PowerPoint Presentation

BiologyChapter 13:Genetic TechnologyMolecular Biology

DNA Fingerprint a sequence of bands that shows a persons DNA sequenceHow to make a DNA FingerprintDNA ExtractionCell is opened and the DNA is separated from the other cell parts

2. Cutting DNADNA is so long we cut it into smaller fragmentsRestriction Enzymes cut DNA at a specific sequence of nucleotides

EcoRI - CTTAA

Ex: ACTGCTTAAGGCATTGCCTTAACAGGCTABam I - CCTAG Ex: GCTTACCCTAGATGACGTTACTTACAGGCHae III - CCGGEx: CCGATACGCTCCGGACTACCGGATCCGGAT

3. Separating DNAGel Electrophoresis a technique for separating DNADNA is negatively chargedLoad DNA into gelApply electric voltage to gelDNA will move through gel to positiveSmaller DNA fragments move faster and further

How do you end up with different size fragments that are unique to each individual?Tandem Repeat region of a chromosome that contains multiple copies of a DNA sequenceThe origin and significance of tandem repeats is a mysteryFor forensic scientists they offer a means of distinguishing one individual from another through DNA fingerprinting30% of human genome is composed of tandem repeats.Tandem repeats seem to act as filler or spacers between the gene regions of DNA

9Gel electrophoresis is used to separate DNA fragments. First, restriction enzymes cut DNA into fragments. The DNA fragments are then poured into wells on a gel, which is similar to a thick piece of gelatin. An electric voltage moves the DNA fragments across the gel. Because longer fragments of DNA move through the gel more slowly, they do not migrate as far across the gel as shorter fragments of DNA. Based on size, the DNA fragments make a pattern of bands on the gel. These bands can then be compared with other samples of DNA.

10Gel electrophoresis is used to separate DNA fragments. First, restriction enzymes cut DNA into fragments. The DNA fragments are then poured into wells on a gel, which is similar to a thick piece of gelatin. An electric voltage moves the DNA fragments across the gel. Because longer fragments of DNA move through the gel more slowly, they do not migrate as far across the gel as shorter fragments of DNA. Based on size, the DNA fragments make a pattern of bands on the gel. These bands can then be compared with other samples of DNA.Fig. 16.7, p. 259

FROMBLOODAT CRIMESCENE1234567PCR

PCR Polymerase Chain Reaction process of making many copies of genesHeat DNA to separate two strandsAs it cools DNA polymerase starts making copiesRepeat this process and end up with millions of copies

DNA heated to separate strandsPCR cyclesDNA copies12345 etc.124816 etc.

Polymerase Chain Reaction (PCR)DNA polymerase adds complementary strandDNA fragment to be copied13Polymerase chain reaction (PCR) is used to make multiple copies of genes. 13-3 Cell Transformation

Transformation one organism is changed by a gene or genes from another organismGenetic Engineering method of cutting DNA from one organism and inserting the DNA into another organismRecombinant DNA DNA made by recombining fragments of DNA from different sourcesPlasmidExtra circular DNA found in some bacteriaVery useful for DNA transfer from one organism into another

Process of TransformationCut out gene of interest with restriction enzymeUse same restriction enzyme to cut plasmidThis creates ends on each that will match upCombine the gene of interest with the plasmid Place the recombinant DNA into a bacteria cellBacteria will replicate this new DNA and make many copies of the gene of interest

13-4 Applications of Genetic Engineering

When recombinant DNA is put into a host that organism will use the foreign DNA as if it were its own.Transgenic Organisms contain functional foreign DNAEx. Glowing bacteria

Fig. 16.12, p. 263

Application of DNA Technology

Transgenic bacteria in agricultureA bacteria on strawberry plants promotes frost damage on leaves. The gene for this protein is removed and frost damage is prevented.A bacteria that lives in soil and in the roots of plants can be engineered to increase the rate of conversion of atmospheric nitrogen to nitrates, a natural fertilizer, to help cut back on fertilizer use and costTransgenic bacteria in industryUsed to clean up oil spillsExtract valuable minerals from ores

Transgenic bacteria in medicineThe production of growth hormone to treat dwarfismHuman insulin used to treat diabetesTransgenic plantsHave been genetically engineered to resist herbicides, produce internal pesticides or increase their protein production. Produce rice with vitamin AIn 2000 52% of soybeans and 25% of corn grown in US was genetically modified

Transgenic AnimalsMake animals grow faster and produce leaner meatTrying to produce chickens resistant to bacterial infections that cause food poisoningCows produce different human proteins in their milk

Cloning

Clone genetically identical offspring produced from a single cellIn 1997 Scottish scientist Ian Wilmut cloned first mammal, a sheep named Dolly

23In early 1997, Dolly made headlines as the first clone of an adult mammal.14-3 Human Molecular GeneticsHuman Genome Project

Human Genome Project An international effort to completely map and sequence the human genomeStarted in 1990 and completed in 2000How did they do it?First determined markers a sequence of bases in widely separated regions of DNACut DNA into random fragmentsDetermined sequences of the fragmentsComputers found areas of overlap between the fragments

One surprise was how few genes humans haveFruit fly 14,000Tiny worm 20,000Human 25,000A human diploid cell contains more than 3 billion base pairsOnly about 2% of the DNA in your chromosomes functions as genesThe average human gene consists of about 3000 base pairsThe largest gene in the human genome has more than 2 million base pairs

Chromosome 22 and 21 were the first 2 human chromosomes sequencedChromosome 22Contains approximately 43 million base pairs545 genes1 causes leukemia1 neurofibromatosisChromosome 21Approximately 32 million base pairs225 genesLou Gehrigs disease (ALS) loss of muscle control due to destruction of nerves in the brain and spinal cord