View
250
Download
1
Embed Size (px)
Citation preview
Avian Influenza H5N1: Vaccination Against a PandemicAvian Influenza H5N1: Vaccination Against a Pandemic
HPAI H5N1 Epidemic in Poultry Populations in Asia
Vaccination Against a Potential Pandemic
The WHO issued a influenza pandemic preparedness plan in 1999 One initiative of the plan is to rapidly prepare a vaccine against
H5N1 One commercial vaccine-producing institution and several research
institutions are currently on the case K. Subbarao et al. and M. Liu et al. have used a process of plasmid
based reverse genetics to create an experimentally working H5N1 vaccine
What Is H5N1?
Influenza A from the family of Orthomyxoviridae
Negative single-strand RNA virus with segment genome
Haemagglutiinin and Neuraminidase viral proteins
15 subtypes of haemagglutinin and 9 subtypes of neuraminidase
All subtypes exist in wild aquatic birds
H5N1 Statistics
Wild aquatic birds are a natural reservoir for all influenza A viruses
Hong Kong 1997 outbreak of H5N1 AI in poultry resulted in the first human cases: 18 infected, 6 die
In 2003 a new subtype of H5N1 AI infected humans
WHO reports that since January 28, 2004, 44 infected resulting in 32 deaths
New subtypes produce a morbidity rate of 70% in humans compared to 33% of the initial H5N1
Nomenclature AI : Avian Influenza HP: High Pathogenic LP: Low Pathogenic HA: Haemagglutinin NA: Neuraminidase
A/goose/Guangdong/1/1997 (H5N1)Antigenic Type
Infected animal
Geographic site of isolation Year of isolation
Antigenic description
• Influenza A H5N1 strain #1 isolated from a goose in Guangdong during 1997
Strain #
Increasing Virulence of H5N1
Antigenic drift resulting from point mutations in the HA and NA genes
Alterations in the surface protein (HA) results in the loss of antibody to neutralize new virus
Query: 541 aataataccaaccaagaagatcttttggtactnnnnnnnattcaccatcctaatgatgcg 600 |||||||||||||||||||||||||||||||| |||||||||||||||||||||Subjct:569 aataataccaaccaagaagatcttttggtactgtgggggattcaccatcctaatgatgcg 628
Query: 601 gcagagcagacaaagctctatcaaaacccaaccacctatatttccgttgggacatcaaca 660 ||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||||Subjct:629 gcagagcagacaaggctctatcaaaacccaaccacttatatttccgttggaacatcaaca 688
• BLAST nucleotide alignment of two haemagglutinin genes from A/chicken/Hubei/489/2004(H5N1)and A/chicken/Thailand/CH-2/2004(H5N1)
Subbarao 2004
Haemagglutinin
HA is to binds to the host cell by sialic acid receptors containing either alpha 2,6-galactose linkages (human) or alpha 2,3-galactose linkages (avian)
Binding of alpha 2,6-galatose linkages corresponds to human epithelial cells and alpha 2,3-galactose linkages corresponds to avian intestinal epithelial cells
Possible reason why H5N1 is not able to cause human-to-human transmission is that haemagglutinin of avian origin has not acquired human receptor-binding specificity.
Once haemagglutinin binds it elicits a neutralizing antibody response
Determining Pathogenicty
Pathogenicity determined by cleavage of the haemagglutinin into two subunits
Low pathogenicity caused by proteases in mammalian respiratory tract/ avian intestinal tract cleaving the haemagglutinin
High pathogenicity determined by proteases present in a multitude of tissues to cleaving haemagglutinin
Highly pathogenic H5 has multiple basic amino acid in connecting peptide of the HA gene, which is adjacent to the cleavage site
Current vaccine research for HPAI H5N1 targeted to the multiple amino acid motif
Subbarao et al. and Liu et al. two groups of researchers that have created an inactivated H5 HA by eliminating the multiple amino acids.
Copyright ©2002 by the National Academy of Sciences
Guan, Y. et al. (2002) Proc. Natl. Acad. Sci. USA 99, 8950-8955
Fig. 1. Phylogenetic trees for the H5 HA1 (a), NP (b), and NS (c) genes of influenza A viruses
Vaccination Production By Reverse Genetics
Reverse genetics: method of genetically engineering portions of the genome and observing the resulting phenotype
Benefits of using reverse genetics:
1. creating a safer virus to work with
2. decreasing embryonated egg mortality
3. higher growth yields/ faster to produce
Can inactivate H5 HA gene by modifying the multiple basic amino acids adjacent to cleavage site associated with HPAI
Experiments: Subbarao et al. Targeted H5 Ha gene of wt HK/491/1997:
GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT
Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe
Modified:
ACT CGA GGA TTA TTT
Thr Arg Gly Leu Phe
• Removed basic amino acid motif by RRT-PCR
• Isolates and rescues PR8 gene from A/Puerto Rico/8/34 (PR8) (H1N1)
•Transfected 293t cells with plasmid containing isolated genes
• Reassortant phenotype: H5N1/PR8
Experiments: Subbarao et al.
Reassorted virus passed in 9-10 day old embryonated eggs Grown in the allantoic cavity to high infectivity titers No plaques on MDBK cells in absence of trypsin Tested virus on chickens resulting in no deaths, no shedding and
50% with detectable antibodies Tested on BALB/C mice, no deaths, but low detectable shedding in
lungs Removal of basic amino acid motif resulted in loss of virulence for
H5N1
Experiments: Subbarao et al.
Produced a Formalin-inactivated H5N1/PR8 vaccine Protected chickens and mice challenged with wt H5N1
Experiments: Liu et al.
Constructed efficacious H5N3 vaccine Still protected against H5N1 except with the benefit of differentiating
between the vaccinated and the infected by different NA Similar deactivation of H5 HA region: A/goose/HK/437-3/99 (H5N1)
GAG AGA AGA AGA AAA AAG AGA GGA TTA TTT
Arg Arg Arg Arg Lys Lys Arg Gly Leu Phe
Modified:
ACA AGA GGA TTA TTT
Thr Arg Gly Leu Phe
Experiments: Liu et al.
Also obtained PR8 from A/Puerto Rico/8/34 (PR8) (H1N1) N3 taken from A/Duck/Germany/1215/73 (H2N3) Same technique of reassortment No embryo death and no plaque formations No detectable replication in chickens Low replication in mice including brain and lungs, but not after 7
days
Experiments: Liu et al.
Tested the efficacy of the H5N3 vaccines on chickens Allantoic fluid of H5N3 vaccine in oil-emulsion adjuvant was
efficacious against H5N1, concentration or purification not needed Added benefit of discriminating between vaccinated and infected
individuals
Discussion of Results
Results of the attenuated reassortant viruses and vaccine production indicate that use of reverse genetics have relevance to the prevention and control of H5N1 in poultry populations and potential human pandemic
Testing for a better animal model for humans has potentially been found
The benefits of using reverse genetic for vaccine process were demonstrated
Currently no human vaccine is available, but trials will start soon
Points to Ponder
Exclusive use of cell culture to generate and grow vaccine Who/what target for vaccination Other means of prevention: surveillance, stockpiling, communication Intellectual property rights on reverse genetics technology
Finally…
There is a worldwide surveillance set-up and the US has been efforts to accrue prophylaxes drugs, especially neuraminidase inhibitors
Stricter hygiene guidelines have also been enforced in domesticated poultry farms
These efforts serve as a template for any new emerging infectious disease
Hopefully we will not see the projected statistics of a pandemic influenza due to early intervention