020.04.20.052399


https://doi.org/10.1101/2020.04.20.052399


https://doi.org/10.1101/2020.04.20.052399

Up in Non-AggUp in AggC

C

0 5 10 15 20 25

hyphal cell wall

anchored component of membrane

integral component of plasma membrane

cell surface

fungal−type cell wall

membrane

plasma membrane

Genes

GO

Term

0.00050.00100.00150.00200.0025

P.value

CC

0 2 4 6 8

glyoxysome

myelin sheath

glycine cleavage complex

peroxisome

Genes

GO

Term

0.0060.0080.0100.0120.014

P.value

Biofilm specific terms (Agg) cellular components

Biofilm specific terms (non-Agg) cellular components

A B

C

D


https://doi.org/10.1101/2020.04.20.052399


https://doi.org/10.1101/2020.04.20.052399

Documents

Candida auris phenotypic heterogeneity determines ... · 4 1 Introduction 2 C. auris is a nosocomial pathogen first identified in 2009 [1]. To date, this multidrug 3 resistant organism