Brc1-Mediated Rescue of Smc5/6 Deﬁciency: Requirement ... · checkpoint response can be restored to these cells by deletion ofHR genes (Verkadeetal. 1999; Ampatzidou et al. 2006;

Copyright � 2007 by the Genetics Society of AmericaDOI: 10.1534/genetics.106.067801

Brc1-Mediated Rescue of Smc5/6 Deficiency: Requirement forMultiple Nucleases and a Novel Rad18 Function

Karen M. Lee,* Suzanne Nizza,* Thomas Hayes,* Kirstin L. Bass,* Anja Irmisch,†

Johanne M. Murray† and Matthew J. O’Connell*,1

*Department of Oncological Sciences, Mount Sinai School of Medicine, New York, New York 10029 and†Genome Damage and Stability Centre, University of Sussex, Brighton BN1 9RQ, United Kingdom

Manuscript received November 3, 2006Accepted for publication January 24, 2007

ABSTRACT

Smc5/6 is a structural maintenance of chromosomes complex, related to the cohesin and condensincomplexes. Recent studies implicate Smc5/6 as being essential for homologous recombination. Each gene isessential, but hypomorphic alleles are defective in the repair of a diverse array of lesions. A particular allele ofsmc6 (smc6-74) is suppressed by overexpression of Brc1, a six-BRCT domain protein that is required for DNArepair during S-phase. This suppression requires the postreplication repair (PRR) protein Rhp18 and thestructure-specific endonucleases Slx1/4 and Mus81/Eme1. However, we show here that the contribution ofRhp18 is via a novel pathway that is independent of PCNA ubiquitination and PRR. Moreover, we identifyExo1 as an additional nuclease required for Brc1-mediated suppression of smc6-74, independent ofmismatch repair. Further, the Apn2 endonuclease is required for the viability of smc6 mutants withoutextrinsic DNA damage, although this is not due to a defect in base excision repair. Several nucleotideexcision repair genes are similarly shown to ensure viability of smc6 mutants. The requirement for excisionfactors for the viability of smc6 mutants is consistent with an inability to respond to spontaneous lesions bySmc5/6-dependent recombination.

EUKARYOTIC cells contain three highly conservedmulti-protein complexes that contain hetero-

dimers of large ATPases known as the structural main-tenance of chromosomes (SMC) proteins (Harvey et al.2002). These complexes are critical for chromosomeintegrity in interphase and for chromosome segregationat mitosis (Hirano 2006). The cohesin complex is es-sential for sister-chromatid cohesion. In its absence, thelack of cohesion manifests as an inability to repairdouble-stranded DNA breaks (DSBs) by homologousrecombination (HR) in the G2 phase of the cell cycle(Birkenbihl and Subramani 1992; Tatebayashi et al.1998; Nagao et al. 2004). In the absence of DSBs, thelack ofcohesionmanifests as chromosomesegregation de-fects inmitosis(Hirano2006).Thecondensincomplexes,together with type II topoisomerases, are required formitotic chromosome condensation. Without condensin,chromosomes are too disorganized to segregate intodaughter cells at mitosis. However, genetic studies impli-catecondensin asalso playing a role inDNA repair duringG2 by an as yet undefined mechanism (Aono et al. 2002).

The function of these complexes in sister-chromatidcohesion and chromosome condensation was readilyinferred from yeast mutants and depletion experimentsin Xenopus oocyte extracts. Unfortunately, this has not

been the case for the third SMC complex, currentlyknown as Smc5/6. This complex contains at least sixstoichiometric subunits: Smc5 and -6, and four non-SMC elements, Nse1–4 (Hazbun et al. 2003; Sergeant

et al. 2005). Genes for each of these subunits are essen-tial, as is a substoichiometric factor, Rad60 (Morishita

et al. 2002). Two recently identified additional membersof the complex, Nse5 and Nse6, are not essential forviability although they are required for DNA repair(Pebernard et al. 2006).

The Smc5/6 complex was initially defined by ahypomorphic allele of smc6 in the fission yeast Schizosac-charomyces pombe. Initially known as rad18-X, and subse-quently renamed smc6-X, this mutation resulted in DNArepair defects that by epistasis analysis were attributed toan HR defect (Lehmann et al. 1995). An additional allele,smc6-74, was identified by virtue of DNA damage check-point maintenance defects (Verkade et al. 1999). How-ever, smc6-74 cells are proficient in the initiation of a DNAdamage checkpoint response as determined by activationof the Chk1 protein kinase (Harvey et al. 2004), which isboth necessary and sufficient to signal G2 arrest inresponse to DNA damage (den Elzen and O’Connell

2004; Latif et al. 2004). Like classical checkpoint mu-tants, irradiated smc6-74 cells enter mitosis withoutcompleting the repair of DSBs, but unlike checkpointmutants, an enforced delay to mitosis does not rescuetheir sensitivity to DNA damage. The recruitment of HRproteins to lesions is normal in smc6-74 mutants, and a

1Corresponding author: Department of Oncological Sciences, MountSinai School of Medicine, 1 Gustave L. Levy Place, Box 1130, New York,NY 10029. E-mail: [email protected]

Genetics 175: 1585–1595 (April 2007)

checkpoint response can be restored to these cells bydeletion of HR genes (Verkade et al. 1999; Ampatzidou

et al. 2006; Miyabe et al. 2006). Together, these observa-tions are consistent with the model that the smc6-74mutation defines a role for the Smc5/6 complex late inrecombination and that the checkpoint machinery isunable to detect a defect in this to prevent mitotic entrywith unresolved lesions still present in the chromosomes.Understanding this defect will be important both indefining Smc5/6 function and in understanding howthe checkpoint signal is terminated.

Brc1 is a six-BRCT domain protein that is required forthe repair of a variety of lesions during S-phase, but notduring G2 (Sheedy et al. 2005). It was identified as anallele-specific high-copy suppressor of smc6-74; modestoverexpression of Brc1 completely rescues the sensitivityof smc6-74 to DNA damage in both S- and G2-phases. brc1is not an essential gene, but it is essential for the viabil-ity of strains with compromised Smc5/6 function(Verkade et al. 1999; Sheedy et al. 2005). There is noevidence that Brc1 physically associates with the Smc5/6complex, and so this suppression is likely to be afunctional bypass that enables cells to repair lesions thatresult from Smc5/6 dysfunction.

We have used this suppression of smc6-74 by Brc1 as anassay to determine which factors are required for thisresponse and as a means to define the nature of the repairand checkpoint maintenance defect in smc6-74 (Sheedy

et al. 2005). Initially, we studied components of check-point control, HR, nucleotide excision repair (NER), andpostreplication repair (PRR). In response to alkylationdamage by high doses of methyl methanesulfonate(MMS), Brc1-mediated suppression of smc6-74 requiredPRR lesion bypass promoted by the Rad18 homologRhp18. This tolerance mechanism enables completionof replication and passage into G2 but not DNA repair. Inresponse to lesions in G2 cells, Brc1-mediated suppressionof smc6-74 relied upon the HR pathway and two structure-specific nucleases implicated in the recombination-dependent restart of stalled replication: Slx1/4 and Mus81/Eme1. Further, deletion of slx1, which by itself results inlittle phenotype, abolished the residual MMS resistanceof smc6-74 cells. These data led to the model that DNAstructures, which are not sensed by the checkpoint, ac-cumulate in smc6-74, and hence cells enter mitosis withouttheir repair. However, such lesions, in a Brc1-dependentmanner, can be processed by the nucleases into alterna-tive structures that both signal a checkpoint and can berepaired by HR even though Smc5/6 function isattenuated. Recently, Smc5/6 was shown to be essentialfor repair at collapsed replication forks (Ampatzidou

et al. 2006). The combined roles for Smc5/6 in repairand checkpoint maintenance at these and other spon-taneous lesions are a likely explanation as to why Smc5/6genes are essential for viability, while HR genes are not.

These studies left open several unanswered questions.Under the assay conditions used, Rhp18 and lesion bypass

were required for Brc1-mediated suppression of lesionsin S-phase, which predicted that this response would actvia mono-ubiqutination of proliferating cell nuclearantigen (PCNA) on lysine-164 (K164), although thishad not been shown. Rhp18 is also required for thesuppression of ultraviolet-C (UV-C, 254 nm) sensitivityduring G2, where lesion bypass should be irrelevant.Further, base excision repair (BER) and mismatch repair(MMR) needed to be considered as alternative mecha-nisms to reverse lesions in these assays. Finally, as Smc5/6mutants are predicted to be defective in HR, they shouldhave a heightened requirement for excision pathways totolerate lesions, although we had tested this with only onegene involved in NER, the XP-G homolog rad13.

Here we address the following issues. We show that therequirement for Rhp18 in this context defines a novelRhp18 function that is independent of lesion bypass andPCNA ubiquitination. Moreover, we identify additionalnucleases, Apn2 and Exo1, as being required for therepair of spontaneous and induced lesions in smc6-74cells. Finally, we show that NER genes are indeed criticalto the full viability of smc6-74, suggesting some redun-dancy for XP-G function in S. pombe. The requirementfor several different nucleases suggests that differenttypes of lesions accumulate in smc6-74, and we speculatethat Brc1 may facilitate the cleavage of these structuresby the nucleases and subsequent processing into HR.

MATERIALS AND METHODS

Fission yeast genetic methods: All strains used werederivatives of 972h� and 975h1. Standard procedures andmedia were used for propagation and genetic manipulation(Moreno et al. 1991). Methods for UV-C and MMS survivalassays and transformation have been described previously(O’Connell et al. 1997; Verkade et al. 1999, 2001; den Elzen

and O’Connell 2004; Harvey et al. 2004). Table 1 shows a listof strains used in this study. Methods for Brc1-mediatedsuppression of smc6-74 were as described (Sheedy et al.2005). For these assays, expression from the attenuated(pRep41) promoter (referred to as pBrc1) under repressingconditions (5 mm thiamine) was used and compared tocontrols containing pRep41 only (referred to as a vector).For suppression of MMS sensitivity, cultures were grown to4 3 106 cells/ml, and 5 ml of 10-fold serial dilutions werespotted onto plates containing a range of MMS doses. Forsuppression of UV-C sensitivity, plates were inoculated intriplicate with 100, 1000, or 10,000 cells, irradiated with0–250 J/m2 of UV-C (254 nm) using a Stratalinker (Stratagene,La Jolla, CA), and colonies left to form for 4 days at 30�. Datawere normalized to unirradiated controls.

Construction of the RING domain mutant rhp18-1: Using agenomic clone of rhp18 (Verkade et al. 2001), codons forcysteine 44, serine 45, and histidine 46, at positions 3 and 4 ofthe cross-brace of the RING domain, were mutated to serine,glycine, and alanine, respectively, using the method of Kunkel(Kunkel et al. 1987) and the oligonucleotide 59-CGCGCCCCCTTAATTACTTCTTCCGGAGCCACCTTTTGTTCGTTTTGTAT (mutated residues are underlined). The mutatedclone was then integrated back into the rhp18 locus byreplacement of the ura4 marker in an rhp18Tura4 strain.Correct integration was confirmed by Southern blotting, andstrains were backcrossed prior to analysis.

1586 K. M. Lee et al.

Analysis of PCNA ubiquitination: Ubiqutination of PCNAwas detected by Western blotting using polyclonal anti-PCNAantisera as described (Frampton et al. 2006). Note that thisantiserum detects a nonspecific band that comigrates with di-ubiquitinated PCNA. Extracts were prepared from untreatedexponential cultures, or cells were treated with 50 J/m2 with a30-min recovery or with 0.01% MMS for 3 hr.

Fluctuation rate analysis of mutation rate: Rates of mutationin can1 were calculated using the method of the median aspreviously described (Fraser et al. 2003) from 11 independentcultures per treatment, with mutants selected on supplementedEMM2 medium containing 60 mg/ml canavanine. UV-C-induced mutagenesis was performed in cells irradiated with100 J/m2. MMS-induced mutagenesis was performed on cellstreated with 0.05% MMS for 60 min, with MMS then inactivatedwith 5% sodium thiosulfate; each condition was chosen to give�50% survival for rhp18 alleles (Sheedy et al. 2005).

RESULTS

Brc1 suppresses smc6-74 via a novel PRR pathway:The DNA damage sensitivity of the S. pombe smc6 hypo-morphic allele smc6-74 is efficiently suppressed by over-expression of Brc1. We have previously shown that thissuppression was reliant on the Rad18 homolog, Rhp18,but was independent of Ubc13 (Sheedy et al. 2005).On the basis of the current models of PRR (Prakash

et al. 2004; Friedberg 2005), these observations predictedthat lesion bypass, but not template switching, was pro-moted by Brc1 and thus should be dependent on mono-ubiquitination of PCNA by Rhp18 and its E2 partner,Rhp6. S. pombe strains deleted for rhp6 show very poorviability and are infertile (Reynolds et al. 1990). However,

TABLE 1

Strains used in this study

Genotype Source

leu1-32, ura4-D18, ade6-704 h� O’Connell et al. (1997)smc6-74 leu1-32, ura4-D18, ade6-704 h� Verkade et al. (1999)rhp18Tura4 leu1-32, ura4-D18, ade6-704 h� Verkade et al. (2001)rhp18-40 leu1-32, ura4-D18, ade6-704 h� Verkade et al. (2001)rhp18-1 leu1-32, ura4-D18, ade6-704 h� This studysmc6-74 rhp18Tura4 leu1-32, ura4-D18, ade6-704 h� Sheedy et al. (2005)smc6-74 rhp18-40 leu1-32, ura4-D18, ade6-704 h� This studysmc6-74 rhp18-1 leu1-32, ura4-D18, ade6-704 h� This studybrc1Tura4 ura4-D18 leu1-32 ade6� h1 Verkade et al. (1999)pcn1-K164RTura4 leu1-32 ura4-D18 ade6-704 h� Frampton et al. (2006)pcn1-K164RTura4 smc6-74 leu1-32 ura4-D18 ade6-704 This studypcn1-K164RTura4 brc1Tura4 leu1-32 ura4-D18 ade6-704 This studyeso1TkanMx6 rev3ThphMx6 dinBTbleMx6 ura4-D18 leu1-32 ade6� Sheedy et al. (2005)smc6-74 eso1TkanMx6 rev3ThphMx6 dinBTbleMx6

ura4-D18 leu1-32 ade6�Sheedy et al. (2005)

mag1Tura4 ura4-D18 leu1-32 ade6-704 h1 Alseth et al. (2005)mag1Tura4 smc6-74 ura4-D18 leu1-32 ade6-704 This studymag1Tura4 brc1Tura4 ura4-D18 leu1-32 ade6� This studynth1Tura4 ura4-D18 leu1-32 arg3-D1 his3-D1 h1 Alseth et al. 2005)nth1Tura4 smc6-74 ura4-D18 leu1-32 arg3-D1 his3-D1 This studynth1Tura4 brc1Tura4 ura4-D18 leu1-32 ade6� This studyapn2TkanMX4 ura4-D18 leu1-32 his3-D1 h� Alseth et al. (2005)apn2TkanMX4 brc1Tura4 ura4-D18 leu1-32 ade6� This studyrad2TLEU2 ura4-D18 leu1-32 his3-D1 h� Alseth et al. (2005)rad2TLEU2 brc1Tura4 ura4-D18 leu1-32 ade6� This studymsh2This3 his3-D1 h� Rudolph et al. (1998)msh2This3 brc1Tura4 ura4-D18 his3-D1 leu1-32 ade6� This studypms1Tura4 ura4-D18 h� Rudolph et al. (1998)pms1Tura4 smc6-74 ura4-D18 leu1-32 ade6� This studypms1Tura4 brc1Tura4 ura4-D18 leu1-32 ade6� This studyexo1Tura4 ura4-D18 leu1-32 h� Rudolph et al. (1998)exo1Tura4 brc1Tura4 ura4-D18 leu1-32 h� This studyexo1Tura4 smc6-74 ura4-D18 leu1-32 h� This studyrhp41Tura4 ura4-D18 leu1-32 h1 Marti et al. (2003)rhp14TkanMX leu1-32 ura4-D18 ade6-704 h� Hohl et al. (2001)rhp14TkanMX brc1Tura4 leu1-32 ura4-D18 ade6-704 This studyswi10TkanMX6 leu1-32 ura4-D18 ade6-704 h� Rodel et al. (1992)swi10TkanMX6 brc1Tura4 ura4-D18 This study

Genotypes of parental strains are shown. Strains with different auxotrophic markers and/or containing plasmids were derived from these.

DNA Repair in Smc6 Mutants 1587

we have previously reported an allele of rhp18, rhp18-40,which encodes a truncated protein that lacks the Rhp6-binding domain (Verkade et al. 2001). We therefore usedthis allele to test the hypothesis that Brc1-mediatedsuppression of smc6-74 was via Rhp18/Rhp6-catalyzedubiqutination.

While rhp18D smc6-74 strains showed no rescue of MMSor UV-C sensitivity by Brc1 overexpression (Figure 1, Aand C; Sheedy et al. 2005), rhp18-40 smc6-74 were indeedproficient for suppression at lower concentrations ofMMS (0.0025%, Figure 1A). At higher concentrations,both strains failed to be rescued by Brc1. Considerablesuppression of the UV-C sensitivity of rhp18-40 smc6-74was also seen upon overexpression of Brc1 (Figure 1D).These data suggested that the lack of suppression inrhp18D smc6-74 strains was due to an Rhp6-independentfunction of Rhp18.

It was formally possible that, in these assays, Rhp18 wasstill acting as an E3 ubiquitin ligase, although utilizinganother E2 enzyme. To test this hypothesis, we mutatedconserved cysteine residues within the Rhp18 RINGdomain. This allele, rhp18-1, showed a similar level ofsensitivity to DNA-damaging agents such as rhp18D andrhp18-40. When combined with smc6-74, rhp18-1 behavedessentially the same as rhp18-40 (Figure 1, A and E). Eachallele of rhp18 increased the MMS and UV-C sensitivityof smc6-74 and the MMS sensitivity of brc1D (Figure 1,A–E; data not shown). We conclude that Rhp18 has anE3-independent function and that this function isrequired for Brc1 to suppress smc6-74.

Lysine 164 (K164) on PCNA is the best-characterizedsite for Rhp18-catalyzed ubiquitination (Matunis 2002;

Lehmann 2006; Watts 2006). We considered that inthe rhp18-1 and -40 strains, another ubiquitin ligasemight compensate for Rhp18. To test this, we assayedBrc1-mediated suppression in a background whereK164 of PCNA had been mutated to arginine (pcn1-K164R). While this mutation significantly enhancedthe MMS and UV-C sensitivity of smc6-74, this was readilysuppressed by Brc1 overexpression for UV-C and atlower (,0.005%), but not higher ($0.005%), MMSconcentrations (Figure 2, A and B). Further, we con-firmed that each allele of rhp18 was defective in PCNAubiqutination (Figure 2C), and thus PCNA ubiqutina-tion is not required for Brc1-mediated suppression ofsmc6-74.

We had previously shown that translesion synthesispolymerases were required for Brc1 to suppress theMMS (but not UV-C) sensitivity of smc6-74, but this wasonly observed at relatively high doses (0.005–0.01%)and also required the triple deletion of polymerasesh, k, and z (Sheedy et al. 2005). We therefore retestedsuppression at lower levels (0.001–0.002%) of MMS andindeed found that the triple polymerase deletion(3TLSD) was unaffected for suppression of smc6-74,although the quadruple mutant had significantly en-hanced MMS sensitivity (Figure 2A). Such enhancementof MMS sensitivity was also observed when the 3TLSD

mutants (Sheedy et al. 2005) or pcn1-K164R (supplemen-tal material at http://www.genetics.org/supplemental/)were combined with brc1D.

Lesion bypass is error prone and leads to mutagenicDNA replication. We confirmed that both rhp18-1 andrhp18-40 are indeed defective in MMS- and UV-C-induced

Figure 1.—Brc1-mediatedsuppression of smc6-74 is inde-pendent of Rhp6 bindingand the RING domainof Rhp18. (A) The indicatedstrains were transformed withvector (V) or pBrc1 (B) andgrown to 4 3 106 cells/ml,and 5 ml of 10-fold serial dilu-tions were assayed at a rangeof MMS doses. Shown arecontrol (0% MMS), 0.0025%MMS, and 0.005% MMS.(B) Plates with lower concen-trations of MMS are shownfor rhp18D strains. Plates werephotographed after 4 days at30�. (C) Epistasis analysis ofMMS sensitivity between brc1Dand alleles of rhp18. Refer toA for sensitivity of rhp18 al-leles. UV-C survival data arenormalized to unirradiatedcontrols for rhp18-40 (D)and rhp18-1 (E). Open trian-gles move to the level of sur-vival of open circles withsuppression.


mutagenesis that is a byproduct of lesion bypass. Influctuation tests for canavanine resistance caused bymutations in can1, wild-type cells showed a 7.7-foldinduction of mutation rate by MMS treatment (6.7 3

10�6) and a 18.4-fold increase by UV-C irradiation (1.6 3

10�5) compared to untreated cells (8.7 3 10�7). rhp18-1and rhp18-40 showed �4-fold higher rates of spontane-ous can1 mutations (3.7 3 10�6 and 3.4 3 10�6, re-spectively). This is consistent with data for Saccharomycescerevisiae rad18D, which shows a 4.6-fold increase (Stelter

and Ulrich 2003). MMS treatment increased this only2.2-fold for rhp18-1 (8.3 3 10�6) and 1.5-fold for rhp18-40(5.2 3 10�6). Similarly, UV-C irradiation increased can1mutation rates only 1.9-fold for rhp18-1 (7.2 3 10�6) and2.9-fold for rhp18-40 (1.0 3 10�5).

Combined, these data show that under high levelsof alkylation damage, Rhp18-mediated lesion bypass viaPCNA and the translesion synthesis polymerases arerequired for Brc1 to suppress lethality in smc6-74 cellsand for MMS resistance in brc1D and smc6-74 cells. Thistolerance mechanism allows for completion of DNAreplication and for subsequent repair. Our previousfindings strongly implicate that HR is ultimately requiredfor DNA repair in this context (Sheedy et al. 2005).

At lower doses of MMS, lesion bypass and PCNA ubi-quitination are not required for Brc1 to suppress smc6-74.

This pathway of repair is independent of the Rhp6-binding and RING domains of Rhp18 and thus definesa novel function for Rhp18 in smc6-74 cells. We note thatthe pcn1-K164R mutation confers greater MMS sensitivitythan does the 3TLSD strain and that pcn1-K164R cells aresensitive to UV-C irradiation in G2, whereas 3TLSD cellsare not (Frampton et al. 2006). We also note that therequirement for Rhp18 extends to the repair of lesionsin cells irradiated in G2 (Verkade et al. 2001). Therefore,this cryptic function for Rhp18 uncovered by the Brc1-mediated suppression of smc6-74 is unlikely to be relatedto its tolerance function to promote the bypass lesionsduring DNA replication.

AP endonuclease Apn2 is critical for survival ofsmc6-74: BER is a predominant pathway in the responseto DNA alkylation in most eukaryotes (Marti et al. 2002).In S. pombe, however, cells lacking the mag1-encodedDNA glycosylase that initiates the BER response to DNAalkylation show wild-type sensitivity to alkylating agentssuch as MMS, and genetic data implicate both NER andHR as options to repair alkylation damage (Memisoglu

and Samson 2000; Alseth et al. 2004, 2005; Sugimoto

et al. 2005). With the HR defects in smc6-74 mutants, wedecided to investigate the contribution of BER to boththe residual MMS resistance of smc6-74 and the suppres-sion of MMS sensitivity by Brc1 overexpression.

Figure 2.—PCNA modifica-tion on K164 is not requiredfor Brc1-mediated suppressionof smc6-74. (A) Strains contain-ing a lysine-to-arginine muta-tion at residue 164 of PCNA(pcn1-K164R) or lacking poly-merases h, z, and k (encodedby eso1, rev3 and dinB, 3TLSD)alone or in combination withsmc6-74 containing eitherempty vector (V) or pBrc1(B) were assayed for MMS sen-sitivity as described in Figure 1.In each case a range of MMSconcentrations was assayed.Control (0% MMS), 0.002%MMS, and 0.005% MMS areshown. Double mutants withsmc6-74 were suppressed on0.002% MMS. (B) UV-C sur-vival data for the indicatedstrains show effective suppres-sion of pcn1-K164R smc6-74 bypBrc1. (C) Ubiquitination ofPCNA on K164 was assayedby Western blotting with poly-clonal anti-PCNA antibodies.Ubiquitination of PCNA is en-hanced by treatment withMMS or UV-C, but is absentin the rhp18 mutants. Notethat a nonspecific band of�47 kDa comigrates with di-ubiquinted PCNA.


Currently there are four genes known to function inBER in S. pombe: mag1, nth1, apn2, and rad2 (Fen1homolog), although rad2 is also required for otherrepair pathways (Lieber 1997). Mag1 converts alkylatedbases to abasic (AP) sites, which can then be repaired byeither short- or long-patch BER. Short-patch BERinvolves cleavage 39 to the AP site by the AP lyase,Nth1. This lesion is further processed by a 59 cleavage bythe AP endonuclease Apn2, and the resulting gapis filled by replication. In long-patch BER, Apn2 cleaves59 to the AP site, and the Rad2 flap endonuclease cleavesa further 39 to leave a longer gap that is also filled byreplication. HR and NER can also repair alkylated basesnot processed by Mag1 or intermediates in the Mag1pathway. Deletion of mag1 reduces the MMS sensitivityof HR mutants as cells are unable to commit to BER andtherefore do not rely on HR to repair cleavage products(Alseth et al. 2005).

We constructed double mutants between smc6-74 andmag1D and between nth1D and apn2D. rad2D has pre-viously been shown to be epistatic with smc6-74 for MMSsensitivity. Although mag1D rescues the MMS sensitivityof HR mutants, mag1D smc6-74 strains were slightly moresensitive to MMS, although this was efficiently rescued byBrc1 overexpression (Figure 3). nth1D smc6-74 mutantswere significantly more sensitive to MMS than eitherparent, although in this context nth1 was not requiredfor Brc1-mediated suppression of smc6-74. However,apn2D smc6-74 mutants formed microcolonies of highlyaberrant cells that could not be propagated. An identicalphenotype was observed in apn2D smc6-X double mu-tants (data not shown), and so was not allele specific.This synthetic lethality could be due to two possiblescenarios. First, Apn2 may have a function outside ofthe BER pathway. Second, Mag1-dependent commit-

ment to Apn2-dependent long-patch BER in smc6-74may need to be completed by replication rather than byshunting of cleavage products into an HR- or NER-dependent pathway. However, as Rad2 is required forlong-patch BER and rad2D smc6-74 cells are fully viable,the former is the most likely explanation. In keepingwith this, from 30 dissected tetrads no viable mag1D

apn2D smc6-74 colonies were obtained in a cross ofmag1D smc6-74 3 apn2D (data not shown).

We also investigated the relationship between brc1D

and null alleles of the BER genes (Figure 4). As seenwith HR mutants, mag1D brc1D cells were less sensitiveto MMS than the brc1D parent (mag1D is not MMSsensitive). Conversely, apn2D, nth1D, and rad2D increasedthe MMS sensitivity of brc1D. These data suggest thatBER is important for the residual MMS resistance inbrc1D cells, most likely due to a defect in recombination,as brc1D is epistatic to rhp51D (Sheedy et al. 2005).

Exo1 is required for Brc1-mediated suppression ofsmc6-74: MMR is another excision-based pathway that isessential in genome integrity for removing mismatchednucleotides that arise from replication errors or chemicalmodification (Marti et al. 2002). In Escherichia coli, MutSrecognizes the mismatch and then together with MutLactivates the MutH endonuclease. S. pombe, like manyother eukaryotes, contains multiple MutS and MutLhomologs, but lacks a gene with homology to MutH.The 59–39 exonuclease and endonuclease Exo1 is thoughtto substitute for MutH in MMR (Tran et al. 2004). Weconstructed double mutants between smc6-74 and nullalleles for the major MutS (msh2) and MutL (pms1) homo-logs. Neither msh2D nor pms1D strains were significantlysensitive to MMS, nor did they enhance the MMS sensi-tivity of smc6-74 (Table 2). Moreover, neither gene wasrequired for Brc1-mediated suppression of smc6-74 or

Figure 3.—Synthetic lethality of smc6-74 withapn2D but not other BER mutants. mag1 (A)and nth1 (B) are not required for Brc1-mediatedsuppression of smc6-74 for MMS sensitivity. Ineach case, a range of MMS concentrations was as-sayed as described in Figure 1. Cells contain ei-ther vector (V) or pBrc1 (B). (C) Severesynthetic growth defect of apn2D smc6-74. Tetradswere dissected and grown on yeast extract plussupplements (YES) for 4 days at 30�; squares in-dicate double mutants.


enhanced the MMS sensitivity of brc1D (supplementalmaterial at http://www.genetics.org/supplemental/).These data suggest that mismatch repair is not requiredwhen Smc5/6 function is compromised or when Brc1is absent.

In addition to its role in mismatch repair, Exo1 isrequired for processing of DSBs in S. pombe (Tomita

et al. 2003), and in S. cerevisiae Exo1 has been shown tohave an overlapping function with the Mre11–Rad50–Xrs2 complex for resection of a DSB for HR (Tsubouchi

and Ogawa 2000; Llorente and Symington 2004). Ithas also been shown to process stalled replication forks(Cotta-Ramusino et al. 2005). Deletion of exo1 resultedin only a minor increase in MMS sensitivity, but, whencombined with smc6-74, resulted in a substantial en-hancement of MMS sensitivity (Figure 5A). Importantly,this was not rescued by Brc1 overexpression on plateswith .0002% MMS. Similarly, exo1D significantly en-hanced the MMS sensitivity of brc1D cells (supplementalmaterial at http://www.genetics.org/supplemental/).Together, these data suggest that Brc1 and Exo1 haveoverlapping and nonoverlapping roles.

We also investigated whether Exo1 was required forBrc1 to suppress the UV-C sensitivity of smc6-74 (Figure5B). exo1D cells were only modestly sensitive to high dosesof UV-C, but when exo1D was combined with smc6-74, thedouble mutant had an enhanced UV-C sensitivity com-pared to that of the smc6-74 parent. However, the doublemutant was not rescued by Brc1 overexpression. Thus,Exo1 is another nuclease that becomes essential for therepair of lesions when Smc5/6 function is compromised.

Mutations in NER genes cause synthetic growthdefects with smc6-74: Previous studies have investigatedthe relationship among Smc6, Brc1, and only one factorin NER, the rad13-encoded XPG nuclease (Lehmann

et al. 1995; Sheedy et al. 2005). XPG nucleases removethe flap generated by the NER-dependent synthesis atsites of UV-induced lesions such as cyclobutane dimers

Figure 4.—Epistasis of the MMS sensitivity of brc1D withBER mutants. Plate assays of MMS sensitivity of brc1D com-bined with (A) mag1D and nth1D; (B) apn2D and rad2D. Con-trol (0% MMS) and a range of MMS concentrations areshown. mag1D brc1D (A) shows reduced sensitivity comparedto the brc1D parent. nth1D brc1D (A), apn2D brc1D, and apn2Dbrc1D (B) synergize for MMS sensitivity, but the double mu-tants grow as wild-type cells on the control plate.

TABLE 2

Interactions of smc6 and brc1 with excision repair genes

Pathway GeneS. cerevisiaehomolog smc6-74a brc1Da

Brc1 supp ofsmc6-74

BER mag1 MAG1 Not epistaticb Partial rescuec Yesb

nth1 NTH1 Not epistaticb Not epistaticc Yesb

apn2 APN2 SLb Not epistaticc NArad2 RAD27 Epistaticd Not epistaticc NA

MMR msh2 MSH2 NAe NAe Yese

pms1 PMS1 NAe NAe Yese

exo1 EXO1 Not epistaticf Not epistatice Nof

NER rhp41 RAD4 SGDg ND NArhp14 RAD14 SGDg Not epistatice NAswi10 RAD10 SGDg Not epistatice NArad13 RAD2 Not epistaticd Not epistatich Yesh

SL, synthetic lethal; SGD, synthetic growth defect; ND, not determined; NA, notapplicable.

a Phenotype in combination with smc6-74 (for MMS and UV-C) or brc1D (for MMS).b See Figure 3.c See Figure 4.d From Lehmann et al. (1995).e Supplemental figures (http://www.genetics.org/supplemental/).f See Figure 5.g See Figure 6.h From Sheedy et al. (2005).


and 6-4 photoproducts. rad13D enhances the DNAdamage sensitivity of smc6-74, although it is not requiredfor Brc1 to suppress this. As members of other excisionpathways are required for either Brc1-mediated sup-pression of smc6-74 or, indeed, viability of this mutant,we considered whether there may be some redundancyfor Rad13 function. We constructed double mutantsbetween smc6-74 and null alleles for the NER genesswi10 (ERCC1/XPF/RAD10 homolog; Hang et al.1996), rhp41 (XPC/RAD4; Marti et al. 2003), andrhp14 (XPA/RAD14; Hohl et al. 2001), involved in 59

incision (swi10) and lesion recognition (rhp41, rhp14).In each case, the growth of doubles was inhibited,particularly with swi10D smc6-74 and rhp41D smc6-74strains (Figure 6). In each case, spontaneous suppressorsof this slow growth arose, which made interpretation ofsmc6-74 epistasis studies and Brc1-mediated suppressionunfeasible. Nevertheless, these observations do indeedshow that NER becomes more important for process-ing of spontaneous lesions when Smc5/6 function iscompromised, most likely as recombinational repair is

significantly attenuated in this circumstance. Not sur-prisingly, therefore, these mutations also enhanced theMMS sensitivity of brc1D (Table 2; supplemental mate-rial at http://www.genetics.org/supplemental/).

DISCUSSION

The Smc5/6 complex is a key determinant of genomeintegrity. Since it is structurally related to cohesin andcondensin, it is reasonable to hypothesize that the com-plex plays a fundamental role in chromosome organiza-tion and that the dysfunctional response to DNA damageis a consequence of this. Brc1 serves to activate a pathwaythat can bypass defects in Smc5/6 mutants and is re-quired for viability when Smc5/6 function is compro-mised. The experiments described in this article extendour previously published studies and provide four keyfindings. First, Rhp18 has a function that is independentof Rhp6, its RING domain (and therefore E3 ligaseactivity), and of PCNA ubiqutination and lesion bypass.This can be seen by the requirement of Rhp18 for Brc1 tosuppress the sensitivity of smc6-74 to lower doses ofalkylation damage and to UV-C irradiation in G2. Second,the AP endonuclease Apn2 is critical for the survival ofsmc6 mutants, and this is independent of its role in BER.Exo1 is another nuclease required for Brc1 to suppressthe MMS and UV-C sensitivity of smc6-74, although theexo1 null mutant itself is only slightly sensitive to theseagents. Finally, Swi10 (XPF/RAD10) is yet anothernuclease required for the viability of smc6-74, as are othercomponents of the NER pathway.

Homologs of Rad18, such as S. pombe rhp18, areinvolved in the tolerance of lesions that impede DNA rep-lication. To this end, Rad18 proteins mono-ubiquitinatePCNA, and this promotes the recruitment of the trans-lesion polymerases to replicate beyond the lesion, some-times in an error-prone manner (Friedberg 2005).However, S. pombe rhp18D strains synchronized at variouspoints of the cell cycle are sensitive to DNA-damaging

Figure 6.—Synthetic growth defects of smc6-74 with theNER mutants swi10D, rhp41D, and rhp14D. Tetrads were dis-sected and grown on YES for 4 days at 30�; squares indicatedouble mutants.

Figure 5.—Exo1 nuclease is required for Brc1-mediatedsuppression of the MMS sensitivity of smc6-74. Survival assayswere carried out as described in Figure 1. Cells contain eithervector (V) or pBrc1 (B). Note no suppression and enhancedsensitivity of the exo1D smc6-74 double mutant for concentra-tions of MMS .0.002% (A), and no suppression of the UV-Csensitivity of the exo1D smc6-74 double mutant (B).


agents (Verkade et al. 2001), suggesting roles for Rhp18outside the realm of DNA replication. This observationwas corroborated by the finding that, while Rhp18 wasrequired for Brc1 to suppress the UV-C sensitivity ofG2 smc6-74 cells, the translesion polymerases were not.Here, we have shown that the bypass synthesis indepen-dent function for Rhp18 is not related to its E3 ubiquitinligase activity. Recent studies have implicated Rad18 inHR in avian DT40 cells (Szuts et al. 2006), and as HR isrequired for Brc1 to suppress smc6-74 (Sheedy et al.2005), we speculate that this may be a relevant functionfor Rhp18 in our experiments. Thus, the current modelsof DNA damage tolerance are perhaps incomplete. Wealso note that the pcn1-K164R mutation confers greatersensitivity to UV-C and MMS than the 3TLSD strain. Thus,either there are additional bypass polymerases in S. pombeor modification of K164 on PCNA promotes additionalrepair or tolerance functions. Further, it is pertinent tonote that the pcn1-K164R sensitivity to UV-C irradiationwas assayed in G2 cultures, and it was recently shownthat PCNA is mono-ubiquitinated in S. pombe in G2, evenfollowing ionizing radiation (Frampton et al. 2006). Thus,the ubiquitination of PCNA in G2 may define a functionthat is not related to lesion bypass, further highlightingthe need to refine models for Rad18 function.

Deletion of apn2, which encodes the major APendonuclease in S. pombe, is synthetic lethal with smc6-74 and smc6-X. In principle, this effect could be via theAP endonuclease activity of Apn2, although it is notclear why smc6 mutants should accumulate more AP sitesthan wild-type cells, nor did we see such an effect withother BER mutants. Apn2 is a member of the exo-nuclease III family, which displays the additional activi-ties of a 39–59 exonuclease, 39-phosphodiesterase, and39-phosphatase (Unk et al. 2001; Boiteux and Guillet

2004). Therefore, another possible function for Apn2 inthis context is the processing of 39-blocked ends toenable repair synthesis. In budding yeast, the Rad1-Rad10 nuclease (also known as ERCC1-XPF) has alsobeen shown to process 39-blocked ends (Guzder et al.2004), as has the Mus81/Mms4 39-flap endonuclease(Boiteux and Guillet 2004). The S. pombe homologs,Rad16-Swi10, and Mus81/Eme1 also show strong ge-netic interactions with smc6 alleles; swi10D smc6-74double mutants showed a strong synthetic growth defect(Figure 3), and mus81D smc6-74 double mutants arepoorly rescued by Brc1 overexpression (Sheedy et al.2005). These data suggest that 39-blocked ends may beone structure that accumulates in smc6 mutants duringincomplete HR, and, given that brc1 becomes essential insmc6 mutants, increasing Brc1 levels may aid in theprocessing of blocked ends to enable repair.

The other nuclease identified here as being requiredfor Brc1 to suppress smc6-74 is Exo1. Exo1 possesses 59–39

exonuclease activity, although it is also a 59-flap endonu-clease that is related to the structure-specific nucleasesFen1 and XP-G (Tran et al. 2004), encoded by rad2 and

rad13 in S. pombe. Another 59-flap endonuclease, Slx1/4,showed interactions with smc6 that are very reminiscentof Exo1; slx1D cells show wild-type sensitivity to MMSbut greatly sensitize smc6-74 to MMS and are required forBrc1-mediated suppression (Sheedy et al. 2005). Similarlyfor UV-C, both exo1D and slx1D show little sensitivitythemselves and yet enhance the sensitivity of smc6-74 andagain are required for Brc1 to rescue smc6-74. Theseenzymes have the capacity to remove 59-blocked ends,which may be rare in wild-type cells, explaining whythese strains are not MMS sensitive, but become moreabundant when Smc5/6 function is compromised. Rad2,and perhaps Rad13, could also carry out this function,although Rad13 is not required for Brc1 to suppresssmc6-74, and rad2 mutants are epistatic with smc6.

An alternative explanation as to why these nucleasesare required for Brc1 to suppress smc6-74 would be therequirement to excise 59- and 39-flaps. Epistasis analysispredicts that mutants of the Smc5/6 complex aredefective in Rad51-dependent HR (Lehmann et al.1995; De Piccoli et al. 2006) so flaps could arise fromRad51-independent recombination, such as single-stranded annealing (SSA). The nature of the flap wouldbe dependent on the polarity of the exonuclease activitythat processes a particular DSB. However, the suppres-sion of smc6-74 by Brc1 requires the recombinationmediator complexes consisting of Rhp55/Rhp57 (ho-mologs of Rad55/57) and Swi5/Sfr1 (Sheedy et al.2005) and these proteins are not required for SSA.Thus, the majority of the lesions arising from HR defectsin smc6-74 cells are likely to be processed back intoRhp51-dependent HR substrates by Brc1 and the nucle-ases. A direct requirement for Rhp51 in Brc1-mediatedsuppression of smc6-74 cannot be assayed due to theepistatic nature of smc6-74 and rhp51D.

We have no evidence that Brc1 directly modifies theactivities of the nucleases or that it modifies the novelfunction for Rhp18. Indeed, where applicable, doublemutants between these genes and brc1D are significantlymore sensitive to DNA damage. Further, Brc1 appears tobe required only for DNA damage responses during S-phase in wild-type cells, although clearly it can rescuesmc6-74 when DNA damage is inflicted during G2. It ispossible, therefore, that Brc1 somehow stabilizes recom-bination intermediates in smc6 mutants to allow them tobe modified by these nucleases, or perhaps aids in theirrecruitment to the sites of lesions.

The budding yeast homolog of Brc1, known as Esc4/RTT107, is similarly required for resistance to MMS(Rouse 2004), but its relationship to Smc5/6 is currentlynot known. The closest human homolog, PTIP, mayfunction in DNA damage responses (Jowsey et al. 2004),but its expression in S. pombe is not able to rescue brc1D

or smc6-74 (our unpublished data). However, membersof the Smc5/6 complex are highly conserved, as arehomologs of Rad18 and the nucleases discussed in thisarticle, and so it is likely that the DNA damage response


that we have uncovered in these studies is conserved.Molecular function(s) for Smc5/6 are only beginning toemerge, and understanding how Brc1 can bypass defectsin the function of this complex will be an important toolin deciphering what appears to be a very complex seriesof events.

We thank Felicity Watts, Antony Carr, Jurg Kohli, Oliver Fleck, andMagnar Bjoras for S. pombe strains; Felicity Watts for the anti-PCNAantibody; and Edgar Hartsuiker for advice with fluctuation tests. Thiswork was supported by the National Cancer Institute/NationalInstitutes of Health grant CA100076 (M.J.O.) and Cancer ResearchUnited Kingdom and the Biotechnology and Biological SciencesResearch Council (J.M.). K.M.L. is supported by National Institutesof Health/National Cancer Institute training grant T32 CA78207.

LITERATURE CITED

Alseth, I., H. Korvald, F. Osman, E. Seeberg and M. Bjoras,2004 A general role of the DNA glycosylase Nth1 in the abasicsites cleavage step of base excision repair in Schizosaccharomycespombe. Nucleic Acids Res. 32: 5119–5125.

Alseth, I., F. Osman, H. Korvald, I. Tsaneva, M. C. Whitby et al.,2005 Biochemical characterization and DNA repair pathway in-teractions of Mag1-mediated base excision repair in Schizosacchar-omyces pombe. Nucleic Acids Res. 33: 1123–1131.

Ampatzidou, E., A. Irmisch, M. J. O’Connell and J. M. Murray,2006 Smc5/6 is required for repair at collapsed replicationforks. Mol. Cell. Biol. 26: 9387–9401.

Aono, N., T. Sutani, T. Tomonaga, S. Mochida and M. Yanagida,2002 Cnd2 has dual roles in mitotic condensation and inter-phase. Nature 417: 197–202.

Birkenbihl, R. P., and S. Subramani, 1992 Cloning and character-ization of rad21, an essential gene of Schizosaccharomyces pombeinvolved in DNA double-strand-break repair. Nucleic Acids Res.20: 6605–6611.

Boiteux, S., and M. Guillet, 2004 Abasic sites in DNA: repair and bi-ological consequences in Saccharomyces cerevisiae. DNA Rep. 3: 1–12.

Cotta-Ramusino, C., D. Fachinetti, C. Lucca, Y. Doksani, M.Lopes et al., 2005 Exo1 processes stalled replication forks andcounteracts fork reversal in checkpoint-defective cells. Mol. Cell17: 153–159.

den Elzen, N. R., and M. J. O’Connell, 2004 Recovery from DNAdamage checkpoint arrest by PP1-mediated inhibition of Chk1.EMBO J. 23: 908–918.

De Piccoli, G., F. Cortes-Ledesma, G. Ira, J. Torres-Rosell, S.Uhle et al., 2006 Smc5-Smc6 mediate DNA double-strand-break repair by promoting sister-chromatid recombination.Nat. Cell Biol. 8: 1032–1034.

Frampton, J., A. Irmisch, C. M. Green, A. Neiss, M. Trickey et al.,2006 Postreplication repair and PCNA modification in Schizo-saccharomyces pombe. Mol. Biol. Cell 17: 2976–2985.

Fraser, J. L., E. Neill and S. Davey, 2003 Fission yeast Uve1 andApn2 function in distinct oxidative damage repair pathwaysin vivo. DNA Rep. 2: 1253–1267.

Friedberg, E. C., 2005 Suffering in silence: the tolerance of DNAdamage. Nat. Rev. Mol. Cell Biol. 6: 943–953.

Guzder, S. N., C. Torres-Ramos, R. E. Johnson, L. Haracska, L.Prakash et al., 2004 Requirement of yeast Rad1-Rad10 nucleasefor the removal of 39-blocked termini from DNA strand breaksinduced by reactive oxygen species. Genes Dev. 18: 2283–2291.

Hang, H., D. N. Hager, L. Goriparthi, K. M. Hopkins, H. Shih et al.,1996 Schizosaccharomyces pombe rad23 is allelic with swi10, amating-type switching/radioresistance gene that shares sequencehomology with human and mouse ERCC1. Gene 170: 113–117.

Harvey, S. H., M. J. Krien and M. J. O’Connell, 2002 Structuralmaintenance of chromosomes (SMC) proteins, a family of con-served ATPases. Genome Biol. 3: REVIEWS3003.

Harvey, S. H., D. M. Sheedy, A. R. Cuddihy and M. J. O’Connell,2004 Coordination of DNA damage responses via the Smc5/Smc6 complex. Mol. Cell. Biol. 24: 662–674.

Hazbun, T. R., L. Malmstrom, S. Anderson, B. J. Graczyk, B. Fox

et al., 2003 Assigning function to yeast proteins by integrationof technologies. Mol. Cell 12: 1353–1365.

Hirano, T., 2006 At the heart of the chromosome: SMC proteins inaction. Nat. Rev. Mol. Cell Biol. 7: 311–322.

Hohl, M., O. Christensen, C. Kunz, H. Naegeli and O. Fleck,2001 Binding and repair of mismatched DNA mediated byRhp14, the fission yeast homologue of human XPA. J. Biol.Chem. 276: 30766–30772.

Jowsey, P. A., A. J. Doherty and J. Rouse, 2004 Human PTIP facil-itates ATM-mediated activation of p53 and promotes cellularresistance to ionizing radiation. J. Biol. Chem. 279: 55562–55569.

Kunkel, T. A., J. D. Roberts and R. A. Zakour, 1987 Rapid and ef-ficient site-specific mutagenesis without phenotypic selection.Methods Enzymol. 154: 367–382.

Latif, C., N. R. Elzen and M. J. O’Connell, 2004 DNA damagecheckpoint maintenance through sustained Chk1 activity. J. CellSci. 117: 3489–3498.

Lehmann, A. R., 2006 Translesion synthesis in mammalian cells.Exp. Cell Res. 312: 2673–2676.

Lehmann, A. R., M. Walicka, D. J. F. Grittiths, J. M. Murray, F. Z.Watts et al., 1995 The rad18 gene of Schizosaccharomyces pombedefines a new subgroup of the SMC superfamily involved inDNA repair. Mol. Cell. Biol. 15: 7067–7080.

Lieber, M. R., 1997 The FEN-1 family of structure-specific nucleases ineukaryotic DNA replication, recombination and repair. BioEssays19: 233–240.

Llorente, B., and L. S. Symington, 2004 The Mre11 nuclease isnot required for 59 to 39 resection at multiple HO-induceddouble-strand breaks. Mol. Cell. Biol. 24: 9682–9694.

Marti, T. M., C. Kunz and O. Fleck, 2002 DNA mismatch repairand mutation avoidance pathways. J. Cell. Physiol. 191: 28–41.

Marti, T. M., C. Kunz and O. Fleck, 2003 Repair of damaged andmismatched DNA by the XPC homologues Rhp41 and Rhp42 offission yeast. Genetics 164: 457–467.

Matunis, M. J., 2002 On the road to repair: PCNA encountersSUMO and ubiquitin modifications. Mol. Cell 10: 441–442.

Memisoglu, A., and L. Samson, 2000 Contribution of base excisionrepair, nucleotide excision repair, and DNA recombination to al-kylation resistance of the fission yeast Schizosaccharomyces pombe.J. Bacteriol. 182: 2104–2112.

Miyabe, I., T. Morishita, T. Hishida, S. Yonei and H. Shinagawa,2006 Rhp51-dependent recombination intermediates that donot generate checkpoint signal are accumulated in Schizosacchar-omyces pombe rad60 and smc5/6 mutants after release from repli-cation arrest. Mol. Cell. Biol. 26: 343–353.

Moreno, S., A. Klar and P. Nurse, 1991 Molecular genetic analysisof fission yeast Schizosaccharomyces pombe. Methods Enzymol.194: 795–823.

Morishita, T., Y. Tsutsui, H. Iwasaki and H. Shinagawa,2002 The Schizosaccharomyces pombe rad60 gene is essential forrepairing double-strand DNA breaks spontaneously occurringduring replication and induced by DNA-damaging agents. Mol.Cell. Biol. 22: 3537–3548.

Nagao, K., Y. Adachi and M. Yanagida, 2004 Separase-mediatedcleavage of cohesin at interphase is required for DNA repair.Nature 430: 1044–1048.

O’Connell, M. J., J. M. Raleigh, H. M. Verkade and P. Nurse,1997 Chk1 is a wee1 kinase in the G2 DNA damage checkpointinhibiting cdc2 by Y15 phosphorylation. EMBO J. 16: 545–554.

Pebernard, S., J. Wohlschlegel, W. H. McDonald, J. R. Yates, IIIand M. N. Boddy, 2006 The Nse5-Nse6 dimer mediates DNA re-pair rolesof theSmc5-Smc6complex.Mol.Cell.Biol.26:1617–1630.

Prakash, S., R. E. Johnson and L. Prakash, 2005 Eukaryotic trans-lesion synthesis DNA polymerases: specificity of structure andfunction. Annu. Rev. Biochem. 74: 317–353.

Reynolds, P., M. H. Koken, J. H. Hoeijmakers, S. Prakash and L.Prakash, 1990 The rhp61 gene of Schizosaccharomyces pombe: astructural and functional homolog of the RAD6 gene from the dis-tantly related yeast Saccharomyces cerevisiae. EMBO J. 9: 1423–1430.

Rodel, C., S. Kirchhoff and H. Schmidt, 1992 The protein se-quence and some intron positions are conserved between the


switching gene swi10 of Schizosaccharomyces pombe and the humanexcision repair gene ERCC1. Nucleic Acids Res. 20: 6347–6353.

Rouse, J., 2004 Esc4p, a new targetofMec1p (ATR), promotes resump-tion of DNA synthesis after DNA damage. EMBO J. 23: 1188–1197.

Rudolph, C., O. Fleck and J. Kohli, 1998 Schizosaccharomyces pombeexo1 is involved in the same mismatch repair pathway as msh2and pms1. Curr. Genet. 34: 343–350.

Sergeant, J., E. Taylor, J. Palecek, M. Fousteri, E. A. Andrews et al.,2005 Composition and architecture of the Schizosaccharomycespombe Rad18 (Smc5–6) complex. Mol. Cell. Biol. 25: 172–184.

Sheedy, D. M., D. Dimitrova, J. K. Rankin, K. L. Bass, K. M. Lee

et al., 2005 Brc1-mediated DNA repair and damage tolerance.Genetics 171: 457–468.

Stelter, P., and H. D. Ulrich, 2003 Control of spontaneous anddamage-induced mutagenesis by SUMO and ubiquitin conjuga-tion. Nature 425: 188–191.

Sugimoto, T., E. Igawa, H. Tanihigashi, M. Matsubara, H. Ide

et al., 2005 Roles of base excision repair enzymes Nth1p andApn2p from Schizosaccharomyces pombe in processing alkylationand oxidative DNA damage. DNA Rep. 4: 1270–1280.

Szuts, D., L. J. Simpson, S. Kabani, M. Yamazoe and J. E. Sale,2006 Role for RAD18 in homologous recombination in DT40cells. Mol. Cell. Biol. 26: 8032–8041.

Tatebayashi, K., J. Kato and H. Ikeda, 1998 Isolation of a Schizo-saccharomyces pombe rad21ts mutant that is aberrant in chromo-some segregation, microtubule function, DNA repair and sensitive

to hydroxyurea: possible involvement of Rad21 in ubiquitin-mediated proteolysis. Genetics 148: 49–57.

Tomita, K., A. Matsuura, T. Caspari, A. M. Carr, Y. Akamatsu et al.,2003 Competition between the Rad50 complex and the Kuheterodimer reveals a role for Exo1 in processing double-strandbreaks but not telomeres. Mol. Cell. Biol. 23: 5186–5197.

Tran, P. T., N. Erdeniz, L. S. Symington and R. M. Liskay,2004 EXO1-A multi-tasking eukaryotic nuclease. DNA Rep. 3:1549–1559.

Tsubouchi, H., and H. Ogawa, 2000 Exo1 roles for repair of DNAdouble-strand breaks and meiotic crossing over in Saccharomycescerevisiae. Mol. Biol. Cell 11: 2221–2233.

Unk, I., L. Haracska, S. Prakash and L. Prakash, 2001 39-Phos-phodiesterase and 39/59 exonuclease activities of yeast Apn2protein and requirement of these activities for repair of oxidativeDNA damage. Mol. Cell. Biol. 21: 1656–1661.

Verkade, H. M., S. J. Bugg, H. D. Lindsay, A. M. Carr and M. J.O’Connell, 1999 Rad18 is required for DNA repair and check-point responses in fission yeast. Mol. Biol. Cell 10: 2905–2918.

Verkade, H. M., T. Teli, L. V. Laursen, J. M. Murray and M. J.O’Connell, 2001 A homologue of the Rad18 postreplicationrepair gene is required for DNA damage responses throughoutthe fission yeast cell cycle. Mol. Genet. Genomics 265: 993–1003.

Watts, F. Z., 2006 Sumoylation of PCNA: wrestling with recombina-tion at stalled replication forks. DNA Rep. 5: 399–403.

Communicating editor: M. Lichten


Documents

Brc1-Mediated Rescue of Smc5/6 Deﬁciency: Requirement ... · checkpoint response can be restored to these cells by deletion ofHR genes (Verkadeetal. 1999; Ampatzidou et al. 2006;