Bioinformatics and Malaria: How can the computer help in vaccine and drug design against Malaria?

The worldwide Malaria threat:

- 2 billions live at risk of malarial infection- 500 million individuals get infected per year- 2-3 millions die due to P. falciparum infections- Resistance is found against virtually all commercially available drugs- Vectors become resistant against pyrethroids- The only, highly functional vaccine to date is the administration of irradiated sporozoits- BUT, new, very promising drugs are in development (monkey trials/clinical trials)

from Good & Doolan 1998

Three different organism interact in malarial infections

2900 Mb25-30 Mb

280 Mb

from Good & Doolan 1998

Differing stages, different target structures

Knowing the genomes/transcriptomes of all involved species....

H. sapiens P. falciparum A. gambiae

... reveal structures at which an interference can take place, and this is a necessary a “computer job”

Part 1: Bioinformatics + drug target finding

Acalcidosome

Licensed drugs: pyrimethaminesQuinine derivates,Artemsisin drugs

Known “obvious” drug targets, for which some drugs arealready available

Olliaro & Yuthavong 2001

The DOXP pathway example

- In plants, isoprenoid precursors are synthesized via the DOXP pathway (in the chloroplast), in mammalians via the mevalonate pathway (in the cytosol)

- Fosmidomycin is a potent inhibitor of the plant DOXP reductoisomerase

BLAST and alignment analysis of some DOXP reductase genes identified a candidate P. falciparum sequence

Jooma et al. 1999, Science

Work hypothesis of Jooma and cols.:

- Is the already tested drug (non-toxic in human use) Fosmidomycin active against Malaria blood stages which synthesize a lot of isopentenyl precursors?

In vitro cultures of different strains of P. falciparum were effectively inhibited...

Jooma et al. 1999, Science

...and mice infected with lethal P. vinckei were cured at very low doses of either Fosmidomycin or its derivate

Jooma et al. 1999, Science

Advantageous would be the automated identification of all metabolic enzymes in Plasmodium, and the automatedassignment of all known inhibitors to these enzymes

Pf metabolic enzymes

Inhibitordatabase

High-throughputscreening

Even drugs that block both human and plasmodial enzymes can by considered, if the human enzyme is not active/presentin the tissues where the drug is bio-available

SAGE/Microarray data bank of human tissues

SAGE/Microarray data of blood stage plasmodium

Drug data bank

Science 295, 15/02/2002, p 1311-15

Compounds which are weak inhibitors may be modifiedby combinatorial chemistry in silico if the target structure(3-dimensional!) is known, minimizing the number of potential test compounds

N

H

CX

Y

Z

Target structure

A major drawback of alignment-based drug target searchis that some (how many?) enzymes are missed

5´-Taaaccctgaaccctaaaccctaaaccctgaaccctgaaccctaaa ccctgaaccctaaccctgaacccaacccaaaccctaaacctaaaccc taaaccctaaaccctgaaccctaaaccctgaaccctaaaccctaaa ccctaaaaccctaaaccctaaaccctaaaccctgaaccctaaaccc taaaccctaaaccctaaaccctgaaccctaaaccctaaaccctaaa cctaaaccctgaaccctaaaccctaaaccctg

1

ONE BEER FORTHE ONE WHO FINDSTELOMERASE!

Hoffman et al., Nature 2002

Part 2: Bioinformatics and vaccine research

Is a Malaria vaccine feasible?

Co60

Protection

What are known candidate structures:

- anti-infection: CSP, SSP2, STARP, SALSA- anti-hepatic stages CSP, SSP2, LSA1, LSA3, EXP1, STARP, SALSA- anti-merozoite: MSP1-4, PfEBA-175, DBP(Pv), AMA1 SERA, GLURP,Pf155-RESA, RAP1, RAP2- anti-IRBC: PfEMP1, RIFIN, Pf322 GPI- anti-infective stages: Pfs25, Pfs28, Pfs45/48, Pfs230

Richie and Saul, Nature 2002

Rappuoli 2001Curr. Opin. Microbiol.

Rappuoli 2001Curr. Opin. Microbiol.

Suggestion of Hoffmann et al.(Nature Medicine 4,1998, p 1351-53)

In the case of blood stage vaccine candidates: identify expressed genes

cDNA, EST data bank

2. Are they surface-expressed (either merozoite or IRBC)?

3. Express as rec. protein or deliver directly as a DNA vaccine in the rodent system

4. Find homologue in P. falciparum/vivax

5. Test efficacy in in vitro reinvasion assays and in the monkey model

6. Volunteer trials

Identified antigens must be checked for strain varyingpolymorphisms, these polymorphism must be representedin a anti-blood stage vaccine

Candidate protein X

Variants in strains A B C D

Protectiveepitope

By genome scanning, many novel candidate proteindomains potentially important in cell-cell interaction were found

Trends in Parasitology 17 (5), p 297-99

- An important antibody target are the erythrocyte surface-exposed antigens PfEMP1 and perhaps RIFIN and STEVOR (P. falciparum) and VIR (P. vivax)

DBL CIDR DBL DBL ATS

PfEMP1: Highly polymorphic, 50 copies per genome, 1is expressed per trophozoite stage parasite, mediate cytoadherence which can promote severe disease

Step1: Exploring the endless: Sequencing 500 var genes fromAmazonian isolates

Full length var genes

CIDRDBL DBL DBL

Patient data (diseaseseverity)

“Pathoarray”

Step 2: Checking the expressed repertoire against thePathoarray

Patient samples(var - cDNA)

Multiplex-PCR withdomain-specific/ degenerated oligomixes

Definition of “severe” or“non-severe” var domains

Patient data (diseaseseverity)

Step 3: Checking the immune response: Is there aanti-severe disease response?

Patient samples (Plasma)

Elisa

Anamnestic data

Vaccine subunitcandidate

Peptide array

Drawbacks in the genomic approach to vaccines

- Some structures may be lost because the prediction program (HexExon, Glimmer M, PHAT) did not recognize the coding region (see drug targets, too) of a potential antigen

- What if the highly effective vaccine target is a glycosid rest? --> SEE GPI!!!

Further reading:

From genomics to vaccines: Malaria as a model system(Nature medicine 4, 1351 f, 1998)Plasmodium, human and Anopheles genomics and Malaria(Nature 415, 702, this nature issue is particularly interesting, 2002)An overview of chemotherapeutic targets for antimalarial drug discovery(Pharmacol. Ther. 81, 91, 1999)Progress and Challenges for Malaria vaccinesNature 415, 694