Binding of the mammalian homolog of the Drosophila discs largetumor suppressor protein to the ribosome receptor

Minji Kim,a,1 Hironori Ogawa,b,1,2 Kazuyoshi Kohu,a,b Minoru Ichikawa,b,3

Kiyotoshi Satoh,a,b Takefumi Ishidao,a,b Shigeyuki Nada,b and Tetsu Akiyamaa,b,*

a Laboratory of Molecular and Genetic Information, Institute for Molecular and Cellular Biosciences, The University of Tokyo, 1-1-1 Yayoi,

Bunkyo-ku, Tokyo 113-0032, Japanb Department of Oncogene Research, Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565-0871, Japan

Received 22 May 2002

Abstract

DLG, the mammalian homolog of the Drosophila Discs Large suppressor protein, functions as a scaffolding protein that fa-

cilitates the transmission of diverse downstream signals. In the present study, we attempted to identify partner proteins for DLG,

and found that DLG interacts through its PDZ domains with the ribosome receptor. The ribosome receptor is an integral endo-

plasmic reticulum protein that has been suggested to be involved in secretion. Our finding raises the possibility that DLG plays a role

in the regulation of secretion by interacting with the ribosome receptor. � 2002 Elsevier Science (USA). All rights reserved.

DLG, the mammalian homolog of the DrosophilaDiscs Large suppressor protein, contains three PDZdomain repeats followed by an SH3 domain and aguanylate kinase-like (GK) domain. DLG interacts viaits PDZ domain with the colorectal tumor suppressoradenomatous polyposis coli protein (APC), suggestingthat it may be involved in the negative regulation of cellproliferation [1–3]. Consistent with this notion, over-expression of hDLG blocks cell cycle progression fromthe G0/G1 to S phase [4]. DLG also interacts withAMPA-type glutamate receptors, which contain aGluR1 subunit [5] and it may play a role in the matu-ration of this receptor in the endoplasmic reticulum orcis-Golgi as well as its delivery to the synapses [6]. Theclosely related PSD-95 and Chapsyn-110 proteins havebeen reported to interact with the NMDA-type gluta-mate receptors and shaker-type Kþ channels, and tofunction to induce the clustering of these ion channels

[7–10]. These proteins also interact via their GK do-mains with the DLG-associated proteins (DAPs)/syn-apse-associated protein-associated proteins (SAPAPs)/guanylate kinase-associated proteins (GKAPs) [11–13]and a Rap-specific GTPase activating protein, the Spine-associated RapGAP (SPAR)/Spa-1-like protein (SPAL)/[14–16]. In the present study, we passed porcine liverextract through a column to which the PDZ domain ofDLG had been immobilized and isolated the ribosomereceptor as a DLG-binding protein.

Materials and methods

Plasmid construction. cDNA fragments encoding the three PDZ

domains of hDLG (amino acids 203–552) and the carboxy-terminal

region of human p100 (amino acids 1482–1531) were amplified using

the following primer sets flanked by EcoRI and SalI sites; GGGAA

TTCAACACAGATAGCTTGGAAAC and GGGTCGACACGACT

GTATTCTTCAGGTC, GGGAATTCAAGAAGTTAACAAGTGA

CC and CGCGTCGACTAGCCCTCCTTTG-AGCTGCTG, respec-

tively. These fragments were cloned at the EcoRI and SalI sites im-

mediately downstream of the glutathione S-transferase (GST) gene in

pGEX-5X-1 (Pharmacia) or the maltose-binding protein (MBP) gene

in pMAL-p2 (New England Biolabs), so as to produce fusion proteins.

cDNA fragments encoding full-length human p100 were partially

obtained from EST clone (Accession Nos. AA626322 and R64271).

Missing portions were amplified using the following primer sets;

Biochemical and Biophysical Research Communications 294 (2002) 1151–1154

www.academicpress.com

BBRC

* Corresponding author. Fax: +81-3-5818-9437.

E-mail address: akiyama@iam.u-tokyo.ac.jp (T. Akiyama).1 These authors equally contributed to this work.2 Present address: Department of Genetics, Osaka University Med-

ical School, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan.3 Present address: Cardiovascular Division, Osaka National Hospi-

tal, 2-1-14, Hoenzaka, Chuo-ku, Osaka 540-0006, Japan.

0006-291X/02/$ - see front matter � 2002 Elsevier Science (USA). All rights reserved.

PII: S0006 -291X(02 )00600 -9

CCCGGTACCATCGATATTTACGACACTC and CTCCTTGGGA

GCAGTTTCCAAG, GAGCAGGAGATCACGGCTG and GGCAG

AAATACAGATGTGGC. These fragments were cloned into pEGFP-

C2 (Clontech).

Purification of GST–hDLG–PDZ-binding proteins from porcine

liver. Porcine liver was initially homogenized in a Waring blender, and

suspended into PBS containing 2.7mM KCl, 5mM EDTA, 1mM

DTT, 5mg/ml aprotinin, and 2mg/ml leupeptin. The suspension was

further homogenized with a Potter-Elvehjem homogenizer and the

nuclear fraction was pelleted by centrifugation at 1000g for 10min at 4

�C. The supernatant was centrifuged at 8000g for 10min at 4 �C, thenthe supernatant obtained was subjected to additional centrifugation at

105,000g for 60min at 4 �C and the pellet was used as the microsomal

fraction. The nuclear fraction was solubilized with DOC buffer (10mM

K-phosphate, pH 7.4, 5mM EDTA/10% v/v glycerol, 0.5% w/v sodium

deoxycholate, 1mM DTT, 5mg/ml aprotinin, 2mg/ml leupeptin) and

diluted with an equal volume of Triton buffer (10mM K-phosphate,

pH 7.4, 5mM EDTA, 10% v/v glycerol, 2% w/v Triton X-100, 1mM

DTT, 5mg/ml aprotinin, 2mg/ml leupeptin) prior to affinity purifica-

tion. The microsomal fraction was solubilized with cholate buffer

(PBS, 5mM EDTA, 10% v/v glycerol, 1% w/v sodium cholate, 1mM

DTT, 5mg/ml aprotinin, 2mg/ml leupeptin) and fractionated by am-

monium sulfate precipitation. The fraction obtained with 25–50%

ammonium sulfate precipitation was dissolved into 100mM K-phos-

phate, pH 7.4, 5mM EDTA, 1% w/v sodium cholate, and dialyzed

against 25mM K-phosphate, pH 7.4, 5mM EDTA, and 1% w/v so-

dium cholate. Nuclear and microsomal proteins were separately passed

through glutathione–Sepharose 4B columns (1ml bed volume) to re-

move endogenous GST. Flow-through fractions were applied to a

column to which the PDZ domain of hDLG fused to glutathione-S-

transferase (GST–hDLG–PDZ) had been immobilized (4mg of GST–

hDLG–PDZ, 1ml of a glutathione–Sepharose 4B). Proteins adsorbed

to the column were eluted with 6ml of elution buffer containing 1.5M

NaCl and 0.1% Triton X-100.

Peptide sequencing. Affinity-purified p100 was precipitated and

desalted by adding an equal volume of cold acetone ()20 �C) andpelleted by centrifugation at 3000g for 15min at 4 �C. p100 was sep-

arated by SDS–PAGE, transferred onto polyvinylidene difluoride

membrane (ProBlottTM), and then subjected to in situ digestion with

Achromobacter protease I at 37 �C overnight. Eluted peptides were

separated by reverse-phase high pressure liquid chromatography

(HPLC) [column: CAPCELL PAK C18 UG120S-5mm, 4:6� 150mm,

SHISEIDO; mobile phase: linear gradient of acetonitrile (2–30% v/v)

in 0.1% trifluoroacetic acid]. Seven peptides derived from p100 were

analyzed with a protein sequencer.

Antibody. Antibody against the ribosome receptor was raised by

immunizing rabbits with the bacterially synthesized carboxy-terminal

region of human p100 (amino acids 1482–1531) fused to GST. The

antibody was affinity-purified on a column to which the corre-

sponding MBP fusion protein was covalently linked. Rabbit polycl-

onal antibody to hDLG was generated as described before [1]. Mouse

monoclonal antibody to hDLG was obtained from Transduction

Laboratories.

Immunoprecipitation and imunoblotting. COS7 cells were cultured in

Dulbecco’s modified Eagle’s medium (DMEM) supplemented with

10% fetal bovine serum (FBS). p100 subcloned into pEGFP was

transfected into COS7 cells using LipofectAMINE 2000 (Life Tech-

nologies). Cells (5� 106 cells) were lysed in 500ll of buffer A (50mM

Tris–HCl pH 7.5, 150mM NaCl, 5mM EDTA, 2mM NaVO4, 10mM

NaF) containing 1% Triton X-100. The lysates were incubated with

2lg of antibodies for 1 h at 4 �C, and then the immunocomplexes wereadsorbed to protein G–Sepharose 4B for 2 h at 4 �C. Blocking of an-

tibodies was performed by preincubating for 2 h at 4 �C with an excess

amount of the antigens used for immunization. After washing exten-

sively with buffer A containing 0.1% Triton X-100, samples were re-

solved by SDS–PAGE and transferred to a polyvinylidene difluoride

membrane filter (Immobilon P) (Millipore). The blot was subjected to

immunoblotting analysis using alkaline phosphatase-conjugated goat

anti-rabbit immunoglobulin G.

Immunostaining. HeLa cells were cultured in DMEM supplemented

with 10% FBS. Cells were fixed with methanol-acetone (1:1) at )20 �Cfor 5min, and double stained with rabbit polyclonal antibody to the

ribosome receptor and mouse monoclonal antibody to hDLG for

60min at room temperature. Staining patterns obtained with these

antibodies were visualized by incubating with RITC-labeled anti-

rabbit or FITC-labeled anti-mouse IgG for 60min at room tempera-

ture. The cells were photographed with a Carl Zeiss LSM510 laser

scanning microscopy.

Results and discussion

To identify proteins interacting with the PDZ domainof hDLG, lysates prepared from a porcine liver mi-crosomal fraction were loaded onto a column to whichthe PDZ domain of hDLG fused to glutathione-S-transferase (GST–hDLG–PDZ) had been immobilized.Several proteins were found to bind GST–hDLG–PDZbut not GST (Fig. 1). Proteins of molecular mass ofabout 100-kDa (p100) and 180-kDa (p180) were de-

Fig. 1. Purification of hDLG-binding proteins. hDLG-binding pro-

teins were purified from the microsomal (A) and nuclear fractions (B)

of the porcine liver using a GST–hDLG–PDZ–Sepharose column and

fractionated by SDS–PAGE followed by silver staining. p100 and p180

(indicated by arrowheads) bound to GST–hDLG–PDZ–Sepharose but

not GST–Sepharose. Positions of molecular weight markers are shown

on the left. (C) Peptide sequences were obtained from the bands of

p100 as described in Materials and methods.

1152 M. Kim et al. / Biochemical and Biophysical Research Communications 294 (2002) 1151–1154

tected as the most abundant hDLG–PDZ interactingproteins (Fig. 1A). These proteins were also purifiedfrom the nuclear fraction (Fig. 1B).

p100 was digested with Achromobacter protease Iand individual peptides were purified by reverse-phasehigh pressure liquid chromatography (HPLC). Aminoacid sequences of seven peptides were determined with aprotein sequencer and found to be almost identical tothose of the canine ribosome receptor (Fig. 1C) [17]. Thecanine ribosome receptor is an integral endoplasmicreticulum (ER) protein protruding into the cytosol(Fig. 2). It contains tandem repeats of a Asn–Gln–Gly–Lys–Lys–Ala–Glu–Gly–Ala–Pro in its amino-terminalhalf that has been reported to be important for bindingto the ribosome. p100 contained a striking abundance oflysine residues, with an overall isoelectric point of 9.95.Moreover, the canine ribosome receptor contains aT/SXV motif at its carboxy-terminus, which is a targetsequence for the PDZ domain of hDLG. This motif isconserved among the human, rat, mouse, and bovineribosome receptors.

Although the molecular weight of the canine ribosomereceptor was first reported to be 180-kDa, there areseveral variants generated by alternative splicing andsmaller versions are different in the number of the 10amino acid repeats (Fig. 2) [18]. RT-PCR amplificationusing the primers shown in Materials and methods gen-erated a cDNA encoding a splicing variant that consistsof 977 amino acids and lacks all of the 10 amino acidrepeats. The calculated molecular weight of this variantis 109-kDa. Furthermore, immunoblotting analysis withantibody generated against p100 also recognized p180(Fig. 3A). These results suggest that p180 is the full-length ribosome receptor while p100 is a splicing variantthat lacks all of the 10 amino acid repeats.

We next ectopically expressed p100 fused to thecarboxy-terminus of GFP (EGFP-p100) in COS7 cellsand examined whether EGFP-p100 interacts withendogenous hDLG. When cell lysates were subjected toimmunoprecipitation with anti-hDLG antibody fol-lowed by immunoblotting with anti-GFP antibody,EGFP-p100 was found to co-immunoprecipitate withhDLG (Fig. 3B). In line with this result, immunostainingof HeLa cells with antibodies to hDLG and p100 re-vealed that both proteins are present in the cytoplasm

including the region around the nucleus (Fig. 4). Thefinding that both proteins were present at the peri-nuclear region seems to be consistent with the fact thatp100 and p180 were purified as hDLG proteins from thenuclear fraction (Fig. 1B).

Our results suggest that hDLG interacts with the ri-bosome receptor. The ribosome receptor has homology

Fig. 2. Schematic representation of the structures of the ribosome re-

ceptors p180 and p100.

Fig. 3. Association of hDLG with p100 in vitro and in vivo. (A)

hDLG-binding proteins purified from the microsomal fraction of the

porcine liver were subjected to immunoblotting with antibody to p100.

Both p100 and p180 were detected with anti-p100 antibody. These

proteins were not detected in the eluate from a GST–Sepharose col-

umn. Positions of molecular weight markers are shown on the left. (B)

Lysates prepared from COS7 cells that had been transfected with

pEGFP-p100 were subjected to immunoprecipitation with anti-hDLG

antibody, fractionated by 6.5% SDS–PAGE, and immunoblotted with

antibodies to hDLG or GFP. Pep+ indicates that antibodies were

preincubated with antigen before use in immunoprecipitation. Abun-

dant endogenous hDLG was detected in cells not transfected the

expression vector for hDLG.

M. Kim et al. / Biochemical and Biophysical Research Communications 294 (2002) 1151–1154 1153

to kinectin, an ER protein identified as a kinesin-bindingprotein [19]. Kinectin has been shown to play an es-sential role in kinesin-driven vesicle motility [20].Moreover, kinectin has been reported to be a target ofthe small G protein RhoA [21]. Kinectin has two RhoAbinding sites, which reside in a region predicted to forman extended coiled-coil structure [22]. Interestingly, theribosome receptor (amino acid 886–909) also possessessimilar RhoA binding motifs [23]. More recently, it hasbeen reported that expression of the ribosome receptorp180 in yeast cells induces membrane proliferation andincreased secretory activity [24]. Rough membrane waspredominantly observed when the ribosome-bindingdomain of p180 was present, whereas smooth membranewas observed when expression constructs lacking thisregion were used. These findings raise the possibility thathDLG plays a role in the regulation of secretion byinteracting with the ribosome receptor.

Acknowledgment

This work was supported by Grants-in-Aid for Scientific Research

on Priority Areas.

References

[1] A. Matsumine, A. Ogai, T. Senda, N. Okumura, K. Satoh, G.H.

Baeg, T. Kawahara, S. Kobayashi, M. Okada, K. Toyoshima, T.

Akiyama, Science 272 (1996) 1020–1023.

[2] D.F. Woods, P.J. Bryant, Cell 66 (1991) 451–464.

[3] D.F. Woods, C. Hough, D. Peel, G. Callaini, P.J. Bryant, J. Cell

Biol. 134 (1996) 1469–1482.

[4] T. Ishidate, A. Matsumine, K. Toyoshima, T. Akiyama, Onco-

gene 19 (2000) 365–372.

[5] A.S. Leonard, M.A. Davare, M.C. Horne, C.C. Garner, J.W.

Hell, J. Biol. Chem. 273 (1998) 19518–19524.

[6] N. Sans, C. Racca, R.S. Petralia, Y.X. Wang, J. McCallum, R.J.

Wenthold, J. Neurosci. 21 (2001) 7506–7516.

[7] C.C. Garner, J. Nash, R.L. Huganir, Trends Cell Biol. 10 (2000)

274–280.

[8] E. Kim, M. Niethammer, A. Rothschild, Y.N. Jan, M. Sheng,

Nature 378 (1995) 85–88.

[9] H.C. Kornau, L.T. Schenker, M.B. Kennedy, P.H. Seeburg,

Science 269 (1995) 1737–1740.

[10] M. Sheng, Proc. Natl. Acad. Sci. USA 98 (2001) 7058–

7061.

[11] E. Kim, S. Naisbitt, Y.P. Hsueh, A. Rao, A. Rothschild, A.M.

Craig, M. Sheng, J. Cell Biol. 136 (1997) 669–678.

[12] K. Satoh, H. Yanai, T. Senda, K. Kohu, T. Nakamura, N.

Okumura, A. Matsumine, S. Kobayashi, K. Toyoshima, T.

Akiyama, Genes Cells 2 (1997) 415–424.

[13] M. Takeuchi, Y. Hata, K. Hirao, A. Toyoda, M. Irie, Y. Takai,

J. Biol. Chem. 272 (1997) 11943–11951.

[14] D.T. Pak, S. Yang, S. Rudolph-Correia, E. Kim, M. Sheng,

Neuron 31 (2001) 289–303.

[15] B.C. Roy, T. Kuroda, S. Mori, K. Kohu, T. Akiyama, T. Senda,

Med. Electron. Microsc. 32 (1999) 20–24.

[16] B.C. Roy, K. Kohu, K. Matsuura, H. Yanai, T. Akiyama, Genes

Cells 7 (2002) 607–617.

[17] E.E. Wanker, Y. Sun, A.J. Savitz, D.I. Meyer, J. Cell Biol. 130

(1995) 29–39.

[18] R. Langley, E. Leung, C. Morris, R. Berg, M. McDonald, A.

Weaver, D.A. Parry, J. Ni, J. Su, R. Gentz, N. Spurr, G.W.

Krissansen, DNA Cell Biol. 17 (1998) 449–460.

[19] I. Toyoshima, H. Yu, E.R. Steuer, M.P. Sheetz, J. Cell Biol. 118

(1992) 1121–1131.

[20] J. Kumar, H. Yu, M.P.. Sheetz, Science 267 (1995) 1834–

1837.

[21] K. Hotta, K. Tanaka, A. Mino, H. Kohno, Y. Takai, Biochem.

Biophys. Res. Commun. 225 (1996) 69–74.

[22] A.S. Alberts, N. Bouquin, L.H. Johnston, R. Treisman, J. Biol.

Chem. 273 (1998) 8616–8622.

[23] E. Leung, C.G. Print, D.A. Parry, D.N. Closey, P.J. Lockhart,

S.J. Skinner, D.C. Batchelor, G.W. Krissansen, Immunol. Cell

Biol. 74 (1996) 421–433.

[24] F. Becker, L. Block-Alper, G. Nakamura, J. Harada, K.D.

Wittrup, D.I. Meyer, J. Cell Biol. 146 (1999) 273–284.

Fig. 4. Colocalization of the ribosome receptor with hDLG. HeLa cells

were double stained with antibodies to the ribosome receptor and

hDLG. Scale bars, 50lm.

1154 M. Kim et al. / Biochemical and Biophysical Research Communications 294 (2002) 1151–1154