Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
ASSOCIATION OF A NONSENSE MUTATION AT THE
CODON FOR GLU 54 IN THE GM2A GENE WITH AB
VARIANT CiMZ GANGLIOSIDOSIS: CHARACTERIZING
THE INTRONf EXON JUNCTIONS OF THE GENE
by
Biao Chen
Thesis submitted in conformity with the requirements For the degree of Master of Science
Department of Laboratory Medicine & Pathobiology University of Toronto
National Library l*l OfCamda Biblïatheque natiar\ale du Canada
Acquisitions and Acquisitions et Bibliographie Senrices services bibliographiques
395 Weüington Sireet 395. rue Wellington Ottawa ON K1A ON4 -ON K 1 A W canada canade
The author has granted a non- L'auteur a accordé une licence non exclusive Licence dowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sell reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/^ de
reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be p ~ t e d or othewise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. autorisation.
TABLE OF CONTENTS
THESIS ABSTRACT.. ..................................................................~........................ v
ACKNOWLEDGMENT ......................................................................................... vi .. LIST OF FIGURES ............................................................................................ .vit
LIST OF TABLES ................................................................................................. ix
AE3BREVIATIONS ............................................................................................... -x
PUBLICATIONS AND PRESENTATIONS .................................................................. xi
CHAPTER 1 GENERAL INTRODUCTION
1 - 1 HISTORICAL INTRODUCTION ......................................................................... -2
1.2 GANGLIOSIDES .............................................................................................. 5
1 .2.1 Structure and nomenclature ........................................................................ 5
1.2.2 Synthesis and degradation ......................................................................... 5
1 .2.3 Functions ............................................................................................. 6 . .
1.2.4 Gm gangliosrde ..................................................................................... 6
1.3 HEXOSAMINIDASES AND THE ACTIVATOR ........................................................ 8 1 .3.1 S tmcture and properties ......................................................................... -3
........................................................... 1 -3 -2 B iosynthesis, processing and transport 9
1.4 THE INTERACTION BETWEEN THE ACTNATOR, G m GANGLIOSIDE AND
HEXOSAMINIDASE A ....................................................................................... -14
............................................................ 1.4.1 The substrates of hexosaminidase A 14
............................. 1.4.2 Role of the Activator in Gw hydrolysis by hexosaminidase A 15
.................................................. 1 .4.3 Binding of the Activator with gangliosides -17
1.4.4 The binding domains in the Activator .......................................................... 18
1 -5 STRUCTURE OF HEXOSAMINfDASE AND THE ACTIVATOR GENES ...................... 18
1 S.1 Hexosaminidase genes .......................................................................... -18
1 S.2 The GM2 Activator gene ........................................................................... 19
1.6 OTHER LYSOSOMAL SPHINGOLIPID ACTIVATOR PROTELNS.. ........................... -21
1.7 GM2 GANGLIOSIDOSES AND MUTATIONS IN THER RELATED GENES .................. 22
1 .7.1 Classification of Gm gangliosidoses ........................................................... 22
1 .7.2 Clinical phenotypes ............................................. ... ........................... 22
1.7 -3 Mutations associated with Tay-Sachs disease and Sandho ff disease ............. .... .. 25
1.7.4 Mutations associated with the AB variant form of Cim gangliosidosis ........ ,. ........ 25
1.8 MOUSE Gm ACTIVATOR PROTEIN AND MOUSE MODELS OF Gm GANGLIOSIDOSES
.......................... ,. ................................................................................ 29 . .
1.8.1 The Gm activator protein in mice ............................................................... 29
1.8.2 Mouse mode1 of Gm gangliosidoses .......................................................... -29
1 -9 THESIS OBJECTIVES ...................................................................................... 30
1.10 REFERENCES ............................................................................................ -31
CHAPTER II CHARACTERIZATION OF THE EXON/ INTRON JUNCTIONS OF THE
GM2A GENE
.................................................................. 2.1 INTRODUCTION ................... ... -42
2.2 MATERIALS AND METHODS .......................................................................... 45
2.2.1 Isolation of genomic DNA ...................................................................... 45
2.2.2 Long PCR to ampli@ intron 1 and intron 2 of the GM2A gene ............................ 45
................................................. 2.2.3 Restriction analysis of intron 1 and intron 2 -48
.................... 2.2.4 Subcloning of both ends of introns 1 and 2 into the pBluescnpt vector 48
................................... 2.2.5 Nucleotide sequencing fkom both ends of intron 1 and 2 48
2.2.6 Use of PCR to ampli@ ail of the exons and exon/ intron junctions of the GM2A
............................................................................... gene ................. ... -49
................................................................................. 2.2.7 Direct sequencing .5 1
.................................................................................................... 2.3 RESULTS 51
................................................................................................ 2.4 DISCUSSION 55
.................................................................................... 2.5 ACKNOWLEDGMENT 62
.............................................................................................. 2.6 REFERENCES -63
CHAPTER III ASSOCIATION OF A NONSENSE MUTATION AT THE CODON FOR
GLU54 IN THE GMZA GENE WITH ACUTE AB VARIANT Cm GANCZIOSlDOSIS
3.1 INTRODUCTION ........................................................................................ ...67 3.2 MATERIALS AND METHODS ................. .., ....................................................... 68
3.2.1 Patient information ............................................................... .. .......... 68
3.2.2 Ce11 lines and leukocyte sample ............................................................... -69
3.2.3 Western blot analysis ............................................................................. 69
3.2.4 Poly A' RNA isolation and Northem blot analysis ......................................... -70
3.2.5 Total RNA isolation and RT-PCR .............................................................. 71
3.2.6 Cloning and sequencing of the normal and patient Activator cDNA ....................... 72
3.2.7 PCR amplification of genomic DNA fragments containing nucleotide 160 ............. 72
3.2.8 Direct sequencing, ............................................. .. ................................. 73
3.2.9 Determination of the length of intron 1 & 2 of the GM2A gene fiom the patient's
genomic DNA by long PCR ........................................................................... 73
...... 3.2.10 Detection of the Activator rnRNA lacking exon 2 in normal genomic DNA ... .. 73
..................................................................................................... 3.3 RESULTS 74
................................................................................................. 3.4 DISCUSSION 87
.................................................................................... 3.5 ACKNO WLEDGEMENT 93
3.6 REFERENCES .............................................................................................. -94
CHAPTER IV FUTURE WORK
................................................... 4.1 Expression of the exon 2-lacking activator in E coli 98
4.2 Testing the Iipid binding b c t i o n of the exon 2-lacking activator ................................... 99
4.3 EstabIishing a pennanently exon 2-lacking cDNA transfected CHO cell line .................... -99 ............................. 4.4 Determination of the levels of exon 2-lacking mRNA in variant tissue 100
............................................................................................. 4.5 REFERENCES 101
ASSOCIATION OF A NONSENSE MUTATION AT CODON FOR GLU
54 IN THE GM2A GENE WITH AB VARIANT C;M2 GANGLIOSIDOSIS:
CHARACTERIZING THE INTRON/ EXON SUNCTIONS OF THE GENE
by
Biao Chen
Department of Laboratory Medicine & Pathobiology University of Toronto
1999
THESIS ABSTRACT
The AB variant form of Gm gangliosidosis is an inherited lysosorna1 storage disease caused
by mutations in the GM2A gene. In this study, the introd exon junction of GMZA gene was
characterized, and a PCR procedure was developed to quickly analyze the GM2A gene for
mutations. Meanwhile, a new AB variznt patient was detected and characterized. The patient was
found to be deficient in both Gm activator protein and niRNA. RT-PCR and sequencing detected
some normal size cDNA (containing a single nonsense mutation in exon 2 (Glu54STOP)) along
with a lower-level of a smaller cDNA species (an infiame deletion of exon 2 (AE2)). Further
experiments excluded the possibility that AE2 specie was a product of abnonnal splicing from a
second mutant allele. Finally, through restriction digestion and nested amplification of RT-PCR
product, the normal sample was also found to contain AE2 species mRNA. Therefore, a
Glu54STOP nonsense mutation and a naturally occwring transcript oPAE2 were identified.
1 would like to extend my sincere gratitude to my supervisor, Dr. Don Mahuran, for his
constant support and guidance. 1 wish to thank Dr. John Callahan for his critical comments on the
manuscripts of rny thesis. 1 also like to thank the other members of my advisory cornmittee, Dr.
Paul Thorner and Dr. Janet Forstner, for their participation in evaluating my work.
1 highly appreciate al1 colleagues in Dr. Mahuran and Dr. Callahan's laboratories for their
friendship and assistance. 1 would like to thank Sunqu Zhang, Brigitte Rigat, Roderick Tse,
Yongmin Hou, Scott Bukovac, Huinan Deng and Natasha Smilljanic-Georgijev for their helpful
advice and discussion. 1 specially thank Amy Leung for her great technical assistance and Mana
Chow for her kindly help. 1 would also like to acknowledge Rick Bugshow, Irené Warren and
Marie-Anne Skomorowski for making an enjoyable place to work.
1 would like to appreciate Dr. Raymond Tellier for his critical advisors in long PCR
technique. 1 would like to thank Dr. Chi-Chung Hui for his continued encouragement and support
and Dr. Qi Ding for her valuable experimental suggestion. 1 also like to thank Dr. Joe Clarke for
offering clinical data and Dr. Paula Strasberg for her technical advisors.
Most of al1 1 would like to thank my wife, Meili, for her understanding, encouragement and
love, and my son, Richard, for making my life joyous 2nd worthwhile.
Chapter 1
Fig. 1-1.
Fig. 1-2.
Fig. 1-3.
Fig. 1-4.
Fig- 1-5.
Fig. 1-6.
Fig. 1-7.
Fig. 1-8.
Chapter 2
Fig. 2- 1.
Fig. 2-2.
Fig. 2-3.
Fig. 2-4.
Fig. 2-5.
Chapter 3
Fig. 3- 1 .
Fig. 3-2.
Fig. 3-3.
Fig. 3-4.
Fig. 3-5.
Fig. 3-6.
Fig. 3-7.
S tnicture of G , ganglioside.
Lysosomal degradation pathway for gangiioside GM,.
Disulfide bonds in the Activator protein
Mode1 for lysosomal protein targeting to lysosomes
A mode1 of the two known functions of the Activator
The known GM2A gene structure in 1996
The variants of G , gangliosidosis
Mutations and polymorphisms in the GM2A gene
Determination of the length of intron 1 and intron 2 of the GM2A gene
Digestion of intron 1 and intron 2 with BarnHI and Ssd
PCR amplification of al1 4 exons and digestion with unique restriction
endonucleases
Restriction map of the GM2A gene
Nucleotide sequences of GM2A exons and their flanking intronic sequences
Western blot analysis
Northem blot analysis
Reverse transcription and PCR analysis
Nucleotide sequence of cDNA fiom hvo normal individuals
Nucleotide sequence of the larger cDNA fiom the patient
Nucleotide sequence of the smaller cDNA fiom the patient
(A) Digestion of exon 2 flanking region with M d V (B) The digestion
diagram of exon 2 flanking region with W V
vii
Fig. 3-8, Nucleotide sequence of a PCR amplifïed region of the GM2A gene containhg
nucleotide 175 fiom three normal individuals
Fig. 3-9. Direct sequencing of PCR products fkom the patient's genomic DNA
Fig 3- i 0. Digestion of intron 1 of the GM2A gene obtained by PCR with EcoM and
BamHI
Fig. 3- 1 1. (A). Digestion of wild type cDNA and the exon 2-lacking cDNA (AE2) by
Hinf l. (B). Digestion diagram for fiil1 length and AE2 cDNA by Hinf 1
Fig. 3- 12. Nested PCR amplification of RT-PCR product fiom the patient and a normal
individual
Chapter 4
No figures
viii
LIST OF TABLES
Chapter 1
Table 1 - 1 Naturally occurring mutations in the G W A gene
Table 1-2 GM2A gene polyrnorphisms
Chapter 2
Table 2-1 Pnmers used to ampli@ intron 1 and uitron 2 of GMZA gene
Table 2-2 Primers used to ampli@ the exons and the exon/ intron junctions of GM2A gene
Chapter 3
No tables
Chapter 4
No tables
4-MUG 4-MUGS Activator bp cDNA Cer CHO ceil cpm CRM Da DTT ER FCS Ga1 GalNAc Glc GlcNAC Hex IVS kb M6P MEM NeuNAc nt PAGE PCR SAP SDS WT AE2
4-methylumbelliferyl PN-acetylglucosamuie 4-methylumbelliferyl p-N-acetylglucosamine-6-sulfate the human G , activator protein base pair complementary DNA ceramide Chinese Hamster Ovary ce11 counts per minute cross reacting material Dalton dithiothreitol endoplasmic reticulum fetal calf serurn galactose N-acetylgalactosamine glucose N-acetylglucosamine B-N-acetylhexosaminidase (EC 3 -2.1.52) intervening sequence kilobase pairs mannose-6-phosphate minimum essential media N-acetylneuraminic acid (sialic acid) nucleo tide(s) poIyacrylamide gel electrophoresis polymerase chain reaction sphingolipid activator protein sodium dodecyl suIfate wild type a deletion of exon 2 Erom Activator mRNA
Publications & Presentations
B. Chen, B. Rigat, C. Curry and D. J. Mahuran. Structure of the GMZA gene: Identification of an
exon 2 nonsense mutation and a naturally accu-g transcript with an inframe deletion of exon 2
(1999). Arnerican Journal of Human Genetics, Volume 65: 77-87.
B. Chen, B. Rigat, J. T. R. Clarke, and D. J. Mahuran, G175A transition (Val59Ile substitution) is a
novel polymorphism in human G W A gene. Presented in the Garrod Association of Canada
Conference, April 1997, Toronto
CHAPTER 1
GENERAL INTRODUCTION
1.1 HISTORICAL INTRODUCTION
The GMz activator protein (the Activator) was identified and characterized as a result of the
discovery of its participation in the hydrolysis of GMt ganglioside (GaiNAccS(1-4)-(NeuNAca(2-
3)) -Galp( 1 -4)-Glc-ceramide) (Fig 1 - 1) by ~hexosaminidase A (Hex A) (Conzelmann and Sandhoff
1979). The interest in Hex A derived fiom the discovery that deficiency in its activity is associated
with the Tay-Sachs disease (Okada and O'Brien 1969). This disease was first described late in the
last century (Sachs 1887; Tay 1881) as a common hereditary disease in Jews (Sachs 1896)- Tay-
Sachs disease is the most common of three disorders caused by the intralysosomal storage of GM2
ganglicside (Kienk 1935), which are known as Gm gangliosidosis (Suzuki and Chen 1967). Gm
ganglioside contains a terminal, nonreducing fblinked GalNAc residue, which can be cleaved by
hexosaminidase (Hex) (Makita and Yamakawa 1963; Svennerholm 1962). Hex can be separated
into two major isoenzymes, Hex A and Hex B (Robinson and Stirling 1968). The patients with
Tay-Sachs disease were found to lack the A but not the B isozyme (Okada and O'Brien 1969). It
was found that whereas Hex A is composed of an acidic a subunit and a basic subunit, Hex B is
composed of two P subunits (Snvastava and Beutler 1973). Thus classic Tay-Sachs disease results
from defects in the unique a subunit which preclude the formation of only Hex A. Other studies
demonstrated that some non-Jewish patients presumed to have Tay-Sachs disease were missing both
Hex A and Hex B or, even more paradoxically, had normal levels of both isoenzymes (Sandhoff
1969). The lack o f both Hex A and Hex B was referred as O variant of G M ~ gangliosidosis or
Sandhoff disease. It results fiom a deficiency of the $ subunit, precluding the formation of either
isoenzyrne. The existence of normal Hex A and Hex B levels in patients with Gm Gangliosidosis,
referred to as the AB variant form, suggested other r'actor(s), in addition to Hex A, participated in
the hydrolysis of ClhlZ ganglioside.
Site of Hex A cleavage i
oligosaccharide ceramide
O - C C C H
r?c A, I II wcn
GalNAc Gal Glc Cm 1 1 - CWOH t cm CHOH 1 - O .
I L 2 cn2 I f CH2 -
I L - 1
II CH2
stearic acid
I; NeuNAc
d2 1 sphingosine
CH2
Fig. 1-1. Structure of Gw ganglioside. The cleavage site of G m hy Hex A is indicated. Gal,
galactose; Glc, glucose; NeuNAc, N-acetylneuraminic acid (sialic acid); GalNAc, N-
acetylgalactosamine.
Through the study on the patients with AB variant Gm gangliosidosis, Conzelmann and
Sandhoff suggested that a "stimulating factor", which can stimulate Hex A to hydrolyze Gm, was
deficient (Conzelmann and Sandhoff 1978). Li and colleagues also found that "a heat stable factor"
obtained fiom a crude Hex fraction fiom human Iiver could stimulate the hydrolysis of Gm by Hex
A, but not Hex B (Li et al. 1973). This "heat stable factor" was identified as a protein, the
Activator, without any inherent enzyme activity towards ganglioside (Hechtman 1977). The
Activator was purified and further characterized as a small (Mr=22,000), acidic (p14.8) monomer
(Conzelmann and Sandhoff 1979). Further study indicated that the Activator did not activate Hex
A, but functioned as a transport protein by solubilizïng a single molecule of ganglioside Gm fkom
the lysosomal membrane and presenting it to Hex A for hydrolysis (Conzelmann et al. 1982).
In the 1990s, the Activator was M e r characterized at the molecular level. The Activator is
encoded by GM2A gene on chromosome 5 Weng et al. 1993). Its deduced sequence includes 193
amino acids with the N-terminal23 amino acids as a signal peptide, the following 8 amino acids as
a propeptide and the remaining 162 amino acids as the mature f o m that contains one site for N-
linked gl ycosy iation. The complete localization of the Activator's four disulfide bonds has been
reported (Schütte et al. 1998) and a mouse mode1 for the AB variant fonn of Gm gangliosidosis has
been established (Liu et al. 1997). Four mutations in the GM2A gene have been reported to be
responsible for deficiencies of the Activator protein, causing the AB variant form of GM2
gangliosidosis (Schepers et al. 1996; Schroder et al. 1991; Xie et al. L992b). Recently, other
functions of the Activator have been identified. In addition to its fùnction as a cofactor for the
hydrolysis of GM2 by Hex A, the Activator has been shown to bind, solubilize and transport a broad
spectrum of Iipid molecules (reviewed in (Mahuran 1998)). Furthemore. the Activator's
intracellular transport is only partially dependent on the Mannose-6-phosphate receptor (MPR) .
Besides the lysosomal form, secretory forms of the Activator are also present, and once secreted
they can be re-captured fkom the extracellular fluid through a second carbohydrate-independent
rnechanism (Rigat et al. 1997).
1.2 GANGLIOSIDES
1 -2.1 Structure and nomenclature
Gangliosides are a group of glycolipids consisting of a hydrophobic ceramide and a
hydrophilic oligosaccharide chain. The presence of one or more sialic acid residues separate these
compound from glycolipids (Sandhoff et al. 1989). Gangliosides are classified based on their
oligosaccharide moiety alone, i-e. regardless of variations in the lengths of the hydrocarbon chains
comprising the s2hingosine and fatty acid components. Members of the ganglio-family are
designed by "G". The number of sialic acid residues in a ganglioside is designated by a capital
letter: A (asialo-), M (monosialo-), D (disialo-), T (trisialo-), Q (quatrosialo-), etc. The length of the
neutrd sugar chain is designated by a number following the formula "5-n", where "n" is the number
of neural sugars in the ganglioside.
1.2.2 S-wthesis and derrradation
The synthesis of gangliosides begins in the smooth ER where the ceramide portion is
synthesized from serine and palmitoyl CoA. After the addition of an amide-linked fatty acid, the
ceramide is transferred to the Golgi apparatus (Zeller and Marchase 1992)' where ceramide is
glycosylated by the transfer of the individual sugar from the respective uridine-5'-diphosphate
(UDP) derivatives. Glucose first links with ceramide to forrn glucosylceramide (GlcCer) in the
presence of glucosyltransferase, then galactose joins to GlcCer to forrn lactosylceramide (LacCer)
catalyzed by gdactosyltransferase. The sequential addition of monosaccharide or sialic acid
residues to the growing oligosaccharide chain, yielding ganglioside CiM3 and more complex
gangliosides, is catalyzed by membrane-bound glycosyltransferases.
Afier their synthesis in the Golgi, gangliosides are transported to the plasma membrane by
vesicular flow and anchored to the outer leaflet of the membrane by their ceramide moieties, with
their ~Iigosaccharides extending into the extracellufar space (Van Echten and Sandhoff 1993).
Gangliosides on the plasma membrane are ultimately transported to the lysosomal cornpartment for
degradation after endocytosis. Degradation occurs in the lysosome through the sequential removal
of the monosaccharides tiom the non-reducing terminal end of the molecule, each by a specific
lysosomal glycosidase (Fig 1-2), in the reverse of their order of synthesis. In most cases, a
deficiency of any one of these enzymes results in a lipid storage disease (reviewed in (Neufeld
199 1)).
1.2.3 Functions
Gangliosides anchor to the plasma membrane through their hydrophobie ceramide moiety so
that their hydrophilic oligosaccharide chains extend into the extracellular space and form cell-type
specific patterns on the cell surface. Gangliosides play important roles in ce11 recognition and
adhesion, and in signal transduction (Zeller and Marchase 1992). They are especially abundant in
neurones where they assist with synaptic transmission and neuro-protection (Thomas and Brewer
i 990)-
1.2.4 G - M-> an di oside
Guz ganglioside is an intermediate in both the synthesis and degradation of Gui, which is
more abundant in normal neuronal cells. GM2 ganglioside contains ceramide core and a
trisaccharide (gangliotriaose) chain with one sialic acid (Fig 1-1). GM2 ganglioside is almost
exclusively degraded through the removal of the terminal GalNAc by Hex A to produce Gm in
Gal-GalNAc-Gd-Glc-Cer I
NeuNAc (G,,gangiioside)
w l i o s i d e 8-cialactosidase Ga1
GaihiAc-Gal-Glc-Cer I
NeuNAc (G, ganglioside) I
osaminidase A GaiNAc
1 - NeuNAc
(G, ganglioside)
NeuNAc A- neuraminidase
Gal-Glc-Cer (lactosylceramide)
&galactosidase
Ga1 Glc-Cer (glucosylceramide)
ocerebroside &glucosidase Glc
Cer
+ fatty acid + sphingenine
Fig. 1-2. Lysosomal degradation pathway for ganglioside GMI. The names of the hydrolysis
products are in the brackets, while the hydrolases are underlined.
human, however, in mice, Gm is also slowly degraded through the removal of the other terminal
residue, NeuAc, by sialidase to fom GAZ (Sandhoff et al. 1989).
1.3 HEXOSAMINIDASES AM) THE G m ACTIVATOR
1 -3.1 Structure and moperties
Lysosomal p-hexosaminidase (&N-acetylhexosaminidase, EC 3.2.1.52, Hex) cleaves
terminal b-linked N-acetylglucasamine (GlcNAc) and N-acetylgalactosamine (GalNAc) residues
from glycolipid (including GM~, GAZ and globoside), glycoprotein-derived oligosaccharides and
glycosaminoglycans; as well as Ciom artificial substrates which contain fluorescent or chromogenic
properties after hydrolysis. The family of hex isozymes results from the three possible dimeric
combinations of two subunits, a and p, Le. Hex A (a$), Hex B (PB) and Hex S (aa) (Beutler 1979).
In normal human tissue, Hex A and Hex B are the two major isoenzymes. Hex S can only be
detected in samples from the patients with Sandhoff disease (see GM2 gangliosidoses) in which
p-subunits are deficient. Hex A is thermolabile at 50°C while Hex B is thermostable at this
temperature. Hex S is highly thermally labile ( I ~ o M ~ et al. 1975; Sandhoff 1969).
Mature Activator contains 162 amino acid residues and a single N-linked carbohydrate
moiety bound at Asn 63 (Fürst et al. 1990). It is a srnaIl (22kDa) and acidic (PI, 4.8) monomeric
protein, which is heat stable up to 60°C (Conzelmann and Sandhoff 1979; Li et al. 1981). The
Activator contains 8 cysteine residues, which fonn four disulfide bonds at Cys39- 183, Cys99- 106,
Cys 1 12- 138 and Cys 125- 136 (Schütte et al. 1998) (Fig 1-3). The latter three disulfide bridges fa11
within a stretch of 39 residues Iocated in the central third of the molecule. This region also contains
seven out of seventeen prolines, and may serve to keep the central part of the activator in a highly
restricted conformation. This structural element may play a critical role with regard to the stability
and hctionality of the Activator (Schütte et al- 1998).
The Activator is present in various body fluids and tissues such as kidney, placenta, brain,
spleen, Iiver, and serum, but is highest in kidney (800 nglmg protein) and urine (600 ng/mg protein)
(Bane rjee et al. 1984). It is laborious to puri@ the Activator from human tissues and the yield is
also low, e.g. using one kg of human kidney as the starting material only about 1 mg of the
Activator can be isolated (Conzelmann and Sandhoff 1979). Furthemore, the purification of the
Activator often does not totally exclude contamination of other sphingdipid activator proteins (see
Section 1.6). This problem has been solved by the production of hc t iona l re-folded Activator
from transformed bacteria. The recombinant functional Activator has been produced by three
laboratories (Klima et al- 1993; Wu et al. 1994; Xie et ai. 1998). The CO-factor activity of the
unglycosylated refolded protein was found to be similar to that of the wild-type Activator isolated
from the media of transfected CHO cells (Rigat er al. 1997; Smiljanic-Georgijev et al. 1997).
1 -3.2 Biosynthesis. processine and trans~ort
Like other lysosomal glycoproteins, the Hex isoenzymes are synthesized and processed
through a complex biosynthetic pathway which includes the rough ER and Golgi apparatus
(reviewed in (Grave1 et al. 1995)). Briefly, the a and P subunits of hexosaminidases are
synthesized on ribosomes bound to the rough ER as prepropolypeptides, which are cleaved to
propeptides CO-translationally. Both pro-a and pro-p chains are glycosylated at selected Asn-X-
Ser/Thr (Kornfeld and Kornfeld 1985; Komfeld 1986), fold to their near native conformation
(Pelham 1989) and f o m into dimers in ER/ cis Golgi network (Hurtley and Helenius 1989). The
phosphorylation
Fig. 1-3 Disulfide bonds in the Activator protein. Four disulfide bonds are indicated with dot lines.
The eight cystine residues are indicated with bold numbers. The bIank area refers to the
mature form of the Activator, and the cross-hatching areas represent signal peptide. The gray
area represents the 8 residues of the propeptide that are cleaved to form the mature Activator
protein.
of selected mannose residues on the oligosaccharide chains specifically targets the enzymes to the
lysosome via the mannose-6-phosphate receptor @PR) in the trans Golgi network (Mahuran 199 1 ;
Sonderfeld-Fresko and Proia 1989). In the lysosome, M e r proteolytic and glycosidic processing
occur to form the mature enzyme. The pro-a chain is cleaved into two disulfide-linked chains of 53
kDa (a,) (Hasilik and Neufeld 1980; Mahuran and Lowden 1980) and 7-kDa (ap) (Hubbes et al.
1989). Similarly, the pro+ chain is cleaved into three chains of 30-kDa (Ba), 24-26 kDa (Pb)
(Mahuran and Gravel 1988; Mahuran et al- 1982), and 7-10 kDa (Bp) (Hubbes et al. 1989). The
two (c(,c(,) and three (&&f&) polypeptide chains are held together in their respective mature
subunits by disulfide bonds to form the mature Hex A and Hex B, respectively.
The Activator is also synthesized as a prepropolypeptide (193 residues, Mr=20,000) on
ribosomes attached to the rough ER (reviewed in (Gravel et ai. 1995)). The signal peptide (residue
1-23) is cleaved by signal peptidase in the lumen of the ER, resulting in a pro-polypeptide of 170
residues and a Mr of 18,000. This event may be followed by the addition of an oligosaccharide
chain to the asparagine 63 residue contained in the consensus sequence, Asn-X-Ser/Thr. The final
conformation of the monomor is the formation of its 4 disulfide bonds (Fürst er a[. 1990; Xie et al.
1998). Depending on the composition of its oligosaccharide, the pro-polypeptide can have a Mr as
determined by SDS-PAGE, of 22,000 Da (hi& mannose type), 24,000-27,000 Da (complex type) or
20,000 Da (no oligosaccharide) (Rigat et ai. 1997) (Glombitza et ai. 1997).
AAer the newly synthesized propolypeptides are properly folded, they pass out of ER/ cis
Golgi network and enter the cis Golgi where continued Golgi transport is via bulk blow. Mannose-
6-phosphate (M6P) markers may be added to its high mannose-type oligosaccharides in the cis
Golgi networkl cis Golgi in order to specifically target the propolypeptides to the lysosome.
Addition of the M6P marker also prevents high mannose oligosaccharide fiom being processed to a
complex-type structure, which is typical of secretory proteins. The M6P markers are generated by
12
the sequential action of two Golgi enzymes. First, GlcNAc-phosphotransferase transfers GlcNAc-
1 -phosphate £tom the nucleotide sugar uridine diphosphate-GlcNAc to select mannose residues to
give rise to a phosphodiester intermediate. Then, GlcNAc-1-phosphodiester glycosidase removes
the GlcNAc residue to expose the recognition signal (Komfeld and Sly 1995; Lang er al. 1984).
The importance of this process is underlined by the occurrence of 1-ce11 disease which is a severe,
fatal disease caused by the deficiency of GlcNAc-phosphotransferase. FibrobIasts fiom 1-ce11
patients secrete a large percentage of their newly synthesized lysosomal proteins into the culture
media because the pathway for targeting to the lysosome is defective in these cells (Burg et a/.
1985; Hasilik and von Figura 198 1).
The phosphorylation of propolypeptides specially targets them to the lysosome through their
interaction with M6P receptors (Ml?R) in the trans Golgi network (TGN) (Griffiths et al. 1988).
There are two distinct MPRs, CI-MPR (cation-independent) and CD-MPR (cation-dependent). The
large (270 kDa) CI-MPR is also the receptor for insulin-like growth factor II (Morgan et al. 1987).
Both type of MPRs are transmembrane proteins and can be concentrated in clathrin-coated vesicles
on the TGN membrane by the adaptor proteins. The adaptor proteins include the AP-2 adaptors
which are responsible for coated-pit formation at the plasma membrane and M-1 adaptor which act
at the TGN membrane (Glickrnan et al. 1989; Pearse and Robinson 1990). Both MPRs function in
the Golgi-endosome-lysosome pathway, but only the CI-MPR hc t ions at the plasma membrane
and accounts for the "re-capture" activity of cells towards M6P-containing proteins with subsequent
transport to the lysosome (Kornfeld 1990) (Fig 1-4).
Although the major intracellular transport pathway for most lysosomal proteins that do not
contain a transmembrane domain is via a MPR, MPR-independent pathways also exist in some
cells. For example, skin fibroblasts corn 1-ce11 disease patients are deficient in most soluble
lysosomal enzymes, however, other cells, e-g. lymphoblasts, liver and kidney, often contain near
RER
I Biosynthetic pathway 1
Golgi & cis
trans rn
lysosome
O + secretory pathway
w 0 0
Secretory proteins
lysosomal enzymes
-f mannose-6-phosphate receptor
a cytosolic vesicle (clathrin coated)
Fig. 1-4. Mode1 for lysosomal protein targeting to lysosomes
normal levels of the enzyme (Nolm and Sly 1989). Recently, the transport of the Activator in
human fibroblasts has been studied in our laboratory (Rigat et al. 1997). In this report, we identify
the MPR pathway as the major biosynthetic route for the incorporation of the Activator into the
lysosomes of fibroblasts. We also demonstrate that a large percentage of the newly synthesized
Activator does not contain the M6P tag, but contains complex-type oligosaccharides and is
normally secreted. The refolded Activator from bacteria with no oligosaccharide c m be
endocytosed by a carbohydrate-independent mechanism. Simiiar results were also reported tiom
the transport of the Activator in human epidermal keratinocytes (Glombitza et al. 1997). However,
in the latter study the author estimated that only 10% of the Activator was phosphorylated and that
70% was retained intracellularly; thus, they concluded that there must be a major MPR-independent
biosynthetic pathway for the Activator. These data suggest that a large fraction of the Activator
synthesized in normal cells is treated as secretory rather than Iysosomely-targeted proteins and this
secretory form could serve as a glycosphingolipid transport protein.
Afier the Activator enten the lysosome, the propolypeptide is processed by proteolytic and
glycosidic enzymes to form 22 kDa mature protein. The activator precursor is the major form found
in the culture medium, while the mature f o m is detected in cells, suggesting a rapid processing
compared to the low biosynthetic rate (Bwg et al. 1985).
1.4 THE INTERACTION BETWEEN THE ACTIVATOR, GMZ GANGLIOSIDE AND HEXOSAMINIDASE A
1 -4.1 The substrates of hexosarninidase A
Although al1 three Hex isoenzymes c m hydrolyze substrate with terminal $-GlcNAc or P-
GalNAc residues, only Hex A can hydrolyze Gw ganglioside with the Activator in vivo in humans
(Conzelmann et al. 1 982). In vitro certain detergents can replace the Activator function, however in
this case Hex S as well as Hex A can hydrolyse GMz. An uncharged fluorogenic substrate, 4-
15
methylumbelliferone-GlcNAc (4MüG), is recognized by al1 Hex isozymes and does not require the
Activator. However, a related negatively charged compound, 4-methylumbelliferyl-GlcNAc-6-
sulfate (4MUGS), can be cleaved efficiently by Hex A and Hex S, and only slowly by Hex B
(Bayleran 1984). This suggests a unique charged binding site in the a-subwiit.
1.4.2 Roie of the Activator in GMz - hvdrolvsis - bv hexosaminidase A
The Activator can extract Gm and several other glycosphingolipids fkom micelles or
liposomes, forming stable water-soluble 1: 1 complexes, but it appears unable to penetrate the
liposomal membrane (Conzelmann et al. 1982). Thus, the Activator acts primarily as a substrate-
specific CO-factor of Hex A, instead of ccactivating" the enzyme (Sandhoff et al. 1989). Briefly, the
Activator solubilizes a single molecule oEGW fiom the lysosomal membrane to form a complex,
and presents it to Hex A for hydrolysis. AAer the reaction, the Activator participates in another
round of catalysis (Fig 1-5) (Grave1 et al. 1995).
The mechanism by which the Activator acts as a CO-factor in hydrolyzing Gm by Hex A has
not been fully elucidated and some controversy still exists in the literature. Sandhoff and colleagues
believe that primary function of the Activator is to remove Gm fkom its membranous environment
that sterically hinders Hex A (Meier et al. 199 1). On the other hand, Li and colleagues believe that
the Function of the Activator in Gm hydrolysis is more than simply solubilizing the lipid substrates.
They believe that the effectiveness of the Activator in stimulating the hydrolysis of Guz is due to its
ability to recognize the specific trisaccharide structure of the GLI<~ epitope, GalNAcp144
(NeuAcaZJ3) Gal-, and to modify the strong hydrogen bond between GalNAc and NeuAc
Fig 1-5 A mode1 of the two known functions of the Activator. 1) its role as a substrate-specific co-
factor for the hydrolysis of Gw by Hex A, and 2) its role as a glycolipid uansport protein.
Fig 1-5 A mode1 of the two known Functions of the Activator. 1 ) its role as a substrate-specific co-
factor for the hydrolysis of G m by Hex A, and 2) its role as a glycolipid transport protein.
(Wu et al. 1994). Further work is needed to dari@ the relative importance of the Activator's
detergent-like function versus its interactions with the terminal GalNAc and NeuAc residue in the
hydrolysis of Gm.
1.4.3 Binding of the Activator with ~aneliosides
The Activator interacts with both the hydrophilic oligosaccharide and hydrophobic ceramide
moieties of gangliosides to f o m Activator-ganglioside cornplex. Because complex-formation is
reversible, the Activator is able to extract a ganglioside ffom one membrane and replace it in
another, i e. serve as a general ganglioside transport protein. The spectrum of glycolipids that
interacts with the Activator is prirnarily determined by their oligosaccharide moieties. In vitro
binding studies have indicated that the terminal GalNAc and interna1 NeuAc residues of ganglioside
play an important role in determining binding afinity, i-e. GW >> GMl > GDI, = Gm = GAZ (Fürst
and Sandhoff 1992; Fürst er al. 1990).
The hydrophobic binding site for the ceramide portion of gangliosides may be composed of
a pocket formed by amphiphilic a helices predicted from the amino acid sequence of the Activator
(Fürst er al. 1990). Recently, a fluorescence-dequenching assay specific for the hydrophobic
binding pocket has been evaluated and optimized in our laboratory (Smiljanic-Georgijev et al.
1997). This assay was developed based on the investigation of endosotne/ lysosome fusion by a
fluorescence dequenching method (Kuwana et al. 1993; Kuwana et al. 1995). The investigation by
Kuwana et al suggested that the Activator couid act as a transfer protein of the fluorescence lipid
probe, octadecylrhodamine (R- 18), between egg phosphatidylchoIine liposomes, as well as isolated
endosornes and lysosomes. In our study, we first develop a fluorescence dequenching assay that
could be used to evaluate the hydrophobic binding function of the Activator. The optimal time
course was detennined to be fiom the 5" to 10" minute afier the initiation of the assay. The optimal
amount of the Activator and optimal pH used in this assay were found to be fiom 0.75 pg to 4 pg
18
and pH 5, respectively. Because addition of glycosphingolipid (GSL) could inhibit R-18 transport,
the percentage inhibition could also be used to assess the oligosaccharide binding sites in the
Activator. Thus the fluorescence dequenching assay was used to extend the spectrum of GSL-
binding affinity with the Activator, i. e. G M ~ (90% inhibition) >> G T I ~ (62%) >> GMI (25%) z Gw
(24%) > GW (17%) >> GA2 (3%).
1.4.4 The binding domains in the Activator
The possible binding domains with G M ~ and Hex A in the Activator have been proposed
from the following experiments. Three truncated fonns of the Activator, truncated at L157 plus
extra residues WSCPVGSPPGTTA, or tmncated at C 183 and K185 by introducing a STOP codon,
were tested for a fiinctional hydrophobic binding site. The experiments indicated that the
hydrophobic binding function in each mutant protein was lost (Rigat er ai. 1997; Smiijanic-
Georgijev er ai. 1997; Xie et ai. 1998). These data suggest that the hydrophobic binding site is
located in the C-terminus of the Activator. On the other hand, the shidy of naturally occuming
Cys138Arg substitution in the Activator suggested the location of its Hex A-binding domain. This
mutated activator did not lack the Activator Iipid transport activity (Smiljanic-Georgijev et al.
1997), but did lack the ability to assist Hex A in hydrolysis of Gm (Xie et al. 1998). Thus Cys138
or the loop structure formed with Cysll2 is likely cnticai in foming the recognition site for Hex A,
localizing this domain to the middle region of the protein.
1.5 STRUCTURE OF HEXOSAMINIDASE AND THE ACTIVATOR GENES
1 -5.1 Hexosaminidase aenes
The genes encoding the a- (HEXA) and & (HEXB) subunits have been isolated and
charactenzed. The H E U gene is 35 kb long, contains 14 exons (Proia and Soravia 1987) and is
mapped to chromosome lSq23-q24 (Nakai et al. 199 1). The HEYB gene is about 45 kb long and
also contains 14 exons (Neote et al. 1988; Proia 1988). HEXB gene locates on chromosome 5q 13
(Biklcer et al. 1988). The promoters of both HEAX and HEXB have been identified (Neote et aL
1 988; Proia and Soravia 1987). The HEXA and HEXB genes encode propro-polypeptides of 529
and 556 residues, respectively. A cornparison of the deduced primary sequences from the both
cDNAs reveals an overall60% identity. As well, both genes show a striking degree of homology in
both the number and the placement of exodintron junctions. These data indicate the both genes are
derived from a common ancestor (Korneluk et al. 1986; Proia 1988); thus structure-function
retationships within the two subunits shoufd be conserved.
1-52 The Gu7 - activator gene
The Activator is encoded by GMZA gene. GMZA is a mal1 gene of at least 16 kb, and its
hl 1 length cDNA has been isolated (Klima et al. 199 1; Nagarajan et al. 1992; Xie et al. 199 1). The
promoter of the GMZA gene has not been characterized. The 2.5 kb cDNA is transcribed fiom four
exons in the GMZA with exon 1 containing the 5' untranslated region and exon 4 containing more
than 1.5 kb of 3' untranslated sequence. At the begiming of my thesis work, only intron 3 had been
fùlly sequenced (Klima et al. 1991), and the sequences of intron 1, intron 2 and their exonic
junctions were incomplete (Fig 1-6). A second altematively spliced mRNA product containing
exons 1-3 and part of intron 3 had also been identified (Nagarajan et al. 1992). Due to the presence
of a STOP codon early in the retained intron 3 sequence, the product of the alternatively spliced
mRNA is a truncated fom of the Activator, missing residues 142-193 and containing an additional
three residues encoded by the intron 3, Val-Ser-Thr. The GMZA gene has been mapped to
chromosome 5q3 2-33, while a processed pseudogene related to the functional, G MZA P, was
identified and localized to ciuomosome 3 (Heng et ai. 1993; Swallow et al. 1993; Xie et al- 1992a).
Fig 1-6 The known GM2A gene structure in 1996. The larger open boxes refer to the exons, and
the black boxes refer to the 5' and 3' end untranslated region. The smaller open boxes refer
to the introns. The regions with known sequences of the gene are indicated with double
underline.
21
Three polymorphisms, ASSG, G205A and G582A, have been reported in the exons of the GM2A
gene through screening of cDNA library and sequencing (Xie et a' 199 1) (Table 1-2) (Fig 1-8).
1.6 OTHER LYSOSOMAL SPHINGOLLPID ACTIVATOR PROTEINS
In addition to the Activator, the lysosomal degradation of other sphingolipids with short
h ydrophi lic groups is also dependent on small nonenzymic gl ycoproteins, tenned sphingolipid
activator proteins (SAP). Four homologous SAPs, SapA, Sap-B, Sap-C and Sap-D, have been
characterized. These proteins al1 arise from the processing of a single SAP precursor polypeptide,
prosaposin (Sandhoff et al. 1999, which is encoded by a gene on chromosome 10. The prosaposin
has a total of 524 amino acids with five N-glycosylation sites. The four homologous domains, each
encoding about 80 amino acids, result in SAP A-D (Roman and Grabowski 1989). Most of the
precursor is first transported to the ce11 surface and then endocytosed into the lysosomal
cornpartment, where it is processed into the four mature glycoprotein forms. The Activator is
evolutionarily distinct from the other SAPs. It functions as a monomer while Sap A-D are
homodimers. The Activator is encoded by a separate gene that shares no significant deduced
pnmary structure homology with the others (Schroder et al. 1989).
The functions of Sap A-D differ significantly. Saposin B is known as a nonspecific
activator protein and has been found to have a detergent-like activity which stimulates the
hydrolyses of various glycolipids by different glycosidases (Li et al. 1988). e.g. it activates the
hydrolysis of cerebroside sulfate, GMI, and globotriaosylceramide by arylsulphatase A, p-
galactosidase, and a-galactosidase, respectively. Sap-C stimulates the hydrolysis of
glucosy lceramide, galactosylceramide, and sphingomyelin by B -glucosylceramidase,
B-galactosidase, and sphingomyelinase, respectively. The clinical findings in Sap-C defciency are
thought to be similar to thcse in Gaucher disease type 3 (Beutler and Grabowski 1995). In vitro,
Sap-A activates glucosylceramidase and galactosylceramidase, while Sap-D shows some
stimulatory effect on the degradation of ceramide in vitro and in vivo (Azurna et al. 1994; Klein et
al. 1994).
1.7 G M ~ GANGLIOSIDOSES AND MUTATIONS LN THEIR RELATED GENES
1 -7.1 Classification of GMT - aandiosidoses
Deficiency of f3-hexosaminidase isoenzymes or the Activator causes a group of autosomal
recessive inherited disorders, known as GMZ gangliosidosis. The major characteristic of these
disorders is the excessive intralysosornal accumulation of ganglioside GM~, particularly in neuronal
cells where ganglioside synthesis is greatest. There are three variants in Gm gangliosidosis (Fig I-
7), i. e. Tay-Sachs disease (B variant), Sandhoff disease (O variant) and AB variant (Sandhoff et al.
1989). Tay-Sachs disease results fiom Hex A deficiency through mutations of the HEXA gene
encoding the a subunit (Hex B activity is normal or increased in these patients). Sandhoff disease
is characterized by combined Hex A and Hex B deficiency caused by mutations in the HEXB gene
encoding the common subunit. The AB variant is caused by mutation of the GM2A gene
encoding the Activator. In this variant, Hex A and Hex B are both structurally and hnctionally
normal, however, hydrolysis of ganglioside G M ~ is prevented by the absence of the GM~-Activator
complex, the true substrate for Hex A (reviewed in (Grave1 et aL 1995)).
1.7.2 Clinka1 ~henotypes
GM2 is an intermediate in the degradation of GMi (Fig 1-2). Since G M ~ is particularly rich in
neurons, GMt gangliosidosis is principally a neurological disorder. The most pronounced cellular
change is the presence of swollen neurons with massiv~ accumulation of storage matenal in
Gene
Poly- peptide
Gm
Deficienc y
HEXA HEXB GM2A chi 15q23-24 chr 5q13 chr 5q32-33
Tay-Sachs Sandhoff AB variant Disease Disease Form (B variant) CO variant)
Fig. 1-7 The variants of Gm gangliosidoses
lysosomes throughout the nervous system. These form characteristic inclusions, the "membranous
cytoplasmic bodies", which are lamellar structures consisting of dense concentnc membranes
(Terry and Weiss 1963).
Patients with Gw gangliosidosis display a wide spectrurn of clinka1 severity, which is Iikely
related to the amount of residual Hex A activity present (Leinekugel et uL 1992). On the basis of
t heir di fferent cl inical phenotypes, patients are generally classi fied into acute (the classical infantile
type), subacute (late infantile and juvenile type) and chronic forms (adult type) (reviewed in
[Mahuran, in press #492]). Generally, the earlier the onset of symptoms the more severe the
resulting disease. A correlation between residual Hex A activity and the severity of the resulting
disease in the patients with Gw gangliosidosis has been determined. Residual Hex A activities
found for acute, subacute, and chronic patients were O.1%, OS%, and 2-4% of normal controls,
respectively (Conzelmann et al. 1983). Al1 three forms of Gm gangliosidoses appear in Tay-Sachs
disease and Sandhoff disease, however, only the infantile form of AB-variant has been described.
The acute form of al1 three variants is the most common, and also is the clinically and
biochemicaIly least variable. While affected infants generally appear completely normal at birth,
they usually begin to show motor weakness in the first 3 to 5 months. An exaggerated startle
response is often one of the first signs recognized by parents. More profound neurological
symptoms, such as hypotonia, ataxia, and development retardation are found and develop rapidly
with death normally occurring by the age of about 4 years. Cherry-red spot in retina is a common
sign in this form. The subacute phenotypes usually show evidence of neurological symptoms, such
as ataxia and progressive psychomotor retardation, at 2-6 years of age with death occurring between
10- 15 years of age. The chronic fonn of Gm gangliosidosis displays highly variable symptoms and
clinical course even in the same family (Argov and Navon 1984; Mcinnes et al. 1992). Some of
chronic patients have motor difficulties, psychosis, mental deterioration and progressive dystonia.
However, other chronic patients present with abnonnalities of gait and posture between 2 and 5
years of age, and most of these patients with this condition are still living in their third or fourth
decade of life (reviewed in (Grave1 et al. 1995)). Al1 Gu2 gangliosidoses exhibit an autosomal
recessive pattern of inhentance, and heterozygous forms for any of the defects are completely
asymptomatic.
1.7.3 Mutations associated with Tav-Sachs disease and Sandhoff disease
Mutations in genes encoding the subunits of hexosaminidase A, HEXA and HEAB, have
been widely reported. At least 87 H . gene mutations and 23 HEXB gene mutations have been
characterized [Mahuran, in press #492]. These mutations can be placed into a number of broad
categories, i,e, partial gene deletions, mutations producing early stop codons, mutations affecting
mRNA processing and missense mutations (Mahuran 1997).
1.7.4 Mutations associated with the AB variant form of GE gannliosidosis
The AB variant f o m of G M ~ gangliosidoses is extremely rare and only four different
mutations in GM2A have been described at the molecular level (Table 1-1) (Fig 1-8). Of these
mutations, the Cysl38Arg (T412jC) substitution was the first to be described (Schroder et al.
199 1 ; Xie et al. 1992b) and is the most interesting one fiom a structure-function point of view (Xie
et al. 1998). This mutation did not affect GMZA mRNA transcription, but it caused its encoded
protein to be retained and degraded in the ER (Xie et al. 1992b). Bacterial expression and refolding
studies indicate that the mutant protein retained 1.2% of the wild type's specific Hex A CO-factor
activity. The presence of this srna11 amount of activity in the mutant protein coupled with a nearly
normal CD spectmm strongly suggested that no major tertiary or secondary structural changes had
occurred due to the mutation (Xie et al. 1998). However, the mutant protein was found
Fig. 1-8 Mutations and polymorphisms in the GM2A gene. Four reported mutations are localized
with arrows: 1). AAG 262-264 deletion, 2). A410 deletion, 3). T412+C transition
(Cys l38Arg), 4). G5063C transversion (Argl69Pro). Three polymorphisms, ASSG,
G205A and G582A, are indicated. El, E2, E3 and E4 represent exonl-4.
Table 1-1 Naturally Occurring Mutations in the GM2A gene
Mutation 1 Location 1 Rcsult 1 Biochemical phenotype Klinical 1 Hcritagc 1 Rcferencc
1 ) A AAG 262-264 2) A A410
1 1 rcsidual activitv after bactcrial exoression '
Exon 3
I Normal mRNA, no maturc CRM, transport mutation, 3% 'Ion 1 ::_Cid, rcsidual aciivity d e r bacterial cxpreuion
A Lys 88
precursor detecicd no signilicant function, transpoct mutation, bacterial expression dcmonstrated the protein rctained ganglioside transport function, but rcduccd
Normal rnRNA, no maturc CRM, transport mutation,8%
Exon 3
1
l I 1 transport mutation
loss of 24 Cys 138 3
' Exon 4
No dctcctable CRM or function in patient cclls, COS-Act;
consangiiinity
Phenotypc Acute
Arg I69JPro Acutc I
Saudi Arabian
interaction with Hex A -
Premature degradation of thc mutant GM2 activaior,
(Schepcrs el al. 1996)
(Sc hepers et ai. 1 996)
(Sctirodcr et al, 1993; Xie et al. 1998; Xie et al. 1992)
(Sc hriidcr et al, 1 993)
Table 1-2 GM2A gene polymorphisms
1 AS53G 1 Exon 1 1 Alal93Thr ( Located in the putative ( (Schradcr et al. 1989; Xie et al. 1
Commcnts Rcsul t Varicty
A2053G
1 1 1 anothcr 1 1 1
Rc fercncc Locaiion
A5829G
Exon 2
Exon 4
Va1693Mct
One Stop codon 40
signal peptide Found in a number of
i99i) (Fürst CI al, 1990; Schroder et
diffcrciit sources al, 1989; Xic et al. 199 1) (Xic et RI. 199 1)
28
to have a 14-fold reduction in its heat stability at 60°C likely due to the loss of a disulfide, Cys 1 12-
Cys 13 8 (Schroder et al. 199 1; Xie et al. 1992b). The fluorescence dequenching assay for R-18
binding and its inhibition by Gw (SmiIjanic-Georgijev et al, 1997) detected no differences between
the wild type and mutant proteins, indicating that the Cys 1 12-Cys 138 loop is not involved in lipid
transportation and Gm binding. Kinetic analysis demonstrated a -10 fold increase in the Km of
Hex A for the mutant Activator-Gm complex with Little or no change in V,,,. Therefore, the
mutation specifically affects a domain in the Activator that is responsible for the recognition of the
Activatod G- complex by Hex A-
Another AB variant patient was found to be homozygous for a G506 to C (Argl69Pro)
mutation (Schroder et al. 1993). BHK cells -sfected with the corresponding mutant cDNA
constmct produced no detectable Activator protein. Therefore, the Argl69Pro substitution, like
rnany others in HEX4 and HEXB genes, appears to result in premature degradation of the mutant
Activator in ER.
Recently, two small deletion mutations in GMîA gene have been reported; a three base
deletion, AAG(262-264), resulting in the deletion of Lys88 (referred as AK88), and a single base
deletion, A 41 0, causing a fiameshifi (referred as fsH137) with the substitution of 33 amino acids
and the loss of another 24 amino acid residues (Schepers et al. 1996). Each patient was homoallelic
for their respective mutations. Although the cultured fibroblasts of both patients produce normal
levels of GMZA mRNA, they iacked detectable Activator protein. Pulsekhase and in vitro
translation study indicated a premature degradation of each mutant Activator in the ER.
1.8 MOUSE Gw ACTIVATOR PROTEIN AND MOUSE MODELS OF G m GANGLIOSIDOSES
1.8.1 The GE activator rote in in mice
There are proteins similar to the hurnan Activator in rats, mice, cattle and pigs (Burg et ai.
1983). The mouse Gx activator protein has been the best investigated among these species. The
cDNA of mouse Gm activator was isolated and characterized in 1993 (Bellachioma et al. 1993).
The mouse activator mRNA is similar in overall structure to that of human- It has a similar length
of mRNA, its coding sequence is also at the 5' end, containing a similar long untranslated region in
3' end. The cornparison of mouse and human sequences downstream from the termination codon
indicates a 67% nucleotide and 68% amino acid identity. The greatest divergence between the
sequences is found in the first 3 1 amino acids, which includes the signal peptide and pro-peptide
sequence in hurnan activator protein, while the regions from residue 32 to the C-terminal are 75%
identical. Ttius the tertiary structures of the human and mouse GiM2 activator proteins are likely to
be very similar. Al1 eight cysteines of the human sequence are conserved in the mouse; however,
the N-glycosylation sites are not (Bellachioma et ai. 1993). The mouse Gm2a gene is mapped to a
region on mouse chromosome 1 1 that is homologous with a segment of hurnan chromosome 5.
1.8.2 Mouse mode1 of GhA2pangliosidoses
Through the targeted disruption of the hem, hexb, and gmîa genes, mouse models of Tay-
Sachs, Sandhoff, and the AB-variant form of Gm gangliosidosis have been established (Liu et al.
1997; Sango et ai. 1995). Although the three human disorders are very similar in their clinical
phenotypes, each of the mouse models is distinct. The Sandhoff mouse exhibited the most
extensive ganglioside accumulations which produced the most severe neurological disease, while
Tay-Sachs mouse appeared to be phenotypically normal (Sango et ai. 1995). The AB variant mouse
was of an intermediate phenotype (Liu et 41. 1997). The possible reason for the difference between
the human disorders and the mouse models is that there is an alternative degradative patbway for
GMZ ganglioside in mice. In the primary pathway, the Gm/activator is degraded to Gw by Hex A
(the major and almost exclusive pathway in humans). In the second normally minor pathway
specific to the mouse, Gm is degraded by sialidase to Ge and then by Hex A or, to a lesser extent,
Hex B to lactosylceramide. Therefore, the Tay-Sachs mouse accumulates iower amounts of GW,
but not G a , and appears asymptomatic. The Sandhoff mouse accumulates both Gw and GAZ due to
blocks in both pathways and shows a severe phenotype. The AB variant mouse accumulates G M ~
with a small amount of Ga. These data indicate the hexosaminidase-mediated degradation of GAZ
can proceed to some extent in the absence of the activator possibly with SAP-B. However, mouse
GM2 activator is likely required for this reaction to proceed at an optimal rate (Liu et al. 1997). In
summary, because the catabolic pathways for Gw in mouse and human are clearly not identical,
these mouse models of GM2 gangliosidosis cannot truly reflect their cornterparts in humans (Yuziuk
el al. 1 998).
1.9 THESIS OBJECTIVES
The objectives of this thesis are to characterize the introdexon junctions of GM2A gene, to
develop a procedure to quickly analyze the GM2A gene for mutations, and to identiQ the
mutation(s) in a new patient with AB variant form of Gm gangliosidosis.
Argov 2, Navon R (1984) Clinical and genetic variations in the syndrome of adult
gangliosidosis resulting tiom hexosaminidase A deficiency. Ann. Neurol. 16: 14-20
Bane rjee A, Burg J, Conzelmann E, Carroll M, Sandhoff K (1984) Enzyme-linked immunosorbent
assay for the ganglioside GM2-activator protein. Hoppe-Seyler's Z.Physiol.Chem. 369347-
356
Bayleran J (1 984) Synthesis of 4-methylumbellifetyl-$-D-Wacetylglucos-ae-6-sulfate and its
use in classification of GM2 gangliosidosis genotypes. C1inica.Chimica.Acta
Bellachioma G, Stirling J, Orlacchio A, Beccari T (1993) Cloning and sequence analysis of a cDNA
clone coding for the mouse GM2 activator protein. Bi0chem.J. 294:227-230
Beutler E (1979) The biochernical genetics of the hexosaminidase system in man. Am. J. Hum.
Genet. 3 1 :95-105
Bikker H, Meyer MF, Merk AC, devijtder JJ, Bolhuis PA (1988) XmnI RFLP at 5q13 detected by a
049 Xmn 1 fiagrnent of human hexosaminidase (Hm). Nucleic Acids Res. 16:8 198-8 198
Burg J, Bane rjee A, Conzelmann E, Sandnoff K (1983) Activating proteins for ganglioside GM2
degradation by beta-hexosaminidase isoenzymes in tissue extracts fiom different species.
Hoppe-Seyler's Z.Physiol.Chem. 364932 1-829
Burg J, Banerjee A, Sandhoff K (1 985) Molecuiar forms of GM2 activator protein: astudy on its
biosynthesis in human skin fibroblasts. Biol.Chem.Hoppe-Seyler 3663387-89 1
Conzelmann E, Burg J, Stephan G, Sandhoff K (1982) Complexing of glycolipids and their transfer
between membranes by the activator protein for degradation of lysosomal ganglioside GM2.
Eur.J.Biochem. 123:455-464
32
Conzelmann E, Kytzia H-J, Navon R, Sandhoff K (1983) Ganglioside GM2 N-Acetyl-beta-D-
galactosaminidase activity in cultured fibrablasts of late-infantile and adult GM2
gang liosidosis patients and of healthy probands with low hexosarninidase level.
Am.J.Hum.Genet. 35:900-9 13
Conzelmann E, Sandhoff K (1978) AB variant of infantile GM2 gangliosidosis: Deficiency of a
factor necessary for stimulation of hexosaminidase A-catalyzed degradation o f ganglioside
GM2 and glycolipid GA2. Proc.Natl.Acad.Sci.USA 753979-3983
Conzelmann E, Sandhoff K (1979) Purification and characterization of an activator protein for the
degradation of glycolipids GM2 and GA2 by hexosaminidase A. Hoppe-Seyler's
2-Physiol-Chem. 360: 1837- 1849
Fürst W, Sandhoff K (1992) Activator proteins and topology of lysosomal sphhgolipid catabolism.
Biochim. Biophys. Acta 1 126: 1-16
Fürst W, Schubert J, Machleid W, Meyer HE, Sandhoff K (1 990) The complete amino-acid
sequence of human ganglioside GM2 activator protein and cerebroside sulfate activator
protein. Eur.J.Biochem. l92:709-7 14
Glickman JN, Conibear E, Pearse BMF (1989) Specificity of binding of clathrùi adaptors to signals
on the mannose-6-phosphate/insulin-like growth factor II receptor. EMBO J. 8: 104 1 - 1047
Glombitza GJ, Becker E, Kaiser HW, Sandhoff K (1997) Biosynthesis, processing, and intracellular
transport of GM2 activator protein in human epidemal keratinocytes. J.Biol.Chem.
2725 1 99-5207
Grave1 RA, Clarke JTR, Kaback MM, Mahuran D, Sandhoff K, Suzuki K (1995) The G m
gangliosidoses. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The rnetabolic basis of
inherited disease. McGraw-Hill, New York, pp 2829-2879
Griffith G, Hoflack B, Simons K, Mellman 1, Kodeld S (1988) The mannose 6-phosphate
receptor and the biogenesis of the lysosomes. Ce11 52:329-341
Hasilik A, Neufeld EF (1980) Biosynthesis of lysosomal enzymes in fibroblasts: phosphorylation of
mannose residues. J-Biol. Chem- 25549464960
Hasilik A, von Figura K (1 98 1) Oligosaccharides in lysosomal enzymes. Distributions of high-
mannose and complex oligosaccharïdes in cathepsin D and &hexosaminidase. Eur. J.
Biochem. 12 1: 125-129
Hechtman P (1 977) Characterization of an activating factor required for hydrolysis of G m
ganglioside catalyzed by hexosaminidase A. Can. J. Biochem. 55:3 15-324
Heng HHQ, Xie B, Shi XM, Tsui L-C, Mahuran DJ (1993) Refhed mapping of the activator
protein (GM2A) locus to 5q3 1.3-q33.1, distal to the spinal muscular atrophy locus.
Genomics 18:429-43 1
Hubbes M, Callahan 1, Grave1 R, Mahuran D (1989) The amino-terminal sequences in the pro-a
and -p polypeptides of hurnan lysosomal B-hexosaminidase A and B are retained in the
mature isozymes. FEBS. LETT. 249:3 16-320
Hurtley SM, Helenius A (1989) Protein oligomerization in the endoplasmic reticulurn. Ann. Rev.
Celt Biol. 5:277-307
Ikonne IV, Rattazzi MC, Desnick RI (1975) Characterization of hex S, the major residual p-
hexosaminidase activity in type O G M ~ gangliosidosis (Sandhoff-latzkewitz disease). Am.
1. Hum. Genet. 27:639-650
KIenk E (1 935) Uber die Natur der Phosphatide und anderer Lipoide des Gehirn und der Leber bei
der Niemann-Pick'schen Krankheit. Hoppe-Seylefs Z Physiol. Chem. 235:24-28
Klirna H, Klein A, van Echten G, Schwamnann G, Suzuki K, Sandhoff K (1993) Over-expression
of a fiuictionally active human GM2 activator protein in Escherichia coli. BiochemJ.
292:S7 1-576
Klima H, Tanaka A, Schnabel D, Nakano T, Schroder M, Suzuki K, Sandhoff K (1 99 1)
Characterization of full-length cDNAs and the gene coding for the human G m activator
protein. FEBS Lett- 289:260-264
Korneluk B, Mahuran DJ, Neote K, Kiavins MH, O'Dowd BF, Tropak M, Willard HF, Anderson
M-J, Lowden JA, Gravel RA (1986) Isolation of cDNA clones coding for the alpha-subunit
of human beta-hexosaminidase. JJ3iol.Chern. 26 1 :8407-84 13
Komfeld R, Komfeld S (1985) Assembly of asparagine-linked oligosaccharides. Ann. Rev.
Biochem. 54:63 1-664
Komfeld S (1 986) Trafficking of lysosomal enzymes in normal and disease States. J. Clin. Lnvest-
77: 1-6
Komfeld S (1990) Lysosomal enzyme targeting. Biochem.Soc.Trans. 18:367-374
Komfeld S, Sly WS (1995) 1-ce11 disease and pseudo-Hurler polydystrophy: Disorders of lysosomal
encyme phophorylation and localization. In: Scriver CR, Beaudet AL, Sly WS, Valle D
(eds) The metabolic basis of inherited disease. McGraw-Hill, New York, pp 2495-2508
Kuwana T, Mullock BM, Luzio JP (1993) Identification of a protein capable of causing fusion of
endosorne and lysosome membranes. Biochem.Soc.Trans. 2 1 :299-300
Kuwana T, Mullock BM, Luzio JP (1995) Identification of a lysosomal protein causing lipid
transfer,using a fluorescence assay designed to monitor membrane fusion between rat liver
endosomes and lysosomes. Bi0chem.J. 308:937-946
35
Lang L, Reitman M, Tang J, Roberts RM, Konifeld S (1984) Lysosornai enzyme phosphorylation:
Recognition of a protein-dependent determinant allows specific phosphorylation of
oligosaccharides present on lysosomal enzymes. J. Biol. Chern- 259: 14663-14671
Leinekugel P, Michel S, Conzelmann E, Sandhoff K (1 992) Quantitative correlation between the
residual activity of beta-hexosaminidase A and arylsulfatase A and the seventy of the
resulting lysosomal storage disease. Hum.Genet. 88:s 12-523
Li S-C, Hirabayashi Y, Li Y-T (198 1) A protein activator for the enzymic hydrolysis of GM2
ganglioside. J.Biol.Chem. 256:6234-6240
Li Y -T, Mazzotta MY, Wan C-C, Orth R, Li S-C (1 973) Hydrolysis of Tay-Sachs ganglioside by fk
hexosaminidase A of human liver and urine. J-Ce11 Biol. 248:75 12-75 15
Liu Y, Hoffmann A, Grinberg A, Westphal H, McDonald MP, Miller KM, Crawley .IN, Sandhoff
K, Suniki K, Proia RL (1 997) Mouse mode1 of GM2 activator deficiency manifests
cerebellar pathology and motor impairment. Proc.Natl.Acad.Sci.US A 94:s 13 8-8 143
Mahuran D, Grave1 R (1 988) The molecular biology of $-hexosaminidase: localization of the
proteolytic processing and carbohydrate containing sites. In: Salvayre R, Douste-Blazy L,
Gatt S (eds) NATO AS1 Series A: Life Science. Vol. 150. Plenum Publishing Co., pp 225-
236
Mahuran D, Lowden JA (1980) The subunit and polypeptide structure of hexosaminidases from
human placenta. Can.J.Biochem. 58:289-294
Mahuran DJ (1 99 1) The Biochemistry of HEYA and HEYB Gene Mutations Causing G m
Gangliosidosis. Biochim. Biophys. Acta 1096:87-94
Mahuran DJ (1 997) G M ~ gangliosidosis and structure-function relationships in &hexosaminidase.
In: Swallow D, Edwards Y (eds) Protein dysfimction in human genetic disease: Human
molecular genetics. BioScientific, Oxford, pp 99- 1 17
Mahuran DJ (1998) The GMî activator protein, its roles as a CO-factor in GM.2 hydrolysis and as a
general glycolipid transport protein. Biochirn Biophys Acta 1393 : 1- 18
Mahuran DJ, Tsui F, Gravel RA, Lowden JA (1 982) Evidence for two dissimilar polypeptide chahs
in the f32 subunit of hexosaminidase. Proc. Natl. Acad. Sci. (USA) 79: 1602-1605
Makita A, Yamakawa T (1963) The glycolipids of the brain of Tay-Sachs disease. The chemical
structure of globoside and main ganglioside. Jpn. J. Exp. Med. 33:36 1
bIcInnes B, Potier M, Wakamatsu N, MeIancon SB, Klavins MH, Tsuji S, Mahuran DJ (1992) An
unusual splicing mutation in the HEXB gene is associated with dramatically different
phenotypes in patients fkom different racial backgrounds. J.Clin.1nvest. 90:306-3 14
Meier EM, Schwarzmann G, Furst W, Sandhoff K (1991) The human G m activator protein: A
substrate specific of beta-hexosaminidase A. J.Bio1.Chem. 266: 1879- 1887
Morgan DO, Edman JC, Standring DN, Frkd VA, Smith MC, Roth RA, Rutter WJ (1987) Insulin-
like growth factor iI receptor as a multifunctional binding protein. Nature 329:301-307
Nagarajan S, Chen H-C, Li S-C, Li Y-T, Loclqer JM (1992) Evidence for two cDNA clones
encoding human Gm-activator protein. Bi0chem.J. 282:807-8 13
Nakai H, Byers MG, Nowak NJ, Shows TB (199 1) Assignment of beta-hexosaminidase A alpha-
subunit to human chromosomal region 1 5q23->q24. Cytogenet. Ce11 Genet. 56: 164- 164
Neote K, Bapat B, Dumbrille-Ross A, Troxel C, Schuster SM, Mahuran DJ, Gravel RA (1988)
Characterization of the human HEXB gene encoding lysosomal p-hexosaminidase.
Genomics 3:279-286
Neufeld EF (1 991) Lysosomal Storage diseases. Annu.Rev.Biochem. 60:257-280
Nolan CM, Sly WS (1989) 1-ceIl disease and pseudo-Hurler polydystrophy: Disorders of lysosomal
enzyme phosphorylation and localization. In: Scriver CR, Beaudet AL, Sly WS, Valle D
(eds) The metabolic basis of inherited disease. Vol. 2. McGraw-Hill, New York, pp 1589-
1601
Okada S, O'Brien JS (1969) Tay-Sachs disease: generalized absence of a f3-D-N-
acetylhexosaminiciase component. Science. 165:698-700
Pearse BMF, Robinson MS (1990) Clathrin, adaptors, and sorting. Annu.Rev.CeI1 Biol. 6: 15 1-17 1
Pelham RB (1 989) Control of protein exit corn the endoplasmic reticulum. Ann. Rev. Ce11 Biol.
5: 1-23
Proia R, Soravia E (1987) Organization of the gene encoding the human beta-hexosaminidase
alpha-chain. J.Biol.Chem. 2625673-568 1
Proia RL (1988) Gene encoding the human phexosaminidase f3-chain: Extensive homology of
intron placement in the a- and p-genes. Froc. Natl. Acad. Sci. (USA) 85: 1883-1 887
Rigat B, Wang W, Leung A, Mahuran DJ (1997) Two mechanisms for the recapture of extracellular
Gm2 activator protein: evidence for a major secretory form of the protein. Biochemistry
36:8325-833 1
Robinson D, Stirling IL (1 968) N-acetyl- gluc cos ami nid as es in human spleen. Biochem. I.
1 O7:32 1-327
Sachs B (1 887) On arrested cerebral development with special reference to its cortical pathology. J.
New. Ment. Dis. 14541
Sachs B (1896) A family form of idiocy, generally fatal, associated with early blindness. J. New.
Ment. Dis. 2 1 :475-479
Sandhoff K (1 969) Variation of B-N-acetylhexosaminidase-pattern in Tay-Sachs disease. FEBS
Lett. 4:3 5 1-3 54
Sandhoff K, Conzelmann E, Neufeld EF, Kaback MM, Suzuki K (1989) The gangliosidoses.
In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis of inherited disease.
Vol. 2. McGraw-Hill, New York, pp 1807-1839
Sango K, Yamanaka S, H o h a n n A, Okuda Y, Grinberg A, Westphal H, McDonald MP, Crauley
JN, Sandhoff K, Suniki K, Proia RL (1995) Moue models of Tay-Sachs and Sandhoff
diseases differ in neurologie phenotype and ganglioside metabolism. Nature Genet. 1 1 : 170-
176
Schepers U, Glombirct G, Lemm T, H o h a n n A, Chabas A, Ozand P, Sandhoff K (1996)
Molecular analysis of a GM2 activator deficiency in two patients with GM2 gangliosidosis
AB variant. Am.J.Wum.Genet. 59: 1048- 1056
Schrtider M, Klima H, Nakano T, Kwon H, Quintem LE, Gartner S, Suzuki K, Sandhoff K (1989)
Isolation of a cDNA encoding the human GM2 activator protein. FEBS Lett. 25 1: 197-200
Schroder M, Schnabel D, Hurwitz R, Young E, Suzuki K, Sandhoff K (1993) Molecular genetics of
GM2 gangliosidosis AB variant: a novel mutation and expression in BHK cells. HumGenet.
92:437-440
Schroder M, Schnabel D, Suzuki K, Sandhoff K (1991) A mutation in the gene of a glycolipid-
binding protein (GM2 activator) that causes GM2 gangliosidosis variant AB. FEBS Lett.
290: 1-3
Schütte CG, Lemm T, Glombitza GI, Sandhoff K (1998) Complete localization of disulfide bonds
in GM2 activator protein. Protein Science 7: 1039-1 045
Smiljanic-Georgijev N, Rigat B, Xie B, Wang W, Mahuran D (1 997) Characterization of the
affinity of the GM2 activator protein for glycolipids by a fluorescence dequenching assay.
Biochim. Biophys. Acta 1339: 192-202
Sonderfeld-Fresko S, Proia RL (1989) Analysis of the glycosylation and phosphorylation of the
iysosomal enzyme, f3-hexosaminidase B, by site-dkted mutagenesis. J. Biol. Chem.
264:7692-7697
Srivastava SK, Beutler E (1973) Hexosaminidase A and hexosaminidase B: studies in Tay-Sachs
and Sandhoff s disease. Nature. 24 1:463-463
Suzuki K, Chen GC (1967) Brain ceramide hexosides in Tay-Sachs disease and generalized
gangliosidosis. J Lipid Res 8: 105
Svennerholm L (1962) The chemical structure of normal human brain and Tay-Sachs gangliosides.
Biochem. Biophys. Res. Commun 9:436
Swallow DM, Islam 1, Fox MF, Klima H, Schepers U, Sandhoff K (1993) Regional localization of
the gene coding for the GM2 activator protein (GM2A) to chromosome 5q32-33 and
confirmation of the assignment of GMZAP to chromosome 2. Ann-Hum-Genet. 57: 187- L 93
Tay W (1 88 1) Symmetrical changes in the region of the yellow spot in each eye of an infant. Trans.
Ophthalmol. Soc. U.K. 1 : 155-! 57
Terry RD, Weiss M (1963) Studies in Tay-Sachs: II. Ultrastructure of the cerebrum. J. Neuropathol.
Exp. Neurol. 22: 18
Thomas PD, Brewer GJ (1990) Gangliosides and synaptic transmission. Biochim Biophys Acta Rev
Biomembr 1 O3 1 :277-289
Van Echten G, Sandhoff K (1993) Ganglioside metabolism. Enzymology, topology, and regdation.
J. Biol- Chem. 26853414344
Wu YY, Lockyer JM, Sugiyama E, Pavlova NV, Li Y-T, Li S-C (1994) Expression and specificity
of human GM2 activator protein. J. Biol. Chem. 269: 16276- 16283
Xie B, Kennedy IL, McInnes B, Auger D, Mahuran D (1992a) Identification of a processed
pseudogene related to the functional gene encoding the GM2 activator protein: Localization
of the pseudogene to hurnan chromosome 3 and the functional gene to hurnan chromosome
5. Genomics 14:796-798
Xie B, McInnes B, Neote K, Lamhonwah A-M, Mahuran D (1991) Isolation and expression of a
full-length cDNA encoding the human G m activator protein. Biochem. Biophys. Res.
Commun. 177: 1217-1223
Xie B, Rigat B, Smiljanic-Georgijev N, Deng H, Mahuran DJ (1998) Biochemical charactenzation
of the Cys l38Arg substitution associated with the AB variant form of G m gangliosidosis:
Evidence that Cys 138 is required for the recognition of the G m activatodGm ganglioside
complex by B-hexosarninidase A. Biochemistry 37:8 14-82 1
Xie B, Wang W, Mahuran DJ (1992b) A Cysl38-to-Arg substitution in the GM2 activator protein is
associated with the AB variant f o m of GM2 gangliosidosis. Am.l.Hum.Genet. 50: 1046-
1052
Yuziuk JA, Bertoni C, Beccan T, Orlacchio A, Wu Y-Y, Li S-C, Li Y-T (1998) Specificity of
mouse G M ~ activator protein and PN-acetyl-hexosaminidase A and B: Similarities and
differences with their human couterparts in the catabolism of G m . J. Biol. Chem. 273:66-
77
Zeller CB, Marchase RB (1 992) Gangliosides as modulaton of ce11 function. Am. J. Physiol. CeIl
Physiol. 262:C 134 1 -C 1355
CHAPTER II
CHARACTERIZATION OF THE EXONI INTRON
JUNCTIONS OF THE GM2A GENE
2.1 INTRODUCTION
n ie G M ~ activator protein (Activator) is a substrate specific cofactor for degradation of Gm
ganglioside by lysosomal ~hexosaminidase A and is encoded by the GUZA gene on chromosome 5
(Heng et al. 1993; Xie et al. 1992). GM2A mRNA is about 2.5 kb and contains a 582 nucleotide
coding region and a long 3' untranslated end sequence (Klima et al. 199 1 ; Nagarajan et al. 1992;
Xie et al. 1991). GM2A is a small gene of at least 16 kb whose promoter has not been
charactenzed. Three exons (exon 2-4) have been identified and a fourth (exon 1) extrapolated to
account for the remaining 81 bp of 5' coding sequence. Arnong these three introns (1-3)' only
intron 3 has been hlly sequenced, and the sequences of intron 1 and intron 2 and their exonic
junctions remain to be determined.
Sandhoff and colleagues previously screened a genomic DNA library and found that two
genomic clones contained part of the GM2A gene (Klima et al. 1991). Based on data fiom these
clones, they demonstrated that intron 2 was 7.3 kb in length and predicted that intron 1 contained
more than 1.8 kb. They sequenced the full length of intron 3 (38 1 bp), 20 bp each of the 5' and 3 '
ends of intron 2 and 20 bp of the 3' end of intron 1. However they could not obtain the 5' end
sequence of intron 1, as neither genomic clones contained this part of the sequence. In our
laboratory, we also screened a hDash human genomic library and obtained a GM2A related clone
that contained a 13 kb insert. This 13 kb insert produced six fragments of approximately 4.5 kb, 3
kb, 2.5 kb, 2 kb, 0.7 kb, and 0.3 kb with EcoR I digestion. The 0.7 kb fragment was found to
contain part of GM2A cDNA sequence and the 2.5 kb fiagrnent to contain its 3' untranslated end.
In order to confirm that the hDash insert was an authentic fragment of the GM2A gene, the 0.7 bp
fragment was subcloned into pBluescript vector and sequenced. Sequence results indicated that the
0.7 kb fragment contained the 3' end of intron 2, exon 2, intron 3 and part of exon 4. However, it
was found that none of the other fragments fiom the 13 kb insert contained the complete 5' end of
GMZA including the end of its intron 1.
It is well known that specific intronic nucieotides, especially those close to exodintron
junctions, are required for mRNA splicing. Mutations in these nucleotides often cause alternative
mRNA splicing which in turn results in a severe reduction or deficiency in the protein product and
an abnormal clinical phenotype (E3reathnach and Chambon 198 1; McKeown 1992; Sharp 1994).
The most critical nucleotides in the introns are those o f the "invariant splice sites", Le. IVS
(intervening sequence) +lg and +2t, and IVS -2a and -lg, and branch sites (Lewin 1997). When
mRNA is splicing, the reaction with the 5' splice site involves the formation of a lariat like structure
that joins the "gt" end of the intron (5' splice site) via a 5' - 2' Iinkage to the "A" at the position of
the branch site which is close to 3 ' end of the intron, Then the 3 ' -OH end of the exon attacks the 3 '
splice site and ligates to the next exon. Krawczak analyzed 101 different cases of splice junction
mutations, and he estimated that 15% of al1 point mutations causing human genetic disease result
from a rnRNA splicing defect. Most junction mutations are caused by point mutations at splice sites
while others are caused by a mutation of intronic nucleotides 3-15 upstream fiom the intron 3' end
(Krawczak et al. 1992). More recently, branch site mutations which cause alternative rnRNA
splicing have been reported (Hara et al. 1995; Webb et al. 1996). in yeast, branch site,
UACUAAC, is conserved and lies 18-40 nucleotides upstream of the 3 ' splice site (Zhuang et al.
1989). The branch site in higher eukaryotes is not well conserved, but has a preference for purines
or pyrimidines at each position and the target "A" nucleotide which usually lies less than 100
nucleotides upstream fiom the 3'splice site (Lewin 1997). One point mutation in an intronic
nucleotide, 26 bp upstream of the 3' splice site in IVS 30 o f the human FBN2 gene, which resuited
in severe congenital contractural arachnodactyly (CCA), has been reported. This point mutation
was concliided to be located at the branch site in the intronic sequences (Maslen et al. 1997). Based
on the above reports, in order to completely analyze genornic DNA for disease causing mutations, it
is necessary to characterize the introdexon junction sequence and at least -100 bp at each end of
the intronic sequences.
Among the other two genes whose protein products are needed to degrade G m ganglioside,
HEM. and HEXB, 13 splicing disease-causing mutations have been reported. Of these 13
mutations, 7 involve one of four splice site nucleotides, "gt" at 5' end and "ag" at 3' end (reviewed
in (Grave1 et al. 1995)). Thus the characterization of the introdexon junction of the GM2A gene is
necessary in order to fûlly screen the gene for a disease causing mutations.
Previously our lab and others have tried to characterize the complete structure of the GM2A
gene by isolating gene hgrnents fiom a genomic DNA library. However, in both cases the 5' end
including intron 1 was not isolated. Screening a genomic DNA library is also a time-consuming
and complicated technique. Thus, I decided to take advantage of new PCR techniques that have
been used to ampli@ more than 10 kb of A phage DNA CKainz et al. 1992; Ohler and Rose 1992).
Cheng and colleagues have amplified up to 22 kb of the p-globulin gene cluster fiom human
genomic DNA and up to 42 kb fiom phage h DNA (Cheng 1994), while Barnes have amplified up
to 35 kb of DNA with high fidelity and high yield from A phage (Bames 1994). As the exon
sequences of GM2A gene have been identified, my objective was to ampli@ the full length of intron
1 and intron 2 with exonic primers using long PCR techniques. In this study, 1 amplified both
introns either of two DNA polymerases, rTth XL (Perkin Elmer) or Klan Taq-1 DNA polymerase
(Clontech). Afier subcloning both ends of each intron from the digested PCR fragments, 1
sequenced more than 500 nucleotides fiom each end of the introns. I next designed four pairs of
primers based on these intronic sequences which could ampli@ al1 four exons and their flanking
regions in the GM2A gene using a single set of PCR conditions. Finally, 1 deveioped a restriction
map for the full length of the GMZA gene (except part of 3' untransiated region).
2.2 MATERIALS AND METHODS
2.2.1 Isolation of ~enomic DNA
Normal cultured skin fibroblast ceIl lines were obtained fkom the Tissue Culture Facility, the
Hospital for Sick Children, Toronto and the leukocytes of normal individuals were obtained from
the Clinical Laboratory in Hospital for Sick Children, Toronto- Confluent fibroblast celts were
harvested by scraping *th a rubber policeman. They were resuspended in 2 ml of phosphate
buffered saline (PBS), centrifuged and the ce11 pellet was collected. Both fibroblast cells and
Ieukocytes were resuspended in lysis buffer (100 m M Tris-CI pH 8, 40 mM EDTA pH 8, 0.2%
SDS, and 0.6 mglm1 protease K) and were grounded, then incubated in 5S°C water bath for 10
hours. The sample was extracted with one volume of phenol/chloroform, and DNA was
precipitated by adding 2 volumes of 100% ethanol. The DNA pellet was rinsed with 70% ethanol
and resuspended in 10 rnM Tris-Cl pH 8, 1 m M EDTA pH 8 (TE bufler).
2.2.2 Long PCR to amdifi intron 1 and intron 2 of the GM2A gene
Two pairs of primers were designed through RightPrimer software (BioDisk, San Francisco,
California) to be used for amplification of intron 1 and intron 2 of the GMZA gene (Table 2-1). The
primers for intron 1 each contained 18 nt of exonic sequence plus 10 nt to produce an Xho I site, i-e.
5'-GCGCCTCGAGGACCCACCCTTCCCGATG (#2833, upstream, - 15+3, counting from the
"A" of the first ATG as the nucleotide 1, and 5'-GCGCCTCGAGCAGGGGGACACTGGTGCT
(#2834, downstream, 228->2 1 1, Xho I sites are underlined). The primers for amptification of intron
2 each contained 32 nt of exonic sequence plus 10 nt to generate an Xho I site, i. e, 5 ' -
GCGCCTCGAGTI'CCTGGGATAACTGTGATGAAGGGAAGGAC !#805, upstream, 1023
46
1 3 3) and 5 '-GCGCCTCGAGGGCAGGGCTCCCCAGTAGGAATTAACATTA (#806,
downstream, 376+345) (Table 2-1).
The rTrh extra Long DNA polymerase (rTth XL) was purchased fiom Perkin Elmer. intron 1
was amplified with prirners #2833 and #2834 in a GeneAmp PCR system 2400 (Perkin-Elmer). An
Ampliwax PCR Gem 100 bead (Perkin Elmer) was added to perform a "hot start9' reaction. The
PCR was performed in a 100 pl reaction volume with 0.4 pg template, 0.5 FM primers, 4 unit rTth
XL, 200 p M each dNTP, 1.1 mM M ~ ( O A C ) ~ (magnesium acetate). The cycling parameters used
were 1 min at 94OC for denaturation, and 35 cycles each of 15 sec at 94"C, 30 sec at 60°C and 5 min
at 72"C, then extra extension for 10 min at 72OC.
Intron 2 was amplified using Advantage KlenTaq Polymerase Mix (Clontech, Cat# 841 7- 1),
which contained Klen Taq-l DNA polymerase, TaqStart anti-Taq Antibody and minor Deep Vent
DNA polymerase, based on several reports (Tellier et ai. 1996; Barnes et al. 1994). Intron 2 was
arnplified with primers #805 and #806 in Robocycler 40 (Stratagene). The PCR was performed in a
50 fl reaction volume with 0.4 - 0.6 pg templates, 0.5 primers, 1 FI Advantage KlenTaq
Polymerase Mix, 200 j.M each dNTP in a buffer of 40 m M Triche-KOH @H=9.2), 15 mM KOAc,
3.5 mM M ~ ( O A C ) ~ and 75 pg/ml bovine serum albumin. The cycling parameters were:
denaturation at 99°C for 35 sec, annealing at 67OC for 30 sec, and elongation at 6g°C for 9 min
during cycles 1-1 5, then for 1 1 min during cycles 16-25, and finally 13 min during cycles 26-35.
Ten each of the PCR products were mixed with DNA loading dye and were analyzed by
eIectrophoresis in a 1% agarose gel.
Table 2-1 Primers used to amplify intron 1 and intron 2 of GM2A gene
Size of PCR product 6.7kb
5 ' location El (-15)
Intron
1
2
Size of intron 6.45kb
6.60kb
Primers "
GCGCCTCGAGGACCCACCCTTCCCGATG
Pol yinerase
GCGCCTCGAGCAGGGGGACACTGGTGCT GCGCCTCGAGTTCCTGGGATAACTGTGATGAAGGGAAGGACC GCGCCTCGAGGGCAGGGCTCCCCAGTAGGAATTAACATGTCA
rTth extra long ( Perkinpl Elmer) Advantagc Klcn Taq mix(C1ontech)
E2 (228) E2(102) E3(376)
a. The M o I site in the primers is underlined. b. Exonic location is based on the "A" of thc first ATG as nucleotide 1.
2.2.3 Restriction analvsis of intron I and intron 2
The PCR products of intron 1 and intron 2 were digested by the following endonucleases:
BamH Sst 1, EcoR i, B a 1, Kpn I, Hind 1 ' and Xho 1. The digestion results were analyzed in 1%
agarose gel. Four BamH I digestion fragments of intron 1 were separated with QiAEX II gel
extraction kit (Qiagen) and were M e r digested with the other six endonucleases. Two Sst I
digestion fragments of intron 2 were also separated and were further digested with the other six
endonucleases.
2.2.4 Subcloning - of both ends of introns 1 and 2 into the ~Bluescr i~ t vector
Restriction analysis identified two BamH I hgments of intron 1 (0.6 kb and 1.2 kb) as the
5' and 3'ends of intron 1. These two fragments were independently digested with Xho I and
cleaned with QIAEX II gel extraction kit (Qiagen). One hundred ng of each fragment was ligated
inro 30 ng BamH I/Xho 1 sites of pBluescnpt vector @BS, Stragagene) with T4 ligase (Borhinger,
Cat# 799 099). The ligation products were transformed into XL-Blue MRF' competent cell
(Stratagene, Cat# 200230). Through white/ blue selection in 50 pg/ml ampicillin LB plates with X-
Ga1 and IPTG, the white colonies were picked and grown in LB media containing 50 pg/ml of
ampicillin. Isolation of the plasmid DNA was performed with Qiagen mini-preparation kit
(Qiagen). Digestions of 5 pl of the isolated plasmid DNA with the restriction enzymes BamHI and
Xho I were performed to ensure the plasmid contained the correct insert. Four kb and 2.9 kb Sst I
fragments of intron 2 were digested by Sst I and subcloned into the Sst I/ Xho I sites of the same
vector and analyzed by similar methods.
2.2.5 Nucleotide seauencing both ends of intron 1 and 2
The nucleotide sequences of the above inserts were determined by the dideoxy chain
termination method (Sanger et al. 1977). Plasmid DNA products, 1 .S pg, containing each end of
the introns, were mixed with 30 ng each of T7 or T3 primers (Stragagene), [a--''s] dATP
(Arnersham) and other components of the sequenase kit as recommended by the manufacturer
(Pharmacia, Cat# 27-1682-01). In order to confirm the sequences of the introns, both antisense and
sense were sequenced from PCR products obtained fiom five independent individual genomic DNA
samples.
2.2.6 Use of PCR to ampli* al1 of the exons and exod intron iunctions of the GMZA gene
Based on the nucleotide sequences obtained from the 5' and 3' ends of the introns, 1
designed 4 pairs of primers (Table 2-2) using RightPrimer software (BioDisk, San Francisco,
California) to amplify al1 of the exons and their flanking regions by PCR. Fragments made up of
exons and their intronic flanking regions were amplified with each pair of primers (Table 2-2) using
a GeneAmp PCR systern 2400 (Perkin-Elmer). PCR was performed in a total volume of 100 pl
with 0.6 pg genomic DNA, 0.5 FM primers, 0.2 m M each of dNTP, 2.5 mM MgCl* and 2.5 unit
Taq-Gold DNA polymerase (Perkin Elmer). The cycling parameters used were 10 min at 94OC for
denaturation, 43 cycles each of 30 sec at 94OC, 30 sec at 54OC and 30 sec at 72OC, then 10 min at
72°C for elongation. With these conditions, PCR amplification of exon 3 and its flanking region
produced some nonspecific DNA. Although these nonspecific bands did not interfere with the
isolation of the target fragment, it was found that they could be removed by lowering the
concentration of MgClz to 2.0 mM. Based on my exonic and intronic sequences and those obtained
from previous studies (Xie et al. 199 l), each of the PCR fragments (Exon 1, 2, 3, and 4) was
designed to contain a unique restriction site, Xba 1, Sst 1, Pst 1, and EcoR I, respectively (Table 2-2,
Fig 2-5). These digestion sites can be used as controls to confirm the identity of the amplified
fragments. Thus each Fragment was digested by their respective restriction endonuclease and
analyzed by electrophoresis in a 1% agarose gel.
Table 2-2 Primers used to amplify the exons and the exonl intron junctions of GM2A gene
I (- 149) 56.2 528bp Sst I :76+452 ( 2 1 8) 56.2
7 16bp PSI 1 :484+232
Tm OC'
l AAGGCTGTCTGCATTTTCACTC
CATGTCTCTGGATTTGTAAGCC IVS3 (-290) ECOR 1 :3 12+352 GGCTATCAAGAACTGTCCAACT E4 (802)
5' locationb
E I (-69) E 1 IVS 1 (256) / 58.1 1 1
nt = nucleotides Exonic locations are based on the "A" of the first ATG as nucleotide 1 ; intronic locations arc counted from first splice site of 5' end (plus nunibcr) or last nt of 3' splicc site (minus number) Calculation of Tm is bascd on Currcnt Protocol in Molecular Biology, edited by Ausubel et al. (1997).
primers (22119~
GGAAGGCATTTAAAGGACCTCT
2.2.7 Direct seauencinq
PCR products containing exons and their flanking regions were purified with the Qiagen
PCR purification kit (Qiagen). In order to c o n f m the nucleotide sequences at both ends of the
introns, direct sequencing was performed based on Thermos Sequenase Radiolabeled Terminator
Cycle Sequencing kit (Amersham, Cat# US79750). Up to 250 ng (about 1 pmol) of templates and
30 ng of one PCR primer were mixed with 8 units thermo sequenase polyrnerase and related buffer
(total volume 20 pl), and 4.5 pl of reaction mixtures were transferred to each of 2.5 ~1 [a-33~]
ddNTP mixtures (Amersham, Cat# AH 9539). Afier mineral oil was added, cycling termination
reactions were performed in Robocycler 40 (Siratagene) with 2 min at 94OC for denaturation, 25
cycles of each 30 sec at 94"C, 30 sec at 55°C and 1 min at 72°C. Reaction solutions were denatured
and loaded in glycerol tolerant DNA sequencing gel (Amersham). Sequencing gels were dried and
exposed to Kodak Biomax MR autoradiography film.
2.3 RESULTS
The initial primers used to ampli@ both introns were located within exons, allowing their
orientation in the GMZA gene to be easily determined. The intron 1 PCR product was
approximately 6.7 kb in length (Fig 2-1) and its 5' end contained 96 bp fiom exon 1 and its 3' end
contained 146 bp from exon 2. Therefore, the length of intron 1 of the GM2A gene was found to be
approximately 6.45 kb. The intron 2 PCR product was approximately 6.9 kb (less than the 7 kb
marker, Fig 2-l), and its 5' end contained 133 bp from exon 2 and its 3' end contained 143 bp from
exon 3. Therefore, the length of intron 2 of GMZA gene was found to be approximately 6.6 kb.
In addition to the five endonucleases, EcoR i, Bamff 1, Sac 1 (isoschizomer of Sst 4, Kpn 1
and Xba I, which were used in Klima's study (Klima et al. 199 l), 1 also digested intron 1 and intron
Fig 2- 1 . Determination of the length of intron 1 (-6.45kb) and intron 2 (4 .6kb) of the GM2A gene:
Intronic sequences were amplified by PCR. Each end of the fragments includes about
150bpexonic sequences. Intron 1,Il; Intron 2,12; 1 kb marker, M.
2 with two other endonucleases, Hind 1'1 andBo I. The PCR product containing intron 1 was
cIeaved by B a d I into four smaller fragments, 0.6 kb, 1.2 kb, 1.8 kb and 3.1 kb (Fig 2-2). These
four fragments were digested by six other endonucleases (data not shown). From these data it was
concluded that the 0.6 kb and 1.2 kb hgments fkom the BamKI digestion were the 5' and 3' ends
of intron 1. The PCR product containing intron 2 was digested by Sst I into tsvo smaller fragments,
4.0 kb and 2.9 kb (Fig 2-2). These eagments were separated and also digested by the other six
endonucleases. Two Hind II2 sites in intron 1, one Hind III site in intron 2 and no Xho I site in
either introns were identified. These digestion results were used to construct a restriction map of
intron 1 and intron 2 (Fig 2-4).
pBluescript plasmid DNAs containing each end of intron 1 and intron 2 were sequenced.
The sequence results confirmed that the 0.6 kb and 1.2 kb BamH I fragments of intmn 1 contained
the 5' and 3' ends of intron 1, respectively, and the 4.0 kb and 2.9 kb Sst I fragments of intron 2
were the 5' and 3' ends of intron 2, respectively. Exonic sequences at cach end of the intron-PCR
products were consistent with GM2A cDNA sequences (Klima et al. 199 1; Xie et al. 199 1). Two
intronic nucleotides, IVSl (-12)g and IVSl (-lS)c, in the 3' end of intron 1 differed fiom those
previously reported by Klima et al (Klima et al. 1991).
Restriction digestion of intron 1 and intron 2 with multiple endonucleases determined their
restriction maps while DNA sequencing indicated their 5' to 3' orientation within each intron. My
mapping data were combined with the nucleotide sequences of 5' and 3' untranslated regions
reported previously (Klima et al. 199 1; Xie et al. 199 1) to produce a complete restriction map for
the GM2A gene (Fig 2-4).
Primers and their locations for amplification of exons and their flanking sequences are
indicated in Table 2-2. The lengths of the PCR products for exons 1-4 are 426 bp, 528 bp, 716 bp
7kb
3kb
1.6kb
lkb
Fig 2-2. Digestion of intron 1 and intron 2 with BamHl and Sstl. the 0.6kb and 1.2kb BamHI
fragments of intron 1 were confimed as the 5' and 3' end of intron 1, respectively, and the 4.0kb
and 2.9kb Sstl fragments of intron 2 as the 5' and 3' end of intron 2, respectively. The lower band
of intron 2 digested by BamHI contains two similar size bands that were confirmed as both ends
of intron 2 (data not shown). A small fiagrnent (4 .2kb) of intron 1 produced by digestion with
Ssrl cannot be seen in this gel. Intron 1,11; intron 2,12; undigested. CID; digested by BamHI, B;
digested by Sstl, S; I kb marker, M.
and 665 bp, respectively. Each of these four hgments can be digested by unique endonucleases,
Xba I, Sst I, Pst I and EcoR 1, into two srnaller fragments (Table 2-2; Fig 2-3)- The former three
restriction sites are located in intronic sequences (Fig 2-S), while the EcoR I site, located in exon 4,
is a unique site in the GMtA cDNA m e et al. 1991).
Direct sequencing of the PCR product confmed the intronic sequences obtained from
sequencing the clones, including IVS 1 (- 12)g and IVS 1(-I S)c, which differed fiom NS 1 (- 12)t and
IVS(- 1 5)g in the previous report (Klima et al. 199 1). Furthermore, an intronic polymorphism,
IVS 1(-92)a/t, was identified. Beside these, three reported exonic polymorphisms, ASSG, G205A
and G582A, were confirmed and another novel exonic polymorphisrn, G175A. was found in this
study (chapter 3).
2.4 DISCUSSION
This study demonstrates that it is possible to ampli@ long lengths of genomic DNA
containing entire introns. Traditionally, genomic DNA was screened, then genomic DNA clones
were sequenced to obtain intronic sequence. The screening Iibrary procedwe is time-consuming,
and positive genomic clones may not cover the full length of introns. The long PCR technique
solves these problems with a simple experïmental technique. Furthermore, electrophoretic anaiysis
of the intronic PCR product obtained fiom a long PCR provides a direct measurement of the full
length of the intron that is usefui for mapping and further studies of the genes. According to
previous reports and this study, long PCR polymerase, primer designing, annealing temperature,
and extension time are critical to the long PCR technique (Barnes 1994; Cheng 1994). 1
successfully amplified intron 1 with rTth XL polymerase, but failed to ampli@ intron 2 with the
E4 E3 E2 E l M E U D P UD S U D X U D
Fig. 2-3. PCR amplification of al1 4 exons and digestion with unique restriction endonudeases.
Exons 1-4 (E 1, E2, E3 and E4) and their intronic junctions were amplified by PCR (see
Table 2-1) and digested by previously identified restriction enzymes that have a unique site
within each fragment. UD, undigested; X, B a l ; S, Sstl; P, PstI; E, EcoRI, M, lOObp
marker.
Fig 2-4. Restriction map of the GM2A gene. B=BarnHI, E=EcoRI, S=SEtI, X=X6al, K=Kpnl,
H=HindIII. No XhoI site is present in intron 1 and intron2. The numbers with each restriction site
indicates the number of times it has appeared reading from 5' to 3' in the gene structure. Intron
lengths are given in brackets. The open boxes refer to the exons, and the black boxes refer to the 5'
and 3' untranslated region of the cDNA.
(II TTAAAGGACCTCTGCCGCCTCAGACCTTGCAGTTAACTCCGCCCTGACCCACCCTTCCCG -1
G ATGCAGTCCCTOATOCAOOCTCCCCTCCTQATCOCCC~TCOCOACCCCT 60
*
ggtctggctgagatatgggggtggcca~t~cgtt~t~tauaattgttctctgcactag 120 XbaI
gccttccaaagtaactaattatgggattctggtctgtacaatgagggtggcctctaaaga 180
cttgttctgctccaggccctttttggagagattaatctcacgtctgcactctcctgccct 240
Fig 2-5 Nucleotide sequences of the GM2A exons and their 300 bp flanking intronic sequences.
The sequence of each exon is given 5' to 3', with the intronic sequence in lowercase letters,
the encoding exonic sequence in bold uppercase letters, and the untranslated exonic
sequence in regular uppercase letters. The primers for amplification of the 4 exons and their
flanking regions are showed in arrows indicating their orientation. The unique restriction
sites used to confirm the identity of each fragment are underlined. The numbers in brackets
with arrows and restriction sites indicate the exon being amplified. Three reported
poIyrnorphisms in exons are indicated with "*": ASSG, G205A and GS82G. One exonic
polymorphism G 175A was confinned in this study, as was another intronic polymorphism,
IVS 1 (- 92) ah, which are indicated with "#". Two nucleotides, IVS 1 (- 12) and IVS l ( 4 5 ) of
3 ' end of intron 1, differ from those previously reported and are indicated with """.
ggcctattaggtcagtctcctgtttggaagttccaggtctatcatatcctgccttatagt -241
ttacaatacacttttgggagattatgtcttttgagtcttttagtttagtcctgcctataa -181
gatagtttcttttgtcaacctttttcttcttctccttccttgctgcctgattgtccccag -1
caggacatgtagattcagacactctttcacaggttcatggaatctcaggatcataagatt 180
gaaaggaatctctgatgtcagcq~caqcaacttcctggtgagggcaggagtgacggatac 240 \ ( 2 )
cttgcacctggcagaagcgtcctggccttctctgggcctggtggccaactgctcattatt 300
cagtgagccatgatacaaaaaaaaaaaataaagaattctaagtctatgtatagttcagtg -241 ( 3 )
tagggggaaaattcacatttgattattaatgtctgccatgggcacaataatacactatac -181
tcacacatgggccacaatgttgccattcctagaacagactatctctaagatctcatccag -121
ttaaaaattctatgattaaaatatattgctgcttttttgaagacagaagagctggtatgt -61
ttgccctggaatttacacttataacctttttcaaacctttgttttatttttttttaccag -1
gtaagtacttagggaggagagagcgttacccctgtggctaaagagatggggtttggagag 60/-322 ( 4 ) ,
aagggtctttgcattctccttctacaqatctgcatgtctctggatttgtaagccagtgtg 120/-262 Pst1
acctatcaggaatcacttatcttccgggagcctcagttatccatctacgaaatgggagac 180/-202
ttgaacttagatgtgatcttcagggccctttatccatataatccatgctctacagtgcta 240/-142
tggccgtctctcatcttgtgcggctgttttgagaatgggaagaggggtggtagttcatgg 300/-82 (3)
ctgcaatcctagcagtggctctaggagaaagaccccatcagtaggctcccactgactggc 360/-22
ggtccactggctttcccgcag GGAACCTACTCACTGCCCAAGAGC 450
TCCTCTGTTTTGTGTTTGCCAAGGCCAAACTCCCACTCTCTGCCCCCCTTTAATCCCCTT 690
6 1
same polymerase. After designing longer pnmers (42 nucleotides), setting higher denaturing
temperature and long extension times (Tellier and Bukh 1996), 1 successfully amplified intron 2 by
using another DNA polymerase, Klan Tapl DNA polyrnerase. This result may imply that intron 2
contained a higher percentage of GC pairs (Chenchîk er al. 1996).
The onIy experimental concem for intronic sequences obtained Erom long PCR is related to
the fidelity of the polymerases. In my experiment, rTth XL polymerase was optimized for both
polymerase and proofieading activity, and the Klan Taq polymerase mix contained the minor
component of Deep Vent polymerase, which is believed to contain a 3 3 5 ' exonuclease activity
that enhances the fidelity of replication (Mattila et al. 199 1). Therefore, both polymerases produced
much less replication error during PCR reaction than does Tuq polymerase alone. Furthemore, 1
directly sequenced the regions in each hgment that were reported in Fig 2-5. 1 also sequenced
different individual sampies and the results were consistent among different plasmid clones and
among different individual samples, except one heterozygous a/t in IVS 1(-92) found in a normal
individual sample (Fig 2-5).
When comparing the sequence and restriction rnapping data obtained in this study with those
previously published by Klima et al (Klima et al. 1991)' some differences were found. Klima
reported that the length of intron 2 was 7.3 kb. My data clearly indicated the length of intron 2 is
approximately 6.6 kb (Fig 2- 1). Two intronic nucleotides also differ, Le. IVS 1 (- 12)g and IVS 1 (-
15)c in my study, but IVS 1(-12)t and NS(-1S)g in Klima's report. 1 directly sequenced five
individual PCR products, including one from an AB variant patient (chapter 3), and 1 obtained the
same sequence results. These differences could either be mistakes in Mima et al sequencing or rare
polymorphisms.
Comparing restriction mapping in Klima's report, 1 demonstrated one EcoR 1 (&) site
located in exon 4, which has been confirmed in cDNA sequences (Xie et al. 1991), and other two
62
EcoR i sites (E2 and E3) located at the 3' end of intron 1. Besides the different distances between
some restriction sites 1 obtained and those in Klima's report (Fig 2-4) (Klima et al. 1991), 1 also
found one more B a I site (Xis) close to the 5' end of intron 2 and another Xba I (X3) iocated at the
3' end of intron 1. From plasmid sequencing and direct sequencing, 1 confmed the location of the
following restriction sites: XI, S2, E2 and E3 (Fig 2-S), which are close to introd exon junctions. As
a whole, I completed the nucleotide restriction mapping of the GM2A gene and localized more
exactfy the restriction site of seven endonucleases.
In this study, intron 1 and intron 2 were arnplified by long PCR. Four sets of prirners were
designed to ampli@ four fragments that contain al1 exons and their flanking regions through a one
step PCR reaction using the same parameters and the same concentration of reaction reagents with
the Taq-Gold DNA polyrnerase. Because Taq-Gold DNA polymerase produces a T overhang at the
3' end of PCR products, the exon flanking regions c m be directly subcloned into a plasmid vector
by using TA cloning technique (Invitrogen) and used for M e r analysis (Clark 1988; Mead et al.
199 1). These four pain of primes c m be used for the diagnosis of any patient suspected of having
a disease causing mutation in their GMZA gene. Furthemore, one unique restriction endonuclease
was designed to be present in each fragment, Xba I, Ssr I, Pst 1 and EcoR I, which can be used to
confirrn each PCR product.
2.5 ACKNOWLEDGMENT
1 would like to thank Dr. Raymond Tellier for his critical advises in the long PCR technique,
and Ms. Irené Warren for isolating leukocyte genomic DNA.
2.6 REFERENCES
Bames WM (1994) PCR amplification of up to 35-kb DNA with high fidility and high yield fiom
lamda bacterophage templates. Proc.Natl.Acad.Sci.USA 9 1 :22 16-2220
Breathnach R Chambon P (198 1) Organization and expression of eucaryotic split genes coding for
proteins. Annu.Rev.Biochem. 50:349-383
Chenchik A, Diachenko L, Moqadam F, Tarabykin V, Lukyanov S, Siebert PD (1996) Full-length
cDNA cloning and determination of mRNA 5' and 3' ends by amplification of adaptor-
Iigated cDNA. BioTechniques 2 1 526-534
Cheng S (1994) Effective amplificaiton of long target fkom cloned inserts and human genomic
DNA. Proc.Nat1.Acad.Sci.USA 9 1 5695-5699
Clark JM (1988) Novel non-tempiated nucleotide addition reactions catalyzed by procaryotic and
eucaryotic DNA polymerases. Nucl.Acids Res. 16:9677-9686
Grave1 RA, Clarke JTR, Kaback MM, Mahuran D, Sandhoff K, Suzuki K (1995) The G M ~
gangliosidoses. In: Scnver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis of
inherited disease. McGraw-Hill, New York, pp 2829-2879
Hara T, Ichihara M, Takagi M, Miyajima A (1995) Interleukin-3 (IL-3) poor-responsive inbred
mouse strains carry the identiccal deletion of a branch point in the iL-3 receptor alpha
subunit gene. Blood 85233 1-2336
Heng HHQ, Xie B, Shi XM, Tsui L-C, Mahuran DI (1993) Refined mapping of the G M ~ activator
protein (GM2A) locus to 5q3 1 -3-q33.1, distal to the spinal muscular atrophy locus.
Genomics 1 8:429-43 1
Kainz P, Schmiedlechner A, Snack HB (1992) In vitro amplification of DNA fragments > 10 db.
Anal-Biochem. 202:46-49
64
Klima H, Tanaka A, Schnabel D, Nakano T, Schroder M, Suzuki K, Sandhoff K (1991)
Characterization of full-length cDNAs and the gene coding for the human G M ~ activator
protein. FEBS Lett. 289:260-264
Krawczak M, Reiss J, Cooper DN (1992) The mutational spectrum of single base-pair substitutions
in mRNA splice junctions of human genes:causes and consequences. Hum-Genet. 90:41-54
Lewin B (1 997) Genes W. Oxford University Press, Oxford, England, pp 885-920
Maslen C, Babcock D, Raghunath M, Steinmann B (1997) A rare branch-point mutation is
associated with missplicing of fibrillin-2 in a large family with congenital contractural
arachnodactyly. Am.J.Hum.Genet. 60: 1389- 1398
Mattila P, Korpela J, Tenkanen T, Pitkanen K (1991) Fidelity of DNA synthesis by the
Therrnococct~s iïtoralis DNA polymerase -- an extremely heat stable enzyme with
proofreading activity. Nucl. Acids Res. 19:4967-4973
McKeown M (1 992) Alternative mRNA splicing. Annu.Rev.Cel1 Biol. 8: 133- 155
Mead DA, Pey NK, Heimstadt C, Marcil RA, Smith LM (1991) A universal method for the direct
cloning of PCR amplified nucieic acid. Bio/Technology 9:657-663
Nagarajan S, Chen H-C, Li S-C, Li Y-T, Lockyer JM (1992) Evidence for two cDNA clones
encoding human GM~-activator protein. Bi0chem.J. 282:807-8 13
OhIer LD, Rose EA (1992) Optimization of Ion-distance PCR using a transposon-based mode1
system. PCR methods & applications 2 5 1-59
Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain-termination inhibitors.
Proc.Natl.Acad.Sci.USA 7454634467
Sharp PA (1994) Split genes and RNA splicing. Ce11 77:805-815
Tellier R, Bukh 1 (1996) Long PCR and its application to Hepatitis viruses: amplification of
hepatitis A, hepatitis 9, and hepatitis C virus genomes. 1.Clin.Microbiol. 34:3085-309 1
65
Webb JC, Patel DDT Shoulders CC, Knight BL, Soutar AK (1996) Genetic variation at a splicing
branch point in intron 9 of the low dencity Iipoprotein (LDL)-receptor gene: a rare mutation
that dismpts mRNA splicing in a patient with familial hypercholesterolaemia and a common
poiyrnorphisrn. HumMolGenet. 9: 1325- 133 1
Xie B, McInnes B, Neote K, Lamhonwah A-M, Mahuran D (1 99 1) Isolation and expression of a
full-length cDNA encoding the human -2 activator protein. Biochem. Biophys. Res.
Commun. 177: 1217-1223
Xie B, Wang W, Mahuran DJ (1992) A Cys138-to-Arg substitution in the GM2 activator protein is
associated with the AB variant f o m of GM2 gangliosidosis. Am.J.Hum.Genet. 50: 1046-
1052
Zhuang Y, Goldstein AM, Weiner AM (1989) UACUAAC is the preferred branch site for
rnammalian mRNA splicing. Proc.Natl.Acad.Sci.USA 86:2752-2756
CHAPTER III
ASSOCIATION OF A NONSENSE MUTATION AT
THE CODON FOR GLU54 IN THE GM2A GENE WITH
ACUTE AB VARIANT C;M2 GANGLIOSIDOSIS
3.1 INTRODUCTION
The GW gangliosidoses are a group of autosomal recessive inherited disorders caused by
excessive intralysosomal accumulation of ganglioside Gw. Three variants of these disorders, i.e.
Tay-Sachs disease, Sandhoff disease and the AB variant form, result fiom mutations in the HE-
gene, H E B gene and GM2A gene, respectively. Among these three genes, mutations causing Tay-
Sachs disease and Sandhoff disease have been widely characterized (Mahuran 1999). In general,
mutations that result in complete absence of enzyme activity, protein and/ or mRNA are associated
with an early onset of symptoms and the classic severe acute infantile phenotype. Point mutations,
compatible with the production of stable mRNA and some detectable protein and enzyme activity,
are associated with a later onset and slower progression of the disease.
To date only the acute AB variant form of G M ~ gangliosidosis has been described in four
patients. These patients were al1 homozygous or hemizygous for distinct mutations. Two of these
are missense mutations, a T412 to C (Cysl38Arg) mutation (Schroder et al. 1991; Xie et al. 1992)
and a G506 to C (Arg l6gPr0) mutation (Schroder er al. 1993). Recently, an AAG (262-264)
deletion, resulting in the loss of Lys88, and an A410 deletion, resulting in substitution of 33 arnino
acids and the loss of another 24 amino acid residues afier a premature STOP codon (Schepers et al.
1996), have been reported. None of these mutations affected mRNA stability, but they al1 lead to a
failure to produce a detectable mature Activator in patients' cells, probably owing to abnormal
processing or stability of the protein in ER,
Three polymorphisms, A55G, GZ05A and G582A, have been descnbed in the exons of the
GM7A gene through screening and sequencing cDNA libraries (Xie et al. 199 1). The former two
poIymorphisms cause an Ala to Thr substitution, and a Val to Met substitution, respectively.
G582A causes the 3' TAA STOP codon to become TAG, another STOP codon.
In this study, the G M A genotype fiom a patient suspected of having & gangliosidosis but
with normal Hex A and Hex B levels was characterized. The fibroblasts of the patient were
deficient in both Activator protein and mRNA. This patient's cells contained two different sizes of
cDNA detectable only by RT-PCR. A G160 to T transversion, causing a Glu54STOP mutation in
the exon 2 of the GM2A gene was found in the larger normal length cDNA, the smalIer cDNA
resulted from the in-frame deletion of exon 2. Further expenments indicated that the patient is
likely hornozygous for the Glu54STOP mutation. However, like the four previously reported
mutations, the possible presence of a second large GM2A deletion allele could not be cornpletely
ruled out.
Finally in the context of the novel GMZA nonsense mutation, 1 examine the controversy
(reviewed in (Maquat 1996)) surrounding the hypothesis that nonsense mutations promote the
skipping of the exon in which they are contained in order to re-estzblish the reading fiame (Dietz er
al. 1993; Mazoyer et aL 1998). This hypothesis would require the presence in the nucleus of a
mechanism for reading the fiame pnor to the splicing out of introns (reviewed in (Dietz and
Kendzior 1994)).
3.2 MATERIALS AND METHODS
3.2.1 Patient information
This patient was a boy with Laotian Hmong ancestry, Le. fiom a geographically isolated
small Laotian hi11 tribe, with no known parental consanguinity. At one-year age he had fiequent
seizures and delayed motor development. Motor seizures, myoclonic jerks, hyperacusis and
exaggerated startle response were seen during his second year. He was admitted to Valley
Children's Hospital in Fresno, California because of pneumonia when he was 2 1/2 years old.
Physical examination revealed that he had lower growth parameters, such as height and weight.
69
Ophthalmologic evaluation r~vealed bilateral macular cherry red spots. A spinal tap was perfomed
and total gangliosides were found to be highly elevated. The patient's leukocytes and plasma were
assayed for Hex A and Hex B activity and were found to be normal. Two brothers and one sister of
the patient did not present with similar clinical symptom, nor was there any family history of
individuals with a similar phenotype. Based on the above clinical phenotype and biochemical
assay, he was diagnosed with the AB variant form of Gm gangliosidosis.
3.2-2 Cell lines and leukocvte sample
The patient's cultured fibroblast cells were sent fiom Dr. Cynthia Curing, Valley Children's
Hospital, Fresno, California. Two normal fibroblast cel! lines, referred to as N1 and N2,
respectively, were obtained fiom the Tissue Culture Facility, Hospital for Sick Children. These
fibroblast ce11 lines were grown with a-minimal essential media (crMEM) (Flow Laboratories)
supplemented with 10% (v/v) fetal calf serum (FCS), 100 pg/ml streptomycin and 100 p g h l
penicillin. The normal leukocyte genomic DNA was obtained tiom the method described in chapter
2.
3.2.3 Western blot analvsis
The confluent fibroblast cells fiom N1 and N2, and the patient were harvested with
NaH2P04 lysis buffer (10 m M NaH2P04 with 5% glycerol) and subjected to 5 rounds of freeze-
thawing in dry ice and 37OC waterbath, respectively. An equal volume of tetrachloromethane
(CC14) was added and mixed with lysate. After centrifugation, the upper layer, containing the ce11
lysate, was removed for protein assay. The concentration of protein in the lysates was determined
using the Lowry method (Lowry et al. 195 1). Fi@ pg and 100 pg of normal and patient protein
were mixed with the loading buffer (containing 20 mM DTT and 4% SDS), and boiled for 5 min.
The proteins in each sarnple were separated by 12.5% SDS-PAGE and were transferred to a nitro-
cellulose membrane (Amersham) over a 16 hour period (Brown et al. 1989). A nitro-cellulose
membrane was blocked by exposure to 5% skim milk in Bovine Lacto Transfer Technique
Optimizer (BLOTTO, 10 mM of Tris, 150mM of NaCI, 0.05% of Tween 20, pH 7.5) for 4 hours,
then incubated with a I:1500 dilution (1% skim milk in BLOTTO) of goat anti-glutathione-s-
transferase/ Activator fusion protein antiserum (Xie et al. 1992). The membrane was washed 4
times for 30 min with 1% skim milk in BLOTTO and incubated with a 1:10,000 dilution (1% skim
milk in BLOTTO) of donkey anti-goat IgG/ horse radish peroxidase conjugated for 1 hou. The
membrane was then washed 4 times for 15 min with 1% skim milk in BLOTTO, quickly rinsed
with BLOTTO (no skim milk), and dned between two filter papers. The membrane was incubated
in Detection reagent 1 and 2 (Amersham ECL system) for exactly 1 min, dried briefly on filter
papers, covered with Saran wrap, and exposed to Hyperfilm- ECL for 1 min.
3.2.4 Polv A' RNA isolation and Northem Blot analvsis
As the activator mRNA is very rare (Xie et ai. 1991), p o l y ~ + RNA must be used for
Northem blot analysis. ~ o l y ~ + RNA fiom normal and patient fibroblasts was isolated by the fast
mRNA isolation kit (Invitrogen, Cat No. K1593-02). Four pg each of p o l y ~ ' RNA was separated
electrophoretically on a 1.0% agarose gel containing 2% formaldehyde and then transferred to a
Genescreen nylon membrane @EN life science). The probes used were radiolabelled with [a-32~]
dCTP (Amersham) using the random primer labeling method (Gibco BELL). These probes, a -600
bp full length Activator cDNA obtained eom RT-PCR cloning product of a normal individual and a
-350 bp cDNA Fragment of cytochrome C oxidase complex IV (Cox6a) in pBluescript vector
(obtained fiom Dr. B. H. Robinson's lab), detected the Activator mRNA and the control mRNA of
Coxoa, respectively. Hybridizations were performed in rotating hybndization oven at 6S°C in a
solution containing 100 ng of each probe (10'cpm), 0.5M Na2HP04, 7% SDS, 1% BSA, 50pg/mI
salmon sperm DNA and lmM EDTA for 16 hours. The membrane was washed twice for half an
hour with 30 mM Na2HP04 and 0.1% SDS at 6S°C. The membrane was fmally exposed to Kodak
X-OMAT AR film for 20 hours and the film developed.
3 -2.5 Total RNA isolation and RT-PCR
Total RNA was isolated fiom 150 mm diameter plates of confluent cultured fibroblasts fiom
NI, N2 and the patient based on the guanidinium thiocyanate method (Chomczynski and Sacchi
1987). Briefly, afrer rinsing with PBS, the cells were harvested in 4 ml denaturing solution (4 M
guanidinium thiocyanate, 25 mM sodium citrate pH 7, 0.1 M p-mer~a~toethanol and 0.5%
Sarkosyl). After purification by phenop chloroform extraction, total RNA was precipitated by
adding equal volumes of 100% isopropanol. The pellet was then dissolved in diethylpyrocarbonate
(DEPC)-treated H20.
Two primers, 5'-TTGGATCCCACCCTTCCCGATGCAG (# 1680, upstream, - 1 S+6
(counting forrn first "A" of the Activator initiating ATG)), and 5'-GGATCCGTGGGA
GTTTGGCCTTGGC (#705, downstream, 666->648, BamH I sites are underlined) were designed
for reverse transcription and PCR. Reverse transcription was performed in a total volume 100 pl
with 2 pg of total RNA, 0.6 pg of primer #705, 0.5 mM each of dNTP, and 200 units of M-MLV
transcriptase (Gibco BRL) in a 37OC waterbath for 1.5 hour. Twenty pl of these transcription
solutions were used directly for PCR in Robocycler 4 0 (Stratagene). ARer a "hot start", 2.5 units
of Taq DNA polymerase (Promega) were added in a 50 11 reaction volume with 1.25 p M each of
primers #705 and #1680, 0.2 mM each of dNTP, and 1.5 m M MgC12- PCR was performed in 35
cycles each of 2 min at 94"C, 30 sec at 6L°C and 1 min at 72OC, with an addition final cycle of2
min at 94"C, 30 sec at 61°C and 5 min at 72°C.
3 -2.6 Cloning; and sequencine of the normal and ~atient GE activator cDNA
Two different sizes of cDNA fiom the patient were separated by agarose gel electrophoresis
and purified by Gene Clean kit (BioICan scientific). One pl each of the cDNA products fiom the
patient and 1 pl of fresh RT-PCR product fiom N 1 and N2 were mixed separately with 2 pl of PCR
2.1 vector, 1 pI T4 ligase h the TA cloning kit (Invitrogen) and ligated at 14°C in a waterbath
ovemight. One pl of the ligation reaction was transformed into iNVaF7 One Shot- competent
Ce11 (Invitrogen). White/ blue selection was carried out in 50 pg/ml ampicillin LB plates with the
addition of X-Gal, and the white clonies were picked and grown in LB media containing 50 pdml
of ampicillin. Isolation of the plasmid DNA was performed with Qiagen mini-preparation kit
(Qiagen). Digestion of 5 pl of the isolated plasmid DNA with BamH I was performed in order to
confirm that the plasmid contained a cDNA insert.
The DNA sequences of each cDNA were determined by the dideoxy chain termination
method (see chapter 2). In order to ensure the accuracy, the full length sequences of three
independent clones of each sample were determined using both sense and antisense strands.
3.2.7 PCR amplification of genomic DNA fi-amnents containine; nucleotide 160
Isolation of genomic DNA fiom the patient and N1 fibroblasts was described in chapter 2.
Exon 1, exon 2 and their flanking regions of the patient's genomic DNA were arnplified with the
first and second pain of primers in Table 2-2, using the same PCR parameters described in chapter
2. Each of the 528 bp PCR products from the patient and N1 was digested with endonuclease Nla
I V at 37OC for 2 hours and analyzed by electrophoresis on a 1% agarose gel.
3 -2.8 Direct seauencine;
Each of the PCR products fiom the patient and normal control containing exon 1, exon 2 and
their flanking regions was purified with Qiagen PCR purification kit and directly sequenced with
Thermos Sequenase radiolabelled terminator cycle sequencing kit (Amersham), as described in
chapter 2.
3.2.9 Deterrnination of the length of intron 1 & 2 of the GMZA gene from the vatient's genomic
DNA bv Ionn PCR
A fragment containing intron 1 of the GMZA gene was amplified fiom patient fibroblast
DNA with primer #2833 and #2834 by rTth XL DNA polymerase (see chapter 2). Another
fiagment containing intron 2 of the GMZA gene was also amplified fiom the patient fibroblast DNA
using primer #805 and #806 by Advantage Klen Taq Polymerase (chapter 2). Each of PCR
products was digested with BamH 1, EcoR I and BamH 1 plus EcoR 1, then analyzed by
electrophoresis on a 1 % agarose gel.
3.2.1 O Detection of the Activator mRNA lacking exon 2 in normal eenomic DNA
Based on the DNA sequences fiom GMZA, only a single Ninf 1 site exists in the cDNA
encoding the Activator, and it resides in exon 2. Therefore, the fiil1 length cDNA can be cleaved by
Kinf 1, while any cDNA lacking exon 2 will remain intact afier digestion. Five pl of the RT-PCR
products fiom N 1 and the patient sarnples (Fig 3-3) were digested with Hinf I in a total volume 50
pl at 3 7" C. Two primers, ATCGCCCTGGGCTTGCTT (#1438, upstream, 3 l+48) and
ACAAAACA GAGGAAAAGG (#1968, downstream 642+625), were used to amply the second
round PCR. Nested PCR was performed with 1 pl/ 50 FI of the digested RT-PCR products or equal
amounts of the undigested RT-PCR products, using 0.2 p M of each ofprimers, 1 .O mM MgCl*, and
74
0.2 mM of each dNTP. The cycling panuneters were 10 min at 94OC for denaturation, 35 cycles
each of 30 sec at 94OC, 30 sec at 6I0C and 30 sec at 72OC, then 10 min at 72OC for elongation. Ten
ng of either the cloned wild type or the cDNA lacking exon 2, as well as a Hz0 sample, were
included as controls for the nested PCR amplification.
3.3 RESULTS
The initial diagnosis of the patient as having the AB-variant form of Gw gangliosidosis was
based on his clinical presentation coupled with normal levels of both Hex A and B in his leukocytes
and plasma (see Section 3.2.1 Patient information). Since the four previously descnbed GMZA
disease causing mutations resulted in undetectable levels of Activator cross-reacting material
(CRM) in patient's cells, 1 first analyzed the lysate fiom the patient's fibroblasts by Western
blotting. Whereas lysate from two normal control ce11 lines produced easily detectable immuno-
reactive bands corresponding to the expected Mr of 22,000 (mature form of the Activator), a similar
band was not detectable in lysate samples from the patient's cells containing similar levels of total
protein (Fig 3- 1). This observation confirmed the patient's diagnosis.
To determine the levels of Activator mRNA in the patient's cells, Northern blot analysis was
carried. The results from the positive control Cox6a probe indicated that the normal and patient
samples each contained the same amount of p o l y ~ ' RNA. The Activator probe produced no
detectable signal in the lane containing the patient sample, in contrast to the lane containing the
normal sample where mRNA of the expected size was detected (Fig 3-2).
To determine if any RNA was transcribed fiom either of the patient's GMZA alleles, RT-
PCR was performed. Normal GM2A cDNA contains a 582 bp region encoding the Activator. In
this study, the PCR pnmers amplified a product containing nucleotide - 13 to 666, plus
Fig 3- 1 Western blot analysis. The fibroblast lysate nom a normal individual with 175 G/G (Nl), a
normal individual with 175 N A (N2) and the patient (P) were included. Amount of Iysate
protein loaded in each sarnpIe lane is indicated below.
GM2 activator
Fig 3-2. Northem blot analysis. Four pg PolyA RNA nom a normal individual and the patient was
analyzed. The blot was probed with 3 2 ~ labeled cDNA encoding the Activator and Cox6a
(cytochrome C oxidase complex IV). N, fiom a normal individual; P, fiom the patient.
77
two BumHI sites. Thus the normal full-length RT-PCR product is 69 1 bp. The PCR product nom
the patient sample contained two different molecular sizes of cDNA; the larger one corresponded to
the normal full-Iength (N1 and N2) (Fig 3-3) and the smaller species was of 529 bp. However, the
amount of the smaller cDNA was less than the larger size cDNA (Fig 3-3).
cDNA fragments from Nl, N2 and the two different size cDNA fragments fkom the patient
cells were cloned, and their sequences were determined. The fùll-length sequence of the cDNA
fiom N1 was determined, and the results were consistent with the previously published sequence
(Xie et al. 199 1). However, the cDNA fiom N2 contained a single G 175+A transition (Fig 3-4)
which would encode a Va159IIe substitution in the Activator protein. More significantly the larger
cDNA frorn the patient contained G 160 to T transversion in exon 2 (E3g 3-5) which converts the
codon Glu54 to a STOP codon. The smaller cDNA was found to be missing exon 2 (AE2) (Fig 3-
6). At least one other clone of each cDNA fiom different RT-PCR products was sequenced with the
same primer, and each sequence produced the same results. The complete sequence of each cDNA
was determined and found to have no other changes.
Sequencing of the patient's larger cDNA demonstrated an early nonsense mutation was
located in exon 2 of at least one allele. Sequencing of the smaller cDNA indicated that exon 2 was
skipped which could be the result of a mutation at or near the exon l/ intron 1 or the intron l / exon
2 junctions. Therefore, exon 1, exon 2 and their flanking regions were amplified and sequenced.
Because the G 160 to T transversion causes genomic DNA to [ose a normal NZa I V site, each of the
528 bp fragments from the patient and N1 was digested by M a I V and analyzed by agarose gel
elcctrophoresis. The normal fragment (528 bp) contained three Ma I V sites and cleaved into four
fragments (47 bp, 159 bp, 29 bp and 293 bp), while the fragment obtained from the patient (528 bp)
produced only three hgments, 47 bp, 159 bp and 322 bp (Fig 3-7). Furthemore direct sequencing
Fig 3-3. Reverse transcription and PCR analysis. RNA fiom the patient and two normal individuals
was included. Arrow's point to the predicted normal size product (69 lbp) and unexpected
smaller product fonned in sample from the patient (529bp). P, patient; N1, 175 G/G normal
individual; N2, 175 G/A normal individual; M, h DNN HindiII marker.
N2 N I G A T C G A T C
Fig 3-4. Nucleotide sequence of cDNA fiom two normal individuals. A single G 1 7 5 j A transition
was noted.
Patient Normal
G A T C G A T C
Fig 3-5 Nucleotide sequence of larger cDNA fkom the patient. A single G 160 to T transversion is
noted.
Normal Patient Normal (Exon2Exon3) (ExonlExon3) (Exonl Exon2) G A T C G A T C G A T C
Fig 3-6. Nucleotide sequence of the smaller cDNA from the patient. Exon 2 is missing in the
smaller cDNA of the patient.
of the patient's exon 1 and its flanking region failed to detect any m e r mutations. Direct
sequencing of the patient's exon 2 and its flanking region detected only the nonsense mutation in
the homozygous form with no other sequence difference fiom that of the normal control (Fig 3-9).
This suggested that both of the patient's alleles likely contained the nonsense mutation.
Genomic DNA fiom N2 (containing G175A transition in its cDNA) was also directly
sequenced and was confirmed to have the 175G-A transition presented in both alleles (Fig 3-8).
Interestingly, genomic DNA from another unrelated normal individual (Normal-3, N3) contained
the 175 G/A in a heterozygous f o m (Fig 3-8). In addition, hvo 175 N A homozygotes were also
detected from the genomic DNA of two normal individuals through PCR amplification and
sequencing (data not show). These direct sequencing results indicated that 175 A is a common
polymorphism in GM2A gene.
In order to determine whether the skipping of exon 2 in the smaller cDNA from the patient
resulted from a partial deletion of GMZA gene, both intron 1 and intron 2 of the patient's GM2A
gene were amplified in a single long PCR. The fragment obtained fkom the patient had the same
apparent length as that obtained fkom a normal control and produced the same restriction digest
pattern as the normal fiagrnent with both BumH I and EcoR I (Fig 3-10). These data suggested that
the patient likely is homoygous for the nonsense mutation; however, the presence of a large
deletion allele cannot be completely mled out.
Since the activator mRNA in the patient's p o l y ~ + RNA was undetectable by Northem
blotting, 1 felt it was possible that a similarly low level of the AE2 mRNA might also be present in
normal RT-PCR samples, Le. a naturally occumng altematively spliced form of mRNA, but
because of the relatively high level of normal Activator mRNA in the controis, AE2 was not
detectable. To test this theory 1 developed a nested PCR procedure specific for the AE2 product.
Since only one Hinf I site exists in normal GM2A cDNA (Fig 3-1 LA) and is located in exon 2,
U D N P M
SWbp
3Wbp
1 Wbp
Normal
Patient
Fig 3-7. (A) Digestion of exon 2 flanking region with NMV. PCR fkagments containing exon 2 and
its flanking sequence from a normal individual and the patient were digested by NlolV. UD,
undigested 528 bp PCR fragment; N, digestion of the normal fiagrnent; P, digestion of the fiagrnent
from the patient; M, lOObp marker. (B) The digestion diagram o f exon 2 flanking region with
NiuiK The G 160T stop codon mutation in the patient causes Ioss of an NMV site.
N2 N1 N3
NA175 G/G175 WA175
G A T C G A T C G A T C
Fig 3-8 Nucleotide sequence of a PCR arnplified region of the GM2A gene containing nucleotide
175 from three normal individuals (N 1, N2 and N3).
Patient Normal
G A T C G A T C
Fig 3-9. Direct sequencing o f PCR products from the patient's genomic DNA. Note that the patient
is apparently homozygous for the G 160 to T nonsense mutation.
Fig 3-1 0 Digestion of intron I of the GMZA gene obtained by PCR with EcoiU and BarnWI:
Intron 1 of the GMZA gene from the patient and a normal individual were obtained by long
PCR and digested with EcoRl (E), BamH 1 (B) or both enzymes (E/B). U, undigested; M,
1 kb marker.
digestion of the normal RT-PCR hgment with this enzyme should preclude nested-PCR
amplification using primers # 1968 and #1438 (Fig 3-1 1B). Without digestion by Ninf 1, the second
round PCR products of the normal sample contained predorninantly the fill-length product (lane 3
of Fig 3-12), cornpared with the products fiom the patient's sample (lane 4). However, afier the RT-
PCR products were digested by Hinf 1, both second round PCR products fiom the normal and
patient's samples contained predominantly the AE2 fragment in about equal amounts (lane 5 and 6
of Fig 3-12). A small amount of the fûll-length fragment is also detectable (lane 5 and 6 of Fig 3-
12) reflecting the fact that restriction digestions are not 100% efficient (Valentine and Heflich
1997). Significantly, none of AE2 product was detected in the PCR products fiom cloned normal
cDNA (lane l), indicating that AE2 cDNA obtained in the normal sample (lane 3, 5) is not due to
contamination. This conclusion is strengthened by the negative Hz0 control (lane 7).
3.4 DISCUSSION
The patient showed a classic acute infantile fom of Gm gangliosidosis, but his Hex A and
Hex B levels were normal. In his fibroblast sample, there is no any detectable Activator CRM (Fig
3- 1) and no detectable GM2A mRNA (Fig 3-2). Thus the patient suffered from AB variant form of
GMI gangliosidosis.
Of the four previously reported mutations in the GM2A gene, two are missense mutations,
one is a single codon deletion and the other one is a single nucleotide deletion causing a firame shifi
and early termination (Schepers et al. 1996; Schr6der et al. 1993; Schroder et al. 199 1; Xie et al.
1992). Al1 of these mutations have been located in exon 3 or exon 4 and still produce apparently
full-length and normal levels of steady state GMZA rnRNA in patients' cells. In this study, the
patient's Activator mRNA of normal size could only be detected through RT-PCR, but in addition a
Widetype (one Hinf 1 site) RT-PCR
691bp 1 80 (=172bp+S19bp) .A 705
1 1 1 1
nested PCR
613bp x4 E l E2 E3
Exon 2 skipping (no Hinf 1 site)
nested PCR 7 T 1834 1968
451bp El E3 E4
Fig. 3- 1 1 (A) Digestion of wild type cDNA and the exon 2-lacking cDNA (AES) by Hinf L Wide type cDNA and the exon 2-lacking cDNA (AE2) obtained form RT-PCR (Fig 3-3) are cleaved by Hinf 1. UD, undigested; Hinf 1, Hinf 1 digestion; WT, wide type cDNA; AE2, cDNA missing exon 2; M, 100 bp DNA marker. (B) Digestion diagram for fkil length and AE2 cDNA by Hinf 1. Numbers with arrow indicate primers and their orientation. The length of the RT-PCR and nestedPCR product are indicated. One Hinf 1 site in exon 2 of the normal sample is shown with an arrow.
RT-PCR product cDNA
Fig. 3-12 Nested PCR amplification of RT-PCR product from the patient and a normal
individual. AE2 and WT refer to cDNA lacking exon 2 or containing exon 2, respectively. LJD,
undigested; Hinf 1, Hinf 1 digestion prior to nested PCR; P, patient's RT-PCR product; N, normal
individual's RT-PCR product; C, H20 control; M, lOObp DNA marker.
smaller cDNA species was seen at an even lower level (Fig 3-3). Nucleotide sequencing of the
DNAs uncovered a nonsense mutation at the codon for Glu 54 in exon 2 in the normal size cDNA
and the inhrne deletion of exon 2 in the smaller cDNA (referred as AE2) (Fig 3-5'6). The Glu54 to
STOP codon mutation, which is located in exon 2, is the € k t nonsense mutation reported in the
GMZA gene. This mutation causes the loss of two thirds of the normal amino acids (54-194) fiom
the Activator,
Since the RT-PCR results showed that there were two different sizes of cDNA in the
patient's sample, it was suspected that the STOP codon mutation in one allele produced the normal
length cDNA and a splicing junction mutation in the other allele produced the AE2 mRNA.
However, the experirnental data did not support this hypothesis. a) Direct sequencing (Fig 3-9) and
restriction digestion (Fig 3-7) indicated that the patient was Iikely homozygous for the nonsense
mutation. b) Abnormal altematively spliced mRNA is usually caused by nucleotide mutations in
exon/ intron junctions (Lewin 1997) (Chapter 2). However, no mutations were found in these sites
in intron I l exon 2 or exon 2/ intron 2 junction regions through direct sequencing. c) If the smaller
BE2 cDNA was produced fiom a second unidentified deletion allele, the deletion would have to
encompass al1 of exon 2, and either >149bp of the 3' end of IVS 1 or >218bp of the 5' end of IVS 2,
othewise it would have been detected by long PCR with the exonic primers or by conventional
PCR with the intronic primers I subsequently designed to ampl* exon 2 and its flanking sequences
(Chapter 2). It is unlikely that such a large deletion would result in the exact inframe deletion of
only exon 2 from the allele's transcribed RNA product. d) Since no early STOP codon is present in
the AE2 RNA, its stability should be similar to that of the wild type transcription product (reviewed
in (Maquat 1996)). However, levels of AE2 RNA were much lower than that of normal RNA and
even lower than that of the patient's RNA containing the early STOP codon. Thus the above data
strongly indicate that the patient is likely homozygous for GluS4STOP mutation in his GA4ïA gene
and the AE2 RNA is not transcribed by a second unidentified deletion allele. Nonetheless a near
total deletion of the GM2A gene can not be completely ruled out, which would make the patient
hemizygous for the nonsense mutation. This possibility has also not been ruled out for any of the
other 4 patients previously described with AB variant G m gangliosidosis.
Another observation also supports the likelihood that the patient is homozygous for
nonsense mutation. The patient's family belongs to a deme, the Hmong, a small Laotian hi11 tribe,
and it is unlikely that 2 GM2A mutant alleles would exist in such a small population. For example,
the HEAB mutations responsible for Sandhoff disease (also a rare disease, but still much more
common than the AB-variant) in an Argentinean deme have been characterized. It was concluded
that there was only a single, novel, high fiequency, splice site mutation present in this population
(Kleiman et al. 1994).
Premahire STOP codons can be generated directly through a nonsense point mutation or
indirectly through a Me-sh i f t . The latter can be generated through abnormal mRNA splicing,
deletions, or insertions. There are nurnerous cases of fiame-shift mutation causing GM2
gangliosidosis (reviewed in (Gravel et al. 1995) (Mahuran 1999)). Of those in the HE= or HEM)
genes where the steady state mRNA levels have been reported, only 1 out of 13 have not been
associated with a dramatically reduced amount of transcript (reviewed in (Gravel er al. 1995;
Mahuran 1999)). This Ione exception also produces the most C-terminal STOP codon, AC15 10 in
exon 13 of 14 in HEX4, and results in the loss of only 22 residues (Zokaeem er al. 1987). In
contrast to the effect of early STOP codons causing reduction of steady state levels of mutant
mRNA, the 4 infiame deletion or insertion mutations that have been characterized in the HEXA and
H E D genes al1 produce normal steady state levels of mutant mRNA (reviewed in (Mahuran in
press)). An example of this type of mutation is the major HEXA mutation among Japanese Tay-
Sachs patients, a '@t" substitution in intron 5 resulting in the i n h e deletion of exon 6 (Tanaka
et al. 1993). Based on the above case reports, in-hune deletion usually results in normal steady
state levels of mutant &A. In my study, there is no detectable -A in patient's sampfe as
determined by Northern Biot; thus it is unlikely that the AE2 mRNA (an in-fiame deletion) is
transcribed dominantly in either allele.
There has been a great deal of previously reported data concluding that shortened reading
frames, i.e. early STOP codons, can iead not only to mRNA instability, but also to the inframe
skipping of the constitutive exon in which the mutation is found (Dietz and Kendzior 1994; Dietz et
ai. 1993; Mazoyer et al. 1998; Ronce et al. 1997). There remains a controversy over whether this is
caused by a mechanism in the nucleus that can sense the lack of an open reading frarne and affect
normal splicing (Maquat 1996). In this study, RT-PCR results indicated that in a normal sample
only fbll length mRNA was produced, while in the patient's sample both fiill-length mRNA and
AE2 mRNA was produced, the former one containing G160T (Glu54 to STOP codon) nonsense
mutation in exon 2. At this level it would seem my results are consistent with the conclusion that a
nonsense mutation induces exon skipping to restore the reading fiame. However, nested PCR
amplification of RT-PCR products suggested that AE2 cDNA also existed in normal samples (Iane 3
of Fig 3-12). This conclusion was confirmed by digestion of RT-PCR product with an exon 2-
unique restriction endonuclease, Hinf l, and nested PCR amplification (Iane 5, 6 of Fig. 3-12)
(Valentine and Heflich 1997). Digestion of RT-PCR products with Hinf l eliminated most of the
full-length of cDNA (Fig 3-1 l), thus AE2 cDNA become the predominant form of cDNA and was
amplified equally in both normal and patient samples by the second nested PCR. From this data it
can be concluded that AE2 GM2A mRNA indeed exists in the normal fibroblasts.
Sirnilar study has been reported in the hypoxanthine phosphoribosyl transferase (hprt) gene
by Valentine and Heflich (Valentine and Heflich 1997). They exarnined a homozygous nonsense
mutation associated with exon skipping in hprr mRNA of Chinese hamster ovary cells and
concluded that the apparent increase in exon skipping was a RT-PCR artifact. Tnis artifact was due
to the instability and thus, very low steady state levels, of the normal size RNA containing the
nonsense mutation, coupled with the normal stability of the smaller AE-RNA in which the nonsense
mutation had been deleted and the reading t'rame restored. This small AE-RNA was found to be
constitutively produced at very 1ow levels in normal as wetl as mutant cells. However it could only
be amplified to a level of detectability in normal ceils afier the removal of the hl1 length, wild type
RT-PCR-generated cDNA by digestion with a specific restriction enzyme, followed by a second
nested PCR.
In summary, as premature STOP codon mutation usually causes rapid mRNA degradation
(Muhlrad and Parker 1994), the infiame skipping of the constitutive exon, in which the STOP codon
mutation is found as detected by RT-PCR, is due to a decreasing abundance of the full-length
mRNA (Maquat 1995; Valentine and Heflich 199?), not due to a nuclear mechanism that causes the
increasing abundance of the AE mRNA species. Thus this study indicates that there is likely no
mechanism in the nucleus that can read the fiame of precursor mRNA and affect final splicing
events as previously reported (Dietz and Kendzior 1994; Dietz et al. 1993).
1 would like to thank Dr. C.-C. Hui for his help in Northem blot analysis and Ms. Amy
Leung for her technical assistance in Western blot analysis.
3.6 REFERENCES
Brown CA, Neote K, Leung A, Gravel RA, Mahwan DJ (1989) introduction of the alpha subunit
mutation associated with the B 1 variant of Tay-Sachs disease into the beta subunit produces
a beta-hexosarninidase B without catalytic activity. J.Biol.Chem. 264:2 1705-2 1710
Chomczynski P, Sacchi N (1987) Single-step method of RNA isolation by acid guanidinium
thiocyanate-phenol-chloroform extraction. Anal-Biochem. 162: 1 56- 159
Dietz HC, Kendzior RJ, Jr. (1994) Maintenance of an open reading h m e as an additional level of
scrutiny during splice site selection. Nat Genet 8: 183-8
Dietz HC, Valle D, Francomano CA, Kendzior RJ, Jr., Pyentz RE, Cutting GR (1993) The skipping
of constitutive exons in vivo induced by nonsense mutations. Science 259:680-3
Gravel RA, Clarke JTR, Kaback MM, Mahuran D, Sandhoff K, Suzuki K (1995) The G M ~
gangliosidoses. In: Scriver CR, Beaudet AL, Sly WS, Valle D (eds) The metabolic basis of
inherited disease. McGraw-Hill, New York, pp 2829-2879
Kleiman FE, De Kremer RD, De Ramirez AO, Gravel RA, Argaraiia CE (1994) Sandhoff disease in
Argentina: High fiequency of a splice site mutation in the HEXB gene and correlation
between enzyme and DNA-based tests for heterozygote detection. Hum Genet 94:279-282
Lewin B (!997) Genes VI. Oxford University Press, Oxford, England, pp 885-920
Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (195 1) Protein measurement with the Folin phenol
reagent. J.B iol.Chem. 193 :265-275
Mahuran DJ (1999) Biochernical consequences of mutations causing the GM2 gangliosidoses.
Biochem Biophys Acta :in press
Maquat LE (1995) When cells stop making sense: effects of nonsense codons on RNA metabolism
in vertebrate cells. Rna 1 :453-65
Maquat LE (1996) Defects in RNA splicing and the consequence of shortened translationai reading
&es [editorial] [see comments]. Am J Hum Genet 59:279-86
Mazoyer S, Puget N, Perrin-Vidoz L, Lynch HT, Serova-Sinilnikova OM, Lenoir GM (1998) A
BRCA 1 nonsense mutation causes exon skipping [letter]. Am J Hum Genet 62:7 13-5
Muhlrad D, Parker R (1 994) Prernature translational termination triggers mRNA decapping. Nature
370578-58 1
Schepers U, Glombitza G, Lemm T, Hoffmann A, Chabas A, Ozand P, Sandhoff K (1996)
MoIecuIar analysis of a GM2 activator deficiency in two patients with GM2 gangliosidosis
AB variant. Am. J.Hum.Genet. 59: 1048- 1 O56
Schroder M, Schnabel D, Hurwitz R, Young E, Suzuki K, Sandhoff K (1993) Molecular genetics of
GM2 gangliosidosis AB variant: a novel mutation and expression in BHK cells. HumGenet.
W:43 7-440
Schroder M, Schnabel D, Suzuki K, Sandhoff K (1991) A mutation in the gene of a glycolipid-
binding protein (GM2 activator) that causes GM2 gangliosidosis variant AB. FEBS letters
290: 1-3
Valentine CR, Heflich RH (1997) The association of nonsense mutation with exon-skipping in hprt
mRNA of Chinese hamster ovary cells results fiom an artifact of RT-PCR. Rna 3:660-76
Xie B, McInnes B, Neote K, Larnhonwah A-M, Mahuran D (1991) Isolation and expression of a
full-length cDNA encoding the human G M ~ activator protein. Biochem. Biophys. Res.
Commun. 177: 12 17-1223
Xie B, Wang W, Mahuran DI (1992) A Cysl38-to-Arg substitution in the GM2 activator protein is
associated with the AB variant fonn of GM2 gangliosidosis. Am.J.Hum.Genet. 50: 1046-
1 OS2
%
Zokaeem G, Bayleran I, Kaplan P, Hechtman P, Neufeld EF (1987) A shortened f3-hexosaminidase
a-chain in an Italian patient with infantile Tay-Sachs disease. Am. J. Hum. Genet. 40537-
547
CHAPTER IV
FUTURE WORK
The exon 2-lacking cDNA (AE2) fkom the GMZA gene has been cloned in this sîudy.
Because AE2 mRNA also exists in normal fibroblasts, it is possible that the AE2 mRNA can
translate a shorter protein, which lacks residues between Pro28 and Lys80 (referred as the AE2
activator). This protein would have the signal peptide intact but the single N-linked giycosylation
site would be missing. The question to be answered is whether or not the AE2 activator has a
physiological function in any hurnan tissue. Therefore, the AE2 cDNA will be expressed in E coii
in order to obtain a large amount of the AE2 activator for antibody production, and to determine if
its lipid transport and Hex A binding firnctions still exist. [t will also be transfected into
mammalian cells to elucidate the biosynthetic and intra/ inter cellular transportation pathway in
virro. Since the level of alternative splicing may Vary in different tissues if it is biologically
s i p i ficant, it will also be necessary to determine the level of the AE2 mRNA in a series of other
human tissues.
4.1 Expression of exon 2-lacking activator in E coli
The wild type and AE2 cDNAs inserted into pBluescript obtained in this study wilt be
subcloned into an E coli expression vector, pQE-12 with 6xHis tag (Qiagen) (Klima et al. 1993).
After expression in E coli, the fusion protein will be purified on Ni-NTA resin (Qiagen) and
analyzed by Western blot analysis (method in Chapter 2). If no CRM were detected using our
present anti-Activator antibody, it would indicate that the AE2 activator has lost the epitopes
recognized by the present anti-Activator antibody. In this case a specific polyclonal antibody
against the AE2 activator will be produced. Briefly, the purified and refolded AE2 activator will be
mixed with the Freunds adjuvant and injected into rabbits. After two booster injections, the anti-
AE2 activator IgG will be isolated frorn rabbit serum (Harlow and Lane 1988). The anti-AE2
activator antibody will be used to detect the AE2 activator in CHO cells transfected with AE2
cDNA.
4.2 Testing the lipid binding function of the exon 2-lacking activator
The localization of hydrophobic binding site of the Activator has not been fblly elucidated,
and some controversy still exists in the literature. Li and colleagues suggested that the hydrophobic
binding site is located in residue 34-142 (Nagarajan et al. 1992; Wu et al. 1996), however,
fluorescent dequenching assay in our iaboratory demonstrated that the hydrophobic binding site is
located in the C-terminus of the Activator (Smiljanic-Georgijev et al. 1997). In order to confinn the
Iocalization of hydrophobic binding site of the Activator, the AE2 activator obtained fkom E cati
expression c m be used for dequenching assay. In this assay, the AE2 activator protein, wild type
activator and a tnincated negative control will be tested for their ability to bind and transport R-18
(Smiljanic-Georgijev et al. 1997) (chapter 1). If this functional test is positive for AES, Gm
gangiioside will be added to the Iiposome mixture to test whether it inhibits the fluorescence
dequenching of the AE2 activator. If both functions are normal, it will localize the carbohydrate
and lipid binding sites to the C-terminus of the Activator. Given positive results in these assays, the
AE2 activator will be tested as a CO-factor for Hex A. Negative R-18 transport results will argue
against any biological significance for the alternatively spliced transcript.
4.3 Establishing a permanently exon 2-lacking cDNA transfected CHO cell line
The methods used for transfection of AE2 cDNA into CHO cells is based on those
previously reported (Rigat et al. 1997). Bnefly, the AE2 transfection fragment will be obtained
through PCR amplification of AE2 cDNA with specific primers, and will be ligated with pEF-NE0
vector to form a constnict, pEF-NEO-AE2. pEF-NEO-AE2 will be transfected into CHO cells using
100
lipofectamine (Gibco BRL). The cells will be rnaintained in selection media containing G418.
After a control line of cells completely dies out due to G418 processing, some of the remaining
transfected cells and culture medium will be analyzed by Western blotting using anti AE2 antibody
(see section 4.1). If no CRM is seen with anti AE2 activator antibody in transfected cells or media,
two possibilities may exist. L) AE2 mRNA is not being transcribed; thus Northern blot analysis will
be performed to detect AE2 mRNA. 2) The AE2 RNA is transcribed but the protein is rapidly
degraded in ER. Pulse-chase experiments will be used to determine if this is true. if the latter is
true, the AE2 is likely not a physiologically significant protein. If CRM with anti-activator or anti-
AE2 activator is detected, the localization of the AE2 activator can be determined by
immunofluroscence (Hinek et al. 1996).
4.4 Determination of the levels of exon 2-lacking mRNA in variant tissue
In this study a smail amount of AE2 mRNA was detected in fibroblasts, thus it rnay also
exist in other tissues and cells, perhap in larger amounts. Total mRNA corn other tissues, e.g.
Iiver, kidney, intestine, and muscle, will be isolated. Afier reverse transcription, the primers #1680
and #705 (Chapter 3) will be used to ampli& mRNA. The RT-PCR products will be cleaved by
exon 2-unique restriction enzyme, Hinf 1, and the second round of nested PCR will be applied based
on the method described in chapter 3. The poly (A) RNA will also be isolated from different
tissues. Northem blot analysis will be applied to more quantitatively detect any AE2 mRNA with a
specific AE2 probe in tissues that appear by RT-PCR to produce larger amounts than do fibroblasts.
4.5 REFERENCES
Harlow E, Lane D (1988) Antiiodies - A laboratory manual. Cold Spring Harbor Laboratory, Cold
Spring Harbor, New York, USA
Einek A, Molossi S, Rabinovitch M (1996) Funçtional interplay between interleukin-1 receptor and
elastin binding protein regulates fibronectin production in coronary smooth muscle cells.
Exp. CeIl Res. 225:122-13 1
Klima H, Klein A, van Echten G, Schwacpnatm Gy Suzuki K, Sandhoff K (1993) Over-expression
of a functionally active human GM2 activator protein in Escherichia coli. E3iochem.J.
29257 1-576
Nagarajan S, Chen H-C, Li S-C, Li Y-T, Lockyer SM (1992) Evidence for two cDNA clones
encoding human Gm-activator protein. Biochem J. 2822307-8 13
Rigat B, Wang W, Leung A, Mahuran DJ (1 997) Two mechanisms for the recapture of extracellular
Gm2 activator protein: evidence for a major secretory form of the protein. Biochemistry
36:8325-833 1
Smiijanic-Georgijev N, Rigat B, Xie B, Wang W, Mahuran D (1997) Characterization of the
affinity of the GM2 activator protein for glycolipids by a fluorescence dequenching assay.
Biochim. Biophys. Acta 1339: 192-202
Wu YY, Sonnino S, Li Y-T, Li S-C (1996) Characterization of an alternatively spliced GM2
activator protein, GMîA protein. J.Biol.Chem. 27 1 : 106 1 1-1 O6 15