Upload
others
View
2
Download
0
Embed Size (px)
Citation preview
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
1 of 12
C A N C E R
Targeting the XPO1-dependent nuclear export of E2F7 reverses anthracycline resistance in head and neck squamous cell carcinomasNatalia Saenz-Ponce1, Rachael Pillay1, Lilia Merida de Long1, Trinayan Kashyap2, Christian Argueta2, Yosef Landesman2, Mehlika Hazar-Rethinam3, Samuel Boros4, Benedict Panizza5,6, Maarten Jacquemyn7, Dirk Daelemans7, Orla M. Gannon1, Nicholas A. Saunders1*
Patient mortality rates have remained stubbornly high (40%) for the past 35 years in head and neck squamous cell carcinoma (HNSCC) due to inherent or acquired drug resistance. Thus, a critical issue in advanced SCC is to identify and target the mechanisms that contribute to therapy resistance. We report that the transcriptional inhibitor, E2F7, is mislocalized to the cytoplasm in >80% of human HNSCCs, whereas the transcriptional activator, E2F1, retains localization to the nucleus in SCC. This results in an imbalance in the control of E2F-dependent targets such as SPHK1, which is derepressed and drives resistance to anthracyclines in HNSCC. Specifically, we show that (i) E2F7 is subject to exportin 1 (XPO1)–dependent nuclear export, (ii) E2F7 is selectively mislocalized in most of SCC and multiple other tumor types, (iii) mislocalization of E2F7 in HNSCC causes derepression of Sphk1 and drives anthra-cycline resistance, and (iv) anthracycline resistance can be reversed with a clinically available inhibitor of XPO1, selinexor, in xenotransplant models of HNSCC. Thus, we have identified a strategy to repurpose anthracyclines for use in SCC. More generally, we provide a strategy to restore the balance of E2F1 (activator) and E2F7 (inhibitor) activity in cancer.
INTRODUCTIONCancers arising from stratified squamous epithelial linings of the upper aerodigestive tract [head and neck squamous cell carcinomas (HNSCCs)] are among the most common cancers globally and are caused by exposure to exogenous carcinogens such as tobacco smoke or excessive alcohol consumption and/or human papillomavirus in-fection (1, 2). On a global scale, there are about 640,000 new cases of HNSCC diagnosed each year (3). Tumors which display no evidence of local, regional, or distant spread are associated with high cure rates after surgery and/or radiation (4). Unfortunately, if the disease pro-gresses and spreads to local, regional, and distant sites, then it is as-sociated with an increasingly poor prognosis (4, 5). In this context, treatment failure and patient mortality rates have remained stubbornly high (40%) for the past 35 years in HNSCC patients (3, 6). This high mortality rate can be attributed to inherent or acquired resistance to chemotherapeutics used for HNSCC (platinum-based drugs, taxanes, epidermal growth factor receptor–targeting therapeutic antibodies, and 5-fluorouracil) (7, 8). Thus, a critical issue in advanced SCC is to identify and target mechanisms that contribute to therapy resistance.
Recent studies have shown that the E2F transcription factor fam-ily is key regulators of chemotherapeutic sensitivity and in particu-lar sensitivity to anthracyclines (9, 10). The E2F transcription factor
family is composed of 8 genes encoding 10 gene products, which bind a consensus E2F response element (TTTSSCGC). E2F family members are classified as transcriptional activators (E2F1, E2F2, and E2F3a) or inhibitors (E2F3b, E2F4, E2F5, E2F6, E2F7a, E2F7b, and E2F8) and are important regulators of proliferation, differentiation, survival, apoptosis, and DNA damage responses (11–14). Many of the func-tions of the E2F family are context-specific. For example, E2F1 has been shown to have both tumor-suppressive and oncogenic activity, depending on the tissue context (15–17). This apparent paradox most likely reflects the dominant activity of E2F1 in apoptosis or prolifer-ation depending on the tissue context.
In the context of unperturbed primary cultures of human kerat-inocytes derived from a stratified epithelium (epidermis), transient overexpression of E2F1 is sufficient to induce apoptosis, which can be antagonized by transient overexpression of E2F7 (18, 19). How-ever, in ultraviolet-irradiated mice, E2F1 displays antiapoptotic and tumor-suppressive properties, whereas overexpression in a transgenic mouse model results in constitutively higher rates of apoptosis and is oncogenic (20, 21). Recently, Thurlings et al. (22) showed that E2F1 ablation in the context of mouse keratinocytes was neither oncogenic nor tumor suppressive in a “skin painting” model of carcinogenesis. However, E2F1 ablation combined with E2F7 and E2F8 ablation re-sulted in increased tumor numbers, suggesting a tumor-suppressive role (22). These studies reinforce the critical importance of consid-ering tissue and cellular context when interpreting E2F action. Here, we have focused on the mechanism of E2F-dependent anthracycline resistance in the context of human HNSCC.
Earlier studies have shown that E2F regulates sensitivity to a num-ber of conventional chemotherapeutics (9). In particular, E2F activity drives resistance to anthracyclines in SCC cell lines in vitro and in vivo (9, 10). This resistance is induced by the overexpression/activation of the interdependent sphingosine kinase-1 (SPHK1) and Rac GTPase activating protein 1 (RACGAP1) pathways. Both RACGAP1 and SPHK1
1Epithelial Pathobiology Group, University of Queensland Diamantina Institute, Princess Alexandra Hospital, Translational Research Institute, Woolloongabba, Queensland 4102, Australia. 2Karyopharm Therapeutics Inc., Newton, MA 02459, USA. 3Massachusetts General Hospital Cancer Center, Harvard Medical School, MA 02114, USA. 4Department of Pathology, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, Australia. 5Department of Ear Nose and Throat, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, Australia. 6School of Medicine, Univer-sity of Queensland, Princess Alexandra Hospital, Woolloongabba, Queensland 4102, Australia. 7Katholieke Universiteit Leuven, Department of Microbiology and Immunology, Laboratory of Virology and Chemotherapy, Rega Institute for Medical Research, Herestraat 49, 3000 Leuven, Belgium.*Corresponding author. Email: [email protected]
Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
2 of 12
are direct transcriptional targets of E2F7, and a causative contribu-tion to anthracycline resistance was shown by genetic knockdown, overexpression, and pharmacological inhibition in vitro and in vivo (9, 10). Moreover, interrogation of human tissue microarrays (TMAs) of HNSCC patients showed that E2F7, SPHK1, and RACGAP1 were overexpressed in human SCC and were linked to a poor prognosis (12). Finally, it was shown that anthracycline resistance was driven by the increase in sphingosine-1-phosphate (S1P) that results from the conversion of sphingosine to S1P by SPHK1 (9, 10). Thus, anthracycline resistance was driven by E2F in an S1P-dependent manner in HNSCC. This was consistent with the literature demon-strating that sphingolipids can regulate proliferation, differentiation, invasion, and apoptotic responses in cancer cells (23–25). Thus, SPHK1 is a key enzyme controlling cytotoxic responses in cancer cells (9). The translational relevance of this is highlighted by reports that a combination of doxorubicin plus a SPHK1 inhibitor caused tumor regression in a xenotransplant model of SCC (9, 10).
Although the above findings suggest a link between E2F activity and SPHK1/S1P-dependent anthracycline resistance, the relationship and mechanism controlling this pathway remain unresolved. For ex-ample, E2F1 and E2F7 are both overexpressed in most of HNSCCs and are mutually antagonistic (26). Therefore, we considered the prop-osition that the increase in E2F-dependent SPHK1 transcription may be due to a pathological imbalance in the ratio of activating E2F1 to inhibitory E2F7 in HNSCC. Consistent with this, we report that, in greater than 80% of HNSCCs, there is a selective relocation of E2F7 from the nucleus to the cytoplasm. We show that this mislocalization is due to exportin 1 (XPO1; also known as chromosomal maintenance 1 or CRM1)–dependent export of E2F7 from the nucleus resulting in derepression of SPHK1. Finally, we show that pharmacological in-hibition of XPO1 reverses the E2F7 pathology and anthracycline re-sistance in cell line and patient xenotransplant models of HNSCC.
RESULTSThe opposing actions of E2F1 and E2F7 control SPHK1 expression and doxorubicin resistanceWe previously identified the SPHK1/S1P pathway as a downstream effector of E2F-dependent resistance to anthracyclines such as doxo-rubicin (9, 10). However, it was not determined whether SPHK1 tran-scription was the result of mutual antagonism between the activating E2F1 and the inhibitory E2F7. To address this, we used a suite of hu-man SCC cell lines that differed in their inherent sensitivity/resistance to doxorubicin (9). We transfected doxorubicin-sensitive cell lines, KJDSV40 [half maximal effective concentration (EC50) = 0.1 M] and FaDu (EC50 = 0.2 M), and doxorubicin-resistant cell lines, SCC25 (EC50 = 1.1 M) and Detroit562 (EC50 = 1.2 M), with small inter-fering RNA (siRNA) targeting E2F1 or E2F7. We achieved a knock-down greater than 70% for the E2F7 protein (Fig. 1A and fig. S1A) and 45% for the E2F1 protein (Fig. 1B and fig. S1B) with their cognate siRNAs compared to cells transfected with vehicle or a scrambled con-trol. Treatment with E2F7 siRNA significantly enhanced SPHK1 pro-tein expression (P < 0.01; Fig. 1, C and D), whereas treatment with E2F1 siRNA significantly reduced SPHK1 protein expression com-pared to controls (P < 0.05; Fig. 1, C and E). A similar result was observed for the expression of SPHK1 mRNA in the SCC25 cell line (fig. S2) as was observed for SPHK1 protein. Finally, as shown by the expression of the apoptotic marker cleaved caspase-3, E2F7 deple-tion significantly reduced doxorubicin cytotoxicity (P < 0.05; Fig. 1,
F and G), whereas E2F1 depletion significantly increased doxorubi-cin cytotoxicity (P < 0.05; Fig. 1, F and H). These data indicate that E2F7 represses SPHK1 expression and increases sensitivity to doxo-rubicin, whereas E2F1 induces SPHK1 expression and induces doxo-rubicin resistance in all the tested SCC cell lines. These data show that SPHK1 expression and doxorubicin sensitivity are regulated by the opposing actions of E2F1 and E2F7.
Chromatin immunoprecipitation (ChIP) analysis of extracts from normal human epidermal keratinocytes (HEKs) and the doxorubicin- resistant SCC25 cells showed that E2F1 and E2F7 could bind the E2F response element within the SPHK1 promoter (Fig. 1I). These data show that SPHK1 is a direct transcriptional target of the activating E2F1 and the inhibitory E2F7 in HEKs and SCC25 cells. In the SCC25 cells, there was more than twice as much E2F1 as E2F7 bound to the SPHK1 promoter (Fig. 1I), but in HEKs, there was more bound E2F7 than E2F1. This contrasts with the observation that E2F7 protein was about 2.5-fold more abundant than E2F1 in the SCC25 cells (Fig. 1, J and K). These data indicate that in SCC25 cells, E2F1 is preferen-tially bound to the SPHK1 promoter despite the higher total cellular E2F7 expression. Because previous studies showed that other members of the E2F family, such as E2F4 and E2F5, are subject to an XPO1- dependent nuclear export (27–29), we examined the subcellular local-ization of E2F1 and E2F7 in SCC25 cells and HEKs to see whether this could explain the observed discrepancy between promoter binding and total cellular E2F7. Immunofluorescent (IF) analysis of the E2F1 protein revealed strong nuclear staining in HEKs and SCC25 cells. In contrast, we found that E2F7 displayed strong cytoplasmic staining and weak nuclear staining in SCC25 cells, whereas in HEKs, we de-tected a strong nuclear staining of E2F7 (Fig. 1L). These data indicate that the reduced nuclear localization of E2F7 may cause derepres-sion of SPHK1 promoter activity and expression in SCC25 cells.
E2F7 is frequently mislocalized in HNSCC lesions and causes doxorubicin resistanceTo extend our observation on the mislocalization of E2F7 in doxorubicin- resistant SCC cells, we examined the subcellular localization of E2F1 and E2F7 in five different SCC cell lines (KJDSV40, FaDu, Cal27, SCC25, and Detroit562). IF analysis showed that E2F1 was predom-inantly nuclear in all of these cell types (Fig. 2A). In contrast, we found that E2F7 was predominantly nuclear only in the KJDSV40 cells, whereas all the remaining cell lines displayed prominent cytoplasmic staining and variable to weak nuclear staining of E2F7 (Fig. 2A). More-over, we examined the localization of other XPO1 cargo such as p53, survivin, and topoisomerase IIa proteins, which have been previously reported to be mislocalized in cancer (30–35). However, we found no evidence of their mislocalization in our SCC cell lines and HEKs (fig. S3). Thus, the mislocalization defect was selective for E2F7. Given that SPHK1 expression is directly controlled by E2F1 and E2F7, we determined whether there was a relationship between the relative nuclear expression of E2F1 and E2F7 and SPHK1 expres-sion and doxorubicin sensitivity. First, we noted that total cellular protein expression for E2F1, E2F7, and SPHK1 increased propor-tionately with increasing doxorubicin resistance (Fig. 2, B and C versus Fig. 1, F to H). However, when we quantitated the nuclear content of E2F7 (E2F7nuc) and expressed it as a ratio of E2F1 pres-ent in the nucleus (E2F7nuc/E2F1), we discovered an association with both SPHK1 expression and doxorubicin sensitivity (Fig. 2D). These data are consistent with our ChIP and IF data (Fig. 1) and show that the extent of E2F7 mislocalization in SCC cells correlates
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
3 of 12
Fig. 1. The opposing transcription-al actions of E2F1 and E2F7 con-trol SPHK1 expression and doxo-rubicin resistance in normal tissue and SCC cell lines. (A and B) The effi-cacy of E2F7 or E2F1-targeting siRNAs at knocking down the ex-pression of their cognate targets in KJDSV40 (abbreviated as KJD), FaDu, SCC25, and Detroit562 (abbreviated as Detroit) cells was analyzed by quantitative Western blot analysis of E2F7 (A) and E2F1 (B) proteins. E2F1 and E2F7 expression was normalized to -actin in all instances. Quantita-tive data presented as means ± SEM of triplicate determinations of two biolog-ical replicates. (C to E) Representative Western blot (C) and (D and E) quan-titative analysis of KJD, FaDu, SCC25, and Detroit cells treated with (i) vehi-cle [1:100 dilution dimethyl sulfoxide (DMSO)], (ii) control -galactosidase (-gal) siRNA, (iii) E2F7-targeting siRNA (D), or (iv) E2F1-targeting siRNA (E) for 48 hours, showing the expression of SPHK1. Normalization and quantitation were performed as described in (A). (F to H) Representative Western blot (F) and (G and H) quantitative analy-sis of cleaved caspase-3 in KJD, FaDu, SCC25, and Detroit cells treated with (i) vehicle (1:100 dilution DMSO), (ii) control -galactosidase siRNA + 1 M doxorubicin, (iii) E2F7-targeting siRNA + 1 M doxorubicin (G), or (iv) E2F1- targeting siRNA + 1 M doxorubicin (H) for 48 hours. Total caspase-3 was used to normalize for changes in ex-pression of cleaved caspase-3. (I) ChIP analysis of E2F1 and E2F7 binding to the SPHK1 promoter in HEKs and SCC25 cells. Nonimmune immunoglobulin G (IgG) was used as control. Quantita-tive data represent means ± range of two biological replicates. (J and K) Represent ative Western blot (J) and quantitative analysis (K) of total extracts of proliferating HEKs and SCC25 cells. Expression was plotted as E2F7/E2F1 ratio and was normal-ized to -actin. (L) IF analysis show-ing the intracellular localization of E2F7 and E2F1 in proliferating HEKs and SCC25 cells. Images are representa-tive of at least three replicates. An un-paired t test was used to compare values of treatment groups to their respective vehicle-treated group. *P < 0.05, **P < 0.01, and ***P < 0.001. DAPI, 4′,6-diamidino-2-phenylindole.
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
4 of 12
Fig. 2. Subcellular mislocaliza-tion of E2F7 is a common defect in HNSCC lesions and accom-panies doxorubicin resistance. (A) Subcellular localization of E2F7 and E2F1 was detected by immunofluorescence in KJD, FaDu, Cal27, SCC25, and Detroit cell lines. DAPI-counterstained nuclei are in blue, phalloidin- counterstained actin filaments in red, and the merge column dis-playing E2F7 or E2F1 are in green. Images are representative of three biological replicates. (B and C) Rep-resentative Western blot (B) and quantitative analysis (C) of total protein extracts from KJD, FaDu, Cal27, SCC25, and Detroit cell lines. Membranes were probed for E2F1, E2F7, and SPHK1. -actin was used as loading control. Quan-titative data represent means ± SD of triplicate determinations of three biological replicates. Ex-pression normalized to that of - actin. (D) Nuclear and cytoplasmic fractions from KJD, FaDu, CAL27, SCC25, and Detroit cells were an-alyzed for total SPHK1 and nu-clear E2F7 and E2F1 expression. Quantitative data for E2F7nuc/E2F1nuc represented as means ± SEM of triplicate determinations of two biological replicates. The EC50 values for KJD, FaDu, Cal27, SCC25, and Detroit cells treated for 48 hours with increasing con-centration of doxorubicin (0 to 3 M) were calculated using data from triplicate determinations of three biological replicates. (E) Nor-mal epithelia and HNSCCs from TMAs were stained for E2F1 and E2F7. Representative expression patterns of E2F7 were classified as nuclear (N) if the staining was detected only in the nucleus, nuclear/cytoplasmic (N/C) if the staining was found in both the cytoplasm and nucleus, or cyto-plasmic if the staining was predom-inantly localized to the cytoplasm. All analysis was carried out by a qualified histopathologist (S.B.) in a blinded manner. (F) For quanti-tative analysis, we pooled data from samples with cytoplasmic or nuclear/cytoplasmic staining and referred to these as N/C. The num-ber of normal epithelium and squa-mous cell carcinomas TMA cores with a N or N/C E2F7 expression pattern was quantified; results are shown as percentages. A Fisher’s exact test was used to compare N to N/C ratios in tissue samples. *P < 0.05. (G) The number of metastatic regional lymph nodes in tumor samples is plotted (x axis) against the percentage of samples that displayed nuclear E2F7 expression (y axis).
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
5 of 12
with the derepression of SPHK1 expression and increasing doxoru-bicin resistance.
Next, we determined whether there was evidence for E2F7 mis-localization in patient SCCs. Immunohistochemical (IHC) analysis showed that E2F7 was mislocalized in 80% of cutaneous or HNSCC patient tumors (P < 0.001) and confirmed that the localization of E2F7 was predominantly nuclear in normal epidermal and mucosal keratinocytes (Fig. 2, E and F). The major shift in subcellular local-ization of E2F7 occurred in the transition from normal tissue to early cancer, characterized as tumors with no nodal involvement. However, there was also an association between increasing cytoplasmic localiza-tion and disease progression in SCCs, as characterized by increasing nodal involvement (Fig. 2G). Finally, analysis of additional cancer TMAs showed that E2F7 was significantly mislocalized in 82% of colorectal cancers, 73% of prostate cancers, and 70% of breast cancers compared to normal tissue controls (P < 0.05; fig. S4). Thus, E2F7 mislocaliza-tion is a common defect in human cancers, where it selectively dis-rupts the E2F1/E2F7 transcriptional balance.
E2F7 is an XPO1 cargo proteinOur finding that E2F7 is mislocalized in SCC suggests that E2F7 may be subject to nucleocytoplasmic shuttling. E2Fs 4 and 5 are known to be exported from the nucleus via XPO1 (27–29). Moreover, XPO1 is overexpressed in a number of tumor types, including HNSCC (36, 37). However, there are no reports of nucleocytoplasmic shut-tling of E2F7 (38), and no E2F has been shown to be mislocalized in human tumors before. Thus, we examined whether the mislocaliza-tion of E2F7 in SCC was due to XPO1-dependent nuclear export of E2F7. We treated SCC25 cells with an XPO1 inhibitor, selinexor (KPT-330), for 4 or 8 hours and examined the subcellular distribution of E2F7 by Western blotting and immunofluorescence (Fig. 3, A to C). This experiment showed that the XPO1 inhibitor induced nuclear accu-mulation of E2F7 in SCC25 cells and significantly (P < 0.05) reduced SPHK1 expression (Fig. 3, A to C). Similarly, transfection of an XPO1 siRNA caused a significant (P < 0.05) redistribution of E2F7 to the nucleus in SCC25 cells (Fig. 3, D to F). Moreover, XPO1 siRNA re-duced SPHK1 protein expression to undetectable levels (Fig. 3, D and E). Similar results were obtained using doxorubicin-resistant Detroit cells (fig. S5). These data show that the mislocalization of E2F7 in drug-resistant SCC cells is reversible with a pharmacological inhib-itor of XPO1. Thus, we examined whether combining doxorubicin with an XPO1 inhibitor would also reverse doxorubicin resistance. Doxorubicin-induced cytotoxicity was significantly enhanced in SCC25 cells (EC50 = 1.9 ± 0.2 M versus 0.4 ± 0.04 M; P < 0.001) when combined with selinexor (Fig. 3, G and H). We also observed a sig-nificant enhancement of EC50 values in Detroit (1.7 ± 0.3 M versus 0.1 ± 0.02 M; P < 0.001; Fig. 3I), Cal27 (0.5 ± 0.02 M versus 0.22 ± 0.02 M; P < 0.001; Fig. 3J), and FaDu cells (0.5 ± 0.02 M versus 0.13 ± 0.01 M; P < 0.001; Fig. 3K), all of which also displayed a mis-localization defect (Fig. 2A). These functional data are further sup-ported by our analysis of the E2F7 sequence using the LocNES tool for predicting nuclear export signals [NESs; (38)]. This analysis showed that E2F7 had a strong nuclear export sequence located at amino acid 1 to 25. Finally, treatment of SCC25 cells with selinexor enhanced doxorubicin sensitivity, whereas simultaneous knockdown of E2F7 significantly (P <0.01) decreased the sensitization (fig. S6). This ex-periment shows that mislocalization of E2F7 drives anthracycline resistance. In contrast, selinexor was unable to enhance the cyto-toxic action of paclitaxel in the SCC25 cells (fig. S7), indicating that
E2F7-dependent drug resistance is not generalized to all anticancer drugs.
E2F7 mislocalization is an actionable pathology in HNSCCTo test the in vivo efficacy of a doxorubicin + selinexor combination, we generated xenotransplant tumors using SCC cells in which E2F7 was mislocalized to the cytoplasm (SCC25 or Detroit cells). Consistent with our in vitro findings, the SCC25 xenotransplant tumors treated with selinexor + doxorubicin were significantly smaller (tumor volume) at day 21 after treatment compared with vehicle or single-agent treat-ment groups (P < 0.05; Fig. 4A). Moreover, the doxorubicin + selinexor combination significantly increased the expression of the apoptosis marker cleaved caspase-3 and significantly reduced the expression of the proliferation marker Ki67 (P < 0.05; Fig 4, B and C). Similarly, selinexor relocalized E2F7 to the nucleus of Detroit cells and was significantly more cytotoxic than vehicle or treatment with selinex-or or doxorubicin alone, as shown by tumor volumes and cleaved caspase-3 and Ki67 staining (P < 0.05; fig. S8A). Notably, IHC anal-ysis showed that selinexor caused nuclear accumulation of E2F7 in the SCC25 tumors (Fig. 4D), thus confirming the pharmacological activity of selinexor.
To validate our observations from cell line xenotransplants, we repeated the drug treatments in two patient-derived xenotransplant (PDX) samples of oral SCC, which displayed cytoplasmic localization of E2F7 (referred to as PDXc) and one PDX in which E2F7 was local-ized to the nucleus (referred to as PDXn). After passage of the original tumor biopsy in mice, we generated sufficient second-generation PDX tumor-bearing mice to examine the effect of the selinexor + doxo-rubicin combination. The PDXc tumors grew at a variable rate, making it difficult to generate meaningful tumor growth rate curves across the treatment groups. Despite this, we found that PDXc tumors dis-played significant increases in cleaved caspase-3 and reduced Ki67 staining in all treatment groups compared to the control group (P < 0.05; Fig 4, E and F). However, treatment with doxorubicin + selinexor significantly increased cleaved caspase-3 staining and reduced Ki67 staining compared to the individual agents (P < 0.001; Fig. 4F). Com-bined, our data demonstrate that selinexor is able to reinstate the nuclear localization of E2F7, resulting in improved sensitivity to the cytotoxic effects of doxorubicin in HNSCC.
Finally, we generated a PDX tumor from a primary tumor in which E2F7 retained nuclear localization (PDXn; fig. S8B). This tumor implant-ed and grew in a synchronous manner across the second-generation mice. Analysis of the tumor growth curves revealed that this tumor was sensitive to doxorubicin alone and failed to show significant en-hancement of sensitivity in response to selinexor or the combination (fig. S8B). These data support our proposition that nuclear expression of E2F7 is required to induce doxorubicin sensitivity. Combined, these studies indicate that the E2F7 mislocalization defect could be used as a marker to stratify patients for inclusion in future clinical trials of a selinexor + doxorubicin combination.
DISCUSSIONAbout 40 to 50% of patients with advanced HNSCCs will die of their disease due to acquired or inherent therapy resistance. Unfortunately, the prognosis for these patients has remained unchanged for over four decades due to the lack of therapies to bypass or reverse drug resistance (3, 4). Hence, there is a large unmet clinical need to iden-tify actionable targets within drug resistance pathways that can be
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
6 of 12
exploited to overcome therapy resistance. We provide evidence that resistance to anthracyclines is driven by E2F in an S1P-dependent manner in SCC. Specifically, we show that anthracycline resistance emerges due to an imbalance between the activating E2F1 and the in-
hibitory E2F7 transcription factors. This imbalance is due to the pathological activation of export of E2F7 from the nucleus via the XPO1 pathway. Overall, our study demonstrates (i) that E2F7 is sub-ject to XPO1-dependent nuclear export; (ii) that E2F7 is selectively
Fig. 3. E2F7 is an XPO1 cargo pro-tein. (A to C) Representative Western blot (A), quantitative analysis (B), and immunofluorescence (C) of nuclear and cytoplasmic (Cyto) expression of E2F7 (A and C) and total expression of SPHK1 (A and B) in SCC25 cells treated with DMSO (1 l/ml) for 8 hours (A) or 1 M selinexor for 4 or 8 hours. For immunofluorescence, cells were treated with vehicle or 1 M selinexor for 24 hours (C). (D to F) Represent-ative Western blot (D), quantitative anal-ysis (E), and immunofluorescence (F) of nuclear and cytoplasmic expression of E2F7 (D and F) and total expres-sion of SPHK1 in SCC25 cells (D and E) treated with DMSO (1 l/ml) for 32 hours, 25 nM of -galactosidase control siRNA for 32 hours, or 25 nM XPO1-targeting siRNA for 24 or 32 hours. For Western blot analysis of nuclear and cytoplasmic expression, membranes were probed for E2F7, SPHK1, XPO1, ASH2L, AKT, and actin. ASH2L and AKT were used for normalization of sub-cellular fractions with actin as a loading control. Data presented as means ± SEM of triplicate determinations of at least two biological replicates. Changes in subcellular location of E2F7 after treatment with 1 M selinexor (C) or 25 nM XPO1-targeting siRNA (F) were confirmed by immunofluorescence. (G) Western blot analysis of vehicle and 1 M selinexor-treated SCC25 cells shows expression of full length and cleaved caspase-3. Actin antibody was used for normalization. (H to K) Cyto-toxicity assay of vehicle and 1 M selinexor-treated SCC25 cells (H), De-troit (I), Cal27 (J), or FaDu (K) cells ex-posed to increasing concentrations of doxorubicin (Dox; 0 to 3 M) for 48 hours. Data presented as means ± SEM of triplicate determinations from three biological replicates. (B and E) An unpaired t test was used to com-pare nuclear E2F7, cytoplasmic E2F7, or total SPHK1 expression between ve-hicle control and the treatment groups (selinexor, -gal siRNA, or XPO1 siRNA); *P < 0.05 and **P < 0.01. (H to J) An unpaired t test was used to compare the EC50 values for doxorubicin in the various SCC cell lines in the presence or absence of 1 M selinexor. **P < 0.01 and ***P < 0.001.
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
7 of 12
mislocalized in greater than 80% of human SCC; (iii) that mislocalization of E2F7 in HNSCC causes derepression of SPHK1 and its catalytic product, S1P, which, in turn, drives anthracycline resis-tance; and (iv) that anthracycline resistance is ac-tionable and can be reversed with an inhibitor of XPO1 in xenotransplant models of HNSCC.
E2F1 and E2F7 are mutually antagonistic, yet both are often overexpressed in cancers such as SCC (9). Despite their mutually antagonistic activity, up- regulation of E2F-dependent gene targets is often observed in cancer, suggesting an imbalance be-tween the activating and inhibitory E2Fs (26). Our study provides an explanation as to how simulta-neous elevation of the mutually antagonistic E2F1 and E2F7 results in a transcriptional bias favoring overexpression of E2F-dependent genes and E2F- dependent pathways in SCC. Specifically, we have shown that the export of E2F7 from the nucleus results in derepression of E2F target genes such as SPHK1 (9). Moreover, it provides a likely expla-nation for the overexpression of other E2F target genes such as RACGAP1, E2F1, and E2F7 in SCC (9, 10). E2F7 is a direct transcriptional target of E2F1, and E2F1 is a direct transcriptional target of itself and E2F7. In this way, E2F1 and E2F7 expres-sion self-regulates. This balance is disrupted when E2F7 is selectively exported from the nucleus,
Fig. 4. E2F7 mislocalization is an actionable pathology in HNSCC. (A to D) Xenotransplant model of SCC25 and (E and F) PDXs from two tumor donors were generated, and mice were treated for 14 days with (i) vehicle (0.6% plasdone PVP K-29/32 and 0.6% Poloxamer pluronic F-68), (ii) doxorubicin (0.5 mg/kg), (iii) selinexor (15 mg/kg), or (iv) selinexor (15 mg/kg) + doxorubicin (0.5 mg/kg). Mice were sacrificed 5 days after cessation of treatment or at attainment of an ethical threshold. (A) Individual values of the tumor growth curve are presented as means ± SEM (n = 4). Resected tumors at completion of the study are shown in the right-hand pan-el. (B) IHC detection of the expression of apoptosis (cleaved caspase-3) and proliferation (Ki67) markers in resected tu-mors. (C) Quantitative analysis for the expression of apopto-sis (cleaved caspase-3) and proliferation (Ki67) markers in resected tumors. Quantitative data represent percentages of positive cells and are presented as means ± SEM of two to four tumors. (D) Images show hematoxylin and eosin (H&E) or E2F7 staining for the human-specific marker CK5/6. Repre-sentative images (E) and quantitative analysis (F) of resected PDX tumors showing the expression of apoptosis (cleaved caspase-3) and proliferation (Ki67) markers. Quantitative anal-ysis represents percentages of positive cells, presented as means ± SEM of quadruplicate determinations from at least two tumors per condition. (A) An unpaired t test was used to compare tumor volumes in the selinexor + doxorubicin– treated mice to the tumor volumes of untreated mice or mice treated with each agent alone. **P < 0.01 and ***P < 0.001. (C and F) An unpaired t test was used to compare val-ues of treatment groups to their respective vehicle-treated group. *P < 0.05, **P < 0.01, and ***P < 0.001.
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
8 of 12
resulting in derepression of E2F1, which in turn induces E2F1 and E2F7 expression. This pathology alone could explain many of the E2F-associated effects observed in SCC, such as hyperproliferation, drug resistance, and aberrant differentiation. Moreover, we found evidence that this pathology exists in other cancer types such as pros-tate, colorectal, and breast cancer as well. Thus, strategies that relo-cate E2F7 to the nucleus could potentially restore an E2F1/7 balance and normalize E2F-dependent functions in SCC-derived keratino-cytes and possibly other tumor types.
The present study highlights an E2F-dependent S1P axis respon-sible for anthracycline resistance in SCC. The activation of this drug resistance axis is a direct result of the mislocalization of E2F7 and the consequent derepression of SPHK1 expression. This is most easily appreciated from our finding that selinexor failed to induce anthra-cycline sensitivity in the presence of E2F7 knockdown, indicating that anthracycline resistance is due to loss of nuclear E2F7. Further support comes from our observation that E2F1 (activator) and E2F7 (inhibitor) compete for binding to the SPHK1 promoter. Thus, the mislocalization of E2F7 results in an E2F1-dependent induction of SPHK1 expression. This is supported by ChIP analysis of E2F1 and E2F7 binding to the SPHK1 promoter in normal human keratino-cytes and SCC cells. Moreover, knockdown of E2F1 reduced SPHK1 expression and enhanced doxorubicin sensitivity, whereas knock-down of E2F7 derepressed SPHK1 expression and reduced doxorubicin sensitivity. Finally, although E2F1 and E2F7 were both overexpressed in SCC cell lines, the extent of SPHK1 promoter binding, SPHK1 ex-pression, and doxorubicin sensitivity correlated with the relative amount of E2F1 to E2F7 within the nucleus but not the total cellular expres-sion. These data show the critical dependence of SPHK1 expression and doxorubicin sensitivity on the opposing actions of E2F1 and E2F7. Because dysregulation of the Rb/E2F axis is a common defect in SCC (9, 26), resulting in E2F activation, this is likely to explain the over-expression of SPHK1 and doxorubicin resistance observed in HNSCC. This would also suggest that the mislocalization is a consequence of neoplastic transformation rather than a driver of transformation. Finally, the observation that E2F7 knockdown can induce SPHK1 expression and doxorubicin resistance suggests that these are isoform-specific functions of E2F7. This extends our understanding of the complex-ity of the E2F family because earlier studies with murine skin painting SCC models determined that E2F7 and E2F8 shared nonredundant properties (9).
We have established a direct link between the mislocalization of E2F7 and SPHK1/S1P-induced anthracycline resistance. The mech-anism by which SPHK1/S1P induces anthracycline resistance cannot be attributed to a global antiapoptotic mechanism such as activa-tion of B cell lymphoma 2 (BCL2) homology domain 2/3 proteins (for example, BCL2) or phosphatidylinositol 3-kinase/AKT activa-tion. Supporting this is the observation that a combination of SPHK1 inhibition (genetic or pharmacologic) is able to reverse anthracycline resistance but is unable to alter responses to other cytotoxic agents such as cisplatin (9, 10). Similarly, the use of an XPO1-selective inhib-itor can restore E2F7 nuclear localization and reverse resistance to doxorubicin but not to paclitaxel. Thus, the mechanism by which E2F7 mislocalization induces anthracycline resistance is context- specific.
Previous studies have shown that E2F activity is linked to the sens-ing and repair of DNA damage in the context of murine cutaneous SCC (26). Doxorubicin induces double-strand DNA breaks, and thus, the E2F/SPHK1/S1P axis may work by modulation of responses to doxorubicin-induced DNA damage. Regardless of the mechanism, the
link between the mislocalization of E2F7 and SPHK1/S1P-induced anthracycline resistance provides a translational opportunity because the E2F/SPHK1/S1P axis is actionable via pharmacological inhibitors of SPHK1 (9) or XPO1 in combination with doxorubicin. Lending support to the potential clinical value of targeting E2F/SPHK1/S1P pathway is the observation that most of cutaneous SCCs and HNSCCs have high expression of E2F1, E2F7, SPHK1, and another E2F tar-get RACGAP1 (9, 10). The high expression of these E2F-dependent targets accompanies a poor outcome (9, 10) and suggests that the reinstatement of a “normal” nuclear E2F balance may reverse many of these poor prognostic features of SCC.
Here, we show that E2F7 mislocalization is a common pathology in multiple cancer types such as HNSCC, cutaneous SCC, prostate, colorectal, and breast cancer. Central to this, we provide evidence that E2F7 is a cargo for XPO1-dependent nuclear export. This is supported by data showing that (i) E2F7 contains a high-confidence NES between amino acid 1 and 25 (38) and (ii) E2F7 can be relocal-ized to the nucleus after treatment with XPO1 siRNA or selinexor. The identification of this pathology has clinical and therapeutic im-plications for the management of HNSCC. Defects in XPO1 activity have been reported in other cancers (39). For example, mutation of the NES in cargo proteins causes defects in XPO1-dependent nucle-ar export of BRCA2 in breast cancer (39). This is not the case for the mislocalization of E2F7 because there is no evidence in public data-bases for mutations in E2F7 NES in HNSCC or other cancer types (38). Similarly, although SCCs overexpress XPO1, it is unlikely that this is the reason for the defect in HNSCC. For instance, topoisom-erase IIa p53, survivin, and E2F1 are established cargo of XPO1, yet we found no evidence for their exclusion from the nucleus in our SCC cells. In contrast, E2F7 displayed a mislocalization phenotype in greater than 80% of human SCC. Thus, E2F7 mislocalization is a common context-specific pathology in SCC and results in SPHK1 induction and anthracycline resistance.
A limitation of the present study is that the molecular basis for the mislocalization defect remains unknown. The observation that oth-er XPO1 cargo such as E2F1, topoisomerase IIa, and survivin are not affected would suggest that the defect is not attributable to alterations/mutations in the XPO1 protein itself. Rather, the mislocalization defect is likely due to a pathology-driven posttranslational modifica-tion (marking) of the E2F7 protein (E2F7 is not mutated in SCC) or an interacting partner protein. The concept of “marking” cargo for export is not unprecedented because selective nuclear export occurs in differentiating keratinocytes. For example, E2F5 nuclear export is selectively reduced during squamous differentiation, and E2Fs 4 and 5 display differential subcellular localization in keratinocytes de-spite both being XPO1 cargo (27–29). Thus, selective marking of nucle-ar proteins for export is observed in keratinocytes. Extending this, it is likely that XPO1 inhibitors such as selinexor may alter the export of multiple cargo proteins because they globally inhibit XPO1. Al-though this could be seen as a limitation of the drug, it is clear from the present study and the clinical evidence (details below) that it is able to relocate a select suite of effectors, such as E2F7, needed to induce an anticancer response. The present study has shown that the mis-localization of E2F7 alone can account for doxorubicin resistance.
Inhibition of XPO1 activity has been used to kill various cancer cell types in vitro and in vivo (37, 40–43). There is considerable enthu-siasm for this class of agents, with multiple clinical trials of selinexor underway. Data from earlier trials show selinexor to be tolerated at doses sufficient to show evidence of XPO1 inhibition [35 mg/m2; (44)].
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
9 of 12
Moreover, early results indicate that blood cancers may be more sen-sitive to selinexor than solid tumors (44, 45). The most recent trial of selinexor in relapsed acute lymphoblastic leukemia resulted in 47% of patients achieving a complete response (46). Our study suggests that reversal of the E2F7 nuclear export defect using selinexor in com-bination with anthracyclines may provide a therapeutic opportunity to treat SCC. The reversal of drug resistance appears to be restricted to anthracyclines because we saw no evidence for improved sensi-tivity when selinexor was combined with paclitaxel. A recent report in myeloma cells has shown that selinexor is able to reinstate nucle-ar localization of topoisomerase IIa in multiple myeloma cells and make them sensitive to topoisomerase inhibition (42). Although we observed no defect in topoisomerase IIa localization in the SCC cells, it is clear that E2F1-dependent activation of the SPHK1/S1P axis acts to suppress the cytotoxic action of anthracyclines in SCC cells. Our data support the initiation of a human clinical trial to test the efficacy of an anthracycline plus selinexor in relapsed SCC patients with evi-dence of E2F7 mislocalization.
MATERIALS AND METHODSStudy designThe overall aims of this study were to (i) establish the mechanism by which E2F controls doxorubicin sensitivity in SCC, (ii) establish the extent to which this mechanism is evident in human tumors, and (iii) identify strategies to reverse doxorubicin resistance in SCC. To address these aims, we examined the relationship between the acti-vating E2F1 and repressive E2F7 with regard to the transcription of SPHK1 and anthracycline resistance. Because E2F1 and E2F7 are mu-tually antagonistic, we examined the possibility that anthracycline resistance is due to derepression of SPHK1 caused by the mislocal-ization of E2F7 in SCC and other tumor types. This involved explo-ration of a suite of human SCC cell lines and human TMAs for SCC, colon, breast, and prostate cancer and their corresponding normal epithelia. Next, we examined whether E2F7 mislocalization is attrib-utable to XPO1-mediated nuclear export using specific pharmaco-logical inhibitors and siRNAs. Finally, we tested the clinical potential of XPO1 inhibitors to relocate E2F7 to the nucleus and reverse an-thracycline resistance in xenotransplant models of established human SCC cell lines and PDX material.
In all experiments, sample size was determined by previous ex-perience of the statistical variance encountered, and hence, our design was driven by an appreciation of the power required to determine significance. In all animal experiments, mice were randomly assigned to treatment groups, and minimum numbers of mice were used. Anal-ysis of TMA images was performed by a qualified histopathologist (S.B.) in a blinded manner. Analysis of IHC results was performed in a blinded manner to ensure no bias in reporting. The choice of statistics to be used was based on sample size and determination of sample/population equivalence between groups.
Cell cultureHEKs were isolated and cultured from neonatal foreskins, as described previously (9). HEKs were grown in low-calcium serum-free kerat-inocyte medium (Life Technologies). Isolated HEKs were maintained as proliferative cultures and were serially cultured for up to four pas-sages. The SCC25 and Detroit562 cell lines were purchased from American Type Culture Collection (Cryosite). KJDSV40 cell line was a gift from P. Gallimore (Birmingham, UK), and the Cal27 and FaDu
cell lines were a gift from E. Musgrove (Garvan Institute, Sydney, Australia). All cell lines were authenticated by short tandem repeat genotyping. The SCC cell lines were maintained in 1:1 Dulbecco’s modified Eagle’s medium/Ham’s F12 nutrient mix (pH 7.1) medi-um (Life Technologies) as previously described (9).
IHC and TMAsIHC was performed on formaldehyde-fixed, paraffin-embedded slides, as described previously (19). Briefly, deparaffinized slides were re-hydrated and incubated with a tris-EDTA (pH 9.0) (10 mM tris base, 1 mM EDTA, and 0.05 % Tween 20) antigen retrieval solution in a decloaking chamber (Biocare Medical). Nonspecific antibody bind-ing was blocked with 10% fetal bovine serum (Bovogen Biologicals) for 1 hour, followed by overnight incubation with anti-E2F7 (1:50; Abcam, ab56022), anti-E2F1 (1:100; Santa Cruz Biotechnology, KH95), anti-Ki67 (1:1000; Abcam, ab15580), or anti-cytokeratin 5/6 (1:100; Novus Biologicals, T16-K) primary antibodies. To visualize anti-gens, slides were washed and incubated for 1 hour with horseradish peroxidase (HRP)–conjugated anti-rabbit (GE healthcare, NA934V) or anti-mouse (Life Technologies, 626520) IgG secondary antibody conjugated with HRP (GE healthcare, NA934V) and Cardassian DAB chromogen (Biocare Medical). Normal rabbit (Dako, X0936) or normal mouse (Santa Cruz Biotechnology, SCZSC-2025) IgG was used as negative control. Expression of cleaved caspase-3 protein was detected using the SignalStain Apoptosis IHC Detection kit (Cell Signaling Technology, 12692s). The TMAs with reference numbers SK802a, HN483, HNT1021, and TMA2401a were purchased from US Biomax Inc. An additional TMA was constructed by M. Dzienis and A. C. Vargas at the Medical Oncology Department of the Princess Alexandra Hospital, Australia, as described (9). Staining localization and intensity was evaluated by a pathologist (S.B.) using a modified quick score method described previously (47). The prostate, breast, and colorectal tissue and carcinoma cores from the TMA with reference number TMA2401a were processed using the Ventana platform, ac-cording to the manufacturer’s instructions. All images were processed using the “auto contrast” tool from Adobe Photoshop CC 2017.
siRNA delivery and transfectionsAbout 2 × 105 SCC cells were plated into six-well plates and transfected with validated siRNA sequences targeting -galactosidase (Sigma- Aldrich), E2F7 (9), E2F1 (Sigma-Aldrich), or XPO1/CRM1 (Thermo Fisher Scientific, s14937) using Lipofectamine 2000 Transfection Reagent (Invitrogen), according to the manufacturer’s instructions. SiRNA sequences are reported in table S1.
ImmunofluorescenceAbout 3 × 104 normal HEKs or SCC cells were plated onto 12-mm coverslips (ProSciTech). The next day, cells were treated with (i) 1:1000 DMSO (Sigma-Aldrich), (ii) Lipofectamine 2000 (5 l/ml), (iii) 1 M selinexor (Karyopharm Therapeutics), (iv) 25 nM NC control siRNA, or (v) 25 nM XPO1-targeting siRNA (Thermo Fisher Scientific, s14937). Coverslips were then fixed with 4% paraformal-dehyde (Histopot, Australian Biostain) for 15 min and permeabi-lized with 0.1% Triton X-100 (LabChem) for an additional 20 min. The cells were blocked in 2% bovine serum albumin (Sigma-Aldrich) solution for 30 min, followed by incubation with anti-E2F7 (1:50), anti-E2F1 (1:100), anti-topoisomerase IIa (1:100; Abcam, ab52934), anti-survivin (1:100; Cell Signaling Technology, 71G4B7), or anti-P53 (1:100; Santa Cruz Biotechnology, SC-6243) primary antibodies.
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
10 of 12
Secondary anti-rabbit (1:100; Life Technologies, A11070) or anti- mouse (1:100; Invitrogen, A-11001) antibodies conjugated with Alexa Fluor 488 were used for protein detection. Nuclei and actin fila-ments were counterstained with DAPI (Cell Signaling Technology, 4083s) and phalloidin (Santa Cruz Biotechnology, SCZSC-363795), respectively. The solutions described for fixation, permeabiliza-tion, and blocking were used at 4°C. Normal rabbit or mouse IgG was used as negative controls. Immunostaining was visualized using a Zeiss LSM 510 Meta confocal microscope.
Protein isolation and immunoblottingCell lysis and separation of the nuclear and cytoplasmic fractions were done using the NE-PER Nuclear and Cytoplasmic Extraction Kit (Thermo Fisher Scientific, 78833), according to the manufacturer’s instructions. Total protein was extracted using a radioimmunopre-cipitation assay buffer [150 mM NaCl, 20 mM tris, 1% Triton X-100, 0.1 % SDS, 0.5 % sodium deoxycholate (pH 8.0)]. Total or fractionated subcellular proteins (20 g) were then resolved in a 10% SDS–polyacrylamide gel electrophoresis gel and transferred onto a polyvi-nylidene fluoride membrane (Immobilon-FL, Millipore). Membranes were exposed to one of the following primary antibodies for at least 12 hours: anti-E2F7 (1:500), anti-E2F1 (1:1000), anti-AKT (1:2000; Cell Signaling Technology, 9272S), anti-XPO1 (1:1000; Sigma-Aldrich, 37784), anti-ASH2L (1:2000; Cell Signaling Technology, D93F6), anti–caspase-3 (1:1000; Cell Signaling Technology, 9662), anti-cleaved caspase-3 (1:1000; Cell Signaling Technology, 9661S), anti-actin (1:4000; Santa Cruz Biotechnology, sc-44778), and anti-SPHK1 (1:1000; Sigma-Aldrich, HPA022829). To visualize the results, the membranes were incubated for 1 hour with anti-rabbit or anti-mouse IgG secondary antibodies conjugated with HRP. The reactions were developed using the Super Signal West Pico ECL reagent (Pierce, Thermo Fisher Scientific) and a FusionSL detection system (Vilber Lourmat). Quantitative analysis of protein concentration was per-formed using ImageJ (National Institutes of Health).
Quantitative reverse transcription polymerase chain reactionTotal RNA was isolated with TRIsure reagent (Bioline, BIO-38032), and complementary DNA (cDNA) was prepared using the Tetro cDNA Synthesis Kit (Bioline, BIO-65042), according to the manu-facturer’s instructions. Quantitative reverse transcription polymerase chain reaction (PCR) was performed, as described previously (21), using the following primer sequences: SPHK1, AAGACCTCCT-GACCAACTGC (forward) and GGCTGAGCACAGAGAAGAGG (reverse); E2F1, TCCAAGAATCATATCCAGTGGCT (forward) and GCTGGAATGGTGTCAGCACAGCG (reverse); E2F7, GT-CAGCCCTCACTAAACCTAAG (forward) and TGCGTTGGA-TGCTCTTGG (reverse); TBP, TCAAACCCAGAATTGTTC TC-CTTAT (forward) and CCTGAATCCCTTTAGAATAGGGTAGA (reverse).
Chromatin immunoprecipitationDNA from 4 × 106 cells was collected. The simple ChIP Enzymatic IP kit (Cell Signaling Technology) was used in accordance with the manufacturer’s instructions. Chromatin was incubated overnight at 4°C with normal rabbit IgG (Cell Signaling Technology), anti-E2F1 (1 g per IP; Santa Cruz Biotechnology, sc-193), or anti-E2F7 (1 g, intraperitoneally; Abcam, ab56022) antibodies. We performed quan-titative PCR of the SPHK1 promoter binding region and calculated
relative enrichment, as described in (9). The following SPHK1 promoter primers were used: GGGACCCTTGGTTTCACCTC-3′ (forward) and GAATTTCGGGTGGGCTAGGG-3′ (reverse).
Viability assaysCell viability, after treatment with siRNAs or drugs, was analyzed us-ing the Cell Titer 96 Aqueous One Solution Cell (Promega), accord-ing to the manufacturer’s instructions. Briefly, 7.5 × 103 SCC cells were plated in triplicate in 96-well plates and allowed to adhere for 24 hours before treatment with vehicle (DMSO), 100 nM E2F7- targeting siRNA, or 1 M selinexor alone or in combination with increasing concentrations of doxorubicin (0 to 3 M) for 48 hours. Viability was quantified by reading the absorbance at 490 nm in a Multiskan FC Microplate Photometer (Thermo Fisher Scientific). The data were analyzed using GraphPad Prism v5 software.
Generation of a PDX animal modelHuman SCC tissue samples were obtained from patients with pri-mary and secondary SCC after surgical biopsy. All samples were ob-tained with patient consent and approval from our Institutional Ethics Committee. The tumors were then decontaminated [overnight incuba-tion with penicillin, streptomycin, and gentamicin (10 ng/ml) and am-photericin B (200 ng/ml)], coated with Matrigel (Falcon), and implanted into a subcutaneous “pocket” created in the scruff of the neck of a non-obese diabetic/severe combined immunodeficient (NOD/SCID) fe-male mouse. “First-generation” tumors were allowed to grow until they reached 10 mm in diameter and were then passaged into 16 NOD/SCID “second-generation” females. The second-generation tumors were al-lowed to grow and were used for drug efficacy testing. All the animal studies had approval from our Institutional Bioethics Committee.
In vivo drug efficacy testingIn vivo drug efficacy was determined using our PDX model or cell line xenotransplant models. For the xenotransplant model, female NOD/SCID mice were injected subcutaneously with 1.5 × 106 SCC25, Detroit562, or FaDu cells, and tumors were allowed to grow. Once the xenotransplant or PDX tumor reached 4 mm in diameter, they were randomly assigned to four groups, and mice were treated twice per week for 3 weeks with (i) vehicle (0.6% plasdone PVP K-29/32 and 0.6% Poloxamer pluronic F-68), (ii) doxorubicin (0.5 mg/kg) (Sigma-Aldrich), (iii) selinexor (15 mg/kg), or (iv) selinexor (15 mg/kg) + doxorubicin (0.5 mg/kg). Mice were monitored twice per week for changes in weight and tumor size. Animals were sacrificed at the end of the 3-week period or if the tumors reached 10 mm in diameter. Student’s t test with 95% confidence interval was used to calculate statistical significance (GraphPad Prism v5 software).
Study approvalsThe work presented in this manuscript is covered by approvals from the Princess Alexandra Hospital Human Ethics Committee (HREC/14/QPAH/150) and the University of Queensland Animal Ethics Com-mittee (UQDI/357/17).
Statistical analysisAfter F test evaluation to determine similarity in sample distribution and variance, data were analyzed using unpaired Student’s t test. Anal-ysis of statistical differences between nuclear or nuclear/cytoplasmic staining of normal or cancerous epithelia was performed with a Fisher’s exact test. In all instances, P ≤ 0.05 was considered significant.
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
11 of 12
SUPPLEMENTARY MATERIALSwww.sciencetranslationalmedicine.org/cgi/content/full/10/447/eaar7223/DC1Fig. S1. SiRNA knockdown of E2F7 and E2F1 is demonstrated in SCC cell lines.Fig. S2. E2F1 and E2F7 control SPHK1 mRNA expression.Fig. S3. Subcellular localization of survivin, topoisomerase IIa, and p53 is nuclear in SCC cell lines.Fig. S4. Subcellular mislocalization of E2F7 is a common defect in prostate, colon, and breast carcinomas.Fig. S5. E2F7 is an XPO1 cargo protein.Fig. S6. Mislocalization of E2F7 drives anthracycline resistance.Fig. S7. Selinexor does not enhance the cytotoxic effect of paclitaxel in SCC25 cells.Fig. S8. E2F7 mislocalization is an actionable pathology in HNSCC.Table S1. SiRNA sequences used in this study.Reference (48)
REFERENCES AND NOTES 1. E. Ward, C. As-Brooks, Head and Neck Cancer (Plural Publishing, 2014). 2. L. Jennings, C. D. Schmults, Management of high-risk cutaneous squamous cell
carcinoma. J. Clin. Aesthetic Dermatol. 3, 39–48 (2010). 3. N. Vigneswaran, M. D. Williams, Epidemiologic trends in head and neck cancer and aids
in diagnosis. Oral Maxillofac. Surg. Clin. North Am. 26, 123–141 (2014). 4. M. Ichihashi, M. Ueda, A. Budiyanto, T. Bito, M. Oka, M. Fukunaga, K. Tsuru, T. Horikawa,
UV-induced skin damage. Toxicology 189, 21–39 (2003). 5. E. M. Minicucci, G. N. da Silva, D. M. F. Salvadori, Relationship between head and neck
cancer therapy and some genetic endpoints. World J. Clin. Oncol. 5, 93–102 (2014). 6. I. Nindl, M. Gottschling, E. Stockfleth, Human papillomaviruses and non-melanoma skin
cancer: Basic virology and clinical manifestations. Dis. Markers 23, 247–259 (2007). 7. S. I. Pai, W. H. Westra, Molecular pathology of head and neck cancer: Implications for
diagnosis, prognosis, and treatment. Annu. Rev. Pathol. 4, 49–70 (2009). 8. P. M. Specenier, J. B. Vermorken, Current concepts for the management of head and neck
cancer: Chemotherapy. Oral Oncol. 45, 409–415 (2009). 9. M. Hazar-Rethinam, L. M. de Long, O. M. Gannon, E. Topkas, S. Boros, A. C. Vargas,
M. Dzienis, P. Mukhopadhyay, F. Simpson, L. Endo-Munoz, N. A. Saunders, A novel E2F/sphingosine kinase 1 axis regulates anthracycline response in squamous cell carcinoma. Clin. Cancer Res. 21, 417–427 (2015).
10. M. Hazar-Rethinam, L. M. de Long, O. M. Gannon, S. Boros, A. C. Vargas, M. Dzienis, P. Mukhopadhyay, N. Saenz-Ponce, D. D. E. Dantzic, F. Simpson, N. A. Saunders, RacGAP1 is a novel downstream effector of E2F7-dependent resistance to doxorubicin and is prognostic for overall survival in squamous cell carcinoma. Mol. Cancer Ther. 14, 1939–1950 (2015).
11. D. K. Dimova, N. J. Dyson, The E2F transcriptional network: Old acquaintances with new faces. Oncogene 24, 2810–2826 (2005).
12. J. R. Nevins, Toward an understanding of the functional complexity of the E2F and retinoblastoma families. Cell Growth Differ. 9, 585–593 (1998).
13. N. Dyson, The regulation of E2F by pRB-family proteins. Genes Dev. 12, 2245–2262 (1998). 14. A. Rabinovich, V. X. Jin, R. Rabinovich, X. Xu P. J. Farnham, E2F in vivo binding specificity:
Comparison of consensus versus nonconsensus binding sites. Genome Res. 18, 1763–1777 (2008).
15. K. Vermeulen, D. R. Van Bockstaele, Z. N. Berneman, The cell cycle: A review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif. 36, 131–149 (2003).
16. J. DeGregori, D. G. Johnson, Distinct and overlapping roles for E2F family members in transcription, proliferation and apoptosis. Curr. Mol. Med. 6, 739–748 (2006).
17. R. A. Weinberg, E2F and cell proliferation: A world turned upside down. Cell 85, 457–459 (1996).
18. A. J. Dicker, C. Popa, A. L. Dahler, M. M. Serewko, P. A. Hilditch-Maguire, I. H. Frazer, N. A. Saunders, E2F-1 induces proliferation-specific genes and suppresses squamous differentiation-specific genes in human epidermal keratinocytes. Oncogene 19, 2887–2894 (2000).
19. N. A. Saunders, A. J. Dicker, S. J. Jones A. L. Dahler, E2F1 messenger RNA is destabilized in response to a growth inhibitor in normal human keratinocytes but not in a squamous carcinoma cell line. Cancer Res. 58, 1646–1649 (1998).
20. N. M. Wikonkal, E. Remenyik, D. Knezevic, W. Zhang, M. Liu, H. Zhao, T. R. Berton, D. G. Johnson, D. E. Brash, Inactivating E2f1 reverts apoptosis resistance and cancer sensitivity in Trp53-deficient mice. Nat. Cell Biol. 5, 655–660 (2003).
21. A. M. Pierce, I. B. Gimenez-Conti, R. Schneider-Broussard, L. A. Martinez, C. J. Conti, D. G. Johnson, Increased E2F1 activity induces skin tumors in mice heterozygous and nullizygous for p53. Proc. Natl. Acad. Sci. U.S.A. 95, 8858–8863 (1998).
22. I. Thurlings, L. M. Martínez-López, B. Westendorp, M. Zijp, R. Kuiper, P. Tooten, L. N. Kent, G. Leone, H. J. Vos, B. Burgering, A. de Bruin, Synergistic functions of E2F7 and E2F8 are critical to suppress stress-induced skin cancer. Oncogene 36, 829–839 (2017).
23. R. A. Sabbadini, Sphingosine-1-phosphate antibodies as potential agents in the treatment of cancer and age-related macular degeneration. Br. J. Pharmacol. 162, 1225–1238 (2011).
24. H. Fyrst, J. D. Saba, An update on sphingosine-1-phosphate and other sphingolipid mediators. Nat. Chem. Biol. 6, 489–497 (2010).
25. N. J. Pyne, S. Pyne, Sphingosine 1-phosphate and cancer. Nat. Rev. Cancer 10, 489–503 (2010).
26. L. Endo-Munoz, A. Dahler, N. Teakle, D. Rickwood, M. Hazar-Rethinam, I. Abdul-Jabbar, S. Sommerville, I. Dickinson, P. Kaur, S. Paquet-Fifield, N. Saunders, E2F7 can regulate proliferation, differentiation, and apoptotic responses in human keratinocytes: Implications for cutaneous squamous cell carcinoma formation. Cancer Res. 69, 1800–1808 (2009).
27. S. Gaubatz, J. A. Lees, G. J. Lindeman, D. M. Livingston, E2F4 is exported from the nucleus in a CRM1-dependent manner. Mol. Cell. Biol. 21, 1384–1392 (2001).
28. M. D. Apostolova, I. A. Ivanova, C. Dagnino, S. J. A. D’Souza L. Dagnino, Active nuclear import and export pathways regulate E2F-5 subcellular localization. J. Biol. Chem. 277, 34471–34479 (2002).
29. G. J. Lindeman, L. Dagnino, S. Gaubatz, Y. Xu, R. T. Bronson, H. B. Warren, D. M. Livingston, A specific, nonproliferative role for E2F-5 in choroid plexus function revealed by gene targeting. Genes Dev. 12, 1092–1098 (1998).
30. A. O’Brate, P. Giannakakou, The importance of p53 location: Nuclear or cytoplasmic zip code? Drug Resist. Updat. 6, 313–322 (2003).
31. D. R. Green, G. Kroemer, Cytoplasmic functions of the tumour suppressor p53. Nature 458, 1127–1130 (2009).
32. F. Li, J. Yang, N. Ramnath, M. Javle D. Tan, Nuclear or cytoplasmic expression of survivin: What is the significance? Int. J. Cancer 114, 509–512 (2005).
33. P. Grabowski, T. Kühnel, F. Mühr-Wilkenshoff, B. Heine, H. Stein, M. Höpfner, C. T. Germer, H. Scherübl, Prognostic value of nuclear survivin expression in oesophageal squamous cell carcinoma. Br. J. Cancer 88, 115–119 (2003).
34. S. E. L. Mirski, J. C. Bielawski, S. P. C. Cole, Identification of functional nuclear export sequences in human topoisomerase II and . Biochem. Biophys. Res. Commun. 306, 905–911 (2003).
35. P. Ranganathan, T. Kashyap, X. Yu, X. Meng, T.-H. Lai, B. McNeil, B. Bhatnagar, S. Shacham, M. Kauffman, A. M. Dorrance, W. Blum, D. Sampath, Y. Landesman, R. Garzon, XPO1 inhibition using selinexor synergizes with chemotherapy in acute myeloid leukemia by targeting DNA repair and restoring topoisomerase II to the nucleus. Clin. Cancer Res. 22, 6142–6152 (2016).
36. K. T. Nguyen, M. P. Holloway, R. A. Altura, The CRM1 nuclear export protein in normal development and disease. Int. J. Biochem. Mol. Biol. 3, 137–151 (2012).
37. J. G. Turner, J. Dawson, D. M. Sullivan, Nuclear export of proteins and drug resistance in cancer. Biochem. Pharmacol. 83, 1021–1032 (2012).
38. D. Xu, N. Grishin, Y. M. Chook, NESdb: A database of NES-containing CRM1 cargoes. Mol. Biol. Cell 23, 3673–3676 (2012).
39. A. D. Jeyasekharan, Y. Liu, H. Hattori, V. Pisupati, A. B. Jonsdottir, E. Rajendra, M. Lee, E. Sundaramoorthy, S. Schlachter, C. F. Kaminski, Y. Ofir-Rosenfeld, K. Sato, J. Savill, N. Ayoub, A. R. Venkitaraman, A cancer-associated BRCA2 mutation reveals masked nuclear export signals controlling localization. Nat. Struct. Mol. Biol. 20, 1191–1198 (2013).
40. F. Conforti, Y. Wang, J. A. Rodriguez, A. T. Alberobello, Y.-W. Zhang, G. Giaccone, Molecular pathways: Anticancer activity by inhibition of nucleocytoplasmic shuttling. Clin. Cancer Res. 21, 4508–4513 (2015).
41. S. Kazim, M. Malafa, D. Coppola, K. Husain, S. Zibadi, T. Kashyap, M. Crochiere, Y. Landesman, T. Rashal, D. M. Sullivan, A. Mahipal, Selective nuclear export inhibitor KPT-330 enhances the antitumor activity of gemcitabine in human pancreatic cancer. Mol. Cancer Ther. 14, 1570–1581 (2015).
42. J. G. Turner, J. L. Dawson, S. Grant, K. H. Shain, W. S. Dalton, Y. Dai, M. Meads, R. Baz, M. Kauffman, S. Shacham, D. M. Sullivan, Treatment of acquired drug resistance in multiple myeloma by combination therapy with XPO1 and topoisomerase II inhibitors. J. Hematol. Oncol. 9, 73 (2016).
43. J. Kim, E. McMillan, H. S. Kim, N. Venkateswaran, G. Makkar, J. Rodriguez-Canales, P. Villalobos, J. E. Neggers, S. Mendiratta, S. Wei, Y. Landesman, W. Senapedis, E. Baloglu, C.-W. B. Chow, R. E. Frink, B. Gao, M. Roth, J. D. Minna, D. Daelemans, I. I. Wistuba, B. A. Posner, P. P. Scaglioni, M. A. White, XPO1-dependent nuclear export is a druggable vulnerability in KRAS-mutant lung cancer. Nature 538, 114–117 (2016).
44. A. R. Abdul Razak, M. Mau-Soerensen, N. Y. Gabrail, J. F. Gerecitano, A. F. Shields, T. J. Unger, J. R. Saint-Martin, R. Carlson, Y. Landesman, D. McCauley, T. Rashal, U. Lassen, R. Kim, L.-A. Stayner, M. R. Mirza, M. Kauffman, S. Shacham, A. Mahipal, First-in-class, first-in-human phase I study of selinexor, a selective inhibitor of nuclear export, in patients with advanced solid tumors. J. Clin. Oncol. 34, 4142–4150 (2016).
45. E. F. Attiyeh, J. M. Maris, R. Lock, C. P. Reynolds, M. H. Kang, H. Carol, R. Gorlick, E. A. Kolb, S. T. Keir, J. Wu, Y. Landesman, S. Shacham, D. Lyalin, R. T. Kurmasheva, P. J. Houghton, M. A. Smith, Pharmacodynamic and genomic markers associated with response to the XPO1/CRM1 inhibitor selinexor (KPT-330): A report from the pediatric preclinical testing program. Pediatr. Blood Cancer 63, 276–286 (2016).
46. T. B. Alexander, N. J. Lacayo, J. K. Choi, R. C. Ribeiro, C.-H. Pui, J. E. Rubnitz, Phase I study of selinexor, a selective inhibitor of nuclear export, in combination with fludarabine and
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
Saenz-Ponce et al., Sci. Transl. Med. 10, eaar7223 (2018) 27 June 2018
S C I E N C E T R A N S L A T I O N A L M E D I C I N E | R E S E A R C H A R T I C L E
12 of 12
cytarabine, in pediatric relapsed or refractory acute leukemia. J. Clin. Oncol. 34, 4094–4101 (2016).
47. S. Detre, G. Saclani Jotti, M. Dowsett, A "quickscore" method for immunohistochemical semiquantitation: Validation for oestrogen receptor in breast carcinomas. J. Clin. Pathol. 48, 876–878 (1995).
48. L. P. Zalmas, X. Zhao, A. L. Graham, R. Fisher, C. Reilly, A. S. Coutts, N. B. La Thangue, DNA-damage response control of E2F7 and E2F8. EMBO Rep. 9, 252–259 (2008).
Acknowledgments: We acknowledge the assistance of F. Simpson in sample collection and Y. M. Chook with the identification of the E2F7 NES. We acknowledge the gift of cell lines from P. Gallimore (Birmingham, UK) and E. Musgrove (Garvan Institute, Sydney, Australia). Finally, we acknowledge all the patients who donated tissue for our study. Funding: N.A.S. is supported by a Senior Research Fellowship awarded by the Cancer Council Queensland. N.S.-P. is supported by an International Postgraduate Research Scholarship and an Australian Postgraduate Award. R.P. is supported by an Australian Postgraduate Award, and O.M.G. is funded by Research Grant awarded by the Wesley Medical Research Institute. This work was supported by a grant from Zarraffas Coffee to N.A.S. and B.P. and a Cyril Gilbert Testimonial Grant awarded by the Gallipoli Medical Research Foundation to B.P. Author contributions: N.S.-P. contributed to experimental work, experimental design, writing, and data analysis and interpretation. R.P. contributed to experimental work on PDX model. L.M.d.L. contributed to all laboratory animal work. T.K. contributed to IHC and data analysis. C.A. contributed to design and interpretation of data. Y.L. contributed to design and
interpretation of data. M.H.-R. contributed to in vitro experimental work. S.B. performed all histopathological work. B.P. provided patient samples and contributed to data interpretation. M.J. contributed to work on XPO1 cargo. D.D. contributed to work on XPO1 cargo and data interpretation. O.M.G. co-supervised all work and contributed to in vitro experimental work, experimental design, and data analysis and interpretation. N.A.S. directed all experimental activity and contributed to data interpretation, analysis, and writing of manuscript. Competing interests: T.K., C.A., and Y.L. are employees of the manufacturer of selinexor (Karyopharm). Karyopharm provided no direct funding for the current study, and the work and selinexor were provided on a collaborative basis. M.J. and D.D. are employees of KU Leuven. KU Leuven has a license agreement on XPO1 inhibitors (selinexor). KU Leuven provided no direct funding for the current study, and all work was undertaken on a collaborative basis. All other authors declare that they have no competing interests.
Submitted 11 December 2017Accepted 18 May 2018Published 27 June 201810.1126/scitranslmed.aar7223
Citation: N. Saenz-Ponce, R. Pillay, L. M. de Long, T. Kashyap, C. Argueta, Y. Landesman, M. Hazar-Rethinam, S. Boros, B. Panizza, M. Jacquemyn, D. Daelemans, O. M. Gannon, N. A. Saunders, Targeting the XPO1-dependent nuclear export of E2F7 reverses anthracycline resistance in head and neck squamous cell carcinomas. Sci. Transl. Med. 10, eaar7223 (2018).
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from
in head and neck squamous cell carcinomasTargeting the XPO1-dependent nuclear export of E2F7 reverses anthracycline resistance
Nicholas A. SaundersandMehlika Hazar-Rethinam, Samuel Boros, Benedict Panizza, Maarten Jacquemyn, Dirk Daelemans, Orla M. Gannon
Natalia Saenz-Ponce, Rachael Pillay, Lilia Merida de Long, Trinayan Kashyap, Christian Argueta, Yosef Landesman,
DOI: 10.1126/scitranslmed.aar7223, eaar7223.10Sci Transl Med
thereby restore the efficacy of anthracycline chemotherapy in head and neck cancer.genes. The authors also identified an approved drug that can prevent the export of E2F7 from the nucleus andtranscription-activating counterpart, E2F1, remains in the nucleus and drives transcription of treatment resistance inhibitor called E2F7 is frequently mislocalized to the cytoplasm in these tumors, whereas itsand these proteins' localization within cancer cells. Specifically, the authors discovered that a transcriptional
. identified a mechanism dependent on the balance of two proteins that regulate transcriptionet alSaenz-Ponce common in head and neck squamous cell carcinoma. In their search for the causes of treatment resistance,
Despite recent advances in cancer treatment, resistance to cancer therapy and resulting mortality remainRestoring balance in the nucleus
ARTICLE TOOLS http://stm.sciencemag.org/content/10/447/eaar7223
MATERIALSSUPPLEMENTARY http://stm.sciencemag.org/content/suppl/2018/06/25/10.447.eaar7223.DC1
CONTENTRELATED
http://science.sciencemag.org/content/sci/367/6483/1264.fullhttp://stm.sciencemag.org/content/scitransmed/11/509/eaaw8513.fullhttp://stm.sciencemag.org/content/scitransmed/11/482/eaau5612.fullhttp://stm.sciencemag.org/content/scitransmed/10/455/eaas9668.fullhttp://stm.sciencemag.org/content/scitransmed/3/67/67ra7.fullhttp://stm.sciencemag.org/content/scitransmed/7/305/305ra147.fullhttp://stm.sciencemag.org/content/scitransmed/7/293/293ra104.full
REFERENCES
http://stm.sciencemag.org/content/10/447/eaar7223#BIBLThis article cites 47 articles, 16 of which you can access for free
PERMISSIONS http://www.sciencemag.org/help/reprints-and-permissions
Terms of ServiceUse of this article is subject to the
registered trademark of AAAS. is aScience Translational MedicineScience, 1200 New York Avenue NW, Washington, DC 20005. The title
(ISSN 1946-6242) is published by the American Association for the Advancement ofScience Translational Medicine
of Science. No claim to original U.S. Government WorksCopyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement
by guest on July 31, 2020http://stm
.sciencemag.org/
Dow
nloaded from