S-1

Paper title: Kinetic and catalytic properties of M.HpyAXVII, a phase variable DNA methyltransferase from Helicobacter pylori

Authors: Yedu Prasad, Ritesh Kumar, Awanish Kumar Chaudhary, Rajkumar Dhanaraju, Soneya Majumdar and Desirazu N. Rao

List of materials: Figures S1, S2, S3, S4, S5, S6.

S-2

Figure S1

Figure S1. Sequence alignment of M.HpyAXVII protein sequence across 58 strains – The primary sequence of M.HpyAXVII from 58 strains were aligned using

MUSCLE multiple sequence alignment algorithm and a sequence logo was generated using WebLogo server. The relatively non-conserved TRD region is highlighted.

S-3

Figure S2

Figure S2. Cloning, over-expression and purification of M.HpyAXVII - (A) BamHI and XhoI Restriction digestion of pET-28a expression vector containing hpyaxvii gene.

Lanes marked U = uncut, C = cut. (B) IPTG-induced expression of M.HpyAXVII MTase. Lanes marked UI = Uninduced, I = Induced. (C) M.HpyAXVII purified protein.

Lanes marked WT = Wild type, Marker = Unstained protein marker (fermentas) (D) Western blot with Anti-His6 tag antibody. (E) Western blot with polyclonal antibodies

against M.HpyAXVII raised in rabbit.

A B C

D

E

S-4

Figure S3

1 2 3

A B

Figure S3. Determination of methylation site – (A) MnlI digestion of duplex 11 (Table

2) pre-methylated with M.HpyAXVII. Digestion products were separated on 20% PAGE.

Lanes 1 = Cut, 2 = Uncut, 3 = Marker. [3H-methyl] Counts per minute (CPM) obtained

for each fragment and uncut duplex are given in the table. (B) – M.HpyAXVII dependent

methylation of 26-bp DNA duplex substrates with recognition sequence 5’ TCAGN 3’,

where “N” is A, C, G, or T.

5´ GATCGATCCCTCGATTCTCAGCTGATCAAG

3´ CTAGCTAGGGAGCTAAGAGTCGACTAGTTC

Fragment CPM

30 bp

19 bp

11 bp

20% PAGE

GATCGATCCCTCGATTCTC AGCTGATCAAG

CTAGCTAGGGAGCTAAGA GTCGACTAGTTC

MnlI Digestion

Fragment 1 Fragment 2

S-5

Figure S4

Figure S4. Methylation activity assessment of M.HpyAXVII mutants – Methylation activity of M.HpyAXVII wild types as well as mutants (F658C and Y407V) were

compared. Increasing concentrations of each enzyme (50 nM to 500 nM) were incubated with 2 µM supercoiled pUC19 DNA and 2 µM of tritiated AdoMet. Reactions were

performed in standard buffer at 37oC for 30 minutes before processing as described in “Experimental procedures”. (Inset) CD spectra of M.HpyAXVII wild type and

mutants. Molar ellipticity is plotted against wavelength (nm) of circularly polarized light.

S-6

Figure S5

Figure S5. M.HpyAXVII methylation in the presence of single stranded DNA (Oligo 1, Table 1). M.HpyAXVII dependent methylation of duplex DNA substrate was

assessed at increasing concentrations of single stranded DNA containing TCAG site. 500 nM of enzyme was used. DNA duplex concentration was 5 μM. AdoMet

concentrations was 2 μM. Reactions were performed in standard buffer at 37oC for 30 minutes before processing as described in “Experimental procedures”.

S-7

Figure S6

Figure S6. Ponceau S staining of pre-probed Western blot depicted in Figure 2A. Lane M – Puregene (Genetix) prestained protein ladder (Sizes of proteins in the ladder, in

kDa, is marked on the left margin). Lanes 1,3,5,7 and 9 – Uninduced samples. Lanes 2,4,6,8 and 10 – IPTG-Induced samples.