Regulated Expression of the v-rel Oncogene In Vitro and In Vivo

BY Mira A. Rao

Department of Microbiology and Immunology

McGill University Montreal, Quebec

March 15, 1999

A thesis submitted to the Faculty of Graduate Studies and

Research in partial fulfillment o f the requirements for the degree of Master of Science.

Copyright O Mira A. Rao, 1999

National Library Bibliothèque nationale du Canada

Acquisitions and Acquisitions et Bibliographie Services services bibliographiques

The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seii copies of this thesis in microform, paper or electronic formats.

The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fkom it may be printed or otherwise reproduced without the author's permission.

L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.

L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits saas son autorisation.

Résumé

Le virus aviaire reticuloendothelial de type T (REV-T) est l'un des plus

transformant parmi les retrovirus connus et a été démontré capable de transformer une

large variété de lymphocytes. L'oncogène d'origine virale v-rel, un membre de la famille

Rel/NFkB, procure au virus REV-T le pouvoir de transformer les cellules. Bien que la

capacité transfomante de v-rel est associée a la perturbation du fonctionnement normal

de NF-KB, les mécanismes intracellulaires menant à la transformation sont inconnus.

Nous avons utilisé le système de vecteurs RCAS (Replication Competent Avian

Leukosis LTR With Splice Accepter) pour infecter les cellules du poulet et par

constiquent permettre la dissémination du gène cloné v-rel in vivo. De plus, le système de

vecteurs RCAS a été combiné à un système d'expression de gènes dépendant de la

tétracycline afin de permettre I'expression conditionnelle de l'oncogène viral v-rel des

poulets transgéniques.

A l'aide de ce nouveau système, nous avons réussi a étudier in-situ la

transformation par l'oncogène v-rel. En analysant les ceIlules affectées par la

transformation due à v-rel, nous espérions mieux comprendre le mécanisme menant a la

transformation cellulaire par v-rel. Nos résultats préliminaires suggèrent que les

lymphocytes B des poulets transgéniques pour l'expression de v-rel sont transformées.

L'analyse phénotypique de ces cellules a démontré que les cellules transformées ne

représentent pas toutes les étapes de la différentiation des lymphocytes B, mais plutôt

possèdent le phénotype des lymphocytes matures.

Abstract

The avian reticuloendothelial virus strain T (REV-T) is among the most overtly

transforming of al1 known retrovimses, and has been shown to transfonn a wide range of

lymphocytes. The transforming ability of REV-T is attributed the v-rel oncogene, a

member of the R~VNFKB family of transcription factors. AIthough it is believed that v-

rel mediated transformation involves the disregulation of normal NF43 fiuiction, the

intracellular requirements for transformation are still unknown.

We have used the RCAS vectors (Replication Comptent Avian Leukosis LTR

with Splice Acceptor) for infection and dissemination of viral particles in chicken cells,

permitting sornatic transgenesis of the v-rel oncogene in vivo. In addition, the RCAS

system has been combined with a tetracycline regulated gene expression system, in order

to allow for conditional expression of the v-rel oncogene in transgenic birds.

Using this novei system, we have been able to study in siru transformation by the

i v e 1 oncogene. By addressing the questions pertaining to the cells targeted for

transformation by v-rel, we hoped to gain a better understanding of the mechanism for v-

rel mediated transformation. Preliminary data suggests that B cells were targeted for

transformation by v-rel in the truisgenic birds. Phenotypic analysis revealed that

transformed cells were not representative of al1 stages of B ce11 development, but rather

had a mature B ce11 phenotype.

Ac knowledgements "The best does not corne alone.

It cornes with the Company of the ail." -Rabindranath Tagore

First and foremost, 1 would like to thank my supewisor, Dr. Michael J. FI.

Ratcliffe, not only for financial support, but also for his guidance. Thank you Mike, for

taking me into your lab, for teaching me how a scientist thinks and for sharing with me

your energy and enthusiasm for research.

I do not think it is possible to express how important my family is in my life.

Their unwavering love and support mean the world to me. My mother, Dr. Leticia G.

Rao, and my father, Dr. A. Venket Rao, have always encouraged me to reach for my

goals, and have supported me through every adventure 1 have embarked on. My sister

Maya, who probably knows me better than anyone else, is a major force in my Iife and

for the past 24 years I have admired and looked up to her.

During my time in Montreal 1 have met so many wondefi1 people who have had

a great impact on my life. My fnends in the Chicken Lab, past and present, include

Sandra Iacampo, Camil Sayegh, Ken McDonald, Karen Jacobson, Sandy Demaries and

Onaldo Martinez (fkom whom 1 inhented the project). Together we had some great

laughs. 1 have to thank each and every one of them for showing me the ropes in the lab.

Also, "Merci" à Carnil for the translation of my abstract.

Unfortmately, one page is not enough to nme al1 of the people who have been so

important to me during my Master's years. But, I d e f ~ t e l y have to give a special

mention to Nazgol Khamneipur, Angela Seferta, Alex Maia, Jacqui Brinkman, John

Lewis, Madani Thiarn, Maricar Polintan and Chantal Abouchar. By lending me an ear or

a shoulder, or by sharing a joke and a laugh, these fnends have seen me at my best and at

my worst.

As Tagore said, "The best does not corne alone" ... These are the individuals who

make up rny "dl".

Table of Contents

Page -. Resume ..... . -.... . .. . . . . -. . . . . . . . ..... . .. -. -. - -. - --. -- -. - .-. .-.-... -. . . -. - ---. . .. . - . . . . . . -. . . - . . . . . . . . . ... ... .. -. . ... .. -. .il

Introduction

A. The R e m - K B Family __.___-... ~._--__.*-.*-~*-.-.----.-....-*..-.........-.---....-.--.--..-.-......-...- 1

i. Function & Regdation ....-. . . .--. -. - .- - -. -. . . - - . . . . . .. . . . . . . . . - - - - - - - .. .. . . . .. . . . 1

ii. ReW-icB in Infiammatory & Acute Phase Responses ..---..-.-........-.---.-. 6 .-a

111. R~VNF-KB in Development -.... . . . . . -. -. -. - -. -. - -. . -. -. . . - - --. - -. . . . . . - -. - - - -- - - - - - - - - - - - - - - - - - - - 7

iv. ReljNF-d3 in Lymphocyte Activation & Proliferation --..-..-..-----*--...--*-*-- 8

The v-rel Oncogene .......... .--- .. ............................................ ..-.. -----..----- - ---.- -.-...-.-..-.. 1 O

i. RevT & the v-rel Oncogene ....................................................................... 10

ii. The Helper Virus Dichotomy: RevT vs, C W ..-*-----.-......----.--.-..-.--..-.----.- 11 * *.

111. v-Re1 vs. v-Rel* ...----.-.-.-...--..-.........-.--.-.-...--.-.-------.------....-----.-.-.-...---+--.----.- 12

Transformation by the v-rel Oncoprotein . - - - - -. - -. - - . - . - - - . - -. . . . . - -. . - - -. - - -. -. . . . . . . . . . . . . . . -. . - -. -. 13

i. v-Rel as a Domhant Negative Mutant- .-. ..-..-...-. -- - .. ... - --*- . .-- - - - -. - - - - -. - - - - --. .. .-. 14

ii. The Active Mode1 for v-Re1 Transformation ............................................ 14

iii. v-Re1 Mediated transformation ....--...-.-- .-.-.-..--..-.-.-.. .-.------.-.-.-.-.......-..-.--.-. 16

iv. Activation of AP- 1 genes by v-Rd. - - - . - - a . . . . . * .. . - a . - - -. . . . . - - - - - -. * - a . a - -. . . . .. - -. -. - - . - - - 17

v. v-Re1 & Apoptosis ...................................................................................... 18

B Ce11 Development in Chicken ............................................................................. 20

i- B Ce11 Development: M-als vs. Bir& ..--....-........-*--- -....-.-*..*.-....**. * * - - * 20

ii. BlJrsa of Fabriciw ---.-.-.-.-.-......--.-..--.--.-..-.-..--....-.-.*--...-..--..-.-.--..----.-..-- 21 .S .

111. The Fate of Bursal Cells ........................................................................... 22

22 iv. Summary of B Ce11 Development .-..-.-.---.--*-.---.**.....--.----..-. *

24 ........................................................................................... 11 . Materials & Methods

III . Construction of the TRE/u-reï* Vector

A . Introduction ....................................................................................................... 37

B . Results ............................................................................................................... 44

C . Discussion ......................................................................................................... 56

IV . In Vitro Assays of the TRE/v-rel* Constructs

A . Introduction ....................................................................................................... 59

B . Results ............................................................................................................... 59

C - Discussion ......................................................................................................... 67

V . in Vivo Expression of v-Rel*

A . Introduction ..........................-............................................................................ 72

B . Results ............................................................................................................... 77

C . Discmsion.. ....................................................................................................... 87

ma GeneraI Codusions ........................... :: .............................................................. 93

VI1 . References ........................................................................................................... 96

Ab breviations

ARB: Antigen Retrieval Buffer

BSS: Balanced Salt Solution

CEF: Chick embryo fibroblast

CS: Chicken serum

CSV: Chicken Spcit id Virus

D'PBS: Dubelcco's PBS

FCS: Fetal caif s e m

FITC: Flourescein isothiocyanate

H+E: Hernatoxylin & eosin

IMDiM: Iscove's Modified Dulbecco's Medium

IgH: lmmunoglobulin heavy chah

IgL: Immunoglobul in light chah

K: Kozak

NF-&: Nuclear Factor-kappa B

NLS: Nuclear Localization Signal

PBL: Peripheral Blood Lymphocyte

PBS: Phosphate BufTered Saline

PE: Phycoerithryn

PEG: Polyethylene Glycol

PA: Polyadenylation signal

PMA: Phorbol myristic acetate

R C M : &plication ompetent pian leukosis LTR & go splice acceptor

RCAS: Replication competent Man leukosis LTR & #ce acceptor

Rev T: Reticuloendothelial virus strain T

RHD: Re1 Homology Domain

Tet: Tetracycline

Tg: Transgene

TRE: Tetracycline responsive element

tTA: Tetracycline sensitive transactivator

vii

List of Figures Page

Figure 1 . The Rel/NF-d Family of Transcription Factors .......................................... 3

Figure 2 . Activation of Rel/NF-icB Trawcription Factors ......................................... 5

Figure 3 . Curent Models for v-Re1 Mediated transformation ..................................... 15

.............................................. Figure 4 . The RCAS Retroviral Gene Transfer Cassette 40

Figure 5 . Somatic Tmgenesis by RCAS Vecton in viîro & in vivo ........................ 42

Figure 6 . Conditional Expression of Transgenes Using the RCAS System ................ 44

Figure 7- The RCAS:tTA Constmct ..... .. ....................................................................... 48

Figure 8 . M o w i n g Clal 2:T Shutîie Vector by Addition of a Kozak Sequencc ...... 49

Figure 9 . Modifying Clal2TP Shuttle Vector by Addition of a Kozak Sequence ..... 50

Figure 10 -nie Clal 23-K and C ~ a l ~ ~ ~ Shuale Vectors ......................................... 51

Figure 11 . Cloning TREK & TRE/WPA into RCAS(B) and RCAN(B) ................... 52

Figure 12 . n e PRAO 1 Adapter P ~ ~ s ~ i d ....................................................................... 53

Figure 13 . The pRA02 plasmid ... Cloning of v-rel* into pIWO 1 ................................ 54

Figure 11 . Cloning v-rel* into the RCAS Based Vectors ............................................. 55

Figure 15 . Transfected and Mected CEFs express High Levels of Viral Protein ...... 60

Figure 16- The tTA is Required for Expression of v-Rel* ............................................ 61

Figure 17 . Conditional expression of v-Rel* in vitro. ................................................... 63

Figure 18 . Screening for tTA transgenic birds by Flow Cytornetry ............................ 64

Figure 19 . Bursai Celis are Transformed by RevT(CSV) and not by pRA07 ............ 65

Figure 20- Splenic Lymphoc~tes are T r a n s f ~ ~ e d by pRA07 .................................... 66

Figure 21 . Cell Surface Markers on Avian B cells ....................................................... 73

Figure 22- SOITAC TraWFnesis of conditional v-rel* ............................................... 76

Figure 23 . v-Rel* is Expression in Lymphocytes by Transgenic Birds (- tet)... ......... 79

Figure 21 . In.6ltration of Lymphocytes in the Liver ........~............................................ 80

Figure 25 . Transfomed Cells in the Liver are B Lymphocytes ................................... 81

Figure 26 . B ce11 Tumors in the Liver of v-Rel* Transgenic Birds .............................. 83

Figure 27 . B u r d Cells fkom Transgenic Buds Have a Normal Phenotype ................ 84

Figure 28 . v-Rel* Transformed B Cells in the Spleen & Liver of Transgenic Birds,.85

Figure 29 . Transformed Celis Have a Mature B CeIl Phenotype ................................. 86

viii

Chapter 1. Introduction

Several retrovinises have k e n implicated in cellular transformation, which is a

process that results in unuihibited ce11 growth and proliferation. Uncontrolled growth of

this nature ultimately gives rise to tumor formation. The reticuloendothelial virus strain

T (RevT) is an acutely transfonning retroviruses. In fact, RevT is arnong the mon

overtly transforming of al1 known retroviruses, and it rapidly induces fatal lymphomas in

young chickens (Barth and Humphries, 1988; Barth et al., 1990). The transforming

property of RevT is attributed the oncogene v-rel, a member of the ReVnuclear factor-d

(NF-KB) family of transcriptional regulators (Nuemann et ai., 1997). Transfomation by

v-rel is the subject of the work presented in this thesis.

In spite of the numerous studies on v-rel reported in the literature, the mechanism

for v-Rel-mediated transformation is still unclear. Due to the lethal nature of v-Re1 in

chickens, there has not been an effective method to study in siru transformation by this

oncogene. Therefore, a unique system has been developed in our laboratory to generate

chickens that are transgenic for v-rel, using retrovirai gene transfer cassettes. Essential

elements of the system as well as its construction will be discussed in this thesis.

Moreovi-r, specific questions regarding the target cells of v-rel mediated transformation

will be addressed.

A. The ReVlrci-KB Family

i. Function and Regulation

The importance of the ReVNF-KB family of transcriptional regulaton in s igding

has become increasingly evident. Although NF-KB was originally identified in mature B

cells as a tissue-specific factor involved in the expression of the irnrnunoglobulin K light

chah gene (Miyamoto et al., 1994), studies have revealed R e m - K . activity in virtually

al1 ce11 types including lymphocytes, hepatocytes and osteoclasts (Gerondakis et al.,

1998; Beg et al., 1995; Iotsova et al., 1997). These eukaryotic transcription factors

regulate genes that are involved in immune and inflarnmatory responses, as well as ce11

growth and differentiation (reviewed in (Ghosh et ai., 1998)). The Rei/hiF-~ family was

founded by the v-Rel oncoprotein (Wilhelmsen et al., 1984) and has since grown to

include c-Rel, the cellular homologue of v-Rel, RelA (p65), Rem, NfKbl @50), and

Nficb2 @52) (Gilmore et al., 1996). The two latter gene products result fiom post-

translational processing of precursor proteins, p 105 and p l O0 respectively.

Characteristic of most transcription factors, NF-KB hc t ions as either a homo- or

heterodimer and these dimers, generally referred to as NF-KB, can be composed of any of

the ReVNF-KB proteins described above. The NF43 dimers bind to DNA at lOBp

sequences, known as KB sites, which are found in either the promoter or the enhancer

elements of target genes; the consensus KB sequence is: 5' 4GGGYNNCCY- 3' (Ghosh

et al., 1998). The combination of ReV NF-& subunits in the NF-& dimer determines

the specificity of target genes (Perkins et al., 1 992). The pSO/RelA dimer has k e n most

thoroughly characterized and represents the prototype NF-KB molecule.

Members of the ReVNF-d3 family are identified by a conserved region in their N

tennini, the Re1 Homology Domain (RHD) (Figure 1). Sequences in this stretch of 300

amino acids are responsible for dimerization, binding to DNA at KI^ sites, nuclear

localization (via a nuclear localization signal, NLS), as well as binding to the IKB family

of inhibitory proteins (Bose, 1992). On the other hand, C proximai sequences are

rnember specific, and it is the C temini that confer differential transactivating properties

to the ReÿNF-KB molecules (Smardova et al., 1995). While the C tennini of c-Rel,

p65/RelA and RelB contain strong tramactivation dornains (TAD), neither p50 nor p52

posses homologous structures (Siebenlist et ai., 1994). The C termini of the pl05 and

pl 00 precursors, on the other hand, are homologous to the IKB inhibitory proteins since

they contain several ankyrin motifs. For this reason, these C-termini has been designated

as IKB-y and IKB-6 respectively (Nuemann et al., 1997). Since the individual ReVNF-KB

molecules have different transactivating abilities, the combination of these subunits can

influence the specificity and efficacy of the NF-& dimer.

Although NF-KB is a constitutively active nuclear factor, it is normally

sequestered in the cytoplasm of cells where it is inactive (Miyamoto et al., 1994). The

IKB inhibitors are responsible for the cytoplasmic retention of these dimers. A whole

family of inhibitory proteins, the IKB family, has now been identified, and includes

Figure 1. The ReUNF-icB Famiiy of Transcription Factors. a) Al1 members of the Rel/NF-d3 family share a consewed N terminal motif, the Re1 Homology Domain (RHD), which is responsible for dimerization, nuclear translocation, DNA binding and binding to I d 3 inhibitory proteins. C termini of these proteins are rnernber-specific. While the C termini of c-Rel & p65 have strong transactivation domains (TAD), the C terminus of p50 precursor (p105) encodes a d q m repeats, also found in the I d 3 inhibitors. The black arrow shows the site of post-translational cleavage of the p50 precursor. b) The v-Re1 oncoprotein is an W-Rel -ENV hsion protein. The env encoded amino acids are depicted by black boxes at the N and C tennini of v-Rel. There is a 1 18 amino acid truncation at the C terminal end of v-Rel; therefore, the oncoprotein lacks the strong TAD of its cellular homologue. The small stars represent intemal amino acid substitution found in v-Re1 as compared to c-Rel.

p40A~B-a, IKB-B, I d - y , 1~B-6, pl05 and Bcl-3 (Baldwin, 1996); the most recent

addition to the family is IKB-E (Whiteside et al., 1997). Up until now, IKB-a has been

the most thoroughly characterized member of the I d family, with respect to its structure

and function (Figure 1). The N terminus of IKBU contains residues that can be

phosphorylated or ubiquinated; the central domain encodes six ankyrin repeats,

homologous to the ones found in the pl05 and pl00 precursor proteins; and the C

terminus of the inhibitory protein is rich in negatively charged amino acids maldwin,

1 996).

Recentiy, mutationai analysis of the ReÿNF-KB subunits was carried out by Beg

et al (1992(Beg et al., 1992)) to demonstrate that N F 4 3 dimers interact with the

inhibitory proteins, such as IKB-a, through their RHD. Subsequently, similar mutational

anaiysis techniques were used to show that the IKB proteins interact with the RHD of

NF-KB via their a d y i n repeats (Luque and Gelinas, 1998). Binding of IKB to the RHD

is believed to mask the NLS of R ~ W - K B proteins, which is also found in the RKD.

Therefore, occlusion of the NLS by IKB-a prevents translocation of the NF-KB dimer

from the cytoplasm to the nucleus, rendering the dirners inactive (Gilmore and Morin,

1993).

A broad range of stimuli can activate the R e m - K B transcription factors; these

include cytokines, lipopolysaccharides and phorbol esters as well as lymphocyte

induction through engagement of B or T ce11 receptors (Zurovec et al., 1998). Molecular

targets of these stimuli are the inhibitory proteins, I d (Figure 2). Upon stimulation,

IKB-a is phosphorylated at two key serine residues (Gilrnore and Morin, 1993).

Recently, Roff et al. (1996) demonstrated that phosphorylated IKBU remains bound to

NF-KB dimers. This group also established that phosphorylated I d - a is ubiquinated

pnor to degradation. Therefore, the phosphorylated I d 3 - a protein serves as a substrate

for ubiquination. Only after ubiquination does the inhibitor fall away fiom the NF-KB

dimer, and is then targeted for degradation by îhe 26s proteosorne. Having been released

from the inhibitor, NF43 dimers are free to translocate across the nuctear membrane,

enter the nucleus where they bind to d3 sites, and ultimately alter transcription of

downstrearn genes (Ghosh et ai., 1998).

Figure 2. Activation of ReVNF-d3 Transcription Factors. NF-& dirners are sequestered in the cytoplasm of cells as inactive dimers by binding to inhibitory proteins of the IKB family. Upon stimulation, inhibitory proteins are first phosphorylated, then ubiquinated, afier which they fa11 away fiom the dimer and are targeted for degradation by the 26s proteosorne. Once released, the NF-KB dimer is fiee to translocate across the nuclear membrane and bind to KB sites on the DNA, where it exerts its roIe as a transcriptional regulator.

Activation -

Translocation to the nucleus \

Ubiquitination of IKB

kB site - IKB-a - c-Rel

- c-myc

Figure 2. Activation of ReVNF-KB Transcription Factors

NF-KB activity is controlled by an auto-regdatory mechanism since activated

NF-KB promotes transcription of the inhibitor, 1KB-a (Kopp and Ghosh, 1995).

Recently, Arenzana-Seisdedos et ai. (1 995) showed that IKB-a c m be detected in the

nuclei of cells and, more importantly, that at high levels, IKB-a can negatively regulate

NF-KB b inding to DNA. Therefore, the ReVNF-tcB famil y of transcriptional regdators

provide a system that can rapidly alter the expression of a wide array of genes in

eukaryotic cells.

ii. ReViYF-KB in Inflammatory and Acute Pbase Responses

The activation of Rei/'W-icB dimers is independent of de novo protein synthesis.

Therefore, this system is ideal for rapid responses such as infiammatory, stress and acute

phase responses. Moreover, the auto-regdatory nature of NF-KB allows for a controlled

rcsponse to extemal stimuli. Localized areas of damage caused by stress, injury or

infection provide stimuli for NF-KB activation, which include reactive oxygen species,

LPS and TNF-a (Wulczyn et al., 1996). Consequently, genes involved in both acute

phase and pro-inflamrnatory responses are regulated by NF-KB.

In mice, damage to the liver ultimately leads to the up-regdation of acute phase

proteins (APP), which are important for the protection of host cells. Interestingly,

Baumann and Gauldie (1994) were able to detect high levels of activated NF-KB in the

damaged liver tissue. They also found that NF-KB activity was proportional to the level

of APP expression.

More recently, role of NF-KB in hepatocytes was studied in repenerating liver

tissue by Cressrnan et al. (1994). The mwine liver has a high propensity for regeneration

following physical damage, and in their study Cressman et al. found elevated levels of

activated NF-KB in the rapidly dividing cells of damaged liver tissue. Although hi&

levels of p65/RelA were detected in the nuclei of these hepatocytes, it is still unclear

whether the increased rate of ce11 division was the direct result of NF-KB activity. Genes

encoding IKB-a, pSO, p65lRelA and c-rel were induced in the damaged liver tissue.

Inflarnmatory responses are equally important for the protection of host tissue and

essential elements include cytokines and ce11 adhesion molecules. Cytokines that have an

integral role in inflammatory responses are IL-1, IL-2, IL-6, IL-8, IFN-P and TNF-a.

The genes for these cytokines are up regulated by activated NF-KE~ (Bach et al., 1997).

GM-CSF and G-CSF, also under the control of NF-&, are important infiammatory

mediators because they stimulate the differentiation and proliferation of macrophages and

granulocytes (Kopp and Ghosh, 1 995). Another important immediate-earl y response to

tissue damage is the up-regulation of ce11 adhesion molecules. These proteins, produced

during an inflamrnatory response, help attract circuiating immune cells to the site of

injury (reviewed in (Kopp and Ghosh, 1995)). Genes encoding the ce11 adhesion

moIecules VCAM-1 and ICAM-1 pssess KB sites in their promoters and are, indeed,

under the control of N F - a .

iii. ReVNF-a in Development

In multi-cellular organisms, ReVNF-KB factors have an important role in tissue

development. This is exemplified by Dorsal, a transcription factor identified in

Drosophila. Dorsal is homologous to NF-&, implying an evolutionary importance for

these factors, and it is a dorsallventral morphogen that is found in early developmental

stages of the Drosophila embryo (Govind and Steward, 1991). More recently, other

Dorsal related, and therefore ReVNF-KB related, proteins have been identified in

Drosophila: these include Dif and Relish, both of which have been implicated in the

immune system of these organisms (Ghosh et al., 1998).

The importance of ReVNF-KB in vertebrate development has been studied in vivo

usine murine knockout models. One such mode1 is the p65RelA knockout (Beg et al.,

1995). In these mice, the absence of RelA resulted in high levels of embryonic death.

Autopsy of the embryos revealed that the deaths were predominantly due to severe

developrnental defects in the liver. Hepatocytes were targeted for apoptosis in the

absence of RelA.

The importance of NF-KB in lyrnpbid organs has long been acknowledged.

Although it was originaily proposed that NF-& was oniy important for maintenance of

the spleen, and not for its development (Schmidt-Ullrich et al., 1996), more recent

findings have disproved this hypothesis. Caamano et al. (1998) demonstrated that the

development of spleen was abnormal in ~ S W - K B ~ knockout mice. The defects

obsewed in these mice were the resuit of developmental abnormalities in the

perifollicular and the marginal zones of the spleen; B ceIl compartrnents of the spleen

were also afTected. In addition to p52/NF-KB, RelB has also been implicated in normal

hematopoetic deveiopment since mice that are knocked out for RelB exhibit

splenomegaly, due to extramedullary hernopoiesis (Weih et al., 1996).

Using an avian model, Bushdid et ai. (1998) demonstrated that NF43 has a role

in embryonic development; inhibition of NF-KB activity in deveioping chick embryos

resulted in aberrant Iimb morphology. Although the exact rnechanism of NF-& activity

is still unclear, this group has proposed that these transcription factors regdate the

expression levels of growth factors. Furtherrnore, c-Re1 is expressed at high levels in

developing chick embryos and has been implicated in the differentiation and

development of lymphoid organs therein (Abbadie et al., 1993).

iv. R e m - K B in Lymphocyte Activation and Proliferation

Activation of lymphocytes results in ce11 division, differentiation or apoptosis.

The R e w - t c B members have been irnplicated in determining the final outcome of

lymphocyte induction. While the importance of RelB has been demonstrated for

lymphocyte development, knockout models for other R ~ N - K B members (c-Rel,

pSO/NF-KB1 and p65/ReIA) have also revealed the importance of these subunits in

lymphocyte activation (reviewed in (Gerondakis et al., 1998)). Although the B and T

cells in these knockout mice develop normaily, they exhibit a hypoproliferative response

to mitogenic, cytokine and LPS stimulation.

Interestingly, the composition of NF-KB dimers is not static throughout

lymphocyte developrnent. Liou and CO-workers (1994) were able to show that specific

combinations of Rem-KB members were preferentidy activated at different stages of

B ce11 development. At the pre-B cell stage, pSO/p65 was the main dimer, while in

mature B cells the c-ReVpSO dimer was predominantly activated. Finally, this poup

found that p52/RelB was the active NF-& dimer in terminally differentiated B cells.

Since previous studies have shown that NF-KB specificity is dependent on the

combination of Rel/NF-~i3 subunits in the dimer (Perkins et al., 1992), these findings of

Liou et ai. imply that different genes are induced at the various stages of B ceil

development and activation.

Proliferation of activated B cells is a fimdamentai step in immune responses to

various stimuli, and the ReüNF43 famiiy were found to have a prominent role in this

process. Lymphocytes derived fiom mice lacking the c-rel proto-oncogene exhibit an

impeded proliferative response (Kontgen et al., 1995). These findings were also

observed in rnice that expressed a mutated form of c-Re1 that was vuncated for its C

terminus (Carrasco et al., 1998). Although the mutant c-Re1 still possessed an intact

RHD, it lacked the strong transactivating domain (TAD), demonstrating that the

transactivating property of c-Re1 is required for normal B ce11 proliferation.

In addition to impaired proliferative responses (described above), lymphocytes

with attenuated NF-KB activity exhibit defects in ce11 cycle progression. Following

mitogenic activation, B cells that were missing either Nkb-1 (NF439 or c-Re1 (c-Rel")

were arrested in the G1 stage of ce11 cycle (Grumont et al., 1998). Other studies have

demonstrated that the activity of RelA in lymphocytes is intimately Iuiked to the cyciine-

dependent kinase (cdk) 2 (Perkins et al., 1997). These findings suggest that NF-KB

interacts with the ce11 cycle machinery in proliferating cells.

In an h u n e response, B lymphocytes ultimately undergo terminal

differentiation to pIasma cells. This process involves isotype switching of the

immunoglobulin heavy chah Murine knockout models have revealed that the Rel/NF-

KB proteins are involved in this process as well. Mice that lacked c-Re1 were severely

reduced in both memory and germinal center % ceil compartments (Tumang et al-? 1998).

This lack of mature B lymphocytes implicates a defect in terminal differentiation of these

cells. possibly at the level of imrnunoglobulin class switching. The c-Re1 knockout

mouse is not the only mode1 to exhibit this phenotype, and mice that are knocked out for

pSOMF-KB 1 also manifest defects in isotype switching (Snapper et al.96). The

possibility that R e W - K B transcription factors are involved in the process of isotype

switching is not measonable since d3 elements have k e n identified in the regions

responsible for Cy 1 and Cy3 expression (Tumang et al., 1998).

The R e W - d family is involved in many aspects of cellular activation and

development at the level of transcriptional regdation. Therefore, the consequences of

dysregulated R e m - K B activity c m be severe. Indeed, aberrant expression of c-rel and

nfKbl due to chromosomal rearrangements have k e n observed in human tumors (Lu et

ai., 1991 ; Neri et al., 1991). While normal c-Re1 activity is essentid in eukaryotic cells,

expression of the viral homologue (v-Rel) can result in neoplastic growth. Although the

exact mechanism of v-rel mediated transformation has yet to be elucidated,

understanding how and what this oncogene transforms can ultimately enhance our

understanding of both aormai and altered ReVNF-d3 activity in general.

B. The v-rel Oacogene

i. RevT and the v-rel oncogene

The reticuloendothelial virus strain T (RevT) was initially isolated fiom a turkey

suffering from a reticular disease (Theilen et al., 1966)- Since then, it has been

detennined that RevT is among the most overtly transforming of al1 known retrovimses,

and when RevT was used to infect neonatal chicks, it resulted in fatal tumors and death

within two weeks (Barth and Humphries, 1988). RevT is a replication defective

retrovirus that encodes a single functional gene: v-rel (reviewed in (Nuemann et al.,

1997)). Both the gag and pu1 genes of RevT have been truncated and the env gene has

been substituted for the v-rel oncogene. The result of these modifications is a virally

encoded protein that is expressed at high levels fiom the strong RevT 5' LTR. Due to the

integration of v-rel into the env gene of RevT, there are sequences flanking the oncogene

that encode additional amino acids. The ENV-Rel-ENV fusion protein has 11 ENV

derived amino acids at the N terminus, and 18 at the C terminus. These residues are not

found in the cellular homologue, c-Rel.

The v-Re1 @59v'RC') oncoprotein possess an intact RHD at its N terminus,

confirming its membership in the ReVNF-KB family of transcription factors (Gilmore,

1992). However, v-rel is the only member of the R ~ ~ N F - K B family that is consistently

oncogenic both in vivo and in vitro (Gilmore et al., 1996). A structural importance has

been implicated in the transforming property of v-Re1 since this oncoprotein differs fiom

its cellular homologue (~68''") in many ways. In addition to the ENV derived amino

acids that flank the oncoprotein, v-Re1 is missing two N terminal amino acids found in c-

Re1 and, more importantly, v-Re1 has a l 18 amino acid truncation at its C terminal end.

Therefore, v-Re1 lacks the strong transactivation domain (TAD) that is found in c-Re1

(Figure 1). Finally, there are a total of 18 intemal amino acid substitutions in v-Re1 as

compared to c-Re1 (Bose, 1992). The implications of these modifications in v-Re1

mediated transformation will be discussed subsequently.

ii. The Helper Virus Dichotomy: RevA vs. CSV

Since RevT is replication defective, it is dependent on a helper virus for

propagation, Le., for productive infection of target cells. RevT was first isolated in

conjunction with the replication competent retrovirus RevA, and initial characterization

of RevT transformation in chickens was carried out with RevT(RevA) (Hoelzer et al.,

1980). Although it was discemed that this viral pair could cause lymphomas in chickens

as well as transform cells in vitro, transformation studies in vivo were impeded by the

irnmunopathogenic nature of the helper virus. The RevA retrovirus causes

immunosuppresion, thymic and bursal atrophy in birds and cytopathic effects in chicken

embryo fibroblasts (CEFs) (Barth and Humphries, 1988). Therefore, it was supgested

that the range of target cells ûansfonned by RevT(RevA) was limited by the toxicity of

the RevA retrovirus (Gilmore, 1992). This led the Humphries group to develop a novel

system for studying RevT mediated transformation (Barth and Humphries, 1988).

RevT(RevA) was passaged through a myeloid ce11 line caq ing the chicken syncitiai

virus (CSV) and this ultimately led to the isolation of RevT in the contex? of CSV, a non-

c ytopathic helper vins. Subsequentl y, RevT(CSV) was used to characterize target cells

for v-rel mediated transformation. Interestingly, the RevT(CSV) transformed cells

differed fiom those transformed by RevT(Rev-4) (Barth and Humphries, 1988). This

difference is discussed in the following section.

iii. V-Re1 vs. V-Rel*

Originally, infection of young birds with RevT(RevA) led to the transformation

of several ce11 species. When these cells were characterized by ce11 surface marker

expression, they were found to be predominantiy cells of the myeloid Iineage as weli as

immature lymphocytes (reviewed in (Gilmore, 1992)). On the other hand, infection of

neonatal chicks with RevT(CSV) resulted in polyclonal B ce11 turnors, suggesting that B

cells of a mature phenotype were king transformed (Barth and Humphries, 1988).

Therefore, it was argued that the differences in tumor formation following infection with

either RevTmevA), which gave rise to turnors of a more resîricted clonaiity, or

RevT(CSV) was most likely due to the differences in helper virus.

This hypothesis was challenged when the v-rel oncogene encoded by

RevTf CSV), herein referred to as v-rel*, was fully sequenced (Romero and Humphries,

1 995). It was observed that v-rel* possesses a key alanine to serine substitution at arnino

acid 40, near the DNA binding site in the 'RHD. Moreover, observations made in vitro

revealed that v-rel and v-rel* "0th bound to KB sites, but with different afhities. This

sugpested that the point mutation could have affected the transforming properties of the

oncogene (Romero and Humphries, 1995; Kabrun et al., 199 1).

Cells transformed by v-rel and v-rel* show similar characteristics including an

up-regulation of the major histocompatibility complex class II (MHC class II) expression

and a down reguiated expression of the of the Bu-1 antigen? which is a pan-B ce11 marker

(Hrdlickova et ai., 1994; Humphries and Zhang, 1992). Although aitered gene

expression is characteristic of v-rel and v-rel* transformed cells, a causal relationship

between oncogenesis and the up or down regulated expression of target genes has not yet

been established.

In conclusion, the two forms of RevT differ not only in their helper virus. RevA

vs. CSV, but in the actual oncogene itself, v-rel vs. v-rel*. Although cells transformed

by these two oncogenes exhibit similarities in the altered expression of certain genes, the

phenotype and clonality of the resulting tumors differ: v-rel* transforms lymphocytes of

a more mature phenotype. Therefore, it is necessary to study whether the state of

endogenous gene activation determines the consequence of v-rel expression. It also

remains to be seen whether target cells are defmed by expression of ce11 surface receptors

for the ENV glycoprotein of the helper virus, or whether target ce11 specificity is defmed

by the oncogene itself. In order to comprehend the nature of the cells that are

transformed by v-Rel, it is first necessary to understand the mechanism by which v-Re1

transforms. A brief discussion of the current concepts of v-Re1 mediated transfonnation

is given below.

C. Transformation by the v-Re1 Oncoprotein

Although experiments carried out in vivo have revealed that RevT transfonns a

limited nurnber of ce11 types, this retrovirus was found to have a much wider target ce11

range in vitro. Splenic lymphocytes transformed by RevT in vitro gave rise to

immortaiized ce11 lines (Hannink and Temin, 1991). Immortalized cells that were not

rearranged for the immunoglo bulin heavy chah (IgH) did not undergo subsequent

rearrangement at these loci when grown in culture. On the other hand, transformed B

cells that were rearranged at one or both of the IgH loci, continued to grow in culture as

such. Therefore, it appears that cells transformed by v-Re1 are "fiozen in time" (Bose,

1992)-

Transfomed cells of the myeloid, lymphoid and erythroid lineages were

identified following infection of avian bone marrow cells, in virro, with a replication

competent retrovirus into which v-rel was cloned (Morrison et al., 2991). The

transformed bone marrow cells, however, were not immortaiized and eventually

succurnbed to senescence. In addition to hematopoetic cells, transformation assays also

revealed that v-rel was able to transform fibroblasts to a lirnited degree (reviewed in

(Gilmore, 1992)). Transformation by v-Re1 dramatically increased the 2 month life span

of chicken embryo fibroblasts (CEF) to 9 months, afier which time they senesced. CEFs

transformed by RevT expressed characteristic alterations in morphology due to

disruptions of the cellular cytoskeleton (Momson et al., 1991). Initially it was believed

that v-rel mediated transformation was limited to avian ceIls. Recent studies, however,

have demonstrated that transgenic mice expressing v-rel under the controI of a T ce11

specific promoter developed fatal T cefl lymphomas, showing for the f m tirne that v-rel

activity was not species specific (Carrasco et al., 1996).

Thus far, the exact mechanisrn by which v-Re1 is able to transform cells either in

vitro or in vivo is sûll unclear. The fact that v-Re1 is a member of the ReVNF-d3 family,

however, implies that this oncogene could function at the leveI of transcriptional control.

It is known that in transfonned avian tells v-Re1 interacts with other members of the

R e m - K B family, including c-Rel, p50, pl 15, pl24 and p40 (the Iast three gene

products are the avian homologues to pl 00, pl05 and IKB-a respectively) (Davis et ai.,

199 1 ; Momson et aI., 1989; Capobianco et al., 1992). The structural differences between

v-Re1 and c-Re1 provide insight into the elusive mechanism of v-Re1 mediated

transformation. Over-expression of the c-rel proto-oncogene transforms cells with only

2% efficiency compared to v-rel (Mosialos et al., 1991). Therefore, v-Re1 m u t have

unique features that render it acutely transforming.

i. v-Re1 as a Dominant Negative Mutant

Originally, a dominant negative role was ascribed to v-Re1 (reviewed in

(Nueman. et al., 1997)). This was predominantly based on the C terminal truncation of

the oncoprotein as compared to its cellular counterpart; v-Re1 does not have the strong

transactivation domain (TAD) of c-Re1 (Richardson and Gilmore. 199 1). However, v-

Re1 still possesses an intact RHD, ailowing it to dimerize with other members of the

ReVNF-KB family, translocate to the nucleus and bind DNA at icB sites (Figure 3). For

this reason, it was argued that v-Re1 interacts with the ReVNF-KB subunits to forrn

transcriptionally inactive dimers that can bind to and occlude KB sites. In fact, early

experiments using reporter genes linked to KB sites showed that v-Re1 did in fact

suppress transcription (houe et al., 199 1).

ii. The Active Model for v-Rel Transformafion

More recentIy, the conception of v-Re1 as a dominant negative repressor of

transcription has been reconsidered. Sequence analysis of v-Re1 revealed that the

oncoprotein does possess transactivating motifs despite its lack of the C terminal TAD.

Figure 3. Current Models for v-Rel Mediated Transformation. a) Under normal conditions, NF-KB dimers regulate transcription of target genes by fust binding to rB sites in either the promoter or enhancer regions. b) A Dominant Negative role was initially ascnbed to v-Rel, since the oncoprotein lacked the strong TAD of its cellular homologue, c-Rel. In this model, v-Re1 dimerizes with other members of the ReVNF-KB family to form inactive complexes that can still interact with KB sites. c) More recently, sequencing of v-Re1 revealed N o weak TADs in the C terminus of the oncoprotein, leading to an active role for v-Re1 in the transactivation of target genes.

a) Induction of Targent Genes by ReVNF-rcB Dimers

dimer

b) v-Rel as a Dominant Negative Mutant of c-Rel

kB site -.= +

c ) v-Rel as a Transcriptional Activator

kB site

Figure 3. Current Models for v-Re1 Mediated transformation

In fact, v-Re1 has two weak transactivation domains just downstream of the RHD

(Gilmore et ai., 1996). Moreover, a number of genes are up-regulated in v-Re1

transformed celIs; these include c-rel, nfkbl, i&a, c-jun, HMG-14b, and many others

(Nuemann et al., 1997). However, no definitive causal link has been made between the

up-regulation of many of these genes and transformation. The consequence of gene

induction by v-Re1 will be discussed subsequently.

iii. v-Re1 Mediated Transformation

Difficulty in detennining the exact mechanism for v-Re1 mediated transfonnation

is due, in part, to the fact that v-Re1 is found in both the cytoplasm and the nucleus of

transformed cells. V-Re1 is predominantly found in the cytoplasm of transfonned splenic

lymphocytes, in high molecular weight complexes with other cellular proteins (White et

al., 1996). However, in these cells a small proportion of v-Re1 is located in the nucleus

(Davis et al., 1990).

It has been suggested that the interaction between v-Rel and IKB-a in the

cytoplasm of cells couid titrate out the inhibitory protein, thereby releasing other Rel/NF-

KB dimers (Gilmore, 1992). The Iiberated dimers could then translocate to the nucleus

and aberrantly activate transcription. This is supported by the fmding that v-Re1

homodimers transforrn cells most efficiently than heterodimers that contain the

oncoprotein (Nehyba et al., 1997).

Even though the majority of v-Re1 is found in the cytoplasm of transformed cells,

it \vas recently determined that lymphocytes require a minimal level of v-Re1 in the

nucleus for efficient transfonnation to occur (Sachdev et ai., 1997). In order to show that

a threshold level of v-Re1 was required in the nucleus. mutants of v-Re1 that

contained artificial nuclear export signais (NES) were constructed. Transformation

assays revealed that these mutants had lost their oncogenicity suggesting that v-Rel, in

fact, carries out its transforming activity in the nucleus of cells rather than in the

cytoplasm.

Binding to DNA is a crucial step in v-Re1 mediated transformation. Mutations in

the RHD that interfere with the binding of v-Re1 to KB sites, negate the oncogenic nature

of v-Re1 (Momson et al., 1992; Hrdiickova et ai., 1995). Mutational anaiysis of the

oncoprotein has provided additional hsight on the V-ReWa interaction (Nehyba et al.,

1997). Mutations within the RHD as weIl as those at the C terminal end of v-Re1 altered

the KB binding specificity of the oncogene. The loss in DNA binding ability by these v-

Re1 mutants was accompanied by a decrease in their transfonning ability.

Temperature sensitive mutants of v-Rel, fs v-Rel, were recently isolated (White

and Gilmore, 1993). These mutants were found to be transfomring at permissive

temperatures (37°C); however, shifiing to a non-permissive temperature (42°C) resulted

in a loss of fimction. Interestingly, at non-permissive temperatures the ts v-Re1 mutants

were unable to bind KE sites.

To study the mechanism of transformation by the oncoprotein, Wdker and

Enrietto (1996) developed a conditional version of v-Rel, v-ReiER. This conditionai

mutant is a fusion protein made up of v-Re1 and the hormone-binding domain of the

human estrogen receptor. Activation of v-ReER was estrogen dependent (v-RelER was

induced in the presence of estrogen) and coincidentaily, v-RelER binding to KB sites

occurred in an estrogen dependent fashion as well. Therefore, the transforming abilities

of both rs v-Re1 and the conditionai v-RelER are dependent on KB binding.

Although these studies show that the v-ReUd3 interaction is essential for

transformation, the exact role of the association is still not clear. On one hand, Ballard et

al. (1 990) have identified v-Re1 as a ~ £ 3 binding protein that inhibits NF-& fùnction, i.e.,

v-Rel is a dominant negative version of the cellular homologue, c-Rel. On the other

hand, the activation of target gene expression following v-Re1 binding to KB sites has

also been obsewed (Humphries and Zhang, 1992; Walker and E ~ e t t o , 1996).

Implications of aberrant gene activation by v-Re1 are discussed in the next two sections.

iv. Activation of AP-1 genes by v-Re1

It is generally understood that v-&l mediates transformation by modiQing

normal gene expression. As descrïbed above, v-Re1 can forrn dimers with other Rel/NF-

KB subunits and bind KB sites through the FüiD; for this reason, the dominant negative

mode1 for v-Re1 mediated transformation was proposed. Nevertheless, transformation

assays using a series of v-Re1 mutants have demonstrated that the RHD alone is

insuficient to prornote oncogenesis of CEFs in vitro (Sarkar and Gilrnore, 1993). This

group demonstrated that sequences C-terminal to the RHD were indispensable to the

transformation process and recently, two weak TADs were identified in the C terminus of

the oncoprotein. These findings suggest that transformation by v-Re1 could be dependent

on both KB binding and transactivation of target genes.

Several genes are up-regulated as a consequence of v-Re1 mediated

transformation, including MHC class II and the hi& mobility group protein, HMG 14b

(Humphries and Zhang, 1992; Walker and Enrietto, 1996). In some cases, the eficiency

of v-Re1 transactivation differs fiom that of c-Rel. For example, v-Re1 does indeed

induce the IKB-a gene. However, v-Re1 activates transcription of the inhibitor less

efficiently than c-Re1 (Hrdlickova et al., 1995). This could mean that v-Re1 is less

sensitive to the autoregulatory loop than its cellular counterpart, c-Rel, thereby adding to

the oncogenic potentid of v-Rel.

Contrary to its effect on id-a v-Re1 can activate transcription fiom the c-jun

promoter more efficiently that c-Re1 (Fujii et al., 1996). This group also found that v-Re1

activated the c-jun promoter selectively in HeLa cells. More recently. Kralova et ai.

(1998) demonstrated that, in addition to induction of c-jun, c-fos was aiso up-regulate in

v-Re1 transformed CEFs and lymphocytes. Gene products of CM and c-fas are

members of the AP- 1 famil y of transcriptional regulators. Similar to Re1Nk.B

proteins, the AP- 1 transcription factors are responsible for expression of immediate early

response genes and ultimately promote ce11 proliferation (Karin et al., 1997). Therefore,

it is possible that the abnormal transactivation of AP-1 factors by v-Re1 is responsible for

uninhibited ce11 proliferation and tumorigenesis.

v. v-Re1 and Apoptosis

Normal development and tissue homeostasis are dependent on apoptosis, a

physiologicdly important process by which unwanted cells are eliminated @uke et al.,

1996). This form of inducible death is programmed into cells and is characterized by a

common set of morphological alterations. Interference with apoptosis leads to

unrestricted cellular proliferation and is conducive to cancer (Thompson, 1995).

Studies have revealed a Iink between the v-rel oncogene and a decrease in

apoptotic activity. For example, chicken bursal cells that aberrantly expressed v-Re1

were resistant to standard apoptotic stimuli (Neiman et al., 1991). The adverse effect of

v-Re1 on apoptosis has also k e n studied in other ce11 lines, and it was found that by over-

expressing the oncoprotein in HeLa cells, programmed ce11 death could be prevented

(Zong et al., 1997). Similar results w-ere observed in v-Re1 transformed chicken spleen

ceils (White et al., 1995).

The mechanism by which v-Re1 impedes the apoptotic process is still unciear.

However, temperature sensitive mutants of v-Re1 have been used to show the

involvement of Bcl-2 in this process (White and Gilmore. 1996). Bcl-2 is a family of

proteins that are able to suppress apoptosis. Using the v-Re1 mutants, White and Gilmore

demonstrated that over-expression of Bcl-2 could rescue cells £iom apoptosis at

temperatures that were non-permissive for v-Re1 activity. Whether the expression of bcl-

2 genes is regulated by v-Re1 has yet to be determined.

Very recently, another link was made between the transforming ability of v-Rel

and its anti-apoptotic activity (You et al., 1997). CEFs were first transformed by 2s v-Re1

mutants, and then the mRNA species present in CEFs at permissive and non-permissive

temperatures were compared. In this fashion, You er al. found that at permissive

temperatures, transformed cells expressed high levels of message coding for a protein

that is known to inhibit apoptosis, ch-IAP. This message was not expressed under non-

permissive conditions. The Inhibitors of Apoptosis, IAP, make up a novel family of

proteins that are known to block apoptosis normally triggered by a wide array of stimuli

(reviewed in (LaCasse et al., 1998)). The chicken homologue to IAP is ch-IAP. Up-

regulated expression of ch-IAP by v-Re1 could be the mechanism by which the oncogene

interferes with ce11 death, and ultimately lead3 to transformation of CEFs.

The v-Re1 oncoprotein has not been formally linked to the induction of anti-

apoptotic genes. However, mutational analysis of the C terminus of v-Re1 has revealed

that key serine residues in the transactivating domains of v-Re1 are indispensable for the

anti-apoptotic and the transforming properties of the oncogene (Chen et ai., 1999).

Therefore, interference with the transactivating ability of v-Re1 also hampers the anti-

apoptotic activity, and ultimately the transfonning potential, of the oncoprotein.

D. B Cell Development in Chickens

Our laboratory is interested in characterizing the cells that succumb to v-rel*-

mediated transformation in vivo, in order to gain a better understanding of the mechanism

by which v-rel* transfonns cells. As discussed above, initial characterization by

RevT(RevA) and RevT(CSV) infection show that immature and mature B cells,

respectively, are the primary targets for these viruses. However, in order to appreciate

the difference between the target cells for v-rel and v-rel* mediated transformation, it is

necessary to understand avian B ce11 development. This section provides a brief

overview of B ceIl development in chickens.

i. B Cell development: Mammals vs. Birds

Rearrangements of the immunoglobulin (Ig) Iight and heavy Ioci are required to

eenerate functional Ig genes in rnarnmals and birds alike. However, the process by which C

Ig diversity is obtained differs significantly between the two species. In marnmals, the

immunoglobulin locus encodes multiple variable (V), diversity (D) and joining (J)

elements; recombination can occur between any one of the above elements to give a

functional V@)J region for the Ig heavy chain gene, or a functional VJ region for the Ig

light chain gene (Tonegawa, 1983). Owing to the multiple V, D and J elements found at

the Ig locus, the combinatonal possibilities provide the first step in generating a varied

set of Ig molecules. The Ig repertoire is fùrther expanded through junctionai diversity,

which includes the addition of non-templated 'N' nucleotides by terminal

deoxynucleotidyl tramferase (tdt), and the presence of 'P' nucleotides that result fiom

hairpin resolution (Lieber et al., 1994). Anoaer level of diversity is achieved by pairing

of the iight and heavy chains. In rnammals, diversity is an ongoing event throughout the

Iifetime of an animal.

On the other hand, avian species have developed a different way to generate a

diverse Ig repertoire (reviewed in (Ratcli ffe and Jacobsen, 1 994)). S imilar to mammals,

birds have a prerequisite for rearrangement of the Ig locus for comrnitment of a ce11 to the

B lymphocyte lineage. However, uniike mamrnais, birds only have one functional gene

segment for the V and J regions of both the heavy and light chain loci, aithough there are

multiple copies of non-fûnctional gene segments at these loci, YVD, and YVL

respectively (Reynaud et al., 1989). In B cells, rearranged genes must include both the

fùnctional V and J elements for successful induction of surface Ig expression, thereby

resulting in nearly identical V@)J and VJ regions at the heaw and light chah loci,

respectively (Reynaud et ai., 1985; Reynaud et al., 1987). In birds, this process only

occurs during embryo development. The resulting B cells express surface ig with a

limited diversity. However, through a process of somatic gene conversion, these B ce11

are able to diversi@ their Ig genes ((Thompson and Neiman, 1987); reviewed in (Funk

and Thompson, 1996)). In gene conversion, portions of the V pseudo-genes are copied

ont0 the rearranged V gene segment in a unidirectionai fashion. Multiple gene

conversion events can occw for a single V gene segment. In this rnanner, gene

conversion accounts for a majority of the variability found in the chicken Ig repertoire.

ii. The Bursa of Fabricius

In avian species there is an organ located just above the cloaca that serves as the

primay site of B ce11 lyrnphopoesis; this organ is the Bursa of Fabricius. Development

of the bursa starts between days 8 and 14 of embryogenesis and continues until sexual

mitturity, at which time the organ starts to involute (Houssaint et al., 1976). The Bursa is

organized into approximately 10' follicles. These follicles are seeded by a minimum of

two to four B ce11 precursors, which undergo massive proliferation (Ratcliffe, 1989; Funk

and Thompson, 1996). Ultimately, each follicle can houe up to 10' B lymphocytes

(Olah and Glick, 1978).

Although the bursa is indispensable for B ce11 development, these lymphocytes

actually originate at extra-bursal sites. During embryonic development, cells are fvst

committed to the pre-bursai stem ce11 (pre-busc) lineage which then colonize the bursa

(Neri et al.? 1991). These stem cells have a finite life span, and by the two weeks pst-

hatch the pre-buscs completely disappear fiom sites of hematopoesis (Weber and Foglia,

1980).

Early studies suggested that cells at the pre-busc stage are already committed to

the B ce11 lineage (Ratcliffe et al., 1986). PCR anaiysis has been used to c o n f i the

rearrangement of the immunogiobulin (Ig) loci in these stem cells (Mansikka et al.,

1990). As mentioned above, cells entering the bursa have a limited diversity, but

diversification of the Ig repertoire by gene conversion occurs therein. It is now clear that

the bursal microenvironment is essential for fidl gene conversion to take place. In

bursectomized birds, B ce11 numbers are severely compromised and serum antibodies are

of a limited specificity(Lassi1a et ai., 1988; Mansikka et al., 1990).

iii. The Fate of Bursal Cells

As birds age, light chah diversity of B cells in the bursal follicles increases

dramatically (Lassila et al., 1988). Ultimately, mature bursal cells are exponed nom the

bursa to penpheral organs such as the spleen, or to the blood, and can then give rise to

rnanire/mernory B cells (Funk and Thompson, 1996). Only about 5% of the bursal ceils,

however. actually migrate from the bursa and the rest are subjected to an apoptotic death

(Lassila 1989). Concurrent with bursal proliferation and gene conversion, is a process of

selection and it is possible that expression of surface Ig serves as a survival signal for

bursal cells. Our laboratory has demonstrated that down-regulation of Ig precedes

apoptotic death in the bursa (Pararnithiotis et al., 1995). Therefore, diversification events

that result in aberrant Ig genes, by generating premature stop codons or fiameshifi

mutants, and that lead to the down regulation of surface Ig expression, would also target

cells for apoptosis.

iv. Summary of Avian B Cell Developmen t

B celI deveiopment in chickens commences during embyogenesis. Once the pre-

busc cells colonize the bursa massive proliferation and diversification can occur.

Although the majority of B cells appear to apoptose in the bursa, diversified B cells

immigrate to the periphery where they can ultirnately differentiate to mature/memory

cells. To date, it is known that B cells are the targets of v-Re1 mediated transformation.

However, whether B cells at al1 stages of development are susceptible to transformation

by v-rel is still unclear.

E. Specific Experimental Goals

Our laboratory is interested in studying the mechanism of v-rel* mediated

transformation. By determining which cells are targeted for transformation by v-rel*, we

can gain a better understanding of the intracellular requirements for v-Rel*- mediated

oncogenesis. Therefore, development of chickens that are transgenic for the v-rel*

oncogene would provide a mode1 to study in situ transformation. Moreover, generating

transgenic birds of this nature would obviate the prerequisite of cellular infection by

RevT, and therefore elirninate the need for a helper virus.

The work described in this thesis -involves the design and construction of the

vectors used for somatic transgenesis of v-rel* by retroviral cassettes, both in vitro and in

vivo. Since we hypothesized that hi& levels of oncogene expression couId have

detrimental effects on embryo development, the v-rel* oncogene was placed under

conditional expression. The conditional expression system used here was the tetracycline

repressiblr system described by Gossen and Bujard (Gossen and Bujard, 1992). Once the

vectors were constructed, tetracycline levels were optimized in vitro and in vivo for the

conditional expression of v-rel*. Finally, questions regarding target cells were addressed

by phenotyping cells that transformed in vivo under conditions permissive for the

expression of v-rel*.

Chapter 2. Materials and Metbods

In vitro and in vivo work

Chicken Srrains

Chickens used in the work presented here were exclusively of the SC line

(Hyline International, Dallas Center, IA). These chickens are an F1 hybnd of the S and

C line chickens. Line O chickens, which are devoid of endogenous retrovirai loci, were

used as a source of chicken embryo fibroblasts (CEF) (RPRL, East Lancing). Birds

maintained on tetracycline received 100~1 of tetracycline (lOmg/ml in dH20) intra-

peritoneaily, every second day.

Preparation of Ceil Suspensions

Peripheral Blood Lymphocytes (PBLs) were prepared firom fiesh blood drawn

from the chickens and into heparin (lOu/til in saline). Cells were washed in 3 volumes of

Hanks Bdanced Salt Solution (Hanks BSS) and centrifuged at 32 1g for 10 minutes (al1

spins were carried out at 14OC unless othenvise specified). Pellets were then resuspended

in Hanks BSS. Ce11 suspensions were underiayered with Lympholyte M (Homby, ON)

to form a density gradient and then centrifuged at 1075g for 20 minutes. PBLs were

collected fiom the interface, washed three times with Hanks BSS (first at 385g and then

two time at 32 lg), and stored on ice.

Bursal, spleenic and thymic lymphocytes were prepared separately by fmt

mashing tissue through a fine wire mesh. The ce11 suspension was then transferred to a

tube containing Han!! BSS, placed on ice for 5 minutes and then decanted into a fresh

tube to remove any tissue debris. Cells were washed once (321g, 10 minutes) and

resuspended in Hanks BSS. Cell suspensions were underlayered with Lympholyte M and

red blood cells were rernoved by spinning at 1075g for 20 minutes. Lymphocytes were

collected from the interface and washed (see above). The same steps were carried out to

harvest lymphocytes fiom liver tissue. Ali steps described above were carried out under

sterile conditions.

Tissue Culture

Transfonned cells lines and hybridomas were grown in 250mI tissue culture

flasks while chicken embryo fibroblasts (CEFs) were plated on lOOmrn tissue cuiture

plates (Nalgen Nunc I d . , ON ). Cells were cultured in Iscove's Modified Dulbecco's

Medium (IMDM) supplernented with 3.025 g/L NaHCO,, 100 U/ml penicillin, 100

pg/ml streptomycin, 5x1 O-' M 2-ME, 5% heat inactivated fetal calf senun (FCS) and

either 2% chicken s e m (CS) (GibcoBRL, Burlington, Ontario) for transformed cells,

1 % CS for chicken embryo fibroblasts (CEFs) or a total of 10% FCS for hybndomas.

Cells were grown at 37°C with 5% CO, in humidified air.

Thawing and Freezing of Cells

Cells that were fiozen down were washed three times in Dulbecco's PBS (DPBS)

supplemented with 2.5%FCS and viable cells were counted by trypan blue exclusion.

Cells were then resuspended to a final concentration of I07cells/ml in fieezing media

(69% RPMI media, 20% FCS, l%CS, 10% DMSO). 500pls of the ce11 suspension

(5x1 o6 cells) were aliquoted into cryo-tubes. Aliquotes were fiozen at -70°C for 16 hours

then transferred to -1 50°C.

Cells kept at -150°C were quickly thawed, immediately washed in 10 mls of

s t ede IMDW2%CS and resuspended in 2 mis of media. The ceIl suspension was

senally diluted 1 2 in 24 well tissue culture plates. After 24-48 hours, cultures were

ultimately passaged to larger culture flasks. Cells were re-fed every two days.

CEF Culture and Passage

Vials of CEFs were thawed quickIy and immediately washed in IMDM/l%CS

(32 1 g, 10 minutes) before plating on 100mm tissue culture plates. Cells were passaged

on average twice a week. The following procedure was used to harvest confluent CEFs:

Following aspiration of the media, CEFs were washed once with 5 rnls pre-\vanned PBS

A. 2 mls of pre-warmed trypsin solution (0.125% trypsin, 0.7 mM EDTA in PBS A)

were added to the plates and incubated for two minutes with tapping to Ioosen adherent

cells. 5 mls of IMDM/l%CS were added to the plates. Ce11 were then transfemed to

sterile tubes and washed (321g, 10 minutes). These CEFs were resuspended in 2 m l s of

ILMDM/I%CS; viable cells were counted by trypan blue exclusion before k i n g re-plated.

Calcium Phosphate Mediated Transfection

Plasmid DNA was fmt precipitated in the foiiowing manner: 220 pL sterile DNA

(40pg/ml in O. 1 X TE pH8) was mixed with 250 pL of 2X HEPES-buffered saline (KF3S).

3 1 pL of 2M CaCl, was slowly added with bubbling to ensure proper mixing. Following

a 20 minute incubation at room temperature, the calcium phosphate-DNA CO-precipitate

was resuspended by pipetring up and down 3 times and then added dropwise onto a plate

of CEFs containhg 5 mis of pre-warmed IMDM/l%CS. After a 4 hour incubation at

37"C, media was aspirated. CEFs were washed once with pre-warmed PBS A and then

glycerol shocked (IMDM/1%CS/IS% glycerol) for 2 minutes at 37°C. Cells were L

washed once with PBS A and cultured in IMDM/l%CS. Al1 of the above steps were

carried out under stenle conditions. CEFs were transfected when they were at 20%

confluence.

Generation and Testing of RCAS based Viral Stocks

Transfected CEFs were used as a source of virus. Confluent CEFs were washed

with pre-warrned IMDM/I%CS. 5 mis of pre-wmed IMDM/2%CS was then added and

cells were incubated for 4 hours at 37OC. Following the incubation, supernatants were

harvested and cellular debris was removed by centrifugation (321g. 10 minutes).

Supernatants were aliquoted and stored at -70°C. To test for viability of the virai stocks,

nai've CEFs were cultured with 5-7.5 mls of virus, in a total of 10 mis of media- CEFs

were 50-75% confluent upon infection and were grown to confluence in the presence of

vins (2-3 days). CEFs were then harvested, as described above, and analyzed for viral

protein expression by flow cytometry. Expression of c-Re1 and v-Re1 by CEFs was

monitored by Western blot (see below).

Infection of Chick Embryos

Viral stocks were used to infect chick embryos. At day 13 of embryogenesis,

eggs were candled to detemine viability and to mark veins for virus injection. Widows

were cut at the marking with a srnaIl hobby saw and the shell was carefully removed so

as not to distub the shell membrane. Sterile Icc syringes were used to inject -100pL of

viral supematant directly into the exposed vein. Windows were sealed with paraffin wax

before retuming the eggs to the incubator. The injected eggs were candled withui 48

hours of injection to check for viability.

When required 50pl of filter sterilized tetracycline (IOrn~ml in dH20) was

injected through the paraffin window using a sterile lcc syringe. Eggs maintained on

tetrac ycIine received injections every 2 days.

Antibodies

Al1 hybndomas were cultured in IMDWIO%FCS as described above. Once cells

had grown to confluence, supematants were harvested by spinning cultures at 32 1g for 10

minutes to pellet cells. Supernatants were adjusted to a final of pH 8 with TE pH 8,

aliquoted and stored at -30°C. Al1 of the above steps were carried out under sterile

conditions. Monoclond antibodies were either purified by af3nit.y chromatograpby or

used as hybridoma supematants. A list of monocIona1 antibodies that were used is given

Antibody

1

I

W orking Concentration

(Flow Cytomeâry)

Antigen

(Ratcliffe and Tkaiec, 1 990) (RatditTe and Tkaiec, 1990)

4-22 l 1C6

Diluted hybndoma supematant (1 5 ) Diluted hybndorna supematant (1 5) NIA Undiluted hybridoma

Source

supernatant NIA NIA

Chicken IgM Chicken I d -

E. Humphries

E. Humphries

E. Humphries E. Humphnes

HY2 1

Hy23

RCAS viral protein

RCAS Wal protein

HY87 HY18

c-Re1 & v-Re1 Chicken IgM

1 Opg/ml

1 L J

F Io w C ytornetry

For the andysis of cellular antigens, cells were fmt washed three times in pre-

chilled Dubelcco's PBS (D'PBS). 0.Sx106 or 106 CEFs or lymphocytes, respectively,

were used when staining for ce11 surface antigens, while IO6 or 2x106, respectively, were

(Pafamithiotis et al., 1 995) EP25

Bul mix: Fu5 21-1A4 CT3

used when staining for intracellular proteins. The primary antibodies used are descnbed

Chicken MHC class n

1 lA9 LT2

above. Goat anti-mouse secondary antibodies conjugated to either fiourescein

isothiocyanate (FITC) or phycoerithryn (PE) (Southem Biotechnology Associates,

(Houssaint et al., 199 1) (Paramithiotis & Ratcliffe,

Chicken C M 12 Chicken LT2

Chicken Bu1

Chicken CD3

Birmingham, AL) were used.

10cidd 0.2pghnl

During the staining procedure, al1 washes were at 321p for 2 minutes for non-

1995) (Veromaa et al., 1988)

(Chen et al., 1986)

stenle stains. Moreover, live cells were kept on ice throughout the staining procedure.

1 O ~ k w l o ~ g ! d Diluted hybndoma supernatant ( 1 : 1 0)

Cells stained for cytoplasmic antigens were fmt fixed by incubation in ice cold ethanol

(70%) for 30 minutes and then washed with cold D'PBS an additionai three times before

incubation with the primary antibody. Both live and f~ved cells were blocked in D'PBS

+ 2.5%FCS on ice for 15 minutes. Cells were then incubated in SOpl of a primary

antibody for 15 minutes and then washed three times before resuspending in 50p1 of

appropriate goat anti-mouse FITC conjugate for 15 minutes. After three wshes. celis

were resuspended in 400pl DtPBS/2.5%FCS and then analyzed on a FACScan (Becton

Dickinson, Mountain View, CA) by gating of forward and side scatter. For two-colour

analysis of ce11 surface antigen expression, primary antibodies with different isotypes

were used and followed by c o p t e secondary antibodies. One of the secondary

antibodies was conjugated to FITC and the other to PE, allowing sirnultaneous analysis

of the two markers by flow cytometry.

RevT(CSV) Viral Stocks & Transformation of Lymphocytes Ex Vivo

The avian myeloid ceil line, S2A3, was used as a source of the RevT retrovirus in

the context of the CSV helper virus, RevT(CSV). S2A3 cells were cultures at a

concentration of 5x10~ for 4 hours at 37°C in IMDM/2%CS. Supernatants were fmt

harvested by pelleting the unwanted cells, then filtered through a 0.22pm filter and

finaily aliquoted and stored at -70°C.

The RevT(CSV) viral stocks were used for ex vivo transformation of bursal,

splenic and thymic lymphocytes isolated fiom SC chickens (E3enatar et al., 1991)

Western Blots

Protein expression in CEFs and lymphocytes was analyzed by SDS-PAGE.

Whole ce11 lysates fkom 106 CEFs or 3x106 lymphocytes were prepared as follows: cells

were harvested fiom tissue culture plates (CEFs and ce11 lines) or fiom chickens as

described above. m e r washing, cells were pelleted in microfuge tubes and resuspended

in 40pl of protein loading buffer (10% glycerol, 1OmM Tris pH 6.8, 2.3% SDS, 0.1%

bromphenol blue). 2-ME was added to a fmal concentration of 5%. Samples were boiled

for 5 minutes at 95-100°C and then spun at top speed in a microfuge for an additional 5

minutes to sediment large debns. Protein lysates u7ere separated under denaturing

conditions by SDS-PAGE (7.5% acrylamide) for 16 hours at 35volts using a SE 600

Vertical Slab Gel Unit (Hoefer Scientific Instniments, San Francisco). A semi-dry

transfer apparatus (Tyler Research Instruments, Edmonton, Alberta) was used for

transferring proteins to Ntrocellulose membranes (Schleider and Schuell, NH). The

tram fer was carried out at 1 5OmA for 1 hour in transfer buffer (20mM Tris base, 1 50mM

glycine, 20% MeOH). Membranes were blocked in TBS-T pH 7.6 (2OmM Tris base,

1 3 7mM NaCl supplemented with O. 1 % Tween-20) with 5% skim milk for 1 hour at room

temperature. BIots were then washed three times. Al1 washes were carried out in 50 mls

of TBS-T for 5 minutes with shaking. Membranes were immersed in 25 mls of primary

antibody (HY87 hybridoma supernatant) diluted 1 :5 in TBS-T + 5% milk, incubated for

one hour at room temperature with shaking, and then washed three times. The secondary

antibody was a goat anti-mouse coupled to horse radish peroxidase, and was diluted

1:3500 in TBS-T + 5% milk. Blots were incubated in 20 mis of secondary antibody for

45 minutes and then washed three times. M e r the f d wash, blots were developed by

the ECL chemiluniinescence system (Amersham, Oakville, ON).

Histology of Organ Tissue

Liver tissues fiom sacnficed birds were fmed in' 10% buffered forrnalin (buffered

with PBS A). Sarnples were embedded in paraffm wax within 48 hours and thin sections

were prepared for histological examination (Department of Pathology, McGill

University, QC). Hematoxylin & eosin (H+E) stains of the tissue samples were carried

out at the Department of Pathology, McGill University, QC.

For the immunohistochemistry, tissue sections were depdnized in 100%

xylene and re-hydnted over a ten minute interval decreasing concentrations of ethanol

(100%, 90%, 70%, 30% EtOH) and fmally immersed in dH20. Sections were

equilibrated in 600 mls of Antigen Retrievai Buffer (ARB) (18mM citric acid, 82mM

sodium citrate in dH20) and then boiled at high power in a microwave for 5 minutes. An

additional 100 mls of ARB were added and the sections were boiled again for 5 minutes.

Sections were then washed twice in Tris Buffered Saline pH 7.4. Al1 washes were

carried out in 50 rnls of TBS for 5 minutes with shaking.

Endogenous peroxidase activity in the tissue was quenched with 3% H202 (30

minutes ~ 4 t h shaking). Sections were washed 3 times prior to the blocking step.

Blocking of non-specific proteins was performed by incubating the tissue sections for 40

minutes in the blocking b a e r (TBS with 1% goat se-) in a hurnidified chamber

(Dimensions Laboratories Inc., ON). Sections were then incubated for 1.5 hours in the

presence of the primary antibody. Pnmary antibodies were used at a concentration of

30pg/ml in the blocking buffer. Sections were then developed usinç the Vectastain ABC

kit (please refer to manufacturers manual: Vector Laboratones Inc., CA). Finally,

sections were counter-stained with eosin.

Molecular Techniques

DNA Extractions fiom Eukaryotic Cells

Cells were washed three times in PBS A resuspended to give a final of 5x106 cells

per 1 .Sm1 eppendorf tube. Cells were pelleted at top speed in a microfuge for 1 minute

and supernatants were discarded. Pellets were resuspended in 1 ml RSB bufTer (lOmM

TrisNCi pH 7.4, lOmM NaCl, 5mM MgC12, 0.5% NP40) and incubated on ice for 30

minutes. Tubes were then spun at top speed in a rnicrofùge for 10 minutes and

supernatants were discarded. Pellets were solubilized in 500p1 Nuclei B d E r (0.5% SDS,

300mM NaCl, lOmM Tris/HCl pH 7.4,SmM EDTA pH 8) and Protehase K moehringer

Mannheim, Geermany) was added to each tube to a finale concentration of 250pg/ml.

Tubes were incubated overnight in a 37°C waterbath. Protein was removed from the

samples by phenol extraction and the aqueous upper phase was transferred to a fiesh

1 Sm1 tube. Sarnples were M e r extracted with an equal volume of ether and this t h e

the bottom layer was retrieved and transferred to a fresh tube. Ether was boiled off by

placing open tubes in a 60°C waterbath for 5 minutes. DNA was precipitated as follows:

125~1 of 10M ammonium acetate and 625pl of isopropanol were added to samples and

tubes were incubated for 20 minutes at -30°C. DNA was recovered by spinning tubes at

top speed in a microfiige for 10 minutes. Pellets were washed twice with 70% ethanol +

5.6~1 of 5M NaCl and then lyophilized. Ultimately, DNA was resuspended in 100~1 TE

pH 8, quantitated by spectrofiuorimetery and stored at -30°C.

Table of OIigonucleotides

Primer Name

JC (FI

K/E

WE'

pMJ1.0 3'

Sequence (5' + 3')

5'- AGAGCTCGAGCACATTTTCTGGTCAA -3'

5'- GCGGCCGCCACGATATC -3'

5'- CTAGGATATCGTGGCGGCCGCAGCT -3'

5'- GGCCAGTGAATTGTAATACG -3'

pMJ1.0 5' 5'- TCACACAGGAAACAGCTATG -3'

( Rel3' STOP 1 5'- ACGTTTCCTCGCGACAAGGTC -3' 1 I

VL5' (2) 1 5'- ACGCGTCAGGTACTCGTTGCGCCTGGTC -3' 1

Polymerase Chain Reaction (PCR)

Typically, 50ng of eukaryotic DNA template was used in the PCR reactioa.

When PCR amplification was carried out with either TAQ or PFU polymerase

(Strategene, CA) was also used for PCR amplification; in this case the reaction is the

same as descnbed above. Amplification was carried out in 0.5 mi tubes and reactions

were cycled in a Hypercell Biological Thermal Cycler (Chalk River, ON). The PCR

reaction is described below. Denaturation: 1.5 minutes, 95°C; annealing: 1 minute, 60-

65°C; elongation: 1 minute, 72°C. This cycle was repeated 30 times. The reaction was

completed with a final elongation step of 20 minutes at 72°C to minimize background.

2 5 4 aliquots of the PCR reaction were analyzed on 1% agarose gels containine

OSmg/ml of ethidium bromide. Ail primers were manufactured at the Sheldon

Biotechnology Center at McGill University. The following primers were used in this

work.

v-reI 5' start (2)

Transformation of Competent Bacteria

DHSa E. coli cells were rendered competent by rubidium chloride and competent

bacteria were stored at -70°C as glycerol stocks. A 5 0 ~ 1 aliquot of competent bactena

was incubated with 50-75ng of plasmid DN4 for 30 minutes on ice in 1.5 ml epindorph

tubes. Cells were heat-shocked at 42°C for 90 seconds and then immediately placed on

ice for 2 minutes. 500~1 of pre-warmed 1X LB broth was added to each tube and cells

were incubated for 1 hour at 3PC with shaking. Cells were pelleted at top speed (13

000g) in a microfige, resuspended in lx LE3 broth, and then plated onto 1X

LB/1 .S%bacto-agar plates supplemented with 1 OOpg/ml of ampicillin. Plates were

incubated in an inverted position overnight at 37°C.

5'- GGACTTTCTCACCAACCTCCG -3'

Plasmid Isolation by Mini-preparation

Individual bacterial colonies were selected from agar plates (see above) for

plasmid amplification and iso!ation. These colonies were used to seed 5rnl ovemight

cultures. Ovemight bacterial cultures were grown in 1X LB supplemented with

100pg/ml of ampicillin. Cells were pelleted in 1.5 ml tubes at top speed in a microfuge

and resuspended in 2 0 0 ~ 1 TEG buf5er (25mM Tris pH 8, lOmM EDTA, 50mM glucose)

supplemented with 4mg/ml lysozyme (Boehringer Mannheim, Germany) and incubated

for 5 minutes at room temperature. 400pl of alkaline solution (0.2N NaOH, 1% SDS)

was added to the bacterial suspension. Tubes were inverted several times to ensure

proper mixing and then kept on ice for 5 minutes. 300pl of 7.5M ammonium acetate was

added to each reaction to precipitate high molecular weight debris (protehs,

chrornasomal DNA, etc...). Following a 10 minute incubation on ice, tubes were

centnfuged at 13 OOOg for 10 minutes and supernatants were transferred to fiesh 1 Sm1

tubes. 0.6 volumes of isopropanol were added to the supernatants and plasmid DNA was

allowed to precipitate out of solution over a 10 minute interval at room temperature.

Plasmid DNA was isolated by centrifugation at top speed in a microfuge for 10 minutes

and supematants were discarded. DNA pellets were washed once with 70% ethanol and

ultirnately resuspended in TE pH 8 supplemented with 1 u g / d RNase A.

Maxi-Prep of Plasmid by Precipitation with Polyethylene Glycol (PEG)

i. High Copy Number Plasmids

250ml overnight cuitures of transformed DH5a E. coli were grown in lXLB with

100p,e/ml ampicillin (37°C with vigorous shaking). Bacterial cells were harvested by

centrifugation (SOOOg, 15 minutes at 4°C) and washed once in ice cold STE (0.1 M NaCl,

lOmM TrisNC1 pH 8, 1rnM EDTA pH 8). Cells were then resuspended in 9 mls of

solution I (SOmM glucose, 25mM tris/HCI pH 8, lOmM EDTA pH 8) and 1 ml of

lOmg/ml lysozyme (in Tris/HCI pH 8) was added. 20 mls of solution II (0.2N NaOH,

1 % SDS) were added and cells were lysed over a 10 minute interval at room temperature.

10 mls of ice cold solution III (3M Potassium acetate, 2M glacial acetic acid) were added

to precipitate high molecular weight materials. M e r a IO minute incubation on ice,

cellular debris was pelleted (5000g, 20 minutes, no break) and supematants was filtered

through four layers of cheesecloth into a clean centrifuge bottles. 0.6 volumes of

isopropanol were added to the filtered supematants and following a 10 minute incubation

at room temperature, nucleic acids were recovered by centrifugation (6000g, 10 minutes).

Pellets were washed once with 70% ethanol and when sufficiently dried, they were

resuspended in 3 mls of TE pH 8. 3 mls of ice cold Sm LiCl were added and the

resulting mixtures were spun in the Sorvall for 10 minutes at 20 OOOg (4°C).

Supematants were transfemed to fiesh lSml centrifuge tubes and equal volumes of

isopropanol were added to the supematants. The resulting mixtures were resentrifuged

(20 OOOg, 10 minutes, 4°C) and the supematants discarded. Pellets were washed once

with 70% ethanol, air-dried and resuspended in 5 0 0 ~ 1 TE supplemented with 20pghnl

RNase A. Afier a 30-minute incubation at room temperature mixtures were transferred to

1 Sm1 tubes. Plasmid DNA was precipitated fiom solution by addition of 5 0 0 ~ 1 of 1 -6M

NaCl containing 13% PEG 8000. Mer thorough mixing, plasmid DNA was recovered

by spinning at top speed in a microfûge. Pellets were dissolved in 4 0 0 ~ 1 TE pH 8.

Phenol. phenol-chloroform and chloroform extractions were canied out respectively on

the DNA solution; at each step of the extraction the aqueous upper phase was kept.

Ultimately plasmid DNA was precipitated by addition of 1 Op1 IOM ammonium acetate to

the aqueous phase, dong with 2 volumes of 100% ethanol. Tubes were incubated for 10

minutes at room temperature. DNA was retrieved by centrifugation at top speed in a

microfige. Pellets were washed once with 70% ethanol, air-dried and f d l y

resuspended in 5 0 0 ~ 1 of TE pH 8. Plasmid DNA was quantitated by the

spectro fluorimetry.

ii. Low Copy Number Plasmids (Clal 2 based piasmids)

In the event of a low copy number plasmid, chlorarnphenicol was added to

bacterial cultures to maximize plasrnid amplification. Isolated colonies fiom transfonned

bacteria were used inoculate 10 ml overnight cultures (lx LB with 100pgM ampicillin).

Cultures were incubated at 37°C with rotation. 100p1 of the overnight culture was used

to inoculate 25 mls of 1X LB media with 100pg/d ampicillin. 25 mls cultures were

incubated at 37°C with shaking until bacterial growth reached late log phase (OD,*0.6).

25 mis of late log culture was used to inoculate 500 rnls of LB media with 100pghni

ampicillin and cells were grown at 37°C. Once cells reached log phase of growth, OD,

20.4, chloramphenicol \vas added to a final concentration of 170pg/ml. Chlorarnphenicol

treated cultures were grown overnight at 37°C with shaking.

Plasmid DNA was isolated fiom overnight cultures as described above for hîgh

copy number plasmids with the following adjustments: 10 mls of Solution 1, 1 rnls of

lysozyme ( I Omg/ml), 20 rnls of Solution II, 15 mls of Solution III.

Restriction Analysis of Plasmid DNA

In general, 10 units of restriction enzyme were used with the recommended b a e r

per pg of plasmid DNA to be cut. Digests reactions were incubated for 1-5 hours and

heat inactivated at 65°C or 85"C, for IO or 20 minutes respectively, as recommended by

the manufacturer's directions. Digests were analyzed by electrophoresis on 1% agarose

gels supplemented with 0.5pghl ethidium bromide at -120V. The buffer used for

electrophoresis was TBE buffer pH 8 (0.89M Tris Base, 0.89M boric acid, 0-OSM EDTA

PH 8)-

Isolation of DNA Fragments fiom Agarose Gels

In order to isolate a DNA hgment, -10pg of plasmid DNA was digested with

the appropriate enzyme. DNA fragments were separated by gel electrophoresis, as

described above. Important DNA fragments were excised fiom the geI and then purified

using the QIAEX II Gel Extraction Kit (please refer to the manufacturer's manual:

QIAGEN Inc., ON).

Ligation Reactions

Ligation reactions were with a using a 1 :3 or 1:l ratio of vector to ligand for

sticky or blunt end ligations, respectively. Al1 ligations were perfonned in ligase buffer

(1 OrnM Tris-acetate, 1 0mM magnesium acetate, 50mM magnesium acetate supplemented

with 1mM A n ) . In general, 2-3 Weiss uni& of T4 DNA ligase were added to each

reaction (Pharmacia Biotech., Baie D'Urfe, QC). Sticky end ligation reactions were

carxied out for 16 hours at 15°C and heat inactivated for 20 minutes at 65°C prior to

transformation of competent bacteria. Blunt end reactions were incubated at 15°C for 16

hours and then at room temperature for 4 hours before heat inactivation at 65°C.

Sequences that were PCR amplified with PFU polymerase were cloned into

shuttle vectors via blunt end ligation. It was necessary to phosphorylate these DNA

fragments at the 5' end prior to ligation.

DNA Sequencing

Sequencing of DNA tempIates was carried out at the Sheldon Biotechnology

Center of McGill University. The automated DNA sequencing was performed using T7

DNA polymerase in conjunction with internai labeling with fluorescine-15-dATP.

Primers used for sequencing were VLSY(2) and JC(F).

Cbapter 3. Construction of TRElv-rel* Vectors

The mechanism for v-rel-mediated transformation is still unclear. On one hand,

the v-Re1 oncoprotein has been described as a dominant negative version of the cellular

homologue, c-Rel. On the other hand, a role of transcriptional activator has also been

ascribed to this oncoprotein. Nevertheless, is believed that expression of the v-Re1

oncoprotein, a member of the ReiNF-icB farnily of transcription factors, results in the

dysregulated transcription of genes normdly controlled by NF-&, and ultimately leads

to uninhi bited ce11 proli feration and tumor formation.

RevT, the replication incompetent retrovirus that codes for v-rel, has been

isolated in the context of both the RevA and the CSV helper viruses. These wo forms of

RevT differ not oniy in their helper virus, .but also in the actual oncogene itself: v-rel*,

coded by RevT(CSV), has a substitution at position 40 fiom alanine to serine (Romero

and Humphries, 1995). Initial characterization of the cells targeted for transformation by

v-rel* are predomiaantly IgW B cells of a mature phenotype (Barth and Humphries,

1988; Barth and Humphries, 1988). This suggests that the molecular requirements for v-

rel* mediated transformation are found in B cells only d e r maturation.

In order to comprehend fully the mechanism of v-rel*-mediated oncogenesis, as

well as the cellular requirements for transformation, it is first necessary to know which

ce11 lineages are susceptible to transformed by the oncogene. I t is stiil not clear whether

v-rel* mediated transformation is restricted to mature B cells due to the requirement for

cellular infection by RevT. Since RevT is dependent on the CSV helper virus for

successful infection of host cells. This implies that infection by RevT is most likely

Iimited to ce11 lineages that express receptors for the ENV protein of CSV. CurrentIy, the

RevT(CSV) receptor is undefmed.

In order to circumvent the need for infection of cells by RevT, we have designed

a systern to generate chickens that are somatically transgenic for a conditional forai of the

v-rel* oncogene. This system, which ailows for expression of the v-rel* oncogene in a

helper fiee marner, is based on the RCAS vecton developed by Steve Hughes (Hughes

et al., 1987). The RCAS vecton have been successfully used in our laboratory for

expression of transgenes, such as Bcl-2, in vitro and in vivo (Jacobsen et al., 1996).

Since we wanted to use this system to generate chickens that are somatically

transgenic for v-rel*, we were concemed that expression of the oncogene early in

embyogenesis might be fatal in developing chicks. For this reason, we chose to place the

oncogene under conditional expression, and the tetracycline repressible system developed

by Gossen and Bujard (1992) was uicoprated into the retroviral gene transfer cassettes,

together with the v-rel* oncogene. Our goal was to use this system to determine the ce11

lineages that are transformed by v-rel* in situ. Results of our experiments would provide

insight on the mechanism by which v-Rel* mediates transformation.

A. FEATURES OF THE RCAS V ~ c r o ~ s

i. The RCAS Vector

The Replication Comptent Mian Leukosis LTR with Splice Acceptor @CAS)

vectors were used for somatic transgenesis of developing chicks. These vectors were

developed by Steve Hughes (Fredenck, MD) for the purpose of retroviral-mediated gene

transfer into chicken cells both in vitro and in vivo. The prototype virus, the SR-A strain

of Rous Sarcoma Vinis (RSV), was modified in many ways to give the resulting RCAS

vector (Figure 4) (Hughes et al., 1987). The RCAS vectors have fully functional gag,

pol and env genes encoded by the parental RSV, however, the 5' and 3' LTRs found in

these vectors were derived fkom the avian leukosis vins ( U V ) . Encoded within the

proviral vector is a single splice donor (SD) that is found within the gag gene, and two

splice acceptors (SA) that flank the env gene.

The key to the RCAS vector is that it has been engineered to have a unique Cla

1 site downstream of the env gene, into khich any transgene (Tg) can be cloned.

Transcription of the viral gag, pol and env genes and the Tg inserted at the Cla 1 site is

initiated fiom the strong 5' LTR of the RCAS virus. Post-transcriptional processing of

the RCAS transcript occun fiom the splice donor to either one of the downstrearn splice

acceptors. Processing of the transcnpt in this fashion gives rise to a functiond message

encoding either the envelope protein (ENV) or the trasgene (Tg) depending on the splice

acceptor used.

The RCAS vectors encode productive viruses that are tropic to a wide array of

avian cells. Moreover, the RCAS virus is non-pathogenic to chicken cells. Therefore,

infection of chickens with the RCAS virus at early stages of ernbryonic development,

Ieads to the dissemination of infectious viral particles throughout the animal. Taken

together, the RCAS vector is ideal for generating somatically transgenic chickens: not

only does RCAS have the ability to infect multiple ce11 lineages in vivo, but also,

retroviral encoded genes, including the transgene, are expressed in the infected cells.

ii. The RCAN Vector: An Alternate Form of RCAS

Another form of the RCAS vector exists: the Replication sompetent Avian

Leukosis LTR with &O Splice Acceptor (RCAN) (Figure 4). Both RCAS and RCAN are

identical in al1 aspects, except that RCAN is missing the second splice acceptor, which is

just upstream of the Cla 1 cloning site. This means that transcripts driven fiom the 5'

LTR of RCAN c m be processed fiom the SD to the first SA to give a functional message

coding for the ENV protein. However, due to the absence of the second SA, the

transcnpt cannot be processed for the production of functional Tg message. ïherefore,

genes cloned into the Cla 1 site of the RCAN vector are not expressed at the protein

level. This property of RCAN makes it possible to clone a transgene dong with its own

promoter into the Cla 1 cloning site of the vector, such that expression of the transgene is

not controlled by the 5' LTR of the vecror, but rather by the promoter associated with the

transgene.

In addition to the viral genes and the cloning sites, both RCAS and RCAN

vectors carry an ampicillin resistance gene (Amp?, as well as an origin of replication

denved from Escherichia coli (On). These elements allow for proviral amplification in

bactena as a high copy number plasmid.

Figure 4. The RCAS Retroviral Gene Trnnsfer Cassette. The RCAS vectors are based on the SR-A strain of the Rous Sarcoma Virus. There is a unique Cla 1 cioning site located downstream of the viral encoded env gene. A spiice donor (SD) is found within the gag gene. The RCAN provinis only contains one splice acceptor (SA) while K A S has a second SA immediately upstrearn of the cloning site. These vectors possess a strong ALV 5' LTR and the Bryan "hi& titer" polymerase. The E. coli replicon (Ori) and the ampicillin resistance gene (Amp 7 allow for amplification of the provirus in bacteria. RCAS and RCAN vectors with different ENV regions allow for super-infection of ceils with multiple viral vectors.

RCAS

SD SA Cla 1

Figure 4. The RCAS Retrovinl Gene Transfer Cassette

iii. Multiple Sub-Groups of the RCAS Vecton

The env gene encodes the viral envelope protein, ENV, which is expressed at the

surface of viral particles. Expression of ce11 surface receptors specific to the ENV protein

determines whether a ce1 is susceptible to a particular viral infection. Furthemore, cells

cannot be infected with multiple virai particles bearing the same ENV protein.

Therefore, cells infected with a RCAS virus of one sub-family cannot by infected with

other RCAS viruses of the same family. Differences in the env regions do allow for

super-infection of cells by more that one type of virus. Two families of the RCAS

vector, having different ENV regions, exist. These are UCAS(A) and RCAS(B).

Similarly, the same sub-grouping of the RCAN vectors exists: RCAN(A) and RCAN(B).

Any combination of viruses fiom the two different sub-families (A + B) can be used to

doubly infect chicken cells. The existence of two sub-groups of RCAS and RCAN

vectors has been exploited in the work presented in this thesis.

B. USINC THE RCAS SYSTEM FOR SOMATIC TRANSGENESIS

The RCAS provirus is used to transfect naïve line O CEFs in vitro by calcium

phosphate precipitation (Figure 5). The plasrnid integrates into CEF DNA, and

ultimately results in the production of replication competent retroviral particles; the

transgene cloned into the RCAS vector is also included in the virus. Approximately three

days post-transfection, proviral DNA has integrated into the host genome and viral

proteins are expressed in the cytoplasm of the CEFs. The transgene originally cloned

into K A S is also produced by CEFs at this time. Both viral and Tg protein can be

detected by flow cytometry or by western blot. Our laboratory has successfully used the

RCAS system to express the BcI-2 protein in CEFs. Since the line O strain, fiom which

CEFs were derived, are free of exogenous and endogenous retroviral genomes (Astrin et

al., I979), RCAS transfected CEFs serve as a source of RCAS virai stocks, which are

collected as supernatants (Figure 5) .

Viral supernatants obtained fiom transfected CEFs can be used to idect naïve

CEFs. More importantly, injection of viral supernatants into the eggs of chick

Figure 5. Somatic Tnnsgenais by RCAS Ut vitro & in vivo. Naïve line O CEFs that are transfected with RCAS provirus express viral and Tg proteins. Supernatants fiom these CEFs serve as infectious viral stocks, and are injected in ovo for the generation of somatically transgenic chickens.

Transfect with Harvest viral SIN - or RCAS provirus Transgenic CEFs

Naïve CEF

Day 2 1

Inject 1 OOplof virus S/N

Transgenic B ird

Figure 5. Somatic Transgenesis by HCAS Vectors itz vitro & in vivo

embryos leads to the dissemination of infectious viral particles, encoding the transgene,

to many different tissues of the developing cbick, including al1 lymphoid organs

(f etropoulos and Hughes, 1991 ; Petropoulos et al., 1992). Therefore, by hatch the chick

is essentially transgenic for the transgene originally cloned into the RCAS vector (Figure

5). RCAS vectors of different sub-families can be used together to doubly infect either

CEFs or chick enbryos.

Expression of genes that are linked to minimal promoters under the control of

tetracycline operator sequences (TE) can be induced in the presence of a strong

transactivator. A tetracycline sensitive transactivator, tTA, was made as a fusion protein

between the transactivating domain of Herpes Sirnplex Virus VP 16 and the tet-repressor

that regulates the TnlO tet-resistance operon of E. coli (Gossen & Bujard, 1992).

Constitutive tTA expression in the absence of tetracycline alIows for binding of the

transactivator to the TRE, and this activates transcription of a downstream gene.

However, in the presence of tetracycline, the tTA is sequestered away from the TRE,

preventing expression at the level of transcription.

D. INTEC~UTINC THE TETRICYCLINE RESPONSIVE SYSTEM WITH THE RCAS VECTORS

In generai, transcription of genes cloned into the Cla 1 site of either RCAS or

RCAN is controlled by the 5' LTR. However, pst-transcriptional processing of the

transcript from the splice donor to the second splice acceptor is essentiai for translation of

the message. Processing of the transcript in this fashion oniy occurs for RCAS, since

RCAN lacks the second splice acceptor. Expression in RCAN can be manipulated by

introducing a novel promoter dong with the tmnsgene into the Cla 1 cloning site. This

has been successfùlly carried out with both the chicken p-actin and the mouse

metallothionein promoters linked to the CAT gene (Petropoulos and Hughes, 1991). The

Figure 6. Conditional Expression of -Traesgeoe Using the RCAS System. The tetracycline sensitive transactivator (tTA), which was cloned into the RCAS(A) vector, is constitutiveiy produced and induces expression of the transgene, cloned into RCAN(B), fiorn the tetracycline response element (TRE). In the presence of tetracycline tTA is sequestered away fiom the TRE, thereby inhibiting tramactivation.

chicken B-actin promoter was cloned with the CAT reporter gene into the Cla 1 site of

RCAN in both the sense and anti-sense orientations. Elevated levels of CAT were

detected in transfected cells, regardless of the orientation of the Tg in the RCAN vector.

This suggests that expression of CAT was independent of the 5' LTR of RCAS and

instead, was dependent on the chicken f3-actin promoter. Furthemore, when CEFs were

transfected with a RCAS construct that has the CAT reporter gene linked to the mouse

metallothionine promoter, ZnSO, was necessary for CAT expression. Therefore,

exogenous promoters have proven to be fùnctional when cloned into RCAS based

vectors.

ï h e tetracycline repressible system, described above, has two essential

components: the tetrac ycline sensitive transactivator, tTA, and the tetracycline response

element (TRE), which consists of tetracycline operator sequences linked to a minimal

promoter. Constitutive expression of the tTA is required for induction of genes linked to

the TRE. For this reason, tTA was cloned into an RCAS based vector (Figure 6). In the

RCAS virus, transcripts initiated fiom the 5' LTR are indeed processed to allow

expression of the transgene cloned into the Cla 1 site. Thus, the tTA, which is cloned

into RCAS, is constitutively expressed. On the other hand, conditiona1 expression of v-

rel* is dependent on the TRE. If tTA is cloned into a RCAS vectors of the A sub-group,

TRElv-rel* can be cloned into sub-group B members of the RCAS/N family. Therefore,

the two viral constmcts can be used together for double infection of cells both in virro

and in vivo (Figure 6).

Resui ts

A. CLONINC THE TETRACYCLINE SENSITIVE TRANSACTIVATOR INTO RCAS(A)

The tetracycline sensitive transactivator, tTA, which was used in the work

presented here, was initidly isolated fiom a Bluescnpt plasmid (Stratagen) containhg the

tTA (provided by Dr. Alan Cochran, Univer$ty of Toronto). Previously, the tTA was

cloned into an RCAS vector of the A subgroup (RCAS(A):tTA) (Martinez, O., 1 996). At

that t h e , the efficiency of the transactivator was detennined by CAT assay in CEFs: the

RCAS(A):tTA vector was CO-transfected with a vector that contained the CAT reporter

gene under the control of the TRE, pCMVtCAT (Figure 7). CEFs were incubated for 24

hrs in the presence or absence of tet (1 Opg/d). CAT expression was inhibited in doubly

transfected CEFs by the presence of tet.

B. CLONINC THE TETFUCYCLINE RESPONSIVE ELEMENT INTO RCAS(B) AND RCAN(B)

i. Cloaing the TRE iato RCAS(B) and RCAN(B)

RCAS based vectors were engineered to have a unique Cla 1 cloning site

domnstream of the gadpoUenv region. Traditionaiiy, Cla 12 has been used as an adapter

plasmid to facilitate cloning of the transgene into the RCAS based vectors because the

Cla 12 polylinker is flanked by Cla 1 sequences (Hughes et al., 1987). Therefore, after a

transgene is cloned into the polylinker region of Cla 12, it can be lifted out in its entirety

by a CIa 1 digest. In this fashion, the isolated transgene has Cla 1 compatible ends and

can then be sub-cloned into the Cla 1 .site of RCAS or RCAN. One difficulty

encountered in cloning the v-rel* transgene into the RCAS based vectors is that v-rel*

has an interna1 Cla 1 site at position 441. Therefore, it was not possible to isolate the

entire v-rel* sequence as a Cla 1 fiagrnent fiom the Cla 12 shuttle vector. For this

reason, cloning of v-rel* into RCAS and RCAN took place in several steps.

Previously, the tetracycline repressible element (TRE) was cloned into the

polylinker of the Cla 12 shuttle vector at an Eco R1 site to give Cla 12:T (Figure 8)

(Martinez, O., 1996). The TRE was isolated from the pUC-13-3 plasmid (provided by

Dr. Alan Cochran; Gossen and Bujard, 1992) via an Eco R1 digest. Orientation of the

insert was confirmed by a combination of restriction mapping and sequencing.

Moreover, Cla 12:T was further modified by the insertion of a strong B-globin

polyadenylation signal (PA), to enhance post-transcriptional processing. The PA was

obtained from pGEM 32 f(-) (provided by Dr. Nicholas Acheson, McGill University;

(Lanoix and Acheson, 1988)) as a Sa1 1 fragment and then cloned into the Sd 1 site of

the Cla 12 polylinker, downstream of the TRE, to give Cla 12:TP (Figure 9). Orientation

of the PA was confimed by sequencing.

Both Cla 12:T and Cla 12:TP were M e r rnodified as described below. A Sac

l/Spe 1 fiagrnent \vas removed from both vectors, and was replaced by a double stranded

oligonucleotide sequence, [WE + WE'] (synthesized at Sheldon Biotechnology, McGill

University) (Figure 8 & 9). Not land Eco RV sequences, as well as a Kozak sequence

(K), for enhanced translational eficiency (discussed below) (Iida and Masuda, 1996), are

al1 embedded within this 17mer oligonucIeotide. The resulting shuttle vectors, Cla

12:TK and Cla I2:TKP, both possess these three novel elements (Not 1, Eco RV and K)

downstream of the TRE. Insertion of the oligonucleotide was confirmed by restriction

mapping (Figure 10)-

TREK and TREMPA sequences were isolated fiom the Cla 12 shuttle vectors

by Cla 1 digests. These Cla 1 fragments were then sub-cloned into the unique Cla 1 site

of either RCAS(B) or RCAN(B) vectors in either the sense or anti-sense orientation. The

resulting vectors (Figure 1 1) were:

O pSBT: RCAS(B) with the T R E k sequences

pNBT: RCAN(B) with the TRE/Kz sequence

pSBP: RCAS(B) with the TRE/Kz/fA sequence

O pNBP: RCAN(B) with the TRElWPA sequence

O pNBi: RCAN(B) with the TREKzlPA sequence inserted in the inverse

orientation to viral encoded genes

ii. Cloning the v-rel* Transgene into the Modified RCAS(B) and RCAN(B) vectors

The first step was to modify the pMJ1 .O vector (Figure 12). The pMJ 1 .O plasmid

is based on the pCRIITM vector (Invitrogen, CA). First, a 8bp fiqgnent was removed

from pMJ1 .O by a Spe 1ISac 1 double digest. The same double stranded oligonucleotide

described above, (K/E + WE'), was cloned into the Iinearized pMJ1.0 since the Sac 1 and

Spe 1 ends of the double stranded oligonucleotide were compatible with the Sac 1 and

Spe 1 ends. The modified pblJ1 .O was then digested with Eco RV to remove a 40bp

fragment. The Iinearized vector was gel purified and then self-ligated. The final product,

pRAO1, was a circularized plasmid having a unique Eco RV site flanked by Not 1

sequences.

Figure 7. The RCAS:tTA Construct. a) The tTA was isolated from Clal2:tTA as a Cla 1 fragment and cloned into the unique Cla 1 cloning site of RCAS(A) (Martineg O., 1996). b) RCAS:tTA can induce CAT expression fiom a reporter plasmid, pCMVtCAT. CEFs were doubly transfected with RCAS(A):tTA and pCMVtCAT. The reporter plasmid has the CAT gene under the control o f the TRE. Transfectsd CEFs were incubated in the presence or absence of tet (10pg/ml) for 24 hours. CAT assays were carried out on these cells to detennine the amount of CAT enzyme being expressed. (Martinez. 0.. 1 996)

Clal 2:tTA poly linker Sa1 1

5' 3'

Sa1 1 -.-l

SD SA SA a- m 6557

2322 CL

r, tTA 500

CAT EnzymenSmm culture (pg)

Figure 7. a) The RCAS:tTA Construct. b) RCAS:tTA can induce CAT expression from a reporter plasmid, pCMVtCAT. (Work done by Omalso Marti nez)

Figure 8. Modifying the Clal2:T Shuttle Vector by addition of a Kozak Sequence. The tetracycline repressible element (TRE) was cloned into Cla12 as an EcoRl fiagrnent to give Clal2:T. Restriction mapping was carried out to cofirm orientation of the insert (Martinez, O., 1996). Clal2:T was then modified by cloning an oligonucleotide, which coded for both a Kozak sequence and a Notl site, into the polylinker. The two strands of the oligonucleotide, KzEcoRV & (KzEcoRV)', were designed to give 5' and 3' overhangs that were complementary to Sac 1 and Spe 1 sites, respectively (synthesized at S heidon Biotech., Montreal, QC). The resulting vector, Clal 2:TK, was analyzed by restriction mapping.

Cla 12

GCGGCCGCCACGATATC TCGACGCCGGCGGTGCTATAGGATC

6557

2322 4- TRE

500

Cla 1

T

Kozak Sequence

Figure 8. Medifying Clul2T by Addition of a Kuzak Sequencr

Figure 9. ModiTying CIal2:TP Shuttle vector by Addition of a Kozak Sequence. Clal 2:T (see Figure 8) was fust modified by cloning a strong poly-adenylation (PA) signal into the Sa11 site of the polylinker to give Clal2:TP. Orientation of the PA was confirmed by sequencing; the hatched bar shows the region that was fülly sequenced (Martinez, O., 1996). Clal 2:TP was then modified by cloning an oligonucleotide, which coded for a Kozak sequence and a Notl site, into the polylinker (see Figure 9 for the design & synthesis of the double stranded oligonucleotide sequence). The resulting vector, Cla l2:TKP, was analyzed by restriction mapping.

- .

Cla 12

GCGGCCGCCACGATATC TCGACGCCGGCGGTGCTATAGGATC t Kozak Sequence

Figure 9. Modifying ClalZTP by Addition of a Kozak Sequence

Figure 10. The Clal2:TK and CIal2:TKP Shuttle Vecton. This figure represents a schematic o f the modified CIa12 vectors. Clal2:TK (a) has the TRE upstrearn of the Kozak, while Clal2:TKP (b) includes a strong PA sequence as well. A unique Notl site is found in the poly-linker of both constructs. These sequences can be lifted out of the shuttle vector in their entirety as a ClaI hgment.

a) Cla 12:TK Not 1 Sa1 1

a) Cla 12:TKP Not 1 Sa1 1

5' 3'

Figure 10. Clal2:TK & Clal2:TPK Sbuttle Vecton

Figure 11. Cloning T K & TKP into RCAS(B) and RCAN(l3). The TREK was lifted out of the Clal 2 shuttle vectors as a Clal fragment. This fragment was then cloned into the unique Clal cloning site of RCAS(B) and RCANP), to give pSBT and pNBT respectively (a and b). The insert was ctoned into the vectors in the same orientation as viral genes, and the orientation was confirmed by restriction digest analysis (c). The same operation was camed out to isolate the TREKPA Fagment fiom CIal2:TKP. This fragment was then cloned into RCAS(B) or RCAN(B) to give pSBP and pNBP (d and e, respectively) and orientation was c o n f i e d by restriction mapping (0. Finally, the T R E W A was cloned into RCAN(B) in the anti-sense orientation, pNBi (g).

1 Not I

Cla 1

Figu n 1 1 cont. pNBi: RCAN(B):TRE:/K/PA.. .Inverse Orientation

Figure 12. The pRAOl Adapter Plasmid. a) First, an oligonucleotide encoding Notl and EcoRV sites was cloned into the Sac 1/Spe 1 sites of pMJ1 .O, which was based on the pCMI vector (Invitrogen, CA) (see Figure 9 for design and synthesis of the double stranded oligonucleotide), b) A 20 bp EcoRV fragment was then rernoved to give the pRAOl adapter plasmid. This plasmid has a unique EcoRV site flanked by Notl sequences. Insertion of the oligonucleotide was confirmed by restriction mapping.

pMJ1.0 polyf inker

Sac1 Spel EcoRV k t 1

GCGGCCGCCACGATATC EcoRV

\ \ \ \ \ \ \ \ \ \ \

Not 1 EcoRV Not 1

Figure 12. The pRAOl Adaptor Plasmid

Figure 13. The pRA02 plasmid ... Cloning w e i * into pRAO1. a) DNA nom the S2A3 ce11 line was used as a template for PCR amplification of v-rel*. The 5' and 3' primers used in the PCR reaction were v-rel 5' start and Rel 3' STOP, respectively (see Materials & Methods). The PCR product was 5' phosphorylated pnor to clonhg into the EcoRV site of pRAOI. The EcoRV site was destroyed in the process. A combination of restriction mapping (b) and sequencing were canïed out to confïrm the orientation of the insert. Hatched bars at the 5' and 3' ends of v-rel* indicate the regions that were fully sequenced.

Not 1 Not 1

21 16 + v-rel*

642 348

Figure 13. The pRA02 plasmid ...Cloning of w e i * into pRAOl

0

Figure 14. Cloning v-rei* into the modified RCAS(B) and RCAN(I3) vectors. The v-rel* transgene was isolated fiom pRA02 as a Notl fragment and cloned into the unique Notl cloning sites of pSBT, pNBT, pSBT, pSBP and pNBi to give pRA03-7, respectively (a-e). Restriction mapping was carried out to confirm orientation of the transgene in the vectors.

Cla 1

Figure 14 cont Cloning v-rel* into the RCAS Bascd Vectors

S2A3 DNA was used as the template for PCR amplification of the v-rel*

oncogene. S2A3 is a myeloid line that has been tranfected with RevT(CSV) provinis.

The v-rel* oncogene was arnplified using PFU polymerase as described previousiy (see

Materials and Methods). The primers used to ampli& the transgene were: v-rel 5' start

and Re1 3' STOP. The 5' primer was designed so that the first nucleotide, G, coded for

the G of the translational start codon of v-rel*: ATG. The 3' primer was designed to

complement sequences downstream of the v-rel* stop codon. PFU polymerase was used

to ampli@ the oncogene for two reasons: 1) PFU polymerase has 3' + 5' exonuclease

activity (Le., proofieading activity), and 2) it does not leave 3' overhaugs (Le., the PCR

products are blunt ended).

The PCR product was purified by gel electophoresis and 5' phosphorylated prior

to ligation. Meanwhile, the pRAO1 plasmid was linearized with Eco RV, a blunt cutter,

dephosphorylated and gel purified. The PCR product, v-rel*, was then cloned into the

Eco RV site of PRAO 1. In the resulting plasmid. pRA02, the v-rel* transgene is a)

flanked by Not 1 sequences, b) preceded by the Kozak sequence and c) has a

reconstituted translation initation codon (ATG) (Figure 13)

The Wv-rei* sequence was lified out of the pRA02 vector in its entirely by a Not

1 digest and then subcloned into the Not 1 cloning sites of the modified RCAS(B) and

RCAN(B) vectors (pSBT, pNBT, pSBP, pNBP and pNBi) to give pRAO3-7 respectively.

Orientation of Wv-rel* in pRA03-7 was confirmed by restriction mapping (Figure 14).

Discussion

Conditional expression of a gene is a powerfùl tcol for studying the functional

and mechanistic roles of the gene product. In order to study in situ transformation by v-

rel*, we chose to clone the oncogene into the K A S vector. However, one complication

of studying the effects of aberrant v-rel* expression in vivo, is that high levels of v-Rel*

expression in chick embryos could compromise normal developmen~ in particular the

developrnent of lymphoid organs. The rational behind ttiis thinking carne from the

evidence that the v-rel* oncogene appears to target lymphoid cells (Barth and

Humphries, 1988) (see Introduction). Therefore, by developing a system to conditionally

express v-Rel* in vivo, chick embryos could develop normally under conditions non-

permissive for v-rel* expression. Once birds are fülly developed (post-hatch), the

oncogene could be induced and the consequences observed.

There are several conditional v-Rel* systems that have k e n developed. In

particular, the v-RelER mutant and the naturally occurring temperature sensitive mutants

of v-Rel, ts v-Re1 (Boehrnelt et al., 1992; White and Gilmore, 1993). The first construct,

v-RelER, has v-Re1 linked to the activation domain of the estrogen receptor. Replation

of v-RelER is at the pst-translational level, with v-RelER activation occurring only in

the presence of estrogen. The second mutant, ts v-Rel, is also regulated post-

translationally, and the permissive temperature is 37°C. Although the ts mutants of v-Re1

are unsuitable for in vivo studies for obvious reasons. the v-RelER mutant is equally

unsuited for studying v-rel* mediated transformation in vivo, since the elevated levels of

estrogen required to activate v-RelER could have unwanted physiological side effects in

chickens. Therefore, we took advantage of the tetracycline-repressible system, whereby

expression of the transgene is regulated by tetracycline (tet), which has no biological

activity with respect to avian gene expression.

A. RCAS(A):tTA Induces CAT Expression from a Reporter Plasmid

Figure 7a is a pictorial representation of the RCAS(A):tTA constnict (Martinez,

O., 1996). Functionality of the tTA constmct was tested by transient transfection assays

in CEFs using the CAT enzyme as the reporter gene. The reporter plasmid used in these

assays, pCMVtCAT (Dr. A. Cochran, University of Toronto), contained the CAT gene

linked to the TRE. CAT expression, which was observed in CEFs doubly transfected

with RCAS(A):tTA + pCMVtCAT, was significantiy attenuated by the presence of

tetracycline (lOpg/mi) (Figure 7b), showing not only that the RCAS(A):tTA vector is

functional, but aiso that the tetracycline responsive system is functional in avian cells.

Recently, Zong et al. (1997) cloned the tet-repressible system into a spleen

necrosis virus (SNV) based vector to conditionally express v-rel in avian spleen cells in

vitro. Successfid control over v-rel expression revealed that in the absence o f tet, the

condition permissive for v-rel expression, avian splenic lymphocytes were rescued fiom

an apoptotic death.

Initial tests with the RCAS(A):tTA t RCAN(B):TRE/Tg were carried out using

CAT as the reporter transgene. Unfortunately, CAT enzyme was not detected when these

two vectors were used for transient transfection assays in CEFs (data not shown). One

possible reason to explain the lack CAT expression in CEFs transfectant for tTA, is that

expression could be hindered at the level of translation. For this reason, we chose to

supplement the TRE/v-rel* constnicts by addition of a Kozak sequence, which

maximizes translational efficiency. The consensus Kozak sequence is a 13mer

oligonucleotide, 5' -GCCGCC(A/G)CCATGG- 3', where the underlined ATG is the

invariant translation initiation codon (Iida and Masuda 1996). Analysis of different

nucleotide combinations by Iida and Masuda (1996) provided a way to quantitate

eficiencies of potential Kozak sequences. The Kozak sequence that was incorporated

into the v-rel+ constmcts (5'- GCCGCCACGATGG -3 ', Figures 8 & 9) was designed for

maximum translation eficiency.

Finally, the TRE/v-Rel* constnicts were introduced into RCAS(B) and RCAN(B)

either in the sense or anti sense orientation (Figures 11). Although expression of v-rel*

from the minimal promoter should be govemed by the TRE, we believed that by cloning

the transgene into the RCAN vector in the opposite direction to viral encoded genes

(pRA07) we could M e r minimize expression fiom transcripts driven by the S'LTR.

In order to test whether the vectors, pRA03-7 (Figure 14), were fimctional,

transient transfection assays were carried out with CEFs in vitro.

Chapter 4. I n vitro assays of the TRE/v-reI* Coastnicts.

Introduction

The constructs that were described in the previous chapter were designed for

somatic transgenesis of the v-rel* oncogene both in vitro an in vivo. The two elements to

the conditional v-rel* expression system are the RCAS(A):tTA vector, which allows for

the constitutive expression for the tetracycline sensitive transactivator (tTA), and the v-

rel* oncogene, which was placed under the control of the tetracycline responsive element

(TRE), was cloned into members of the RCAS vector farnily fiom the B sub-group.

Super-infection of CEFs with both constructs would allow for conditional expression of

the v-rel* oncogene (Figure 6).

Results

A. v-Rel* Expression in CEFs Requires tTA

CEFs either transfected or infected with RCAS provims or virai supernatant,

respectively, were monitored for viral protein expression by flow cytometry (Figure 15).

CEFs transfected with TRElv-rel* constmcts aione, pRA03-7, did not show any v-Rel*

expression, as deterxnined by Western blot (Figure 16, lanes 1, 3, 5,7 and 9 respectively).

Protein lysates were obtained fiom CEFs three days afier transfection, a suficient time

for viral and Tg protein expression in these cells. These transfectant CEFs (pRA03-7)

were then super-infected with RCAS(A):tTA virus and then cultured in the absence of

tetracycline for an additionai five days, dlowing for dissemination of virus through-out

the cultures, for expression of tTA and for induction of v-rel*. Western blot analysis

shows that CEFs previously transfected with.pRA07 (KAN@) with TREWv-rel*lPA

in the inverse orientation) expressed v-Rel* in the presence of the tTA (Figure 16, lane

10). Oncoprotein expression was not observed in other doubly transfected CEFs (lanes 2,

Figure 15. Trnnsfected and Infected CEFs Express High Levels of Viral Protein. CEFs were transfected with lOpg of provirai DNA (see Materials & Methods). Three days afisr transfection, CEFs were stained with anti-viral protein antibodies (HY23 used as diluted hybridoma supernatant, 1 5 v/v) and analyzed by flow cytornetry (b). These cells are positive for virai protein as cornpared to non-transfected, naïve CEFs (a). CEFs infected with virai supernatant gave similar resuits (c). Staining profiles fiom 10 000 cells are shown. Also used for analysis of viral protein expression was the W 2 1 monoclonai antibody (used as diluted hybridoma supernatant, 1 :5 v/v) and similar results were obtained (data not shown).

A. Naive CEFs B. 'rransfected with RCAS(A): tTA provirus

C . Infected with RCAS(A): tTA viral

supernatant

Viral Protein Expression (HY23)

Figure 15. Transfected & Infected CEFs Express High Levels of Viral Protein

Figure 16. The tTA is Required for Expression of v-Rel* in vitro. CEFs transfected with one of the v-rel* constnicts W-3-7) dici not show oncoprotein expression @59v-'e[3 in the absence of tTA (lanes 1, 3. 5, 7 and 9). However, when super-infected with the RCAS(A):tTA virus. CEFs transfectant for p W 7 showed a significant increase in v-Rel* (lane 10). Oncoprotein expression was not observed by the other doubly transfectant CEFs (lanes 2,4,6 and 8). Al1 CEFs expressed the endogenous c-Rel. HY87 hybridoma supematant was used to probe for Re1 protein expression (used as diluted hybridoma supematant, I :5 vh).

Figure 16. The tTA i s Required for Expression of v-Rel*

4,6 and 8). On the other hand, endogenous c-Re1 expression was constitutively observed

in all CEF cultures.

B. Conditional Expression of v-Rel* with Tetracycliae

The transient transfection assays described above suggested that pRA07

(RCAN(B) construct with the TRE/K/v-rel*/PA fragment in the inverse orientation to

viral genes), could be used for conditional expression of the v-rel*. Subsequent assays

with pRA07 + RCAS(A):tTA transfectant CEFs show that v-Rel* expression could be

inhibited by the continued presence of tetracycline (2pg/ml) (Figure 17, lanes 1-3). CEFs

were infected with a mixture of RCAS(A):tTA and pRA07 viral supernatants (l:Iv/v),

and culhired in IMDMIl%CS + tetracycline (2pg/ml). 5 days afier the removal of

tetracycline, expression of the v-Rel* oncoprotein was observed and conùnued to be

expressed for an additionai 3 days (Figure 17, lanes 4 and 5). Tetracycline was refieshed

every second day.

B. Limiting Dilution Assay of Bursal and Spleen Cells

Ex vivo transformation of avian lymphocytes by RevT(CSV) virus is carried out

in 2 0 0 ~ 1 bulk culture containing 75% S2A3 supernatant (Benatar et al., 199 1). Phorbol

rnyristic acetate (PMA) (20 n g d ) is also added to the cultures to increase the frequency

of transformation. Although the molecular basis for this increase is unclear, it is possible

that PMA alters the state of activation of intracellular molecules required for v-Rel*

mediated transformation.

The fiequency of transformation by the conditionai v-Rel* construct (pRAO7),

under permissive conditions (- tet), was established by limiting dilution analysis in 10p1

Terrasaki cultures as described by Marmqr et al. (1993), and compared with the

transforming eficiency of RevT(CSV), which was also determined by iimiting dilution.

Titrated numbers of either bursal or splenic lymphocytes were combined with 75% S2A3

or pRA07 viral supernatant, in the presence or absence of PMA. Transformation in the

Figure 17. Conditional Expression of v-Rel* in vitro. RCAS(A):tTA + pRA07 transfectant CEFs did not express v-Re1 in the continued presence of tetracycline (2pg/ml) (lanes 1,2 and 3). However, removal of tetracycline resulted in v-Rel* espression within 5 days (lane 4), and the oncoprotein continued to be expressed thereafter (lane 5). Expression of c-Re1 was consistent regardless of the presence or absence of tetracycline. The Hy87 monoclonal antibody was used to probe for Re1 expression (see Figure 16).

- Tet

DAY

Figure 17. Conditional Expression of v-Rcl* in virro

Figure 18. Screening for tTA Transgenic birds by Flow Cytomehy. Lymphocytes were harvested fiom blood of normal and transgenic birds and screened for expression of virai proteins with the HY23 monoclonal antibody (see Figure 1 S), and analyzed by flow cytornetry. Lymphocytes fiom tTA transgenic birds expressed hi& levels of Wal protein (b) while normal birds did not (a). Staining profiles fiom 10 000 cells are shown. The same analysis was carried out on bursal and splenic lymphocytes tkom normal and transgenic birds (data not shown).

Normal tTA Transgenic

Figure 18. Scretning for tTA transgenic Birds by Flow Cytometry

Figure 19. Bursal C e l are Transformed by RevT(CSV) and not by pRA07. Limiting dilution assays were carried out for bursal cells fiom normal (a) and tTA transgenic (b) birds as described previously (Marmor et al., 1993). Titrated nurnbers of bursal cells were grown in 10pl Terrasaki cultures (74/point) containing 75% virai supernatant (either RevT(CSV) or pRA07), in the presence or absence of PMA (20nghl). lOpl cultures were scored as positive when ce11 growth completely covered the bottom of the well. Bursal ceHs are clearly transformed by RevT(CSV) regardiess of tTA expression. The conditional form of v-rel*, encoded by pRA07, was unable to transform bursal cells fiom either normal or tTA transgenic birds.

Input Ce11 Number

A 200 400 600 800 1000

RevT(CSV) + PMA RevT(CSV) -PMA

a vRA07+PMA

Input Cell Number

n 200 400 600 800 1000

C. Transformation of Bursal Lymphocytes by Revï(CSV) & pRAO7

Figure 19. Bursal Cells are Transformed by RevT(CSV) and not by pRAO7

Figure 20. SplenK Lymphocytes are.trpnsformed by RevT(CSV) and pRA07. Limiting dilution andysis (see Figure 19) was carried out on normal (a) and tTA transgenic (b) birds. RevT(CSV) was able to transfomi splenic lymphocytes regardless of tTA expression. The pRA07 virus, in which v-rel* was placed under conditional expression, was unable to transfomi normal splenic lymphocytes. However, splenic Iymphocytes fiom tTA transgenic birds were transformed with a poor efficiency in ex vivo cultures.

Frequency Non-transforming hm

Frequency Non-traasforming log(f)

1 0 ~ 1 cuitures was considered positive when ce11 growth completely covered the bottom

of the well. Lymphocytes used in the limiting dilution assays were taken fiom either

normal control or tTA transgenic birds (see Figure 5 for generation of somatically

transgenic chickens). Analysis by flow cytornetry confirmed high levels of viral protein

expression by tTA transgenic lymphocytes (Figure 18).

The fiequency of non-transfomed cultures was plotted against the number of

input celis per well on a semi-log scale, and regressional analysis of the limiting dilutions

assays were used to determine the efficiency of transformation of the viruses

(RevT(CSV) or PRAO?. Figure 19 and 20 indicate that the conditional v-Rel*

expression system (pRAO7 + RCAS(A):tTA) only transforms splenic lymphocytes in ex

vivo cultures, and that pRA07 transfonns these much less efficiently than RevT(CSV).

Discussion

A. v-Rel* Expression in CEFs Requires tTA and is Inhibited by Tet

The RCAS provirus in teptes into cellular DNA following successfid

transfection of CEFs (discussed previously). Subsequently, transcription of viral genes is

induced from the 5' LTR allowing for an efficient way to screen cultures for successfid

transfectants. Previous work by Ozvaldo Martinez (1 996) demonstrated that the

RCSA(A):tTA construct was functional in CEFs. As seen in Figure 16 it is clear that the

v-Rel* is not expressed in single transfectant cells (pRA03-7) as predicted since

oncogene expression is govemed by the TRE. Initially, we thought that minor levels of

v-Rel* expression would be observed in the RCAS based vectors (pRAO3 and 5), since

transcripts are processed fiom the SD to the second SA, which is found just upstream of

the Cla 1 cloning site. However, leaky expression of the oncoprotein was not observed.

The message derived by pst-transcriptional processing possesses a long TRE encoding

sequence (-450Bp) preceding the translation 'initiation codon for v-rel*. Therefore, it is

possible that proper assembly of the translation initiation machinery is hindered, thereby

preventing expression of v-rel*. On the other hand, le* expression from the K A N

based vectors was not expected, siafe pst-transcriptional processing of the transcript

does not occur, and the outcome was as predicted (Figure 5, lanes 7 & 9).

Super infection of the CEFs with RCAS(A):tTA virus reveaied expression of v-

Rel* in pRA07 transfectants (Figure 16, lane 1 O), but not in the other transfectant cells

(pRA03-6). It is unclear why expression is not observed fiom the other super-iafected

transfectants (pRA03-6). The possibility that mutations could have occurred during the

cloning process, resulting in non-fùnctional constructs is one explanation for the lack of

v-Re1 * expression by the transfectant cells.

Previous work in our laboratory suggests that the strong polyadenylation (PA)

signal is essential for post-transcriptional processing of the message. PCR amplification

of the v-rel transgene fiom S2A3 DNA, did not include an endogenous PA signal, and

two of the TRElv-rel* constmcts, pRA03 and 4, did not include this element. In

addition to post-transcriptional processing, recent studies clearly demonstrated that the

PA signal enhances translation initiation in.eukaryotic cells by recruiting the subunits of

the translational rnachinery (Preiss and Hentze, 1998). Therefore, in the transient

transfection assays with the p u 0 3 and pRA04 vectors, transcription rnight have been

induced fiom the TRE by the transactivator (tTA), but translation of these messages was

inefficient due to the absence of the PA signal. It would be necessary to look at the level

of rnRNA, eitfier by RT-PCR or by Northern blot, to see if v-rel* message is indeed

present in these cells.

The pRA07 transfectants, on the other hand, did show v-Rel* expression when

super-infected with tTA containhg virus. Orientation of the v-rel* transgene in pRA07

opposes the orientation of viral encoded genes (Figure 14). Therefore, transcription of v-

rel* from the TRE is completely independent of the 5' LTR of the parental vector,

RCAN. In addition, this construct, pRA07, contains the strong PA s ipa l that allows for

proper post-transcriptional processing.

Conditionai expression of v-rel by transfectant CEFs (RCAS(A): tTA + pRA07)

was tested by culturing cells in the presence or absence of tetracycline (2pgh.I in

IMDM/l%CS). These assays show that the expression of v-Rel* is inhibited by the

presence of tet. Initially, CEFs were cultured in the presence of tet, which is non-

permissive for v-rel* expression. From these cultures, cells were taken and cultured in

IMDM/l%CS (- tet) while another group was maintained on tet for another 5 days.

Figure 17 clearly demonstrates that the continued presence of tet (2pg/ml) was enough to

inhibit v-Rel* expression at the protein level.

The concentration of tet used in the tetracycline repressible system varies for

different ce11 types, ranging fiom 0.5-10pg/ml (Xu et al., 1998; Bettany and Wolowacz,

1998). Incidentally, the concentration of tetracycline required to inhibit v-rel* expression

in RCAS(A):tTA + pRA07 transfectant CEFs (Figure 17) was 2pg/mL However,

initial charactenzation of the RCAS(A):tTA constnict reveled that higher levels of

tetracycline (1 Opg/ml) was required to inhibit CAT expression fiom reporter plasmids in

CEFs (Figure 7b). This is the same concentration (10pghî) required to inhibit tTA in

transfected U937 cells (Martinez, O., 1996). The concentration of tet required to inhibit

tTA in CEFs was not previously titrated, and it was never determhed whether tet

c O ncentratio ns < l O&ml were adequate for tT A inhibition. Furthemore, the reporter

plasmid that was used to test the efficiency of tTA in CEFs, pCMVtCAT, is based on the

cytomegalovirus (CMV). It is possible that higher ievels of tet are required to inbibit

transcription from pCMVtCAT than fiom the RCAN based vector (pRA07) for reasons

that are unclear.

B. pRA07 Transforms Cells In Vitro with a Poor Efficiency

Transformation of lymphocytes ex vivo by RevT(CSV) is a usefd way to extend

B ce11 life in culture and to study B cell development in vivo since RevT mediated

transformation appears to fieeze cells in time (Barth and Humphries, 1988; Bose, 1992).

Our laboatory routinely uses this tool to midy B ce11 development. Cells are cultured in

IMDLW~%CS containing 75% RevT(CSV) viral supernatant and PMA (20nglml)

(Benatar et ai., 1991). The molecular mechanism for PMA-enhanced transformation

efficiency is still unclear, but it is possible that activation by PMA is in involved in

rendering lymphocytes more susceptible to v-rel*-mediated transformation.

Previous work done in our lab by Marmor et al. (1993) used Iimiting dilution

assays to quantitate the eficiency of RevT(CSV) transformation of Con A-activated

splenic T cells. In this assay, the viral titer is not limiting and the fiequency of growth is

directly proportional to input ce11 numbers. By linear regression analysis of the limiting

dilution assay, the fiequency (B of cells transformed by RevT(CSV) can be caiculated.

In this fashion, it was determined that -1 in 420 activated splenic T cells was

transformed by the RevT(CSV) virus (f= 1/420).

Similarly, limiting dilution assays were used to determine the transformation

efficiencies of RevT(CSV) and pRA07. Figures 19 & 20 show the linear regression

analysis of the limiting dilution assays for bursal and splenic lymphocytes, respectively.

These assays were carried out using normal lymphocytes as well as those derived fiom

tTA transgenic birds (see above). It is clear that pRA07 is unable to transform normal

bursal cells (Figure 19a), which do not express the transactivator (tTA), either in the

presence or the absence of PMA. On the other hand, RevT(CSV) transformation of

bursal cells showed that -1 in 1198 bursal ce11 is transformed in the presence PM&

while -71 76 bursal cells are required for a single transformation event in the absence of

PMA. Therefore, PMA clearly enhances the transformation eficiency of RevT(CSV).

Transformation of tTA transgenic bursal cells ex vivo by RevT(CSV) is similar to

that of normal bursal cells (Figure 19b): 1 in 1298, and 1 in 6142 bursal cells are

transformed in the presence or absence of PMA, respectively. Interestingly, pRAO7

virus did not transform tTA transgenic bursaI cells at d l . One possible reason for this is

that bursal cells are not the primary targets of v-Rel* transformation. This is consistent

with findings that suggest the mature phenotype of B cells transformed by RevT(CSV)

in vivo @eg et al., 1992).

The same limiting dilution assays were carried out with splenic lymphocytes fiom

normal control and tTA transgenic birds (Figure 20). As seen previously, pRA07 virus

does not rtansform lymphocytes obtained fkom normal spleen, which lack the tTA.

RevT(CSV) was found to transform splenic lymphocytes with a fiequency of -1 in 3205

in the presence of PM& and less efficiently, -1 in 4939 splenic cells, in the absence of

PMA. This fiequency is less than that of bursal cells, possibly due to the high

proportion of non-activated T cells nonnally found in the spleen. Splenic T cells must

be activated, by Con-A for example, for successful transformation by RevT(CSV)

(Marmor et al ., 1 993).

The virus bat codes for conditional v-rel*, pRA07, is able to transform tTA

transgenic splenic lymphocytes, aibeit with a very low efficiency. Regressional analysis

of the limiting dilution assay demonstrated that - 1 in 36 970 splenic lymphocytes that

express the tTA were trmsformed by pRA07 in the presence of PMA and under

conditions permissive for v-rel* expression (- tet), and if PMA is not present pRA07

transforms -1 in 75 020 splenic lymphocytes (Figure 20b). Once again, the presence of

T cells in the splenic lymphocyte cultures could explain why the efficiency of

transformation is very low, supporting the notion that v-rel* preferentially targets B ce11

transformation.

Chapter 5. In vivo Expression of ~ R e f *

Introduction

Different stages of avian B ce11 development are identified by rearrangement of

the Ig locus, by the presence of ce11 surface markers, and by expression of the Ig receptor

(dg) . The earliest stage of cornmitment to the B ce11 lineage entails the D to JH

rearrangement of the immunoglobulul heavy chah locus. Through PCR analysis,

Reynolds et al. (1992) were able to detect DJ rearrangements in the yoke sac of day 516

embryos. Subsequent rearrangement of the Ig locus occurs in a stochastic fashion, to

complete either heavy chain or the light chah remangement, resulting in VDJN-J or V-

DJNJ phenotypes, respectively (Benatar et ai., 1992).

The pre-bursal stem cells (pre-busc), which are aiready comrnitted to the B ce11

lineage (Ratcliffe et al., 1986) , are also found in developing embryos, and they are

responsible for colonization of the bursai follicles. Seeding of bursal follicles

commences between day 8 and 14 of embryogenesis (Houssaint et al., 1976). In the

bursa, the pre-busc cells undergo massive proliferation and diversification, with the latter

occurring by gene conversion. Although most of the diversified B cells are destined to

an apoptotic death in the bursa, a small proportion of these cells immigrate to the

periphery, where they can devetop M e r into mature or memory B cells (see

Introduction).

A. Ce11 Surface Markers and B ceIl Development

The expression of ce11 surface markers has been useful for studying lyrnphopoesis

both in mammals and in birds, although the number of avian B cells markers available is

still quite limited. Figure 21 shows the pattern of expression for four avian B ce11

markers at different stages of B ce11 development: Bu-1, Major Histocompatibility

Complex class II (MHC class II), LT2 and ChL12. These four markers were used in the

work presented here for the characterization of B cells fkom normal and transgenic birds.

Figure 21. Ceii Surface Markers on Avian B CeUs. Ce11 surface antigens are expressed at various Ievels at different stages of B ce11 development. B cells fiom normal and transgenic birds were analyzed for expression of these four markers by flow cytometry (see Materials & Methods for a Iist of antibodies used and the working concentrations).

Level of Expression

An important marker for avian B cells is Bu-1, a pan-B ce11 marker (Veromaa et

al., 1988). Although the Bu-1 is expressed at al1 stages of B ce11 development in the

chicken, its expression has also been observed on small numbers of non-lymphoid cells

such as macrophages. Expression of this marker has been observed on cells in the

embryonic spleen at the earliest stages of B ce11 cornmitment (pre-busc), and is expressed

at al1 stages of development, including terminaily differentiated plasma cells (Houssaint

et al., 1987). Until now, the role of Bu-1 in B ce11 ontogeny is remains unclear, but

recent evidence points to Bu- 1 as a mediator of ce11 death (Funk et al., 1997). Similar to

Bu-1, the MHC class II marker is ubiquitously expressed on B cells of al1 stages of

development (Hala et al,, 1977). This rnarker, important for the activation of helper T

cells (Th), is in no way restricted to B ceIls, but it is expressed at intermediate levels at

al1 stages of B ce11 development.

The third marker that was used to describe normal and transgenic B ceUs in the

work presented here, is LT2, an antigen that has been characterized in our laboratoxy

(Paramithiotis and RatclBe, 1996). Although the fùnction of LT2 is not understood, our

laboratory has shown its expression on a specific population of short lived B cells in

peripheral blood. Chicken PBL B cells can be divided into three distinct populations

(Paramithiotis and Ratcliffe, I993), which include short lived (2-3 days) non-dividing

ceIls, longer Iived (2-3 weeks) non-dividing cells and short tived cells generated at extra-

bursal sites (populations 1 -3 respectively) (Paramithiotis and Ratcliffe, 1 993). LT2 is

expressed on the short-lived cells (Population 1), while ce1Is that make up Population 2

are exciusively LT2- (Paramithiotis and RatclifTe, 1996). For this reason, cells in the -

periphery, such as splenic lymphocytes, are heterogeneous for LT2 expression, ranging

fiom LT2- to LTZ'(Figure 21 & 29). Although it has not been confmed, it is likely that

the mature/memory B cells are negative for LT2 expression, since LT2' B cells in the

periphery only have a short life span.

The ChL 12 marker has facilitated the. study of B cell emigration fiorn the bursa.

In the bursa, cells that are committed to the B ce11 lineage, having undergone the initial

rearrangement at the Ig L and IgH loci, are negative for Ch1 12 expression. However, just

prior to emigration, ChL12 expression on the surface of diversified B cells is

dramatically up-regulated (Larnpisuo et al., 1 998). Consequently, peripheral B cells in

the spleen express hi& levels of this antigen (Figure 21 & 29). Splenic lymphocytes,

however, show a sub-population of large ~hL12'" B cells that are resistant to bursectomy

(unpublished data). The proportion of these cells increases significantly 30 days d e r

bursectomy. It is possible that these large lymphocytes, which have down regulated

expression of the ChL12 antigen, belong to a population of mattire B cells.

B. Conditional Expression of v d * In Vivo

The v-rel* oncogene has k e n shown to target B lymphocytes of a mature

phenotype both in vitro and in vivo (Barth and Humphries, 1988; Barth and Humphries,

1988). Therefore, the potential for abnormal development of lymphoid organs and the

potential for premature death of v-rel* transgenic embryos were indeed very h i a . In

order to fulfill our goal of king able to study cells targeted for transformation by v-rel*,

which would ultimately provide insight into the mechanisrn of v-rel*-mediated

transformation, we developed a mode1 that would allow us to study the consequence of

oncogene expression in normal birds.

Having established that the pRA07 constntct could successfùlly be used for

conditional expression of v-rel* in vitro (see Chapter 4), the RCAS-based system was

taken ifi vivo to study transformation by the oncogene in situ. Using this conditional

expression system, transgenic embryos could develop normally until hatch under

conditions that were non-permissive for transgene expression (+ tet). Only after hatch

would v-rel* expression by induced by the removal of tetracycline.

Conditional v-rel* transgenic birds were generated by injection with a viral

cocktail consisting of RCAS(A):tTA + pRA07 (l:lv/v) in ovo dong witb 0.5mg tet to

prevent expression of the oncogene (Figure 22). Embryos were maintained on tet until

hatch by injection directly into the egg every second day. Following hatch, a set of birds

was taken off tet to allow for induction of the v-rel* oncogene and the remaining chicks

were given lmg of tet (in water) every second day via intra-peritoneal injection. Six days

afier hatch, birds were sacrificed and lymphocytes were harvested fiom various organs.

Figure 22. Somatic Trnnsgenesis of Conditional v 4 t A viral supernatants cocktail containing RCAS(A):tTA + pRA07 (1: 1 v/v) was injected into eggs at dl3 of embryogenesis to allow for dissemination of viral particles and infection of multiple ce11 lineages (see Figure 5). AI1 somatically transgenic birds were maintained on tetracycline (0.5mg in dH,O every second day) until hatch. Afier hatch a group of bu& were withdrawn from tetracycline while another group continued to receive lmg of tetracycline (in dH,O) by intra-peritoneal injection every second day.

Results

A. Dramatic Increase in B Cells Numbers in the Spleen and Liver of v-rel*

Transgenic Birds

Normal control and v-rel* transgenic birds, both (+) and (-) tet, were sacrificed

six days afier hatch. Autopsy of transgenic birds that were expressing the oncogene (-

tet) revealed gross enlargement of the spleen and liver, and abnormal white nodules of

ceIl growth were observed in these organs (data not shown). Lymphocytes were

harvested fiom the bursa, thymus, spleen, liver and blood of normal and transgenic

chicks (both + and - tet), and cells were counted by trypan biue exclusion to determine

the total number of lymphocytes in each tissue preparation. Lymphocytes were fixed in

70% ethanoi and analyzed for viral protein expression by flow cytometry as per usual

(data not shown) to confirm RCAS and/or RCAN viral infection in transgenic birds.

Western blot analysis confmed v-Rel* expression by the transgenic lymphocytes

harvested fiom the birds that had been taken off tet (Figure 23).

The percentages of T and B cells in each sample were determined by flow

cytornetrv, based on CD3 and IgM expression respectively. The absolute numbers of T

and B Lymphocytes in each sample were calculated by combining the percentage of

lymphocytes in each sample (FACS data) with total ce11 numbers.

As shown in Figure 24% T ce11 numbers in the thymus, spleen and blood were

comparable for normal birds and transgenic birds regardless of v-rel* expression (+ or -

tet). However, the number of T cells was >100 times greater in transfomed liver (- tet)

than in normal or non-transformed liver (+ tet).

When the absolute B cells numbers were determined for the different tissue

samples, transgenic birds that were expressing v-Rel* (i.e.? - tet) appeared to have a

fewer B lymphocytes, while a slight increase in splenic B cells (-10x) was observed in

these birds (Figure 24b). The major difference, however, was the massive invasion of B

lymphocytes into the liver of the transgenic birds ttiat were expressing v-reI* (-tet).

Compared to the normal controls, transgenic chicks that expressed v-rel* (- tet) had >10

000 times more B cells in the liver. Furthemore, transformed B cells appeared not to be

recirculating since the number of PBL B cells was comparable for normal and transgenic

chicks (-1 0').

B. Transformed Cells in the Liver Include B Lymphocytes

In order to confirm that foreign cells in the liver of conditional v-rel* transgenic

birds (- tet) were B cells, PCR analysis was carried out on these ceIIs to detennine

whether rearrangement at the Ig light chah locus had occurred, a feature that is unique to

B cells. The primers used in this assay were designed to ampli@ a fiagrnent fiom the V,

gene segment, VL5'(2), to a region located within the J-C intron, JC(F). Prior to

rearmgement, the distance between the MO primer binding sites is too large for

amplification to occur; however, rearrangement at the light chah locus reduces this

distance, allowing for amplification. Figure 25 shows that cells harvested fkom the liver

of transgenic birds (- tet) did have a rearranged light chah locus, codrming their B cells

statu.

B. Aberrant Foci of B Ce11 Growth in the Liver of Transformed Chicks.

Sections of liver tissue kom normal and transgenic chicks were stained by

hematoxylin and eosin (H+E) (Figure 26). Cornpared to normal liver, the liver from v-

Rei* transgenic birds (- tet) show distinct foci of aberrant ce11 growth (Figures a & c

respectively). The liver of transgenic birds maintained on tet did not have these colonies

of darkly stained cells (Figure 26, b). Dark purple staining of the ectopic celis in the liver

by eosin suggested that these cells were highly nucleated, which is a characteristic feame

of lymphocytes. In addition, flow cytometry and PCR analysis of transgenic hepatic ce11

samples confmed the infiltration of B cells jnto the liver. Taken together, these results

suggested that the foci of growth in the liver of v-Rel* expressing birds were in fact the B

ce11 infiltrates.

Figure 23. v-Rel* is Expressed by Transgenic Birds that were Withdrawn from Tetracycline. Western blot analysis, using the HY87 antibody (see Figure 15), was carried out on lymphocytes fiom normal and transgenic birds, either + or - tet. Lymphocytes fiom the bursa, spleen and liver of transgenic birds that were uithdrawn from tet showed high level of v-Rel* expression (lanes 5,6 and 7), while normal controls and transgenic birds (+ tet) did not show oncoprotein expression (lanes 1-4). Al1 cells expressed c-Rel.

Normal

(+ tet) (- tet)

Figure 23. v-Rel* is Expressed in Lymphocytes from Transgenic Birds (- te*)

Figure 24. Absolute T and B Cell Numben in Lymphoid Organs and the Liver. Absolute lymphocyte nurnbers were calculated by a combination of ce11 counting and the percentage of T and B cells (as determined by flow cytornetry) in each sample. CD3 and surface IgM were used as markers for T and B cells respectively. The antibodies that were used were CT3 and 4-22 respectively. CT3 was used as a diluted hybridoma supernatant (1:lO vh), and the working concentration of 4-22 was lOpe/ml. Under conditions permissive for v-rel* expression, elevated numbers of B and T cells are seen in the liver and spleen of transgenic birds.

Total T Cell Numben in Nomal & Transgenic Chicks

In PBL

B ce11 Numben in N o m l & Transgenic Chicks

I l Normai 0 (+ tet)

Spleen Liver PBL

Figure 24. Infiltration of ~ ~ r n i h o c ~ t c s into the Livrr of v a l * Transgenic Birds

Figure 25. Transformed Cells in the Liver are B Lymphocyîes. Remangement of the immunoglobulin light chain locus, which is unique to B cells, was probed by PCR analysis using TAQ polymerase. The 5' primer, VL5'(2), binds within the V region of the light chah locus, while the 3' primer, JC(F), binds within the J-C intron. Prior to rearrangement, the primer binding sites are too far apart for efficient amplification. In B ceIls, however, rearrangement of the light chain locus brings the primer binding sites closer together, thereby allowing for amplification of a 700bp DNA fragment. The DT40 B ce11 lymphoma served as a positive control.

Germ Line Configuration of the IgL Locus

Rearranged IgL Locus (B Cells)

2116

Rearranged Light Chain 642

248

Figure 25. Transformed Cells in the Liver are B Cells

Liver sections were analyzed by immunohistochernisty to look at Ig heavy chah

(IgH) and lighi chah (IgL) expression (Figure 26, d-f & g-h respectively). Normally

there is a neglipible amount of B cells found in the liver of chicks (Figure 26, d & g), but

when v-Rel* is expressed, B cells appear as clusten of growth in the liver. Panels f and g

of Figure 26 show that at least some of the aberrant ce11 nodules stain positive for IgH

and IgL respectively. Histology of the liver from transgenic buds maintained on tet is

comparable to that of normal chickens (Panel b & e, Figure 26).

C. Phenotyping B Cells from Normal and Transgenic Birds

Using flow cytometry, we have looked at the expression of the following four cell

surface markers: Bu-1, MHC class II, ChL12 and LT2 on bursal lymphocytes in order to

characterize the B cells fiom normal and transgenic bu&. Figure 27 shows that the

phenotype of bursal cells fkom v-Rel* expressing birds (- tet) is relatively norxnai for al1

four of these markers.

The same four markers were used to characterize splenic and hepatic

lymphocytes. Characteristic of v-Rel* transformed lymphocytes, B cells harvested fiom

the spleen and liver of transgenic birds (- tet) showed high levels of MCH class II

expression (Figure 28). When Bu-1 expression was analyzed, it was found that although

the majority of the B cells in the spleen of v-Rel* transgenic birds were positive for Bu-l

expression, a group of B cells that had down-regulated expression of Bu-1 were

observed. Transforrned lymphocytes obtained fiom the liver of transgenic birds (- tet)

were predominantiy Bu-1' B ceIIs (Figure 28).

Significant differences in LT2 and ChL12 expression were observed between

normal and transformed B cells fiorn the spleen and the Iiver alike. Although little is

known about the role of LT2 in B cet1 development, work done by our laboratory has

suggested that this surface antigen is found on short lived PBL B ce11 populations that

emigrated fkom the bursal cortex (Paramithiotis and Ratcliffe, 1996). Normal expression

of LT2 in peripherd organs, such as the spleen, spans a broad range fiom LT2- through to

LT2' (Figures 21 & 29). It appears, however, that splenic B cells fiom transgeaic birds

expressing v-Rel* (-tet) were predominantly LT2-. Whether this was due to down-

Figure 26. B Cells Tumon in the Liver of v-Rel* Transgenic Bird. H+E staining of normal and v-rel* transgenic liver tissue (a-c). These stains show that normal hepatic tissue had very few lymphocytes. while birds expressing v-rel* (- tetracycline) have distinct foci of lymphocyte growth in their liver. Immunohistochemistry reveals that some of the tumors in the liver of v-rel* transgenic birds are IgH and IgL positive (f and h). Liver tissue fiorn transgenic birds maintained on tetracycline has a normal phenotype (b and e). Panel f shows that not every hepatic -or contained B cells. H+E staining of tissue was done by the Department of Pathology, McGill University, Montreal, QC. The working concentration of the antibodies used for the irnmunohistochemistry, 4-22 & 11C6 (see Materials & Methods), was 30pg/ml.

Figure 27. Bursil Cells from Transgenic Birds Have a Normal Phenotype. B u r d lymphocytes fiom normal and transgenic birds were analyzed by flow cytometry for expression of the ce11 surface markers Bu-1, LT2 and ChLl2 (for antibodies see Materials and Meîhods). Normal expression patterns for these markers are given in Fi,pe 2 2 . Bursal lymphocytes fiom transgenic birds (-tet) expressed normal levels of al1 three markers. suggesting that B ce11 development was not significady altered by the expression of v-Rel*.

Normal tTA + TRElv-rel* (- tet)

Figure 27. Bursal Cells from Transgenic Birds Have a Normal Pbenotype

Figure 28. v-Rel* Transfomeà B Cells in the Spleen and Liver of Transgenic Birds. Altered gene expression in v-Rel* transformed B cells includes up-regdation of MHC class II and down-regdation of the Bu-1 antigen. Expression of MHC class II and Bu-1 by lymphocytes fiom the spleen and liver of normal and transgenic birds was anaiyzed by flow cytometry (antibodies are described in Materials & Methods). A population of splenic B cells fiom birds expressing v-rel* (- tet) manifest this phenotype. B cells fiom the liver of these birds have elevated levels of MHC class II, but they are Bu- 1 *. Transgenic birds maintained on tet have a normal phenotype.

MHC class II

Figure 29. Transformed Celis Have a Mature B Cell Phenotype. Lymphocytes fiom the spleen and liver were analyzed by flow cytornetry for LT2 and ChL12 expression (see Materials & Methods for working concentrations of antibodies) and compared with normal expression patterns for these markers (Figure 21). The major@ of splenic B cells h m transgenic birds (- tet) are LTZ, and an increased nurnber of these B cells are ChLlZ1'. Lymphocytes fiom the liver of these birds are predominantly LT2' and Chi, 12-. This is consistent with B cells of a mature phenotype. Splenic lymphocytes fiom transgenic birds maintained on tet have a nonnal phenotype.

regulated expression, or resulted fiom transformation of LT2- B cells alone is still

unclear, Furthermore, B cells in the Iiver were almost exclusively negative for LT2

expression.

ChL12 is a marker for bursal derived B cells and it is normaily expressed at high

levels in the penphery (Figure 21 & 29). The effects of v-Rel* mediated transformation

on Cm12 expression has not been looked at until now. The results here show the

emergence of a group of B cells with down-regulated ChL 12 expression under conditions

that are permissive for v-rel* expression (- tet). Furthemore, the majority of B cells

found in the liver of these birds were ChLIT. Once again, it is unclear whether

transformation results in the down-regdation of ChL 12, or if ChL 12 is down-regulated

prior to transformation.

Discussion

A. v-Rel* Expression In Vivo is Inhibited by Tetraqcline

Although conditional forms of v-Re1 have previously been exploited in vimo, this

is the first example of conditional expression of the v-rel* oncogene in vivo. The results

obtained fiom transgenic birds maintained on tetracycline, in which v-rel* is not

expressed. are largely comparable to the results fiorn normal birds. Moreover, Western

analysis shows that v-Rel* expression in lymphocytes of transgenic birds is abrogated by

the admission of tetracycline via intra-peritoneal injection (Figure 23). Therefore, it is

most Iikely that a11 transgenic embryos maintained on tetracycline developed normally

until hatch. Chicks that were administered tetracycline post-hatch continued to develop

normally, as detemined by ce11 surface marker expression, while the chicks that stopped

receiving tet at hatch succurnbed to the effects of the v-rel* oncogene.

B. Expression of v-rel* I n Vivo Leads Massive B Ce11 Infiltration of the Liver

Early work by Barth & Humphries (1988), looked at the effects of RevT(CSV)

infection of day old chicks. Infection with RevT(CSV) lead to rapid death, and autopsy

of birds revealed the presence of himors in the liver. Immunohistochemistry was carried

out on liver sections to show that -90% of the tumors were IgM'. The results obtained

here, from somatically transgenic birds that were expressing v-rel* (- tet) also point to

tumorigenesis in the iiver. Characterization of lymphocytes obtained from the liver

indicated that the majority of the infiltrating lymphocytes were IgM'. However, T cells

did not seem to be immune to the presence of v-rel* since the nurnber of T cells in the

liver was significantly elevated in transgenic birds that expressed v-Rel* (Figure 24a).

Having confirmed the presence of B cells in hepatic lymphocyte samples obtained

fiom v-rel* expressing birds (-tet), based on rearrangement of the Ig light chah locus

(Figure 25), the architecture of tumors was probed by immunohistochemistry. Initial

stains of liver tissue by HtE show that the transforrned cells are present in distinct foci of

growth, suggesting the possibility of clonality in each tumor. Although this is an issue

that is still wiresolved, probing the liver tissue for IgH and IgL expression demonstrated

that the Ig' B cells appeared to be concentrated in these nodules (Figure 26, f & h

respectively). It should be mentioned, however, that there were tumors in the liver that

were stained purple by eosin, but negative for IgH (Figures 26, e). It is possible that

these foci represent tumors of T ce11 growth, since elevated nurnbers of T cells were also

found in the liver transgenic birds (- tet) (Figure 24a). Transformation of T cells in

transgenic birds expressing v-rel* (- tet) is not surprising since previous work done in our

laboratory by Marmor et al. (1993) showed that avian T celts of both the a@ and the y/6

T ce11 receptor (TCR) lineages are transformed by RevT(CSV) in vitro. The transfonned

T cells obtained fiom the liver of transgenic birds (- tet) have yet to be characterized.

C . Bursal Cells from Transgenic Birds are Normal

By the fust week pst-hatch a large proponion of bunal cells have already

undergone diversification by gene conversion, and the number of pre-busc cells are on

the decline. The pre-busc cells undergo rapidly division in the bursa, giving rise to a

large polyclonal population within each follicle. Only a srnail proportion of these IgM'

cells (-5%) actually emigrates fkom the bursa, an event that is preceded by the up-

regulation of the ChL 12 expression at the ce11 surface (Lampisuo et al., 1998). Thus, the

proportion of cells emigrating fiom the bursa is reflected by the small ratio of cells

expressing elevated levels ChL12 (Figure 27). It is interesting to note that the bursal

cells from transgenic birds that were expressing the oncogene (- tet) shows normal

patterns for ChL 12 expression regardless of the decrease in the absolute number of cells

found in the bursa (Figure 24).

Furthemore, Figure 27 shows that bursal cells fiom v-rel* transgenic birds that

were expressing the oncogene (- tet) show normal levels of LT2, Bu-land ChL12

expression (as depicted in Figure 21). Once again, it would seem that v-Rel* expression

did not effect the quality of B cells in the bursa, only that the oncogene caused a

reduction in the total number of cells therein. Therefore, it is possible that v-Rel* does

not effect B ceil development in the bursa per se! as determined by phenotypic analysis,

but it could possibly hinder the rate or eficiency at which ce11 division occurs. Another

possibility is that bursal cells fiom v-rel* transgenic birds (-tet) could be more

susceptible to apoptosis in the bursa than normal. For this reason, it would be interesting

to quantitate apoptotic activity in the bursa fiom nonnal and transgenic birds, either by

ce11 cycle anaiysis (to look at DNA content of cells) or by tunel assay to visudize

apoptosis in situ. A third possibility is that the v-Rel* oncoprotein drives bursal

emigration, thereby causing a reduction in the totd number of cells in the bursa-

D. Splenic & Hepatic Lymphocytes Are Characteristic w e l * Transformed cells

Lymphocytes harvested fiom the spleen and liver of v-rel* transgenic birds

thRved when cultured in IMDM/2%CS (data not shown), which is uncharacteristic of

normal lymphocytes. In general, normal lymphocytes taken fiorn birds apoptose within

24 hours unless preventative measures are taken to ensure their survival, such as

transformation with RevT(CSV) virus (Benatar et al., 1991). Transformation by v-rel* is

known to imrnortalize splenic B celis (Bose, 1992), although RevT(CSV) transformed T

cells, having a finite life span, senesce within six months (Marmor et al., 1993)-

Interestingly, it has been observed that bursal cells transformed with RevT(CSV) grow

well in vitro for 2 months, afier which tirne growth slows down significantly

(unpublished data). Therefore, it appears that in situ transformation by v-rel* can, to a

certain degree, extend the life span of splenic and hepatic lymphocytes. Whether these

cells are immortalized has yet to be detennined.

Since v-rel* is a member if the ReVNF-d family of transcription factors (see

Introduction), it is possible that transformation by this oncogene is the consequence,

either direct or indirect, of disregulated gene expression. Thus far it has been shown that

v-Re1 can alter the expression of several genes ranging fiom those involved in ce11

activation, c--os (Fujii et al., 1996), to those that inhibit apoptosis, chL4P (You et al.,

1997). In addition, it has been observed that v-Re1 transformed lymphocytes express

elevated levels of MHC class II, but that Bu-1 expression by v-Re1 transformed B ceils is

significantly down regulated (Humphries and Zhang, 1992). The same results were

obtained for cells transformed by v-Rel* (Marmor et al., 1993).

Phenotypic analysis of the splenic and hepatic lymphocytes fiom v-rel*

transgenic birds (- tet) revealed that ce11 surface expression of the MHC class II and Bu-1

markers complied with that of RevT(CSV) transformed cells; MHC II was expressed at

high levels and Bu4 was significantiy down legulated (Figure 28). Therefore, it appears

that induction of the v-rel* oncogene did indeed result in the transformation of

lymphocytes in situ.

Since the exact mechanism of v-rel* mediated transformation is not fully

understood, it remains unclear how altered gene expression by v-Rel* can lead to

transformation. Down-regulated expression of the Bu-1 antigen on v-rel* transfomed

lymphocytes, however, is interesting in light of the recent evidence by Funk et al. (1997),

suggesting a pro-apoptotic role for the Bu-1 antigen. This group observed that

incubation of B cells in the presence of anti-Bu- t antibodies resulted in a significant loss

of viability, and ultirnately ended in death of the B lymphocytes. Therefore, the down-

regulation of Bu-1 by v-Re! could be one mechanism by which the oncoprotein protects

cells fiom an untirneiy death.

E. Transformed B Cells Have a Mature Phenotype

B ce11 development in chickens occurs in several stages, fiom pre-bursal stem

cells to mature, terminally differentiated plasma cells. The avian homologues to several

marnmalian ce11 surface markers have now been identified including CD45, a maker

expressed on al1 lymphocytes, and MHC class II (Paramithiotis et al., 199 1 ; Hala et al.,

1977). On the other hand, chicken-specific markers have also been described including

LT2 and ChL 12. Although the role of many of these ce11 surface antigens has yet to be

determined, these markers have aided in the study of B ce11 ontogeny by detennining the

pattern of their expression at different stages of development.

Recently, our laboratory has described the LT2 marker (Paramithiotis and

Ratcliffe, 1996), demonstrating that the expression of LT2 antigen in peripheral blood is

restricted to a population of short lived B cells having bursal origins (Population 1). A

second population of bursa-derived PBL B cells (Population 2) was described as being

LT2-; these cells have a !-figer !if= S~LT LI the periphery (2-3 weeks). Also demonstrated

was the significant decline of LT2 expression on PBL B cells, fiom 50% to 4%, over a

penod of 5 months.

Interestingly, of the lymphocytes obtained fiom the spleen of v-rel* expressing

chicks (- tet) show that the majority of B cells are either L T ~ " or LT2; unlike the normal

control splenic B ce11 popdation (Figure 29). Furthemore, the B cells harvested fiom

the liver of transgenic birds are aimost uniquely LTZ. This suggests the possibility that

Population 2 B cells in the periphery are specifically transformed by v-Rel*.

However, at this point it is not possible to definitively conclude that the LT2' B

cells alone are transformed by v-rel*. Thus far, it is unclear whether the presence of the

v-Rel* oncoprotein merely down regulates LT2 expression or whether the LT2- B cells

are specifically targeted for transformation. Sequence analysis of the LT2 promoter

would reveal the presence or absence of KB sites and, therefore, would provide insight as

to whether LT2 expression is under the control of R e m - K B transcription factors,

including v-Rei*. Unfortunately, the gene encoding LT2 has not yet been cloned.

Nevertheless, the fact that transformed B cells in the spleen of v-rel* transgenic birds (-

tet) are LT2' suggests that the cells targeted for oncogenesis by the oncogene are B cells

of a mature phenotype.

ha lys is of splenic lymphocytes by flow cytometry revealed that many of the B

cells are down regulated for ChLl2 expression in transgenic birds that were withdrawn

fiom tetracycline (Figure 29). Moreover, transformed lymphocytes that are found in the

liver of these birds are predominantly c ~ L 12'" or C U 12-. Similar to the results obtained

for LT2 expression by transformed lymphocytes, the paucity of ChL 12 on the surface of

v-reZ*-transformed cells suggest a mature B ce11 phenotype (Figure 21). Once again, it is

not clear whether ~hL12'" cells are specifically targeted for v-rel*-mediated

transformation or whether transformation by this oncogene results in the down regulated

expression of the ChL 12 marker.

General Conclusion

RevT is among the most overtiy transforming of al1 known retrovinises. The

oncogene responsible for Rev-T mediated transformation is v-rel, a member of the

ReVNF-K. family of transcriptionai regulators. Although the exact mechanism for v-

Rd-mediated transformation is still unclear, several models have been suggested. The

two major models feature v-Re1 as either a dominant negative mutant of the cellular

homologue, c-Rel, or as a transcriptional activator (Figure 3). Although the two

mechanisms are opposed to one another, they are both based on the fact that v-Re1 is

indeed a transcriptional regulator. Therefore, it is generally accepted that v-rel

transforms target cells through disregulated gene expression. There are several genes that

show altered expression in v-rel-transfonned cells, such as mhc class I I , bu-1, c-jun, ch-

iap. However, a causal relationship between the altered expression of genes and v-Re1

has yet to be Mly established. Our laboratory is interested in studying the mechanism by

which v-Re1 transforms target cells.

Since RevT is a replication defective retrovins, it is dependent on a helper virus

for successfiil infection of cells. RevT has now been isolated in the context of two

different helper viruses, RevA and CSV. Interestingly, the cells transformed by RevT

differ depending on the helper virus; while RevT(RevA) appears to transform myeloid

cells and immature B cells, RevT(CSV) targets mature B cells and gives rise to

polyclonal B ce11 tumors. This suggests that the range of cells targeted for v-Rel-

mediated transformation is limited by expression of ce11 surface receptors for the ENV

protein of the helper virus. However, the v-rel oncogene that is encoded by RevT in the

context of CSV, herein referred to as v-rel*, was found to have an alanine-to-serine

mutation within the RHD, proximal to the IcB binding site. Although v-Re1 and v-Rel*

both interact with KB sites in vizro, they interact with different a f i t i e s .

In order to understand the mechanism for v-Rel*-mediated transformation, we

have devised a system to study in situ transformation. By generating somatically

transgenic chickens that express v-rel* in a conditional manner, we were able to

determine which cells were target for transformation by this oncogene. Since the

tetracycline sensitive transactivator, tTA, was cloned into an RCAS vector of the A sub-

group (Martinez, O., 1996), the v-rel* oncogene was cloned under the control of the

tetracycline response element (TE) into RCAS and RCAN sub-group B vectors. A

strong poly-adenylation signal, designed to maxirnize pst-transcriptional processing,

and a Kozak sequence, to increase translational efficiency were included within the

vectors.

Initiai charactenzation of these vectors in CEFs revealed that pRA07, an

K A N @ ) vector which has the TRE/v-rel*/PA transgene in the opposing direction to

viral encoded genes, could be used for conditionai expression of v-rel* in vitro.

Subsequently, a cocktail of RCAS(A):tTA + p u 0 7 virai supematants (1:l v/v) were

used for infection and transgenesis of developing embryos. These embryos were

maintained on tetracycline until hatch to prevent expression of v-rel*, thereby allowing

normal development of the embryo. Transgenic birds were withdrawn fiom tetracycline

at hatch and sacrificed on the sixth day. .

Autopsy of these birds revealed gross enlargement of the spleen and the liver

when compared to nomal control birds and the transgenic birds maintained on

tetracycline. Analysis of the transformed cells harvested fiom the spleen and liver of

birds withdrawn fkom tetracycline revealed that they were predominantly IgM' and PCR

analysis of the Ig iight chah locus confïrmed that they were, in part, B cells.

The tumors were M e r characterized by immunohistochemistry and we

concluded that the t~ansformed B cells found in the Iiver of transgenic birds (- tet) were

concentrated in foci of growth. The pattern of tumor growth suggested the possibility of

lymphocyte clonality. In addition there were also tumors that did not stain positive for

the IgH, and it is possible that they could be T ce11 tumors.

Phenotypic analysis based ce11 surface marker expression, LT2 and ChL 12, by the

lymphocytes harvested fiom the spleen and liver of transgenic birds (- tet), suggested that

the transformed B cells were of a mature phenotype (LM- and ChL 123 Expression of

the other markers by transfonned lymphocytes, MHC class II and Bu-1, did not reflect

expression patterns of mature B cells. However, expression of these two markers was

characteristic of v-Rel* transfonned B cells: up-regulated MHC class II and loss of Bu-1

expression.

nie prevalence of transformed B ce11 in the spleen of transgenic birds (- tet) by

day 6 post-hatch correlated with fmdings of Zhang et al. (Zhang et al., 1991). This group

found that RevT transformed splenic lymphocytes from week old chicks displayed

fùnctional rearrangements at the IgH and IgL loci. Moreover, they isolated a RevT

transformant that produced IgG, suggesting that mature, terminally differentiated B celis

could be transformed. On the other hand, transformation assays performed on ernbryonic

splenic lymphocytes resulted in transfonned cells that did not have Ig heavy chah gene

remangement. We looked at the effects of v-rel* on B cells in week-old hatchlings, and

the transformed B cells fiom transgenic birds (- tet) had a mature B ce11 phenotype, based

on ce11 surface antigen expression.

When birds were sacrificed and autopsied, the spleen and liver of transgenic birds

(- tet) were grossly enlarged, and Figure 24 shows that the number of B cells in the liver

of these birds is >10 000 times greater than in nonnal birds. At this point, it is unclear

whether the lymphocytes normally found in the liver (-IO4) are being transformed in situ.

It is also possible that lymphocytes are transformed at extra-hepatic sites, and are then

filtered out of circulation in the liver where they rapidly proliferate.

The system that we have developed is the first example of conditional expression

of v-rel* in vivo. In the presence of tetracycline, transgenic birds do not exhibit

lymphocyte transformation. However, withdrawal of tetracycline ultimately gives rise to

massive tumors of lymphoid cells. Therefore, we have developed a system in which we

can regulate the induction of tumor formation in vivo.

References

Abbadie, C., Kabrun, N., Bouali, F., Smardova, J., Stehelin, D., Vandenbunder, B., and Enrietto, P.J. (1993). High levels of c-rel expression are associated witti programmed ce11 death in the developing avian embryo and in bone marrow cells in vitro. Cell 75,899-9 12.

Arenzana-Seisdedos, F., Thompson, J., Rodriguez, M. S ., Bacheierie, F., Thomas, D., and Hay, R.T. (1995). Inducible nuclear expression of newly synthesized 1 kappa B alpha negatively regdates DNA-binding and transcriptional activities of NF- kappa B. Mo1 Ce11 Bi01 15,2689-2696.

Astrin, S.M., Buss, E.G., and Haywards, W.S. (1979). Endogenous virai genes are non- essential in the chicken. Nature 282,339-34 1.

Bach, F.H., Hancock, W.W., and Ferran, C. (1997). Protective genes expressed in endothelial cells: a regdatory response to injury. Immunol Today 18,483-486.

Baldwin, A.S.J. (1996). The NF-kappa B and 1 kappa B proteins: new discoveries and insights. Annu Rev immun01 f 4,649-683.

Ballard, D.W., Walker, W.H., Doerre, S., Sista, P., Molitor, LA., Dixon, E.P., Peffer, N.J., Hannink, M., and Greene, W.C. (1990). The v-rel oncogene encodes a kappa B enhancer binding protein that inhibits NF-kappa B function. Celi 63, 803-814.

Barth, C.F., Ewert, D.L., Oison, W.C., and Humphries, E.H. (1990). Reticuloendo theliosis virus REV-T(REV-A)-induced neoplasia: development of tumors within the T-lymphoid and myeloid lineages. J Virot 64 ,6054-6062.

Barth, C.F. and Humphries, E.H. (1988). A nonimmunosuppressive helper virus allows high effkiency induction of B cet1 lymphomas by reticuloendotheiiosis virus strain T. J Exp Med 167,89-108.

Barth, C.F. and Humphries, E.H. (1988). Expression of v-rel induces mature B-ce11 lines that reflect the diversity of avian imrnunoglobulin heavy- and light-chah rearrangements. Mol Ce11 Bi01 8,5358-5368.

Baumann, H. and Gauidie, J. (1994). The acute phase response [see comments]. Immunol Today I5,74-80.

Beg, A.A., Ruben, S.M., Scheinman, R.I., Haskill, S., Rosen, C.A., and Baldwin, A.S.J. (1992). 1 kappa B interacts with the nilclear localization sequences of the subunits of NF-kappa B: a mechanism for cytoplasrnic retention [published erratum appears in Genes Dev 1992 Dec;6(12B):2664-51. Genes Dev 6, 1 899- 19 13.

Beg, A.A., Sha, W.C., Bronson, R.T., Ghosh, S., and Baltimore, D. (1 995). Embryonic lethality and liver degeneration in rnice lacking the RelA component of NF-kappa B. Nature 376, 167-170.

Benatar, T., Iacampo, S., Tkalec, L., and Ratcliffe, M.J. (1991). Expression of immunoglobulin genes in the avian embryo bone marrow revealed by retrovirai transformation. Eur J Immunol21,2529-2536.

Benatar, T., Tkalec, L., and Ratcliffe, M. J. (1 992). Stochastic remrangement of immunoglobulin variable-region genes in chicken B-ce11 developrnent. Proc Nat1 Acad Sci U S A 89,761 5-761 9.

Bettany, J.T. and Wolowac- KG. (1998). Tetracycline derivatives induce apoptosis selectively in cultured monocytes and macrophages but not in mesenchymal cells. Adv Dent Res 12, 1 36- 143.

Boehmelt, G., Walker, A., Kabrun, N., Mellitzer, G., Beug, H., Zenke, M., and Enrietto, P.J. (1 992). Hormone-regulated v-rel estrogen receptor fusion protein: reversible induction of ce11 transformation and cellular gene expression. EMBO J 11,4641 - 4652.

Bose, H.R.J. (1992). The Re1 family: models for transcriptional regulation and oncogenic transformation. Biochim Biophys Acta 11 14, 1 - 1 7.

Bushdid, P.B., Brantley, D.M., Yull, F.E., Blaeuer, G.L., Hof ian , L.H., Niswander, L., and Kerr, L.D. (1998). Inhibition of NF-kappaB activity resdts in dismption of the apical ectodermal ridge and aberrant limb morphogenesis [see cornments]. Nature 392,6 15-6 1 8.

Caamano, J.H., Rizzo, C.A., Durham, S.K., Banon, D.S., Raventos-Suarez, C., Snapper, C.M., and Bravo, R. (1998). Nuclear factor (NF)-kappa B2 @100/p52) is required for normal splenic microarchitecture and B cell-mediated immune responses. J Exp Med 187,185-196.

Capobianco, A.J., Chang, D., Mosialos, G., and Gilmore, T.D. (1992). plOS, the NF- kappa B p50 precmor protein, is one of the cellular proteins complexed with the v-Re1 oncoprotein in transformed chicken spleen cells. J Virol66,3758-3767.

Carrasco, D., Cheng, J., Lewin, A., Warr, G., Yang, H., Rizzo, C., Rosas, F., Snapper, C., and Bravo, R ( 1 998). Multiple hemopoietic de fects and lymphoid hyperplasia in mice lacking the transcriptional activation domain of the c-Re1 protein. .J Exp Med 187,973-984.

Carrasco, D., -O, C.A., D o h a n , K., and Bravo, R. (1996). The v-rel oncogene promotes malignant T-ce11 leukemia/lyrnphoma in transgenic mice. EMBO J 15, 3640-3650.

Chen, C., Agnes, F., and Gelinas, C. (1 999). Mapping of a serine-rich domain essential for the transcriptional, antiapoptotic, and transforming activities of the v-Re1 oncoprotein un Process Citation]. Mol Ce11 Bi01 19,307-3 16.

Chen, CL., Ager, L.L., Gartland, G.L., and Cooper, MID. (1986). Identification of a T3fï ce11 receptor complex in chickens. J Exp Med 164,375480.

Cressman, D.E., Greenbaum, L.E., Haber, B.A., and Taub, R (1994). Rapid activation of post-hepatectomy factodnuclear factor kappa B in hepatocytes, a prirnary response in the regenerating liver. J Bi01 Chem 269,30429-30435.

Davis, N., Bargmann, W., Lim, M.Y., and Bose, H.J. (1990). Avian retictdoendotheliosis virus-transfonned lymphoid cells contain multiple pp59v-rel complexes. J Virol 64,584-59 1.

Davis, N., Ghosh, S., Simmons, D.L., Tempst, P., Liou, H.C., Baltimore, D., and Bose, H.R. J. ( 1 99 1). Rel-associated pp40: an inhibitor of the rel family of transcription factors. Science 253, 1268- 127 1.

Duke, R.C., Ojcius, D.M., and Young, J.D. (1996). Ce11 suicide in health and disease. Sci Am 275,80-87.

Fujii, M., Minamino, T., Nomura, M., Miyamoto, KI. , Tanaka, J., and Seiki, M. (1996). Selective activation of the proto-oncogene c-jun promoter by the transforming protein v-Rei. Oncogene 12,2 1 93-2202.

Funk, P.E. and ïhompson, C.B. (1996). Current concepts in chicken B ce11 development. Curr Top Microbiol Immunol 212, 17-28.

Funk, P.E., Tregaskes, C.A., Young, J.R., and Thompson, C.B. (1997). The avian chB6 (Bu-1) alloantigen can mediate rapid ce11 death. J Immunol 159, 1695-1 702.

Gerondakis, S., Grumont, R., Rourke, I., and Grossmann, M. (1998). The regulation and roles of ReW-kappa B transcription factors during lymphocyte activation. Curr Opin Immunol 10, 353-359.

Ghosh, S., May, M.J., and Kopp, E.B. (1998). NF-kappa B and Re1 proteins: evolutionarily conserved mediators of immune responses. Annu Rev Immun01 16,225-260.

Gilmore, T.D. (1992). Role of rel fmily genes in normal and malignant lymphoid ce11 gowth. Cancer Surv 2 5,69-87.

Gilmore, T.D., Koedood, M., Piffat, KA., and White, D.W. (1996). ReVNF- kappaBAkappaB proteins and cancer. Oncogene 13, 1 367- 1378.

Gilmore, T.D. and MOM, P.J. (1993). The 1 kappa B proteins: members of a muItifiuictional family . Trends Genet 9,427-433.

Gossen, M. and Bujard, H. (1992). Tight control of gene expression in mammalian ceiis by tetracycline- responsive promoters. Proc Nat1 Acad Sci U S A 89,5547-555 1.

Govind, S. and Steward, R. (1991). Dorsoventral pattern formation in Drosophila: signai transduction and nuclear targeting. Trends Genet 7, I 19- 125.

Grunont, R.J., Rourke, I.J., O'Reilly, L.A., Strasser, A., Miyake, K., Sha, W., and Gerondakis, S. (1998). B lymphocytes differentially use the Re1 and nuclear factor kappaBl (NF- kappaB1) transcription factors to regulate ce11 cycle progression and apoptosis in quiescent and mitogen-activated cells. J Exp Med 18 7,663-674.

Hala, K., Vilhelmova, M., and Hartmanova, J. (1977). The structure of the major histocornpatibility complex of the chicken. Adv Exp Med Bi01 88,227-232.

Hannink, M. and Temin, H.M. (1991). Molecular mechanisms of transformation by the v-rel oncogene. Crit Rev Oncog 2,293-309.

Hoelzer, J.D., Lewis, R.B., Wasmuth, C.R.; and Bose, H.R.J. (1980). Hematopoietic ce11 transformation by reticuloendotheliosis virus: characterization of the genetic defect. Virology 100,462-474.

Houssaint, E., Belo, M., and Le Douarin, N.M. (1976). Investigations on ce11 lineage and tissue interactions in the developing bursa of Fabricius through interspecific chimeras. Dev Bi01 53,250-264.

Houssaint, E., Diez, E., and Pink, J.R. (1987). Ontogeny and tissue distribution of the chicken Bu- 1 a antigen. Immunology 62,463-470.

Houssaint, E., Mansikka, A., and Vainio, 0. (1991). Early separation of B and T lymphocyte precursors in chick embryo. J Exp Med 174397406.

Hrdlickova, R., Nehyba, J., and Bose, H.R.J. (1995). Mutations in the DNA-binding and dimerization domains of v-Re1 are responsible for altered kappa B DNA-binding complexes in transformed cells. J Virol69,3369-3380.

Hrdlickova, R., Nehyba, J., and Humphries, E.H. (1 994). v-rel induces expression of three avian immunoregulatory surface receptors more efficiently than c-tel. J Virol68,308-3 19.

Hrdlickova, R., Nehyba, J., Roy, A., Humphries, E.H., and Bose, H.R.J. (1995). The relocalization of v-Re1 fiom the nucleus to the cytoplasm coincides with induction of expression of Ikba and nfkbl and stabilization of I kappa B-alpha. J Virol 69, 403-413.

Hughes: S.H., Greenhouse, J.J., Petropoulos, C.J., and Sutrave, P. (1987). Adaptor plasmids simplify the insertion of foreign DNA into helper- independent retroviral vectors. J Vu01 61,3004-3012.

Humphries, E.H. and Zhm.g, G. (1992). V-rel and C-rel modulate the expression of both bursal and non-bursal antigens on avian B-ce11 lymphomas. Curr Top Microbiol Immun01 182,47543.

Iida, Y. and Masuda, T. (1996). Strength of translation initiation signal sequence of mRNA as studied by quantification method: effect of nucleotide substitutions upon translation efficiency in rat preproinsulin mRNA. Nucleic Acids Res 24, 33 13-33 16.

Inoue, J., Kerr, L.D., Ramone, L.J., Bengal, E., Hunter, T., and Venna, LM. (1 991). c-rel activates but v-rel suppresses transcription fiom kappa B sites. Proc Natl Acad Sci U S A 88,3715-3719.

Iotsova, V., Caamano, J., Loy, J., Yang, Y., Lewin, A., and Bravo, R. (1997). Osteopetrosis in mice lacking NF-kappa 1 and NF-kappaB2 [see cornments]. Nat Med 3, 1285-1 289.

Jacobsen, K.A., Paramithiotis, E., Ewert, D.L., and Ratcliffe, M.J. (1996). Apoptotic ceil death in the chicken bursa of Fabricius. Adv Exp Med Bi01 106, 155-165.

Kabrun, N., Hodgson, J.W., Doemer, M., Mak, G., Franza, B.R.J., and Enrietto, P.J. (1 99 1). Interaction of the v-rel protein with an NF-kappa B DNA binding site. Proc Natl Acad Sci U S A 88, 1783- 1787.

Karin. M., Liu, Z., and Zandi, E. (1997). AP-1 function and regdation. Curr Opin Ce11 Bi01 9,240-246.

Kontgen, F., Gnunont, R.J., Strasser, A., Metcalf, D., Li, R., Tarlinton, D., and Gerondakis, S. (1995). Mice lacking the c-rel protooncogene exhibit defects in lymphocyte proliferation, humoral immunity, and interleukin-2 expression. Genes Dev 9, 1965-1 977.

Kopp, E.B. and Ghosh, S. (1 995). NF-kappa B and rel proteins in innate immmity. Adv Irnmunol 58, 1 -27.

Kralova, J., Liss, A.S., Bargmann, W., and Bose, H.R.J. (1998). AP-1 factors play an important role in transformation induced by the v- rel oncogene. Mol Ce11 Bi01 18,2997-3009.

Lacasse. E.C., Baird, S., Komeluk, R.G., and MacKenzie, A.E. (1998). n i e inhibitors of apoptosis (IAPs) and their emerging role in cancer Dn Process Citation]. Oncogene 17,3247-3259.

a Lampisuo, M., Arstila, T.P., Liippo, J., and Lassila, 0 . (1998). Expression of chL12 surface antigen is associated with ce11 survival in the avian bursa of Fabricius. Scand J Immunol 47,223-228.

Lanoix, J. and Acheson, N.H. (1 988). A rabbit beta-globin polyadenylation signal directs efficient termination of transcription of polyomavinis DNA. EMBO J 7, 2515- 2522.

Lassila, 0 . (1989). Emigration of B cells fiom chicken bursa of Fabricius. Eur J Immun01 19,955-958.

Lassila, O., Alanen, A., Lefkovits, I., Cooper, M.D., and Pink, J.R. (1988). Immunoglobulin diversification in embryonic chicken bursae and in individuai bursal follicIes. Eur J Immun01 18,943-949.

Lieber, M.R., Chang, C.P., Gallo, M., Gauss, G., Gerstein, R., and Islas, A. (1994). The mechanism of V@)J recombination: site-specificity, reaction fidelity and immunologie diversity. Semin Immunol 6, 143- 1 53.

Liou, H.C., Sha, W.C., Scott, M.L., and Baltimore, D. (1994). Sequential induction of NF-kappa B/Rel family proteins during B-ce11 terminal differentiation. Mol Ce11 Bi01 Ill, 5349-5359.

Lu, D., Thompson, J.D., Gorski, G.K., Rice, N.R., Mayer, MG., and Yunis, J.J. (1 991). Alterations at the rel Locus in human lymphoma. Oncogene 6, 1235-124 1.

Luque, 1. and Gelinas, C. (1998). Distinct domains of IkappaBalpha regulate c-Re1 in the cytoplasm and in the nucleus. Mol Ce11 Biol 18, 12 13-1224.

Mansikka, A., Jalkanen, S., Sandberg, M., Granfors, K., Lassila, O., and Toivanen, P. (1990). Bursectomy of chicken embryos at 60 hours of incubation leads to an oligoclonal B ce11 cornpartment and restricted Ig diversity. J Immunol I45,3601- 3609.

Mansikka, A., Sandberg, M., Lassila, O., and Toivanen, P. (1990). Rearrangement of immunoglobulin light chah genes in the chicken occurs prior to colonization of the embryonic bursa of Fabricius. Proc Natl Acad Sci U S A 87,94 16-9420.

Marmor, M.D., Benatar, T., and Ratcliffe, M.J. (1993). Retrovirai transformation in vitro of chicken T cells expressing either alphdbeta or gammaldelta T ce11 receptors by reticuloendothelîosis virus strain T. J Exp Med 177, 647-656.

Martinez, O. Role of Rel/NF-kappaB members in v-rel induced transformation. 1996. McGill University, Montreal, Qc- (GENERIC) Re f Type: ThesidDissertation

Miyamoto, S., Chiao, P.J., and Venna, LM. (1994). Enhanced 1 kappa B alpha degradation is responsible for constitutive NF- kappa B activity in mature murine B-ce11 lines. Mol Ce11 Bi01 14,3276-3282.

Momson, L.E., Boehmelt, G., Beug, H., and Enrietto, P.J. (1991). Expression of v-rel in a replication competent virus: transformation and biochernical characterization. Oncogene 6, 1657- 1666.

Momson, L.E., Boehmelt, G., and Enrietto, P.J. (1992). Mutations in the rel-homology domain alter the biochemical properties of v-rel and render it transformation defective in chicken embryo fibroblasts. Oncogene 7, 1 137-1 147.

Morrison, L.E., Kabrun, N., Mudri, S., Hayman, M.J., and Enrietto, P.J. (1989). Viral rel and cellular rel associate with cellular proteins in transforrned and normal cells. Oncogene 4,677-683.

Mosialos, G-, Hamer, P., Capobianco, A.J., Laursen, RIA., and Gilmore, T.D. (1991). A protein kinase-A recognition sequence is structurally linked to transformation by pS9v-rel and cytoplasmic retention of p68c-rel. Mol Ce11 Bi01 11, 586795877.

Nehyba, J., Hrdlickova, R., and Bose, H.R.J. (1997). Differences in kappaB DNA- binding properties of v-Re1 and c-Re1 are the result of oncogenic mutations in three distinct functional regions of the Re1 protein. Oncogene 11, 288 1-2897.

Neiman, P.E., Thomas, S.J., and Loring, G. (1991). Induction of apoptosis during normal and neoplastic B-ce11 development in the bursa of Fabricius. Proc Nat1 Acad Sci U S A 88, 5857-5861-

Neri, A., Chang, C.C., Lombardi, L., Salina, M., Comadini, P., Maiolo, A.T., Chaganti, R.S., and Dalla-Favera, R. (1 99 1). B ce11 lymphoma-associated chromosomal translocation involves candidate oncogene lyt- 1 O, homologous to NF-kappa B p50. CeIl 67, 1075-1087.

Nuemann, M., Marienfeld, R., and Serfiing, E. ReVNF-rB transcription factors and cancer: Oncogenesis by dysregulated transcription (Review). international Journal of Oncology 11, 1335-1347. 1997. (GENEIUC) Ref Type: Genenc

Olah, 1. and Glick, B. (1 978). The number and size of the follicular epithelium (FE) and follicles in the bursa of Fabricius. Poult Sci 57, 1445-1450.

Paramîthiotis, E., Jacobsen, KA., and Ratcliffe, M.J. (1995). Loss of surface immunoglobulin expression precedes B ce11 death by apoptosis in the bursa of Fabncius. J Exp Med 181, 105-1 13.

Paramithiotis, E. and Ratcliffe, M.J. (1993). Bursadependent subpopdations of peripheral B lymphocytes in chicken blood. Eur J Immunol 23,96-102.

Paramithiotis, E. and Ratcliffe, M.J. (1996). Evidence for phenotypic heterogeneity arnong B cells emigrating fiom the bursa of fabricius: a reflection of hctional diversity? Curr Top Microbiol Immun01 2/2,29-36.

Paramithiotis, E., Tkalec, L., and Ratcliffe, M.J. (1991). High levels of CD45 are coordinately expressed with CD4 and CD8 on avian thymocytes. J Immun01 I47, 3710-3717.

Perkins, N.D., Felzien, L.K., Betts, J.C., Leung, K., Beach, D.H., and Nabel, G.J. (1997). Regdation of NF-kappaB by cyclin-dependent kinases associated with the p300 coactivator. Science 275,523-527.

Perkins, N.D., Schmid, R.M., Duckett, C.S., Leung, K., Rice, N.R., and Nabel, G.J. (1 992). Distinct combinations of NF-kappa B subunits determine the specificity of transcriptional activation. Proc Nat1 Acad Sci U S A 89, 1529-1 533.

Petropoulos, C.J. and Hughes, S.H. (1991). Replication-competent retrovirus vectors for the transfer and expression of gene cassettes in avian cells. J Virol 65, 3728- 3737.

Petropoulos, C.J., Payne, W., Salter, D.W., and Hughes, S.H. (1992). Appropriate in vivo expression of a muscle-specific promoter by using avian retroviral vectors for gene transfer [corrected] lpublished erratum appears in 3 Virol 1992 Aug;66(8):5 1751. J Virol66,339 I-3397.

Preiss, T. and Hentze, M.W. (1998). Dual function of the messenger RNA cap structure in poly(A)-tail- promoted translation in yeast. Naîure 392, 5 16-520.

Ratcliffe, M.J. (1 989). Generation of immunoglobulin heavy chah diversity subsequent to ce11 surface immunoglobulin expression in the avian bursa of Fabricius. J Exp bled 170, 1 165-1 173.

Ratcliffe, M.J. and Jacobsen, K.A. (1994). Rearrangement of immunoglobulin genes in chicken B ce11 development. Semin Immunol 6, 175- 184.

Ratcliffe, M. Jey Lassila, O., Pink, J.R., and Vainio, 0. (1 986). Avian B ce11 precunors: surface imrnunoglobuiin expression is an early, possibly bursa-independent event. Eur J Immunol 16, 129-133.

Ratcliffe, M.J. and Tkalec, L. (1990). Cross-linking of the surface immunoglobuiin on lymphocytes fiom the bursa of Fabricius results in second messenger generation. Eur J Immunol 20, 1073- 1078.

a Reynaud, C.A., Anquez, V., Dahan, A., and Weill, J.C. (1985). A single rearrangement event generates most of the chicken immunoglobulin light chah diversity. Ce11 40,283-29 1.

Reynaud, C.A., Anquez, V., Grimal, H., and Weill, J.C. (1987). A hyperconversion mechanism generates the chicken Iight chain preimmune repertoire. Ce11 48, 3 79- 3 88.

Reynaud, C.A., Dahan, A., Anquez, V., and Weill, J-C. (1989). Somatic hyperconversion diversifies the single Vh gene of the chicken with a high incidence in the D region. Ce11 59, 1 7 1 - 1 83.

Reynaud, C.A., Imhof, B.A., Anquez, V., and Weill, J.C. (1992). Emergence of cornmitted B lymphoid progenitors in the developing chicken embryo. EMS0 J 11,4349-4358.

Richardson, P. M. and Gilmore, T. D. v-Re1 is an inactive member of the Re1 family of transcriptional activating proteins. J Virol 65, 3 122-3 130. 199 1. (GENERIC) Ref Type: Generic

Roff, M., Thompson, J., Rodriguez, My S., Jacque, J. M., Baleux, F., Arenzana- Seisdedos, F., and ay, R. T. Role of IkB-a ubiquination in signal-induced activation of NF-K. in vivo. Journal of Biological Chemistry 271(13), 7844- 7850. 1996. (GENERIC) Ref Type: Generic

Romero, P. and Humphries, E.H. (1995). A mutant v-rel with increased ability to transfonn B lymphocytes. J Virol69,30 1-307.

Sachdev, S., Diehl, LA., McKinsey, T.A., Ham, A., and Hannink, M. (1997). A tkreshold nuclear level of the v-Re1 oncoprotein is required for transformation of avian lymphocytes. Oncogene 14,2585-2594.

Sarkar, S. and Gihore, T.D. (1993). Transformation by the vRel oncoprotein requires sequences carboxy- terminal to the Re1 homology domain. Oncogene 8, 2245- 2252.

Schmidt-Ullrich, R., Memet, S., Lilienbaum, A., Feuillard, J., Raphael, M., and Israel, A. (1996). NF-kappaB activity in transgenic rnice: developmental regulation and tissue specificity. Development 122,2 1 17-2 128.

Siebenlist, U., Franzoso, G., and Brown, K. c1994). Structure. regulation and function of NF-kappa B. Annu Rev Ce11 Bi01 10,405-455.

Smardovq J., Walker, A., Morrison, LE., Kabrun, N., and Enrietto, P.J. (1995). The role of the carboxy terminus of v-Re1 in transformation and activation of endogenous gene expression. Oncogene 10,20 1 7-2026.

Snapper, C.M., Zelazowski, P., Rosas, F.R., Kehry, M.R., Tian, M., Baltimore, D., and Sha, W.C. (1996). B cells fiom pSO/NF-kappa B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. 1 Immun01 156, 183- 19 1.

Theilen, G.H., Zeigel, R.F., and Twiehaus, M.J. (1966). Biological studies with RE virus (strain T) that induces reticuloendotheliosis in turkeys, chickens, and Japanese quail. J Nat1 Cancer Inst 3 7, 73 1-743.

Thompson, C.B. (1 995). Apoptosis in the pathogenesis and treatment of disease. Science 267, 1456-1462.

Thompson, C.B. and Neiman, P.E. (1987). Somatic diversification of the chicken immunoglobulin light chah gene is limited to the rearranged variable gene segment. Ce11 18,369-378.

Tonegawa, S. (1 983). Somatic generation of antibody- diversity. Nature 302: 575-58 1.

Tumang, J.R., Owyang? A., Andjelic, S., Jin, Z., Hardy, R.R., Liou, M.L., and Liou, H.C. (1998). c-Re1 is essential for B lymphocyte survival and cell cycle progression. E u J Immunol 28,429943 12.

Veromq T., Vainio, O., Eerola, E., and Toivanen, P. (1988). Monoclonal antibodies against chicken Bu-la and Bu-1 b alloantigens. Hybridoma 7,4 1-48.

Walker, A.K. and E ~ e n o , P.J. (1996). Analysis of the role of v-rel in transcnptional regulation of high mobility group 14. Oncogene 12,25 15-2525.

Weber, W.T. and Foglia, L.M. (1980). Evidence for the presence of precursor B cells in normal and in horrnonally bursectomized chick embryos. Ce11 Immunol 52, 84- 94.

Weih, F., Durham, S.K., Barton, D.S., Sha, W.C., Baltimore, D., and Bravo, R. (1996). Both multiorgan inflammation and myeloid hyperplasia in RelB-deficient mice are T ce11 dependent. J Immun01 157,3974-3979.

White, D. W. and Gilmore, T.D. (1 993). Temperature-sensitive transforming mutants of the v-rel oncogene. J Virol 67,6876-688 1.

White, D.W. and Giimore, T.D. (1996). Bcl-2 and CnnA have different effects on transformation, apoptosis and the stability of 1 kappa B-alpha in chicken spleen cells transformed by temperature-sensitive v-Re1 oncoproteins. Oncogene 13, 89 1-899.

White, D.W., Pitoc, G.A., and Gilmore, T.D. (1996). Interaction of the v-Re1 oncoprotein with NF-kappaB and IkappaB proteins: heterodimers of a transforrnation- defective v-Re1 mutant and NF02 are functional in vitro and in vivo. Mol Ce11 Bi01 16, 1169-1 178.

White, D.W., Roy, A., and Gihore, T.D. (1995). The v-Re1 oncoprotein blocks apoptosis and proteolysis of 1 kappa B- alpha in transfonned chicken spleen cells. Oncogene 1 O, 857-868.

Whiteside, S.T., Epinat, J-C., Rice, N.R., and Israel, A. (1 997). 1 kappa B epsilon, a novel member of the 1 kappa B family, controls R e m and cReI NF-kappa B activity. EMBO J 16, 1413-1426.

Wilhelmsen, K.C., EggIeton, K., and Temin, H.M. (1 984). Nucleic acid sequences of the oncogene v-rel in reticuloendotheliosis virus strain T and its cellular homolog, the proto-oncogene c-rel. J VU0152 , 172- 182.

Wulczyn, F.G., Krappmann, D., and Scheidereit, C. (1996). The NF-kappa B/Rel and 1 kappa B gene families: mediators of immune response and inflammation. J Mol Med 74, 749-769.

Xul N., Loflin, P., Chen, C.Y., and Shyu, A.B. (1998). A broader role for AU-rich elernent-mediated mRNA turnover revded by a new transcriptional pulse strategy. Nucleic Acids Res 26,558-565.

You, M., Ku, P.T., Ifrdlickova, R., and Bose, H.R.J. (1 997). ch-W1, a member of the inhibitor-of-apoptosis protein family, is a mediator of the antiapoptotic activity of the v-Re1 oncoprotein. Mol Ce11 Bi01 17, 7328-7341.

Zhang, J.Y., Olson. W., Ewert, D., Bargmann, W., and Bose, H.R.J. (1 991). The v-rel oncogene of avian reticuloendotheliosis virus transfonns immature and mature lymphoid cells of the B ce11 lineage in vitro. Virology 183,457-466.

Zong, W.X., Farrell, M., Bash, J., and Gelinas, C. (1997). v-Re1 prevents apoptosis in transformed lymphoid cells and blocks TNFalpha-induced ce11 death. Oncogene IS , 97 1-980.

Zurovec, M., Petrenko, O., Roll, R., and Enrietto, P.J. (1 998). A chicken c-Relsstrogen receptor chimeric protein shows conditional nuclear localization, DN.4 binding, transformation and transcriptional activation. Oncogene 16, 3 133-3 142.