Brand Protectionand Anti-counterfeiting

Technology

Presented by:Michael Impastato636-717-0230 ext. 338michael.impastato@flintinkcom

Brand Protection

Legal Protection available§ Copyrights§ Patents§ Trademarks§ Secret formulas

§ Ensure the integrity of our brands§ Exclusive use of our brand identity§ Consumer recognition of our brand

What is it? It’s not just tamper evidence.

How much is a brand worth?

$150 Million

Brand Protection – WHY?

§ Protect the consumer § Loss of revenue and profit opportunity§ Brand equity protection§ Maintain / Build consumer confidence§ Maintenance of IP rights§ Warranty cost§ Distribution channel control§ Fraudulent coupons and rebates

Brand Protection

How big is the counterfeiting (CF) problem?

Market size RiskSmuggle people $10 bil. HighSmuggle cigarettes $20 bil. HighIllegal drugs $50 bil. HighCF consumer products* $200-400 bil. Low

* Growing at a rate of >30% per year

Nike looses $300 mil per year in EU (15-20% of total revenue) to CF.

Ford lost $1.5 bil in one year to CF. And $300 mil. in unauthorized supplier sales.

Pharmaceutical companies can loose 80% of their profits from channel diversion.

Impact of CF on Business

More than 3000 children died in Africa from CF meningitis injections.

192,000 deaths in China last year due to fake drugs.

400 deaths due to methanol contaminated spirits in the last 3 years

Impact of CF on People

The Global Impact of CF

Counterfeiters have grown to be the 5th largest producer of tobacco in the world.

Globally, >6% of all pharmaceuticals sold are counterfeit.

Drug dealers are increasingly turning to counterfeiting.

Anti-Counterfeiting

Three levels of Protection

Overt

Covert

Forensic Covert

Overt Technology

Examples

§Watermarks§ Light interference inks§ Security threads§ Micro printing§ Holograms§ Serial Numbering

OVERT TECHNOLOGY

Advantage+ Easily identified+ Recognized by the consumer+ Provides sense of protection

Disadvantages- Must educate the consumer- Easy for the CF to duplicate- Must be incorporated into the graphics- Can be remove or obliterated

Examples

§ Micro lettering inside of holograms§ UV fibers§ Micro printing§ Thermochromatic ink§ Photochromatic ink§ Invisible ink

Covert Technology

COVERT TECHNOLOGY

Advantages+ May not impact graphics+ Not easily apparent to CF+ Identified by enforcement personnel+ All packages don’t have to be marked

Disadvantages- Not apparent to the consumer- Can be duplicated by sophisticated CF

Examples:

§ DNA Marking

§ X-Ray Fluorescent tagging

§ Inferred Fluorescent tagging

Forensic Covert Technology

FORENSIC COVERT TECHNOLOGY

Advantage+ No impact on graphics+ CF don’t know its present+ Hard / impossible to duplicate+ Can provide other information+ Forensic level authentication

Disadvantages- Consumers don’t see the protection- Requires instrumentation

DNA TAGGING

DNA TAGGING

DNA is composed of bits of material called oligonucleotides. These bits of material can be combined in various ways to create millions of unique combinations.

Synthetically we can generate specific sequences that can be hidden in the vast amount of DNA naturally present.

DNA TAGGING

Biopolymer consisting of four bases§ G – guanine§ C – Cytosine§ T – Thymine§ A - Adenine

These four base materials can be combined into 20 base strands to generate about a trillion possible combinations.

CTGGAAGATGTGCATTCGAT

DNA TAGGING

Code Examples:A = CGA B = CCA C = GTTD = TTG E = GCC F = GGTG = TTT H = CGC I = ATGJ = AGT K = AAG L = TGCM = TCC N = TCT O = GGA

CGATCCGGAGTJTCTATGAAGGCGGTJTGCAAG

N EKI

TCCTCTGGAAAGATGTGCCCATTTCGCGGATGC

X-ray Fluorescence

Technique

Detector X-Ray Tube

Sample

X-rays hit the sample and are reflected back to the detector

1) The instrument sends energy in the form of an x-ray photons into the sample matrix (paper, plastic, steel, etc.).

2) Some of these x-rays strike electrons in the atoms’inner shells of the sample matrix, dislodging them from their orbit.

3) Having lost an electron, atoms become unstable, or excited.

Basic Principles of X-Ray Fluorescence

4) To regain stability, each excited atom fills the gap left by the lost electron with an electron from one of its outer shells. This causes release of an x-ray photon. This photon has an energy characteristic of the element from which it came.

5) The instrument measures energy and number of returning X-rays to determine the quantity and type of elements in the sample and can be specifically calibrated for custom applications.

Basic Principles of X-Ray Fluorescence

Spectra Produced by the Instrument

Iron (Fe)K-shell 6.4keV(kilo electron volts)

Nickle (Ni)K-shell 7.47keV(kilo electron volts)

AdvantagesAdvantages

•• Invisible (covert)Invisible (covert)

•• NonNon--destructive testingdestructive testing

•• Numerous codes availableNumerous codes available

•• TaggantsTaggants are permanent and indestructibleare permanent and indestructible

•• Forensic level identification in the fieldForensic level identification in the field

•• Not dependent on lineNot dependent on line--ofof--sight viewingsight viewing

•• Capable of layered combination codingCapable of layered combination coding

•• Difficult to impossible to counterfeitDifficult to impossible to counterfeit

X-ray Fluorescence

Infrared Fluorescence

cosmicrays

gammarays

ultra violet rays

X rays microwaves

infra red waves

radio waves

Infrared Fluorescence

Rare earth materialsRare earth materials are used as are used as taggantstaggants in in very low concentrations to very low concentrations to convert the wave convert the wave length of infrared energylength of infrared energy. Infrared energy . Infrared energy can be upcan be up--converted or downconverted or down--converter. The converter. The conversion can be invisible to visible or conversion can be invisible to visible or invisible to invisible. By identifying the invisible to invisible. By identifying the activation wave length and the reflectance activation wave length and the reflectance wave length, wave length, authentication can be verifiedauthentication can be verified..

Electromagnetic energy is available in many different wave lengths. Visible light energy is in the range of 400nm to 750 nm. Infrared energy has longer wave lengths that go above the visible spectrum, and is invisible to the human eye.

cosmicrays

gammarays

ultra violet rays

X rays microwaves

infra red waves

400nm 750nm

radio waves

Infrared Fluorescence

X Rays Ultra Violet

Gamma Rays

Visible Color

Infra Red

Radar Radio Waves

Electro Magnetic Spectrum

Crystal are microscopic and absorb and store light energy from many parts of the light spectrum

Infrared Fluorescence

X Rays Ultra Violet

Gamma Rays

Visible Color

Infra Red

Radar Radio Waves

Electro Magnetic Spectrum

When exposed to a very specific wavelength of energy, the energy in the crystal is released (up-conversion) as a very narrow wavelength of light.

Infrared Fluorescence

•• Invisible (covert)Invisible (covert)

•• Taggants Taggants are rare and not widely availableare rare and not widely available

•• Numerous codes availableNumerous codes available

•• TaggantsTaggants are permanent and indestructibleare permanent and indestructible

•• Field identification is easy and inexpensiveField identification is easy and inexpensive

•• Can visualize graphics (invisible bar code)Can visualize graphics (invisible bar code)

•• Wide range of emitted visible light colorsWide range of emitted visible light colors

•• Difficult to impossible to counterfeitDifficult to impossible to counterfeit

AdvantagesAdvantages

Infrared Fluorescence

Brand Protection

Supply Chain Security

Raw Material Supply

Processing

Warehousing

Distribution

ConsumerWhere will the CounterfeitsInfiltrate?

Loss of control as we move up the supply chain

Brand Protection

§Recognize a problem§Quantify the problem§Choose a comprehensive solution§Integrate the solution§Field authentication and enforcement

PROCESS STEPS

What are you prepared to do about the problem?

Thank You

Presented by:Michael Impastato636-717-0230 ext. 338michael.impastato@flintinkcom

FPA’s 2003 Annual Meeting