Assassin Spiders of Australia

7/29/2019 Assassin Spiders of Australia

1/100

Australian Assassins, Part I: A review of the Assassin Spiders (Araneae, Archaeidae)... 1

Australian Assassins, Part I: A review of the AssassinSpiders (Araneae, Archaeidae) of mid-eastern Australia

Michael G. Rix1,, Mark S. Harvey1,2,3,4,

1Department of Terrestrial Zoology, Western Australian Museum, Locked Bag 49, Welshpool DC, Perth, We-

stern Australia 6986, Australia2Research Associate, Division of Invertebrate Zoology, American Museum ofNatural History, New York, NY 10024, USA 3Research Associate, California Academy of Sciences, 55 Music

Concourse Drive, San Francisco, CA 94118, USA4Adjunct Professor, School of Animal Biology, University ofWestern Australia, 35 Stirling Highway, Crawley, Perth, Western Australia 6009, Australia

urn:lsid:zoobank.org:author:B7D4764D-B9C94496-A2DE-C4D16561C3B3

urn:lsid:zoobank.org:author:FF5EBAF386E84B99-BE2E-A61E44AAEC2C

Corresponding author:Michael G. Rix([email protected])

Academic editor:Jeremy Miller| Received 29 April 2011 | Accepted 25 July 2011 | Published 15 August 2011

urn:lsid:zoobank.org:pub:A9E0AB39-5F41-4992-9DD4-796D7B090E0B

Citation: Rix MG, Harvey MS (2011) Australian Assassins, Part I: A review o the Assassin Spiders (Araneae, Archaeidae)o mid-eastern Australia. ZooKeys 123: 1100. doi: 10.3897/zookeys.123.1448

Abstract

Te Assassin Spiders o the amily Archaeidae are an ancient and iconic lineage o basal araneomorphspiders, characterised by a specialised araneophagic ecology and unique, pelican-like cephalic morphol-ogy. Found throughout the rainorests, wet sclerophyll orests and mesic heathlands o south-western,south-eastern and north-eastern Australia, the genus AustrarchaeaForster & Platnick, 1984 includes a

diverse assemblage o relictual, largely short-range endemic species. With recent dedicated eld surveysand signicant advances in our understanding o archaeid biology and ecology, numerous new species oassassin spiders have been discovered in the montane sub-tropical and warm-temperate closed orests omid-eastern Australia, including several rare or enigmatic taxa and species o conservation concern. Tisauna is revised and 17 new species are described rom south-eastern Queensland and eastern New South

Wales:A. alanisp. n.,A. aleenaesp. n.,A. binfordaesp. n.,A. christopherisp. n.,A. clyneaesp. n.,A. cun-ninghamisp. n.,A. dianneaesp. n.,A. harmsisp. n.,A. helenaesp. n.,A. judyaesp. n.,A. mascordisp. n.,

A. mcguiganaesp. n.,A. milledgeisp. n.,A. monteithisp. n.,A. platnickorum sp. n.,A. ravenisp. n. andA. smithaesp. n. Adult specimens o the type species,A. nodosa(Forster, 1956) are redescribed rom theLamington Plateau, south-eastern Queensland, and distinguished rom the sympatric speciesA. dianneae

sp. n. A key to species and a molecular phylogenetic analysis o COI and COII mtDNA sequences com-plement the species-level taxonomy, with maps, habitat photos, natural history inormation and conserva-tion assessments provided or all species.

ZooKeys 123: 1100 (2011)

doi: 10.3897/zookeys.123.1448

www.zookeys.org

CopyrightMichael G. Rix, Mark S. Harvey.This is an open access article distributed under the terms of the Creative Commons Attribution License,

which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

MONOGRAPH

Launched to accelerate biodiversity research

A peer-reviewed open-access journal
http://dx.doi.org/10.3897/zookeys.123.1448http://zoobank.org/?lsid=urn:lsid:zoobank.org:author:B7D4764D-B9C9%E2%80%934496-A2DE-C4D16561C3B3http://zoobank.org/?lsid=urn:lsid:zoobank.org:author:B7D4764D-B9C9%E2%80%934496-A2DE-C4D16561C3B3http://zoobank.org/?lsid=urn:lsid:zoobank.org:author:FF5EBAF3%E2%80%9386E8%E2%80%934B99-BE2E-A61E44AAEC2Cmailto:[email protected]://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:A9E0AB39-5F41-4992-9DD4-796D7B090E0Bhttp://dx.doi.org/10.3897/zookeys.123.1448http://dx.doi.org/10.3897/zookeys.123.1448http://www.zookeys.org/http://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:73168F86-941E-4B22-B8DD-85E071BFD063http://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:73168F86-941E-4B22-B8DD-85E071BFD063http://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:73168F86-941E-4B22-B8DD-85E071BFD063http://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:A9E0AB39-5F41-4992-9DD4-796D7B090E0Bhttp://zoobank.org/?lsid=urn:lsid:zoobank.org:author:FF5EBAF3%E2%80%9386E8%E2%80%934B99-BE2E-A61E44AAEC2Chttp://zoobank.org/?lsid=urn:lsid:zoobank.org:author:B7D4764D-B9C9%E2%80%934496-A2DE-C4D16561C3B3http://zoobank.org/?lsid=urn:lsid:zoobank.org:pub:73168F86-941E-4B22-B8DD-85E071BFD063mailto:[email protected]://dx.doi.org/10.3897/zookeys.123.1448http://www.zookeys.org/http://dx.doi.org/10.3897/zookeys.123.1448


2/100

Michael G. Rix & Mark S. Harvey / ZooKeys 123: 1100 (2011)2

Keywords

new species, taxonomy, rainorest, conservation, cytochrome coxidase, mitochondrial DNA, Palpimanoidea

Contents

Introduction ............................................................................................................. 3Material and methods............................................................................................... 4Phylogenetic analysis ................................................................................................ 7axonomy .............................................................................................................. 14

Family Archaeidae Koch & Berendt, 1854 ....................................................... 14GenusAustrarchaeaForster & Platnick, 1984 ................................................... 14Key to the species oAustrarchaeaknown rom mid-eastern Australia ............... 17Te south-eastern Queensland (including Border Ranges) auna ...................... 19

Austrarchaea nodosa(Forster, 1956) ............................................................ 19Austrarachaea dianneaeRix & Harvey, sp. n. ............................................. 22Austrarachaea cunninghamiRix & Harvey, sp. n........................................ 24Austrarachaea clyneaeRix & Harvey, sp. n. ................................................ 26Austrarachaea raveniRix & Harvey, sp. n. ................................................. 27Austrarachaea judyaeRix & Harvey, sp. n.................................................. 29Austrarachaea harmsiRix & Harvey, sp. n. ................................................ 31Austrarachaea aleenaeRix & Harvey, sp. n................................................. 33Austrarachaea alaniRix & Harvey, sp. n.................................................... 34

Te New South Wales auna ............................................................................. 36Austrarachaea monteithiRix & Harvey, sp. n. ............................................ 36Austrarachaea christopheriRix & Harvey, sp. n. ......................................... 38Austrarachaea platnickorumRix & Harvey, sp. n. ...................................... 39Austrarachaea binfordaeRix & Harvey, sp. n. ............................................ 41Austrarachaea milledgeiRix & Harvey, sp. n. ............................................. 42

Austrarachaea mascordiRix & Harvey, sp. n. ............................................. 45Austrarachaea smithaeRix & Harvey, sp. n. ............................................... 46Austrarachaea helenaeRix & Harvey, sp. n................................................. 48Austrarachaea mcguiganaeRix & Harvey, sp. n. ......................................... 49

Acknowledgements ................................................................................................. 51Reerences .............................................................................................................. 52Figures ................................................................................................................... 55

Appendix I: Supplementary nexus le .................................................................. 100


3/100


Introduction

Te assassin spiders o the amily Archaeidae are an ancient and iconic lineage o basalaraneomorph spiders, characterised by a remarkable cephalic morphology and special-

ised araneophagic ecology. Archaeid spiders are obligate predators o other spiders, andall possess a grossly-elevated, pelican-like cephalothorax and long chelicerae (Figs 1,4A-C) which are used to hunt and capture their spider prey (Legendre 1961, Forsterand Platnick 1984, Wood et al. 2007, Wood 2008). With extant species known onlyrom Australia, southern Arica and Madagascar, the amily was rst described in Eu-rope rom Baltic amber ossil specimens, prior to the discovery o living representativesin the orests o Madagascar in the mid-19th century (Cambridge 1881, Forster andPlatnick 1984, Harvey 2002a, Wood et al. 2007). Other ossil assassin spiders severalcongeneric with, and all remarkably similar to, extant taxa have since been discoveredin ossil strata o at least Mesozoic age, spectacularly illustrating the antiquity o thegroup (Penney 2003, Selden et al. 2008). Indeed, assassin spiders very similar to mod-ern species were probably present throughout the Mesozoic; an observation urtherevidenced by recent higher-level phylogenetic research indicating the basal position othe Archaeidae relative to other araneomorph spider amilies (see Griswold et al. 2005,Rix et al. 2008, Rix and Harvey 2010).

Assassin spiders are iconic among arachnids due to the extraordinary history otheir discovery, their remarkable appearance and antiquity, their limited distributionon the southern continents, their extreme endemism, and their highly specialisedaraneophagic biology (Forster and Platnick 1984, Harvey 2002a, Wood et al. 2007,

Wood 2008). Tey are the emblem o Madagascars rich spider auna (Wood 2008)and have attracted a great deal o research interest in recent years as highly diverse andendemic aunas have been uncovered in Madagascar and southern Arica (see Plat-nick 1991a, Lotz 1996, 2003, 2006, Wood et al. 2007, Wood 2008). Te Australianauna is comparatively poorly-known relative to those rom the Malagasy and Aricanregions, despite the presence o dozens o species in south-western, south-eastern andnorth-eastern Australia (Figs 23).

Te Recent archaeid auna consists o 37 described species in three genera (Plat-nick 2011): EriaucheniusO.P.-Cambridge, 1881 and AfrarchaeaForster & Platnick,1984 rom the Malagasy and Arican regions; and AustrarchaeaForster & Platnick,1984, endemic to mainland Australia (Figs 12). Only ve species oAustrarchaeahavepreviously been described rom opposite corners o continental Australia: A. daviesaeForster & Platnick, 1984 rom the Atherton ableland, north-eastern Queensland;the type speciesA. nodosa(Forster, 1956) rom the Lamington Plateau, south-easternQueensland; A. hickmani (Butler, 1929) rom Victoria; A. mainaePlatnick, 1991brom the Albany region o south-western Western Australia (see also Main 1995, Har-

vey 2002a, Rix and Harvey 2008); andA. robinsiHarvey 2002a rom the eastern Stir-ling Range National Park, south-western Western Australia. All ve taxa were knownonly provisionally by their original taxonomic descriptions and subsequent collections,and recent research onAustrarchaeahad not progressed beyond a simple recognition


4/100


o the high levels o diversity and endemism present among Australian taxa (M. Rix,pers. obs.). In act, the Australian archaeid auna is ar more diverse and widespreadthan expected even 10 years ago and, with recent advances in our understanding oarchaeid biology and ecology, numerous new species and aunas have been discovered,

including several species rom regions previously assumed to be devoid o Archaeidae(e.g. southern South Australia and the south-eastern coast o Western Australia; seeFig. 2). In south-eastern Queensland and eastern New South Wales, the rainorests andmontane wet sclerophyll orests along the Great Dividing Range provide habitats orat least 18 known species oAustrarchaea, most o which were undescribed, and all owhich have relatively restricted, highly endemic distributions.

Te current paper is thus a taxonomic revision o the species o Archaeidae knownrom mid-eastern Australia, including those rom south-eastern Queensland and east-ern New South Wales, north o the Australian Alps (Fig. 2). Te type species,A. nodo-sa, is redescribed rom the Lamington Plateau, south-eastern Queensland, and an ad-ditional 17 new species are described rom habitats between Kroombit ops NationalPark in Queensland and the Badja State Forest in southern New South Wales. Tese 18species were ound to orm a monophyletic clade in a molecular phylogenetic analysis(Fig. 3B), and the remaining Australian Archaeidae will be described in orthcomingmonographic treatments.

Material and methods

All taxa were described and illustrated rom specimens stored in 75% or 95% ethanol.Digital images were taken using a Leica MZ16A binocular microscope and a LeicaDM2500 compound microscope, with auto-montage images captured using LeicaDFC500 mounted cameras with Leica Application Suite Version 3.6.0 sotware. Malelet pedipalps were dissected prior to imaging and bulbs were aligned or standardisedcomparison in the retrolateral and pro-distal positions illustrated; expanded pedipalpswere illustrated in a retro-ventral position. Female genitalia were dissected and cleared

in a 10% lactic acid plus 90% glycerol solution, prior to mounting on temporary glassslides. Illustrations were made on Utoplex tracing paper, using printed template auto-montage images.

Measurements. Measurements are in millimetres (rounded to the nearest hun-dredth o a millimetre) and were taken using an ocular graticule on a Leica M80 binoc-ular microscope. Let legs were removed rom specimens prior to taking measurementsand imaging lateral body proles. Lateral prole images were standardised or inter-specic comparison by vertically aligning the centre o each let anterior median eyewith the lower anterior margin o the carapace (above the labrum) (Fig. 6). Carapace

height was measured in lateral view, rom the margin o the pars thoracica above coxaII to the highest point o the pars cephalica (Fig. 6). Carapace length was measuredrom the lower anterior margin o the carapace (above the labrum) to the posteriormargin o the pars thoracica (above the pedicel) (Fig. 6). Neck width was measured in


5/100


lateral view, at the narrowest point o the carapace, with total length, carapace width,abdomen length and abdomen width all measured in dorsal view.

Morphometrics. o quantiy inter-specic variation in the shape o the cephalo-thorax and head, three morphometric ratios were derived rom lateral prole images

(see Figs 69). Te carapaceheight to carapace length (CH/CL) ratio, used extensivelyby Wood et al. (2007) and Wood (2008), quanties the relative dorsal elevation othe carapace, irrespective o gross body size (Fig. 6). Te CH/CL ratio used here di-ers slightly to that described by Wood (2008), in that carapace height and length aremeasured directly rom relative points on the carapace (Fig. 6), and not necessarily atright angles to each other (see measurement denitions, above), thus avoiding any vari-ation caused by tilting o the neck or the non-perpendicular alignment o specimens.For any given size class, mid-eastern Australian Austrarchaeahave a CH/CL ratio o2.002.44; taxa with a relatively taller, more greatly elevated pars cephalica have aCH/CL ratio > 2.20 (Fig. 6). Tepost-ocular ratio (P.O. ratio) (Figs 79) measures thelength o the head posterior to the AME, relative to the dorsal elevation o the parscephalica above the level o the AME, and quanties the signicant inter-specic (andoten sexually dimorphic) variation seen in the relative dorsal extension o the posteriorhead region (e.g. see Figs 8D, 8G) . While most species oAustrarchaearom mid-eastern Australia possess a post-ocular ratio o 0.250.35 (Figs 7J, 7N, 8H), severaltaxa possess a strongly elevated dorsal pars cephalica, with a P.O. ratio > 0.37 (Figs7C, 8C, 8E, 9G). In contrast, the highest point of pars cephalica(HPC) to post-ocularlength ratio (Figs 79) measures the position o the highest point o the dorsal parscephalica, relative to the length o the head posterior to the AME. It quanties theequally signicant variation observed in the position o the head apex, rom taxa witha more-or-less rounded or hemispherical head in lateral view (HPC to post-ocularlength ratio ~0.550.70) (Figs 7G, 7J, 7N) to taxa with a posteriorly extended, conicalhead (HPC to post-ocular length ratio ~0.90) (Figs 7C, 8C-E).

Molecular and laboratory methods. For molecular analyses, specimens were pre-served in 95% ethanol and stored at 4C. Between two and seven legs o each indi-vidual were removed or DNA extractions and whole genomic DNA was extracted

rom leg tissue samples using the Qiagen DNeasy Blood and issue Kit protocol oranimal tissues. Polymerase chain reaction (PCR) amplication o target gene regionswas achieved using Invitrogen Platinum TaqPolymerase chemistry, in an EppendorMastercycler ep gradient S thermal cycler. For each PCR reaction, 2 l o extractedDNA, 0.25 l o Platinum Taq(at 5 u/l), 2 l o MgCl2 (at 50 mM), 2.5 l o 10xPCR buer, 5 l o dNPs (at 1 mM) and 5 l o each primer (at 2 M) were used inevery 25 l reaction. For most taxa, 1071 bp o the mitochondrial cytochrome coxi-dase subunit I (COI) gene, along with 535541 bp o the adjacent COII gene (~1609bp in total), were amplied using the primers ArCO1 (newly-designed or this study)

and C2-N-3661b (modied rom Simon et al. 1994), or variants thereo (see ables12). For several taxa, additional internal primers were used to ampliy the same regionin two overlapping segments. Te PCR protocol used was: 94C or 1 min; 35x (94Cor 30 sec, 52.1C or 30 sec, 72C or 1 min); 72C or 5 min. Te presence o PCR


6/100


products in PCR reactions was conrmed using standard agarose gel electrophoresis; iPCR products were detected, PCR reactions were then puried using the MoBio Ul-traClean PCR Clean-up Kit. Bi-directional sequencing o puried PCR products wasperormed by Macrogen Corporation (South Korea), using supplied PCR primers and

additional internal sequencing primers (see able 1). Sequence (.ab1) les or the cod-ing and non-coding strands were assembled automatically as anti-parallel contigs, andthen visualised using Sequencher 4.8 (Demonstration Version). Annotated sequenceswere saved as text les, and imported into ClustalX Version 1.83 (Tompson et al.1997) or alignment using deault parameters.

Conventions. Troughout this paper the term Border Ranges is used to de-note the mountainous geographic border region between south-eastern Queenslandand northern New South Wales (see Fig. 28B), including the McPherson Range andMain Range, and encompassing the World Heritage-listed rainorests o the Mount

Warning, Border Ranges, Springbrook, Lamington, Mount Chinghee, Mount Barney,Mount Nothoagus, Mount Clunie, Koreelah and Main Range National Parks.

For Material Examined sections, specimens o indeterminate identication (usuallyjuveniles) are included or mapping purposes, and tentatively linked to named speciesaccording to their geographic proximity to type localities (or in the case o genotyped

juvenile specimens, according to their molecular phylogenetic anity); such specimensare highlighted in Figures 2845, and individually listed or each species. Specimensnot examined or the current revision, but currently housed at the Caliornia Academyo Sciences (due to ongoing research) are also listed separately (with identications con-rmed by H. Wood), along with unexamined juvenile specimens recently accessioned.Specimens sequenced or the molecular analysis are denoted by superscript codes, whichcorrespond to specimen codes as shown in Figure 3B and able 2. For species Diagno-ses, molecular autapomorphies (e.g. see Harvey et al. 2008, Cook et al. 2010) are codedaccording their nucleotide number (11609), as dened in able 3 and Figure 3A.

Abbreviations used in the text are as ollows:

ALE Anterior lateral eye/sAME Anterior median eye/sCH/CL Carapace height (CH) to carapace length (CL) ratioF1/CL Femur I length (F1) to carapace length (CL) ratioHPC Highest point o pars cephalicaH 16 Abdominal hump-like tubercles 16PME Posterior median eye/sS 13 egular sclerites 13

Specimens described in this study are lodged at the ollowing institutions:

AMS Australian Museum, Sydney (G. Milledge)ANIC Australian National Insect Collection, Canberra (B. Halliday)


7/100


CASEN Caliornia Academy o Sciences, San Francisco (C. Griswold, D. Ubick)MACN Museo Argentino de Ciencias Naturales, Buenos Aires (M. Ramrez)QMB Queensland Museum, Brisbane (R. Raven, O. Seeman)

WAM Western Australian Museum, Perth (MSH, J. Waldock)

Table 1.Primers used to ampliy and sequence COI and COII genes or the molecular analysis. Under-lined letters denote nucleotide modications.

Name Sequence (5-3) ype (Gene) Reerences

PCR PRIMERS

ArCO1 CAAGCGGGCCCA Forward (COI)ArCO1a1 CAAGCGGGCCACA Forward (COI)ArCO1c2 CAGGCGGGGCGCACAA Forward (COI)

ZrCO13

CACAAGCGGGCC Forward (COI)C2-N-3661 CACAAACGAACAGACCA Reverse (COII) Simon et al. (1994)C2-N-3661a4 CACAAACAGAACAGACCA Reverse (COII) Simon et al. (1994)C2-N-3661b5 CACAAACAGAACAGACC Reverse (COII) Simon et al. (1994)SEQUENCING/PCR PRIMERS*

SeqF2a YCAAGWAAGAAAGG Forward (COI)SeqF2a1 CAYCAAGDRAGAARGG Forward (COI)SeqR1 CACAGGAAACWGAAAHCG Reverse (COI)SeqR1a CACWGGRARCHGAAAHCGACG Reverse (COI)

*Used as PCR primers in certain taxa (see able 2)1Used or Victorian and Stirling Range National ParkAustrarchaeaspp.2Used or Otiothops birabeni3Used orZearchaeasp. 24Used or outgroups and Western Australian/VictorianAustrarchaeaspp.5Used or most south-eastern AustralianAustrarchaeaspp.

Phylogenetic analysis

o complement and inorm the morphological hypotheses presented or the species-level taxonomy (see below), and to provide molecular autapomorphies useul or dis-tinguishing species oAustrarchaearom mid-eastern Australia, a molecular taxonomicapproach was employed using mitochondrial DNA nucleotide sequences. A 1071 bpragment o the cytochrome coxidase subunit I (COI) gene, along with a 535541 bpragment o the adjacent COII gene (Fig. 3A, able 3), were amplied in species o

Austrarchaea(and outgroups) or analysis under a Bayesian ramework. Tese data weregenerated and aligned as described in the Methods (above), and the resulting nexus le

(see Appendix I) was analysed as highlighted (below).axa. Specimens o Archaeidae were collected throughout mid-eastern Australiain March-May 2010, or use in molecular analyses. At least three specimens romeach major population were sequenced or COI and COII; or some populations,


8/100


Table 2. Specimens sequenced or the molecular analysis. Primer sequences are urther listed in able 1.

Species/Museum No.

SpecimenCode

GenBankAccession

Forward PCRPrimer/s

Reverse PCRPrimer/s

OUGROUPS

Hickmania troglodytes(Higgins & Petterd, 1883) (Bubs Hill Karst, AS):WAM 79989 N.A. JF909360 ArCO1 C2-N-3661aTarlina smithersiGray, 1987 in Forster et al., 1987 (Willi Willi National Park, NSW):

WAM 112581 N.A. JF909361 ArCOI/SeqF2a SeqR1/C2-N-3661aOtiothops birabeniMello-Leito, 1945 (Parque Nacional El Palmar, Argentina):MACN Ar11491 N.A. JF909362 ArCO1c/SeqF2a SeqR1/C2-N-3661a

Zearchaeasp. 1 (Lewis Pass, New Zealand):WAM 79990 N.A. JF909363 ArCO1/SeqF2a SeqR1/C2-N-3661aZearchaeasp. 2 (Milord Sound, New Zealand):

WAM 112582 N.A. JF909364 ZrCO1 C2-N-3661a Eriauchenius workmaniO.P.-Cambridge, 1881 (Ranomaana, Madagascar):CASEN 9018984 N.A. JF909365 ArCO1 C2-N-3661aOHERAUSTRARCHAEA SPP.

Austrarchaeasp. (Acheron Gap, VIC):WAM 112583 Ar14-49-F JF909366 ArCO1a C2-N-3661aWAM 112583 Ar14-134-J JF909367 ArCO1a C2-N-3661aAustrarchaea mainaePlatnick, 1991b (Albany, SW. WA):WAM 89572 WF-9-F JF909368 ArCO1 C2-N-3661aWAM 89578 GR-17-J JF909369 ArCO1 C2-N-3661a

Austrarchaea robinsiHarvey, 2002a (Stirling Range, SW. WA):WAM 89558 EP-40-J JF909370 ArCO1a C2-N-3661aWAM 89558 EP-41-J JF909371 ArCO1a C2-N-3661aAustrarchaeasp. (Karri Valley, SW. WA):WAM 89565 KV-38-J JF909372 ArCO1 C2-N-3661aAustrarchaeasp. (Wellington National Park, SW. WA):WAM 112584 CO-158-F JF909373 ArCO1 C2-N-3661aAustrarchaeasp. (Daintree National Park, NE. QLD):WAM 97462 MG-45-J JF909374 ArCO1 C2-N-3661

MID-EASERN AUSRALIANAUSTRARCHAEA SPP.Austrarchaea nodosa(Forster, 1956):WAM 89592 LAM-51-J JF909375 ArCO1/SeqF2a1 SeqR1a/C2-N-3661WAM 112571 Ar56-58-J JF909376 ArCO1 C2-N-3661bWAM 112572 Ar57-46-J JF909377 ArCO1 C2-N-3661bWAM 112573 Ar58-53-J JF909378 ArCO1 C2-N-3661bAustrarchaea alanisp. n.:WAM 112550 K-63-F JF909379 ArCO1 C2-N-3661bWAM 112550 K-64-J JF909380 ArCO1 C2-N-3661bWAM 112550 K-65-J JF909381 ArCO1 C2-N-3661b

WAM 112551 K-66-M JF909382 ArCO1 C2-N-3661bWAM 112551 K-67-J JF909383 ArCO1 C2-N-3661b


9/100


Species/Museum No.

SpecimenCode

GenBankAccession

Forward PCRPrimer/s

Reverse PCRPrimer/s

Austrarchaea aleenaesp. n.:WAM 112552 BUL-68-M JF909384 ArCO1/SeqF2a1 SeqR1a/C2-N-3661b

WAM 112552 BUL-69-J JF909385 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bWAM 112552 BUL-70-J JF909386 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bAustrarchaea binfordaesp. n.:AMS KS114969 Ar46-106-M JF909402 ArCO1 C2-N-3661bAustrarchaea christopherisp. n.:AMS KS114968 Ar49-95-M JF909387 ArCO1 C2-N-3661bWAM 112554 Ar49-96-J JF909388 ArCO1 C2-N-3661bWAM 112554 Ar49-97-J JF909389 ArCO1 C2-N-3661bWAM 112553 Ar50-98-J JF909390 ArCO1 C2-N-3661bWAM 112553 Ar50-99-J JF909391 ArCO1 C2-N-3661bWAM 112553 Ar50-100-J JF909392 ArCO1 C2-N-3661bAustrarchaea cunninghamisp. n.:WAM 112555 Ar55-89-F JF909393 ArCO1 C2-N-3661bWAM 112555 Ar55-90-J JF909394 ArCO1 C2-N-3661bWAM 112555 Ar55-91-J JF909395 ArCO1 C2-N-3661bAustrarchaea dianneaesp. n.:WAM 112557 Ar59-60-M JF909396 ArCO1 C2-N-3661bWAM 112557 Ar59-61-J JF909397 ArCO1 C2-N-3661bWAM 112557 Ar59-62-J JF909398 ArCO1 C2-N-3661b

WAM 112556 Ar56-54-M JF909399 ArCO1 C2-N-3661bWAM 112556 Ar56-55-J JF909400 ArCO1 C2-N-3661bWAM 112556 Ar56-56-J JF909401 ArCO1 C2-N-3661bAustrarchaea harmsisp. n.:WAM 112559 Ar70-73-M JF909406 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bWAM 112559 Ar70-74-J JF909407 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bWAM 112559 Ar70-75-J JF909408 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bWAM 112560 Ar71-71-J JF909409 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bWAM 112560 Ar71-72-J JF909410 ArCO1/SeqF2a1 SeqR1a/C2-N-3661bAustrarchaea helenaesp. n.:

WAM 112561 Ar30-124-J JF909411 ArCO1 C2-N-3661bWAM 112561 Ar30-125-J JF909412 ArCO1 C2-N-3661bWAM 112561 Ar30-126-J JF909413 ArCO1 C2-N-3661bAustrarchaea judyaesp. n.:WAM 112563 Ar67-76-F JF909414 ArCO1 C2-N-3661bWAM 112563 Ar67-78-J JF909415 ArCO1 C2-N-3661bWAM 112562 Ar66-79-J JF909416 ArCO1 C2-N-3661bWAM 112564 Ar68-80-M JF909417 ArCO1 C2-N-3661bWAM 112564 Ar68-81-J JF909418 ArCO1 C2-N-3661b

WAM 112564 Ar68-82-J JF909419 ArCO1 C2-N-3661bAustrarchaea mascordisp. n.:AMS KS114973 Ar41-48-F JF909420 ArCO1 C2-N-3661bWAM 112566 Ar41-113-J JF909421 ArCO1 C2-N-3661b


10/100


Species/Museum No.

SpecimenCode

GenBankAccession

Forward PCRPrimer/s

Reverse PCRPrimer/s

WAM 112566 Ar41-114-J JF909422 ArCO1 C2-N-3661bWAM 112565 Ar40-115-M JF909423 ArCO1 C2-N-3661b

Austrarchaea mcguiganaesp. n.:WAM 112567 Ar28-47-J JF909424 ArCO1 C2-N-3661WAM 112567 Ar28-128-J JF909425 ArCO1 SeqR1A/C2-N-3661Austrarchaea milledgeisp. n.:WAM 112568 Ar43-107-F JF909426 ArCO1 C2-N-3661bWAM 112568 Ar43-108-J JF909427 ArCO1 C2-N-3661bWAM 112568 Ar43-109-J JF909428 ArCO1 C2-N-3661bWAM 112569 Ar42-110-J JF909429 ArCO1 C2-N-3661bWAM 112569 Ar42-111-J JF909430 ArCO1 C2-N-3661bWAM 112569 Ar42-112-J JF909431 ArCO1 C2-N-3661bAustrarchaea monteithisp. n.:AMS KS114976 Ar52-92-F JF909432 ArCO1 C2-N-3661bWAM 112570 Ar52-93-J JF909433 ArCO1 C2-N-3661bWAM 112570 Ar52-94-J JF909434 ArCO1 C2-N-3661bAustrarchaea platnickorum sp. n.:WAM 112558 Ar51-101-M JF909403 ArCO1 C2-N-3661bWAM 112558 Ar51-102-F JF909404 ArCO1 C2-N-3661bWAM 112558 Ar51-103-J JF909405 ArCO1 C2-N-3661bAustrarchaea ravenisp. n.:

QMB S90192 Ar73-83-F JF909435 ArCO1/SeqF2a SeqR1/C2-N-3661bWAM 112574 Ar73-84-J JF909436 ArCO1/SeqF2a SeqR1/C2-N-3661bWAM 112574 Ar73-85-J JF909437 ArCO1/SeqF2a SeqR1/C2-N-3661bWAM 112575 Ar69-86-M JF909438 ArCO1/SeqF2a SeqR1/C2-N-3661bWAM 112575 Ar69-87-J JF909439 ArCO1/SeqF2a SeqR1/C2-N-3661bWAM 112575 Ar69-88-J JF909440 ArCO1/SeqF2a SeqR1/C2-N-3661bAustrarchaea smithaesp. n.:WAM 112576 Ar32-116-F JF909441 ArCO1 C2-N-3661bWAM 112576 Ar32-117-J JF909442 ArCO1 C2-N-3661bWAM 112576 Ar32-118-J JF909443 ArCO1 C2-N-3661b

Austrarchaeasp. indet. (Willi Willi National Park, NSW):WAM 112580 Ar47-104-J JF909444 ArCO1 C2-N-3661bWAM 112580 Ar47-105-J JF909445 ArCO1 C2-N-3661bAustrarchaeasp. indet. (Kanangra-Boyd National Park, NSW):WAM 112578 Ar33-119-J JF909446 ArCO1 C2-N-3661bWAM 112578 Ar33-120-J JF909447 ArCO1 C2-N-3661bWAM 112578 Ar33-121-J JF909448 ArCO1 C2-N-3661bWAM 112579 Ar34-122-J JF909449 ArCO1 C2-N-3661bWAM 112579 Ar34-123-J JF909450 ArCO1 C2-N-3661b

Austrarchaeasp. indet. (Badja State Forest, NSW):WAM 112577 Ar27-129-J JF909451 ArCO1 C2-N-3661bWAM 112577 Ar27-130-J JF909452 ArCO1 C2-N-3661bWAM 112577 Ar27-131-J JF909453 ArCO1 C2-N-3661b


11/100


Table 3. Mitochondrial COI-COII DNA sequence o juvenile Austrarchaea nodosa (Forster, 1956)(WAM 112571), showing the nucleotide numbering system (1-1609) used to designate molecular au-tapomorphies or species diagnoses. Underlined nucleotides denote stop and initiation codons or COIand COII, respectively.

COI mtDNA (nucleotides 1-1071)

AAGGGCGAAAACACAGAAAACGACAGGAAGAGA-AAGAAAAGCC GGGGCGAAAACAGCAAAC-AACGCCGAGCGGGGCAAACAAAGAACAGACGAAA-AAACCCGACCGCGGGAGGGGGGACCAACAACA-AGAGGCACCCGAAGAAAAACCGGGGA-GCCAGAAGAGGACAGAGGAAGCGGAGCCGGAGAGGG-GAGAAGCAAGGGAAGGGGGAAGGGGGAGAGCCCACA-

AACGGGAAGGAGGGAACCGGGCGAACGCGCACAAA-AGCAGCCCACGGAAAGGGAAGAGGAAGCACAAGGGC-

AAAAGGAAGCCCAAAGAGGGGGAGGAAC-AGGCGGGGACAGGAGAGAGCAACCAGAAGACAGA-ACACAGGGGCCACAAGGAAGAAGGAGCGAGC-AGGCGGAACAGACCGGGGGAGCGAACAA-GGAACAAACAAAAAAGGAGGAAAACCC-CAACAGGGGAAAGGAACCACGCGACGAACCGACGC-AACGAAAAAGCCAGGGCAACAAGGAA-AAAAACAGAGAGGAACAAAAAAAGGACGAA-AAAAACCGGGAGGAAAAAGGAGCCCCCAAGACAACA-AACAGAGGACAAGAAAAACOII mtDNA (nucleotides 1072-1609)

GCCAACGAGGCAGACAAAAAGCCGAGGAGCAG-AACAGAAACAAGGAAGAAGAAAGAGGGGG-AAAGGAACGAGAAAAAAAACACAGAAAGAGGG-CAAGAG AGAGAGAAGGACGCCCAGCA GAAA-GCCCCACAAGAAAAAGAGGAAAAGAACCGAAAAC-AAAAAAGGCACAGGAAGACAGAGAAGAGAAAGGA-GACGGAGCAAAACAGAGGGGGGAGGACACGGCAGAG-GGAAAAAAGGACCCAAACAACCGAAAACAGAAGA-GAGACACGAACACCGCAGGGAAAAAAGAGCACCAG-GCGAAAACCAAA

ewer specimens were available. Most populations o Archaeidae previously knownrom mid-eastern Australia were successully sampled and sequenced or the molecularanalysis (see superscript DNA codes in the Material Examined sections, below), withnumerous newly discovered populations also included. In total, sequences rom 94taxa were added to the nal alignment (see able 2), including 79 Austrarchaearommid-eastern Australia, one archaeid specimen rom north-eastern Queensland andeight Archaeidae rom Victoria and Western Australia. A specimen o the Madagascan

species Eriauchenius workmaniO.P.-Cambridge, 1881 was also included, along withthree other Palpimanoidea in the amilies Mecysmaucheniidae and Palpimanidae. Tetree was rooted with the outgroups Hickmania troglodytes(Higgins & Petterd, 1883)(Austrochilidae) and Tarlina smithersiGray, 1987 (Gradungulidae) (both in the super-


12/100


amily Austrochiloidea), shown to be sister or basal to the Palpimanoidea in previousanalyses (see Griswold et al. 2005, Rix et al. 2008, Rix and Harvey 2010).

Analysis. o iner phylogenetic relationships among sequenced specimens o Ar-chaeidae rom mid-eastern Australia, a combined, gene-partitioned Bayesian phyloge-

netic analysis was executed in MrBayes Version 3.1.2 (Huelsenbeck and Ronquist 2001,Ronquist and Huelsenbeck 2003). Prior to analysis, MrModeltest Version 3.7 (Posadaand Crandall 1998) was used to choose the appropriate model o nucleotide substitu-tion or each partition under an Akaike Inormation Criterion (AIC) ramework; orthe COI data, the GR+I+G model was invoked with the ollowing settings [Lset nst=6rates=gamma]; or the COII data, the VM+I+G model was invoked with the ollowingsettings [Lset nst=6 rates=gamma]. For each data partition, parameters were estimated in-dependently ([Unlink tratio=(all) pinvar=(all) shape=(all) statereq=(all) revmat=(all)]),rates were allowed to vary across partitions ([Prset applyto=(all) ratepr=variable]), andour Markov Chain Monte Carlo (MCMC) chains were run or 20 million generations,sampling every 1000 generations, with the nal standard deviation o split requencies< 0.01 and the rst 2,000,000 sampled trees discarded as burnin ([burnin=2000]).Burnin times and log likelikood trace les were visualised using racer Version 1.5(Rambaut and Drummond 2009). Posterior probabilities were calculated and reportedon a 50% majority-rule consensus tree o the post-burnin sample.

Results and discussion. Te summary phylogenetic tree resulting rom Bayesiananalysis o the COI and COII data is presented in Figure 3B. Te amily Archaeidaeand the genusAustrarchaea(as currently dened) were both monophyletic and stronglysupported, with all mid-eastern Australian taxa similarly united in a monophyletic (al-though weakly supported) clade (highlighted green in Fig. 3B). Within this mid-east-ern Australian lineage, evidence or at least 17 morphological species was supported by17 equivalently-monophyletic and strongly supported molecular clades; inter-specic(i.e. sister-species) pairwise divergences or the combined (COI + COII) dataset rangedrom 810%, with intra-specic divergences ranging rom 06%. Tree monophyleticclades rom populations known only by juveniles (rom the Kanangra-Boyd NationalPark, Willi Willi National Park and Badja State Forest) had sequence divergences in the

range 89% (relative to sister-clades), suggesting that these populations may representdistinct species. Deeper species-group lineages were generally poorly supported by theCOI and COII data, althoughA. monteithisp. n. was clearly inerred as a basal taxon,sister to all other species rom mid-eastern Australia (Fig. 3B).

Te results o the molecular phylogenetic analysis highlight the utility o compar-ing molecular and morphological taxonomic techniques, and provide a rst insight intothe possible phylogenetic relationships among Australian Archaeidae. Despite theirexaggerated morphology and specialised ecology, species oAustrarchaeaare otherwisemorphologically conservative haplogyne spiders, with only relatively subtle inter-spe-

cic somatic and genitalic dierences between adults, and a diagnostic requirement inmost species or adult male specimens. Tis morphological conservatism, combinedwith the general paucity o specimens in collections, the relative over-representation o


13/100


juveniles in collections and in the eld, along with the diculties associated with col-lecting adult males, renders the identication o species oAustrarchaeadicult basedon morphology alone. By sequencing juveniles and adults rom across mid-eastern

Australia, a much clearer picture o the distribution and limits o each species has been

achieved; populations known only rom juveniles and emales could be condentlylinked to type localities, and newly-collected juvenile specimens could or the rsttime be associated with conspecic adult specimens. In the case o collections madeat Binna Burra (Lamington National Park) in April 2010, juvenile specimens o twosympatric species were successully genotyped to determine their identication, and totest whetherA. nodosaandA. dianneaesp. n. were truly sympatric on the LamingtonPlateau (see Nomenclatural Remarks orA. nodosa, below).

Te phylogenetic relationships inerred or Australian species o Archaeidae remainhighly preliminary in the absence o additional genes and a greater taxon sample romsouthern and north-eastern Australia (M. Rix, unpublished data), however several keyresults are worthy o discussion. Firstly, the enigmaticA. monteithisp. n., rom the Gi-braltar Range National Park (Fig. 19), was clearly inerred as a basal sister-species to allother Archaeidae rom mid-eastern Australia, which together ormed a monophyletic(although weakly supported) mid-eastern Australian clade (highlighted green in Fig. 3B)sister to an undescribed species rom north-eastern Queensland. Tis result is congruentwith morphology, in that the linear gradation seen in the number o dorsal hump-liketubercles on the abdomen (our in north-eastern Queensland taxa; ve inA. monteithisp.n.; six in all other mid-eastern Australian taxa; Figs 5E-G) matches the inerred gradationo clades in Figure 3B. Similarly, the observed gap in the distribution o archaeid speciesin central Queensland, roughly consistent with the St Lawrence Gap (Webb and racey1981) between Gladstone and Mackay (Fig. 2), seems to refect a genuine phylogeneticbarrier, rather than a collecting arteact. Te other major gap in the distribution o Ar-chaeidae in mesic eastern Australia, roughly consistent with the mountainous Australianalpine zone bordering New South Wales and Victoria (Fig. 2), seems to also refect asecond major phylogenetic barrier between a divergent clade o southern Australian taxa(highlighted blue in Fig. 3B) and all other Australian Archaeidae.

Clearly, applying molecular taxonomic methods to a morphological taxonomy iso great utility or species oAustrarchaea. For the current revision, molecular data areclearly linked to specimens and to museum registration numbers by using DNA taxoncodes in Material Examined sections, each o which corresponds to an equivalent codein able 2, and to branch terminals in Figure 3B. o ully integrate the molecular datawith the morphological taxonomic hypotheses presented (below), species are also diag-nosed (where possible) with unique molecular autapomorphies, in addition to stand-ard morphological characters (see Conventions, above). Tis approach will acilitatethe molecular identication o specimens in the uture (as advocated by numerous

authors, e.g. Cook et al. 2010), and assist in accurately genotyping juveniles or whichgenitalic and adult somatic characters are unavailable.


14/100


Taxonomy

Family Archaeidae Koch & Berendt, 1854

GenusAustrarchaeaForster & Platnick, 1984http://species-id.net/wiki/Austrarchaea

AustrarchaeaForster & Platnick, 1984: 21; Platnick 1991b: 259; Main 1995: 151;Harvey 2002a: 35.

ype species.Archaea nodosaForster, 1956, by original designation.Diagnosis. Species oAustrarchaeacan be distinguished rom all other extant Ar-

chaeidae (i.e. Malagasy and Arican species oEriaucheniusandAfrarchaea) by the pres-ence o numerous, clustered spermathecae in emales (Figs 5D, 10G, 14G) and by thepresence o a long, wiry embolus on the pedipalp o males (Figs 10E, 15E, 27E) (For-ster and Platnick 1984, Wood 2008). Te remarkable, elevated shape o the carapace(Figs 4A-C, 10A-B) and the very long chelicerae (Figs 4B, 4D) will also immediatelyseparate this genus rom all other Australian spiders.

Description. Small, haplogyne, araneomorph spiders; total length 2.5 to 5.0.Colouration: Body colouration cryptic and relatively uniorm across species, usu-

ally with only subtle intraspecic variation in abdominal patterning; carapace, sternumand chelicerae tan brown to dark reddish-brown, interspersed with darker regions ogranulate cuticle (Fig. 5), covered in highly refective setae; legs tan-brown to darkerreddish-brown, with pattern o darker annulations on distal segments; abdomen mot-tled with beige and variable hues o grey-brown (Figs 5E-G), with darker sclerites,scutes and sclerotic spots (Figs 5A-B); paler beige markings due to refective, subcu-ticular guanine crystals (Fig. 5B); antero-lateral ace o abdomen always with large,humeral patch o refective guanine crystals (Figs 5A, 5E-G).

Cephalothorax: Carapace greatly elevated anteriorly (CH/CL ratio usually 2.02.4;Fig. 6), with raised, highly modied pars cephalica orming neck and bulbous head (see

Wood 2008) (Figs 4A-C); neck with concomitantly long diastema (see Schtt 2002)between cheliceral bases and anterior margin o carapace, used along entire length withsclerotised cuticle (Fig. 4C); cheliceral bases emanating rom broad, ully-enclosed cheli-ceral oramen situated at ront o head (Figs 4A-B); posterior head region usually alsobearing two pairs o rudimentary protrusions or horns, each typically terminating in ashort, thickened seta (Fig. 4A). Carapace with densely granulate cuticular microstructure(Fig. 4G), covered in larger setose tubercles arranged in clusters or distinct rows (Figs 4C,4E); each tubercle bearing single densely plumose or ciliate seta; setose tubercles larg-est on neck and pars thoracica (Figs 4C, 4E). Eight eyes present on anterior margin o

head, in our widely separated diads (Figs 4A-B); AME largest, widely separated, di-rected antero-laterally on rounded ocular bulge (Fig. 4B); PME situated closely posteriorto AME, directed obliquely on postero-lateral side o ocular bulge; lateral eyes contiguous,with shared raised bases, directed ventro-laterally on widest lateral margin o head (Figs
http://species-id.net/wiki/Austrarchaeahttp://species-id.net/wiki/Austrarchaea


15/100


4A-B). Sternum longer than wide, covered in setose tubercles; lateral margins separatedrom dorsal pleural sclerite extending between coxae I-IV. Labium subtriangular, not usedto sternum, directed antero-ventrally at oblique angle to sternum; labrum with pair odivergent projections on anterior surace. Maxillae large (Fig. 4C), straddling labium and

labrum, converging distally; serrula a single row o teeth. Chelicerae very long, spear-like,distally divergent (Figs 4B, 4D, 4F), usually with proximal bulging projection (Fig. 4B);both sexes with oval, ectal stridulatory le adjacent to pedipalps (Fig. 4F); males usuallyalso with brush (Figs 4F, 12C, 19C, 22C), short comb (Figs 14C, 18C) or dense tut (Figs16C, 17C) o accessory setae on anterior ace o paturon. Chelicerae armed with threerows o peg teeth; anterior (prolateral) row with two peg teeth near tip o ang; posterior(retrolateral) row with single peg tooth near tip o ang; median (prolateral) row with morethan 15 peg teeth extending along inner prolateral margin o paturon to near base o ang;median row with approximately nine porrect, comb-like peg teeth adjacent to ang, severallarger, fattened, spiniorm peg teeth near tip o ang, and additional progressively shorter,spiniorm peg teeth along inner paturon (Fig. 4D); cheliceral retromargin also with ouror ve true teeth and prominent cheliceral gland mound.

Legs and female pedipalp: Legs (longest to shortest) 1423, covered with short plumosesetae; spines absent; patella I long, greater than one-third length o emur I. richobothriapresent on tibiae and metatarsi o legs; tibiae I-IV each with two trichobothria; metatarsiI-IV each with single trichobothrium; bothrial bases with strongly ridged hood. arsi shorterthan metatarsi, with capsulate tarsal organ and three claws; tarsi, metatarsi and distal tibiae olegs I-II usually with ventral and pro-ventral rows o moveable, spatulate setae. Female pedi-palp with long, porrect trochanter and small tarsal claw; tibia with two dorsal trichobothria.

Abdomen: Abdomen arched anteriorly, rounded-subtriangular in lateral view, usu-ally with our to six large hump-like tubercles on dorsal surace (Figs 5A, 5E-G); cuticlecovered with short plumose setae and numerous sclerotic spots (Figs 5A-B). Epigastricregion with sclerotised (setose) book lung covers and dorsal and ventral plates sur-rounding pedicel (Fig. 5C) (plates used in males); dorsal pedicel plate with transverseridges; emales with median genital plate and sclerotised lateral sigillae (Figs 5C-D);males with broad dorsal scute used anteriorly to epigastric sclerites, with or without

additional paired sclerites associated with hump-like tubercles (Fig. 5A). Six spinnerets,surrounded by thickened cuticle; ALS largest, PMS smallest; colulus absent. Posteriorpair o divided tracheal spiracles situated anterior to spinnerets; males also with trans-verse row o epiandrous gland spigots situated closely anterior to epigastric urrow.

Genitalia: Female genitalia haplogyne, with sclerotised, strongly arched genital plateanterior to epigastric urrow (Figs 5C-D); internally with gonopore leading to large,spherical membranous bursa (Fig. 17G; see also Forster and Platnick 1984, g. 57) over-lying two separate, radiating clusters o sclerotised anterior spermathecae (Figs 5D, 10G,14G, 19G). Male pedipalp with complex, expandable pyriorm bulb (Figs10E, 19E,

23E, 24E), consisting o smooth tegulum, proximal subtegulum and associated tegulargroove with basal haematodocha (Figs 10E, 23E, 27E) (similar to Mecysmaucheniidaeand potentially analogous to the subtegular division o Entelegynae); distal tegulumwith excavate, rimmed cavity surrounding massive, infatable haematodochal complex


16/100


incorporating distal embolus, basal embolic sclerite and multiple tegular sclerites (Figs26D, 27E) (see below); distal haematodochal complex with balloon-like proximal por-tion (anchored by distal rim o tegulum) and sinuous, tapering embolic portion (an-chored by fexible, hinged retro-ventral conductor) (Figs 26D, 27E). Unexpanded pedi-

palp with olded, wiry embolus abutting conductor (Fig. 17E); tegular sclerites embed-ded pro-distally (Fig. 20E); pedipalpal expansion and haematodochal infation (e.g. seeFigs 14E, 23E, 26D, 27E) resulting in signicant conormational changes to shape oconductor, length and orientation o embolus, and relative position o tegular sclerites.

As noted by Wood (2008), the homology o the tegular sclerites among archaeidgenera remains unclear, and this is especially true orAustrarchaearelative to Malagasyand Arican taxa. For the purposes o this revision, and or an easy comparison amongspecies oAustrarchaearom mid-eastern Australia, the moveable tegular sclerites o thepedipalp are here numbered (13), relative to their pro-distal position within the unex-panded tegular cavity (e.g. see Figs 11F, 17F). egular sclerite 1 (S 1) is a porrect, vari-ably spiniorm (Fig. 25F), rod-like (Fig. 20E) or liorm (Fig. 10F) process (breakablein some specimens; Fig. 21F) that originates near the prolateral base o the conductor,adjacent to the embedded base o the proximal embolic sclerite; during pedipalpal ex-pansion this sclerite usually remains distally directed, positioned adjacent to the embolichaematodocha (Figs 26D, 27E). egular sclerite 2 (S 2) is a distinctive, pointed, usu-ally spur-like process, angled obliquely towards the conductor (Figs 11F, 25F), whichis closely associated with the adjacent tegular sclerite 2a (S 2a); in the unexpandedstate, the sinuous, liorm S 2a is usually obscured and locked within a olded groovealong the margin o S 2 (see Forster and Platnick 1984, gs 60, 62). egular sclerite 3(S 3) is the most disto-dorsally positioned o the tegular sclerites, with a broader, moreplate-like morphology relative to S 12, usually visible as a distally pointed or rod-likeprojection beyond the retro-distal rim o the tegulum (Figs 14E-F, 17E-F, 20D-E).

Distribution. Assassin spiders occur in mesic habitats throughout south-eastern,south-western and north-eastern mainland Australia (Fig. 2), usually in montane rain-orests (Figs 30C, 38C, 41C) and wet eucalypt orests (Figs 39C, 42C, 45C), but oc-casionally in temperate heathlands or lowland rainorests (Fig. 40C). In south-eastern

Australia they occur on Kangaroo Island (South Australia) and along the Great DividingRange, rom Grampians National Park in south-western Victoria north to Kroombitops National Park in south-eastern Queensland. In south-western Western Australiathey occur rom the Leeuwin-Naturaliste National Park east to Cape Le Grand Na-tional Park, with outlying populations in the Porongurup and Stirling Range NationalParks. In north-eastern Queensland archaeids occur along the Great Dividing Range,rom Eungella National Park near Mackay north to the Mount Finnigan Uplands, nearCooktown. Although this distribution is markedly concordant with the distributiono closed and tall open orests in Australias east and extreme south-west (see Specht

1981), assassin spiders appear to be notably absent rom asmania, rom the AustralianAlps and rom the St Lawrence Gap (Webb and racey 1981) (Fig. 2), as evidencedby the lack o museum specimens and despite targeted searches by the senior author.


17/100


Composition. Five described species Austrarchaea daviesaeForster & Platnick,1984,A. hickmani(Butler, 1929),A. mainaePlatnick, 1991b,A. nodosa(Forster, 1956)andA. robinsiHarvey, 2002a and the 17 new species rom mid-eastern Australia:A.alanisp. n.,A. aleenaesp. n.,A. binfordaesp. n.,A. christopherisp. n.,A. clyneaesp. n.,

A. cunninghamisp. n.,A. dianneaesp. n.,A. harmsisp. n.,A. helenaesp. n.,A. judyaesp. n.,A. mascordisp. n.,A. mcguiganaesp. n.,A. milledgeisp. n.,A. monteithisp. n.,

A.platnickorum sp. n., A. ravenisp. n. andA. smithaesp. n.Remarks.At least three clades o Archaeidae can be recognised in Australia (Fig. 3B;

see also Wood et al. 2010): a mid-eastern Australian clade, distributed rom southernNew South Wales to south-eastern Queensland (including the enigmatic, basal species

A. monteithisp. n.); a north-eastern Queensland clade, endemic to tropical Queensland;and a southern Australian clade, known rom Victoria, South Australia and south-west-ern Western Australia. For the purposes o this revision, mid-eastern Australian speciesare diagnosed relative only to other related species rom mid-eastern Australia (i.e. A.nodosaand its closest relatives; Fig. 3B), all o which possess ve or six dorsal hump-liketubercles on the abdomen (Figs 5F-G) and have a carapace height to carapace length(CH/CL) ratio 2.00. Austrarchaea daviesaeand related species rom north-easternQueensland have only two pairs o hump-like tubercles on the abdomen (Fig. 5E), and

A. hickmani,A. robinsiandA. mainaerom southern Australia have a carapace height tocarapace length (CH/CL) ratio signicantly less than 2.00 (M. Rix, pers. obs.).

Key to the species oAustrarchaeaknown rom mid-eastern Australia (males re-quired)

1 Abdomen with ve dorsal hump-like tubercles (Fig. 5F) ...................................................................................................................... A. monteithisp. n.

Abdomen with six dorsal hump-like tubercles, in three pairs (Fig. 5G) .......22 Male chelicerae with dense tut o accessory setae on anterior ace o paturon

(Figs 16C, 17C, 23C) .................................................................................3 Male chelicerae with uniorm brush (Figs 12C, 19C, 22C) or comb (Figs

14C, 18C) o accessory setae on anterior ace o paturon ............................53 ut o accessory setae on anterior ace o male paturon very strong, dorsally-directed, with pick-like prole in lateral view (Fig. 16C) ...A. harmsisp. n.

ut o accessory setae on anterior ace o male paturon less pronounced, withshorter, densely-bunched prole in lateral view (Figs 17C, 23C) .................4

4 egular sclerite 3 (S 3) very large, porrect (Figs 17D-F); S 2 thin, spini-orm (Fig. 17F) ...................................................................A. aleenaesp. n.

egular sclerite 3 (S 3) not enlarged, rounded-rectangular (Fig. 23E); S 2spur-like, not spiniorm (Fig. 23E) ..................................A. milledgeisp. n.

5 egular sclerite 1 (S 1) very long, rod-like, visible in retrolateral view,reaching to near distal apex o conductor, with broadly-rounded apex (Figs20C-E) ......................................................................A. christopherisp. n.


18/100


egular sclerite 1 (S 1) usually relatively short, obscured by conductor inretrolateral view (Figs 18F, 25F); i S 1 long, never with broadly-roundedapex (Figs 10F, 22F) ....................................................................................6

6 Highest point o male pars cephalica (HPC) near posterior margin o head

(with carapace sometimes almost horizontal anterior to HPC; Figs 8A, 8H),ratio o HPC to post-ocular length 0.84 (Figs 8A, 8C-D, 8H, 9D)..........7

Highest point o male pars cephalica (HPC) closer to middle o head, ratioo HPC to post-ocular length < 0.75 (Figs 8F-G, 8I, 9C, 9F-I) ................11

7 Male chelicerae with short comb o accessory setae on anterior ace o patu-ron (Figs 14C, 18C) ...................................................................................8

Male chelicerae with longer brush o accessory setae on anterior ace o patu-ron (Figs 11C, 15C) ...................................................................................9

8 Conductor ear-shaped, with large proximal lobe (Figs 14D-F); tegular scle-rite 3 (S 3) triangular, with pointed apex (Fig. 14E) ..........A. ravenisp. n.

Conductor oliate, obliquely-angled (Figs 18D-E); tegular sclerite 3 (S 3)very large, porrect, with broadly-pointed rectangular apex (Figs 18D-F) ..................................................................................................... A. alanisp. n.

9 egular sclerite 1 (S 1) very long, spiniorm, visible in retrolateral view,reaching to near distal apex o conductor, with sharply-pointed apex (Figs22E-F) ............................................................................A. binfordaesp. n.

egular sclerite 1 (S 1) relatively short, shorter than S 2, obscured by con-ductor in retrolateral view (Figs 11F, 15F).................................................10

10 Conductor spade-shaped, with sharply-incised proximal margin (Figs 15D-F); male head strongly elevated postero-dorsally, post-ocular ratio > 0.40(Fig. 8C) ..............................................................................A. judyaesp. n.

Conductor oliate, without sharply-incised proximal margin (Figs 11D-E);male head not strongly elevated dorsally, post-ocular ratio < 0.30 (Fig. 8H) ............................................................................................... A. dianneaesp. n.

11 egular sclerite 1 (S 1) very thin, liorm (Figs 10F, 24F) .......................12 egular sclerite 1 (S 1) broader, spiniorm or rod-like (Figs 12F, 13E, 21F,

25F) ......................................................................................................... 1312 Proximal portion o embolic sclerite very broad, fanged, overlying proximalconductor (Figs 10D-E). ......................................A. nodosa(Forster, 1956)

Proximal portion o embolic sclerite not fanged, ully-embraced by conduc-tor (Figs 24D-E) ..............................................................A. mascordisp. n.

13 egular sclerite 1 (S 1) rod-like, without sharply-pointed apex (Fig. 27E) ....................................................................................... A. mcguiganaesp. n.

egular sclerite 1 (S 1) usually spiniorm, with sharply-pointed apex (Figs12F, 13E, 21F, 25F, 26D) .........................................................................14

14 Male head strongly elevated dorsally, post-ocular ratio > 0.38 (Fig. 9G); high-est point o pars cephalica (HPC) approaching posterior quarter o head,ratio o HPC to post-ocular length ~0.70 (Fig. 9G)............A. smithaesp. n.


19/100


Male head not strongly elevated dorsally, post-ocular ratio 0.35 (Figs 8F-G, 9C, 9I); highest point o pars cephalica (HPC) near middle o head, ratioo HPC to post-ocular length < 0.65 (Figs 8F-G, 9C, 9I) .........................15

15 Male head with concave depression near posterior margin (Fig. 8F) ............

........................................................................................... A. clyneaesp. n. Male head without concave depression near posterior margin (Figs 8G, 9C,

9I) ............................................................................................................1616 egular sclerite 1 (S 1) spiniorm, with long, gently-tapered apex (Figs 21F,

26D) .........................................................................................................17 egular sclerite 1 (S 1) relatively short, with rectangular base and sharply-

tapered apex (Fig. 12F) .............................................A. cunninghamisp. n.17 egular sclerite 1 (S 1) with curled distal tip (Fig. 26D) ...A. helenaesp. n. egular sclerite 1 (S 1) straight, without curled distal tip (Fig. 21F) ...........

.................................................................................A. platnickorum sp. n.

Te south-eastern Queensland (including Border Ranges) auna

Austrarchaea nodosa(Forster, 1956)McPherson Range Assassin Spiderhttp://species-id.net/wiki/Austrarchaea_nodosaFigs 1A-B, 5D, 7I, 8I, 10, 28

Archaea nodosaForster, 1956: 151, gs 17.Austrarchaea nodosa(Forster): Forster & Platnick, 1984: 21, gs 46, 910, 19, 27,

3435, 57, 6065.

ype material. Holotype juvenile: Lamington National Park, ullawallal [Ant-arctic Beech orest], south o Binna Burra, Queensland, Australia, [2812'20"S,15311'20"E], rom moss, 31.X.1955, . Woodward (QMB W1955).

Other material examined. AUSRALIA: Queensland: Lamington NationalPark:Binna Burra, track to ullawallal Antarctic Beech orest, 2812'20"S, 15311'20"E,siting and teasing low vegetation, 7.IV.2006, M. & A. Rix, 1, 2 juveniles (WAM89592DNA: LAM-51-J); Binna Burra, 11.II.1971, Y. Lubin, R. Raven, V. Davies, 1(QMB S73925); Binna Burra, Ships Stern Circuit track, 2811'51"S, 15311'28"E,siting elevated lea litter, subtropical rainorest, 764 m, 25.IV.2010, M. & A. Rix, D.& S. Harms, J. Wojcieszek, 1 juvenile (WAM 112571DNA: Ar56-58-J); IBISCA Plot IQ-1100-A, 2815'29"S, 15309'32"E, bark spray, 1141 m, 11.III.2007, G. Tompson,

A. Marcora, 1, 1, 1 juvenile (QMB S75416).New South Wales:Border Ranges

National Park: Upper Brindle Creek, Wiangarie, 2823'S, 15306'E, pyrethrum,Nothofagusrainorest, 840 m, 15.XII.2008, G. Monteith, 1 (QMB S87983). MountWarning National Park: 19751976, G. & S. Monteith, 1 juvenile (QMB S20426);
http://species-id.net/wiki/Austrarchaea_nodosahttp://species-id.net/wiki/Austrarchaea_nodosa


20/100


Mount Warning, track to summit, 2824'08"S, 15316'27"E, siting elevated lealitter under Xanthorrhoea, wet eucalypt orest bordering subtropical rainorest, 728m, 26.IV.2010, M. Rix, 1 juvenile (WAM 112572DNA: Ar57-46-J); o Mount WarningRoad, 2823'51"S, 15317'20"E, siting elevated lea litter, subtropical rainorest, 348

m, 26.IV.2010, D. Harms, 1 juvenile (WAM 112573DNA: Ar58-53-J).Additional material examined (o tentative identifcation). AUSRALIA:

Queensland: Lamington National Park: Mount Hobwee, in moss, 3.IV.1976, R.Raven, 1 juvenile (QMB S30827); Nagarigoon, 8.IV.1976, 1 juvenile (QMB S30817).Mount Chinghee National Park: QM Berlesate, stick brushing, 17.XII.1982, G.Monteith, D. Yeates, G. Tompson, 1 juvenile (QMB S30804). New South Wales:Border Ranges National Park: Border Fence, Levers Plateau, via Rathdowney, pitalltrap, 670 m, 22.V.IX.1976, G. & S. Monteith, 1 juvenile (QMB S30823).

Additional material (not examined).AUSRALIA: Queensland: LamingtonNational Park: ullawallal Antarctic Beech orest, south o Binna Burra, 281239S,1531132E, Nothofagus rainorest, 900 m, 21.III.2006, C. Griswold, D. Silva, R.Raven, B. Baehr, M. Ramrez, 1 (CASEN 9018966); Binna Burra, 27.III.1976,R. Raven, V. Davies, 1, 1 juvenile (QMB S30820); Binna Burra, 2811'38"S,15311'13"E, rainorest, 790 m, 21-23.III.2006, C. Griswold, D. Silva, R. Raven,B. Baehr, M. Ramrez, 1 juvenile (CASEN 9018963); Binna Burra, 2811'38"S,15311'13"E, Berlese o lea litter, rainorest, 790 m, 23.III.2006, C. Griswold, D.Silva, R. Raven, B. Baehr, M. Ramrez, 1 juvenile (CASEN 9018964); Binna Burra,along Border rack, 2811'56"S, 15311'15"E, beating vegetation, 900 m, 2930.IV.2009, H. Wood, 1 (CASEN 9028426); same data, 1 (CASEN 9028388);O'Reillys, 25-26.IX.1986, J. Gallon, R. Raven, 1 (QMB S30814).

Diagnosis.Austrarchaea nodosa can be distinguished rom all other Archaeidaerom mid-eastern Australia by the broad, fanged proximal portion o the embolicsclerite (Figs 10D-E; see also Forster and Platnick 1984, gs 61, 63) and the uniqueshape o the conductor (Figs 10D-E), which is thin, gently-tapered and slightly bentalong its distal hal. Te presence o a shallow concave depression near the posteriormargin o the head (Fig. 7I) can also be used to distinguish emales rom most other

species, including the sympatricA. dianneaesp. n.Tis species can also be distinguished rom other genotyped taxa rom mid-easternAustralia (see Fig. 3B) by the ollowing seven unique nucleotide substitutions or COI(n = 4): A(42), C(393), C(639), C(939), A(960), A(1038), A(1053).

Description.Male(QMB S30817): otal length 3.18; leg I emur 3.01; F1/CLratio 2.70. Cephalothorax dark reddish-brown; legs tan-brown with darker annulations;abdomen mottled grey-brown and beige, with darker reddish-brown dorsal scute andsclerites (Fig. 10B). Carapace very tall (CH/CL ratio 2.30); 1.12 long, 2.56 high,1.08 wide; neck 0.56 wide; bearing two pairs o rudimentary horns; highest point

o pars cephalica (HPC) near middle o head (ratio o HPC to post-ocular length0.57), carapace with shallow concave depression posterior to HPC; head not stronglyelevated dorsally (post-ocular ratio 0.24) (Fig. 8I). Chelicerae with short brush oaccessory setae on anterior ace o paturon (Fig. 10C). Abdomen 1.64 long, 1.13 wide;


21/100


with three pairs o dorsal hump-like tubercles (H 16); dorsal scute used anteriorlyto epigastric sclerites, extending posteriorly to rst pair o hump-like tubercles; H36 each covered by separate dorsal sclerites. Unexpanded pedipalp (WAM 89592)(Figs 10D-F) with thin, pointed conductor, gently-tapered and slightly bent along

distal hal; embolic sclerite with broad, fanged proximal portion overlying proximalconductor; tegular sclerite 1 (S 1) long, liorm, with sinuous distal tip, visible inretrolateral view; S 2 spiniorm, shorter than S 1; S 2a sinuous, largely obscuredby S 2; S 3 indistinct, embedded within distal haematodocha, barely visible beyondretro-distal rim o tegulum.

Female (QMB S30817): otal length 3.54; leg I emur 3.01; F1/CL ratio 2.40.Cephalothorax dark reddish-brown; legs tan-brown with darker annulations; abdomenbi-coloured grey-brown and beige, palest posteriorly (Fig. 10A). Carapace tall (CH/CL ratio 2.12); 1.26 long, 2.67 high, 1.15 wide; neck 0.64 wide; bearing two pairs orudimentary horns; highest point o pars cephalica (HPC) near posterior third o head(ratio o HPC to post-ocular length 0.63), carapace with shallow concave depressionposterior to HPC; head not strongly elevated dorsally (post-ocular ratio 0.23) (Fig.7I). Chelicerae without accessory setae on anterior ace o paturon. Abdomen 2.15 long,1.64 wide; with three pairs o dorsal hump-like tubercles (H 16). Internal genitaliawith cluster o 12 variably shaped spermathecae on either side o gonopore, clustersmeeting near midline o genital plate (Figs 5D, 10G); innermost (anterior) spermathecaelongest, sausage-shaped, curved antero-laterally; outermost (posterior) spermathecaebulbous; other spermathecae variably pyriorm, straight, directed antero-laterally.

Variation: Males (n=2): total length 2.973.18; carapace length 1.121.13;carapace height 2.562.67; CH/CL ratio 2.302.36. Females (n=3): total length 3.544.00; carapace length 1.211.33; carapace height 2.492.87; CH/CL ratio 2.062.15.

Distribution and habitat.Austrarchaea nodosais known rom rainorest habitatsalong the McPherson Range and scenic rim o extreme south-eastern Queenslandand north-eastern New South Wales, in the Lamington, Border Ranges and Mount

Warning National Parks (Fig. 28). At Binna Burra (Lamington National Park) it hasbeen ound in sympatry withA. dianneaesp. n., in the only known example o two-

species sympatry among Australian archaeids (see Nomenclatural Remarks, below).Conservation status. Tis species has a relatively widespread distribution in severalNational Parks protected under World Heritage legislation, and is not considered to beo conservation concern.

Nomenclatural remarks. Te holotype specimen oA. nodosa, described by Forster(1956), is a juvenile (probably penultimate) emale rom the ullawallal Nothofagusorest near Binna Burra, Lamington National Park. Although long assumed to haveonly a single species, the greater Binna Burra region is now the only locality in Australiaknown to have two species o Archaeidae living in close sympatry: numerous specimens

oA. dianneaesp. n. were discovered near Binna Burra in April 2010, along the ShipsStern Circuit rack, along with one juvenile specimen oA. nodosa. BothA. dianneaesp. n. andA. nodosaare closely related (Fig. 3B) rainorest-dwelling taxa, rendering theidentication o Forsters holotype specimen and thereore the identication o the


22/100


generic type species questionable. o address this issue, and to determine which specieswas actually described by Forster (1956), two lines o evidence are discussed below.

ullawallal the type locality cited by Forster (1956) is a well-known, high-altitude Nothofagus mooreicool-temperate rainorest, situated o Binna Burras Border

rack at around 900 m elevation. Te dominant rainorest surrounding ullawallal isa closed, complex notophyllous vine orest (with isolated warm-temperate and cool-temperate elements), typical o higher elevations throughout the Lamington NationalPark and McPherson Range (Fig. 28C). In all o the higher-altitude and/or closedrainorests o the Lamington Plateau and Border Ranges National Park, only identiablespecimens oA. nodosa(as recognised above) have so ar been collected. Furthermore,the two male specimens collected at or near ullawallal (WAM 89592, CASEN9018966) are also bothA. nodosaas here recognised. In contrast, the three localitieswhereA. dianneaesp. n. has been ound (i.e. along the Ships Stern Circuit rack nearBinna Burra, Wojigumal Creek, and in the amborine National Park) are signicantlylower in altitude than ullawallal and the surrounding Border rack region o BinnaBurra (764 m, 570 m and 313 m, respectively), with more open mixed rainorests andemergent eucalypts at the Binna Burra and Mount amborine localities (Fig. 29C).

Secondly, emale specimens o both species possess a distinctive head morphology;emales oA. nodosa(as here recognised) are characterised by a shallow concave depressionposterior to the highest point o the pars cephalica (HPC) (Fig. 7I), whereas emales oA.dianneaesp. n. have no such depression and a signicantly more pronounced posteriormargin o the head (Fig. 7H). Te holotype juvenile specimen oA. nodosahas a clearconcave depression posterior to the HPC, and head proportions otherwise very similarto the emale illustrated in Figure 7I. In contrast, the only known penultimate emalespecimen oA. dianneaesp. n., collected rom near Binna Burra (WAM 112556), doesnot have a concave depression posterior to the HPC, and head proportions otherwisesimilar to the allotype emaleA. dianneaesp. n. illustrated in Figure 7H.

Clearly, given the identication o specimens collected rom the type locality andsimilar nearby habitats, and the morphology o the holotype juvenile specimen, we areas condent as possible in newly-diagnosingA. nodosaas the species described above,

given an otherwise highly precarious nomenclatural situation.

Austrarchaea dianneaeRix & Harvey, sp. n.Gold Coast Hinterland Assassin Spiderurn:lsid:zoobank.org:act:C0149F76-0A44-4DB4-8DAF-088B17161900http://species-id.net/wiki/Austrarchaea_dianneaeFigs 7H, 8H, 11, 29

ype material. Holotype male: amborine National Park, Joalah section, track to Cur-tis Falls, Queensland, Australia, 2755'33"S, 15311'35"E, siting elevated lea litterand hand collecting at night, subtropical rainorest, 313 m, 26.IV.2010, M. Rix, D.Harms (QMB S90185).
http://zoobank.org/?lsid=urn:lsid:zoobank.org:act:C0149F76-0A44-4DB4-8DAF-088B17161900http://species-id.net/wiki/Austrarchaea_dianneaehttp://species-id.net/wiki/Austrarchaea_dianneaehttp://zoobank.org/?lsid=urn:lsid:zoobank.org:act:C0149F76-0A44-4DB4-8DAF-088B17161900


23/100


Paratypes: Allotype emale, same data as holotype (QMB S90186); 2 males and 7juveniles, same data as holotype (WAM 112557DNA: Ar59-60-M/Ar59-61-J/Ar59-62-J).

Other material examined. AUSRALIA: Queensland: Lamington NationalPark: Binna Burra, Ships Stern Circuit track, 2811'51"S, 15311'28"E, siting elevat-

ed lea litter, subtropical rainorest, 764 m, 25.IV.2010, M. & A. Rix, D. & S. Harms,J. Wojcieszek, 2, 4 juveniles (WAM 112556DNA: Ar56-54-M/Ar56-55-J/ Ar56-56-J); WojigumalCreek, 2812'29"S, 15311'56"E, pyrethrum, 570 m, 19.III.2008, A. Nakamura, 1(QMB S87980).

Additional material examined (o tentative identifcation). AUSRALIA:Queensland: Lamington National Park: IBISCA Plot IQ-300-C, 2809'04"S,15308'17"E, pitall trap, 260 m, 23.I.2007, K. Staunton, 1 juvenile (QMB S90181).

Etymology. Te specic epithet is a patronym in honour o the late Dianne Wo-jcieszek (19622003), or her love o the Mount amborine Hinterland.

Diagnosis.Austrarchaea dianneaecan be distinguished rom all other Archaeidaerom mid-eastern Australia exceptA. cunninghamisp. n. by the shape o the conduc-tor (Figs 11D-E), which is broad, oliate and curved laterally, with a triangular apex;and romA. cunninghamisp. n. by the longer, spiniorm tegular sclerite 1 (S 1) (Fig.11F) and by the more conical, posteriorly elevated shape o the male head (Fig. 8H).

Tis species can also be distinguished rom other genotyped taxa rom mid-easternAustralia (see Fig. 3B) by the ollowing three unique nucleotide substitutions or COI(n = 6): (303), G(798), A(1065).

Description.Holotype male: otal length 3.03; leg I emur 3.12; F1/CL ratio 2.83.Cephalothorax dark reddish-brown; legs tan-brown with darker annulations; abdomenmottled grey-brown and beige, with darker reddish-brown dorsal scute and sclerites(Fig. 11B). Carapace very tall (CH/CL ratio 2.37); 1.10 long, 2.62 high, 1.02 wide;neck 0.51 wide; bearing two pairs o rudimentary horns; highest point o pars cephal-ica (HPC) near posterior margin o head (ratio o HPC to post-ocular length 0.87),carapace gently sloping and almost horizontal anterior to HPC; head not stronglyelevated dorsally (post-ocular ratio 0.29) (Fig. 8H). Chelicerae with brush o accessorysetae on anterior ace o paturon (Fig. 11C). Abdomen 1.69 long, 1.33 wide; with three

pairs o dorsal hump-like tubercles (H 16); dorsal scute used anteriorly to epigastricsclerites, extending posteriorly to rst pair o hump-like tubercles; H 36 each cov-ered by separate dorsal sclerites. Unexpanded pedipalp (Figs 11D-F) with broad, oliateconductor, curved laterally with triangular apex; tegular sclerite 1 (S 1) spiniorm, ob-scured by conductor in retrolateral view; S 2 spur-like, longer than S 1; S 2a sinu-ous, largely obscured by S 2; S 3 embedded proximally within distal haematodocha,with sharply-pointed, triangular apex projecting beyond retro-distal rim o tegulum.

Allotype female: otal length 3.74; leg I emur 3.18; F1/CL ratio 2.43. Cephalo-thorax dark reddish-brown; legs tan-brown with darker annulations; abdomen mottled

grey-brown and beige, palest posteriorly (Fig. 11A). Carapace very tall (CH/CL ratio2.28); 1.31 long, 2.97 high, 1.21 wide; neck 0.65 wide; bearing two pairs o rudi-mentary horns; highest point o pars cephalica (HPC) near middle o head (ratio oHPC to post-ocular length 0.55), carapace gently sloping posterior to HPC; head not


24/100


strongly elevated dorsally (post-ocular ratio 0.25) (Fig. 7H). Chelicerae without acces-sory setae on anterior ace o paturon. Abdomen 2.15 long, 1.64 wide; with three pairso dorsal hump-like tubercles (H 16). Internal genitalia with cluster o 12 variablyshaped spermathecae on either side o gonopore, clusters meeting near midline o geni-

tal plate (Fig. 11G); innermost (anterior) spermathecae longest, sausage-shaped, curvedantero-laterally; other spermathecae variably pyriorm, curved, directed laterally.

Variation: Males (n=5): total length 2.733.21; carapace length 1.091.13; cara-pace height 2.532.62; CH/CL ratio 2.242.39. Females (n=2): total length 3.643.74; carapace length 1.31 (invariable); carapace height 2.872.97; CH/CL ratio2.202.28.

Distribution and habitat.Austrarchaea dianneaeis known only rom subtropicalrainorest habitats in the amborine and Lamington National Parks south o Brisbane,south-eastern Queensland (Fig. 29). At Binna Burra (Lamington National Park) it hasbeen ound in sympatry withA. nodosa, in the only known example o two-species sym-patry among Australian archaeids (see Nomenclatural Remarks orA. nodosa, above).

Conservation status. Tis species is a short-range endemic taxon (Harvey 2002b),which although restricted in distribution, is abundant within the amborine NationalPark (M. Rix, pers. obs.) and is urther protected within the World Heritage-listedLamington National Park. It is not considered to be o conservation concern.

Austrarchaea cunninghamiRix & Harvey, sp. n.Main Range Assassin Spiderurn:lsid:zoobank.org:act:EFE94CB8-B85A-4573-B181-E6279995D9B2http://species-id.net/wiki/Austrarchaea_cunninghamiFigs 7G, 8G, 12, 30

ype material. Holotype male: Main Range National Park, Cunningham's Gap, trackto Mount Mitchell, Queensland, Australia, 2803'05"S, 15223'41"E, siting elevat-ed lea litter, subtropical rainorest and adjacent transitional eucalypt orest, 805 m,

23.IV.2010, M. Rix, D. Harms (QMB S90184).Paratypes: Allotype emale, same data as holotype (QMB S90183); 1 emale and14 juveniles, same data as holotype (WAM 112555DNA: Ar55-89-F/Ar55-90-J/Ar55-91-J).

Other material examined. AUSRALIA: Queensland: Main Range NationalPark: Mount Mitchell, pitall, 1060 m, 1.III.1992, D. Cook, 1 juvenile (QMB S25714).

Additional material examined (o tentative identifcation). AUSRALIA:Queensland: Main Range National Park: Mount Superbus, summit, pyrethrum, treesand logs, 1300 m, 8-9.II.1990, G. Monteith, G. Tompson, H. Janetski, 2 juveniles(QMB S38509); Mount Asplenium, pyrethrum, trees and logs, 1290 m, 30.I.1993, G.

Monteith, 1 juvenile (QMB S90179).Etymology. Te specic epithet is a patronym in honour o British botanist andexplorer Allan Cunningham (17911839), ater whom the type locality o this species Cunninghams Gap in the Main Range National Park is named.
http://zoobank.org/?lsid=urn:lsid:zoobank.org:act:EFE94CB8-B85A-4573-B181-E6279995D9B2http://species-id.net/wiki/Austrarchaea_cunninghamihttp://species-id.net/wiki/Austrarchaea_cunninghamihttp://zoobank.org/?lsid=urn:lsid:zoobank.org:act:EFE94CB8-B85A-4573-B181-E6279995D9B2


25/100


Diagnosis.Austrarchaea cunninghamican be distinguished rom all other Archaei-dae rom mid-eastern Australia exceptA. dianneaeby the shape o the conductor (Figs12D-E), which is broad, oliate and curved laterally, with a triangular apex; and rom

A. dianneaeby the shorter, sharply-tapered tegular sclerite 1 (S 1) (Fig. 12F) and by

the more rounded, less conical shape o the male head (Fig. 8G).Tis species can also be distinguished rom other genotyped taxa rom mid-eastern

Australia (see Fig. 3B) by the ollowing our unique nucleotide substitutions or COIand COII (n = 3): C(769), C(981), C(1140), G(1152).

Description.Holotype male: otal length 2.82; leg I emur 3.01; F1/CL ratio2.70. Cephalothorax dark reddish-brown; legs tan-brown with darker annulations;abdomen mottled grey-brown and beige, with darker brown dorsal scute and scler-ites (Fig. 12B). Carapace very tall (CH/CL ratio 2.21); 1.12 long, 2.46 high, 1.05wide; neck 0.56 wide; bearing two pairs o rudimentary horns; highest point opars cephalica (HPC) near middle o head (ratio o HPC to post-ocular length0.60), carapace gently sloping posterior to HPC; head not strongly elevated dor-sally (post-ocular ratio 0.27) (Fig. 8G). Chelicerae with brush o accessory setaeon anterior ace o paturon (Fig. 12C). Abdomen 1.46 long, 0.97 wide; with threepairs o dorsal hump-like tubercles (H 16); dorsal scute used anteriorly to epi-gastric sclerites, extending posteriorly to rst pair o hump-like tubercles; H 36each covered by separate dorsal sclerites. Unexpanded pedipalp (Figs 12D-F) withbroad, oliate conductor, strongly curved laterally with triangular, evenly-taperedapex; tegular sclerite 1 (S 1) relatively short, with rectangular base and sharply-tapered apex, obscured by conductor in retrolateral view; S 2 spur-like, longerthan S 1; S 2a sinuous, liorm, exposed distally; S 3 embedded proximallywithin distal haematodocha, with sharply-pointed apex projecting beyond retro-distal rim o tegulum.

Allotype female: otal length 3.54; leg I emur 3.24; F1/CL ratio 2.30. Cephalo-thorax brown; legs tan-brown with darker annulations; abdomen mottled grey-brownand beige (Fig. 12A). Carapace tall (CH/CL ratio 2.20); 1.41 long, 3.10 high, 1.28wide; neck 0.76 wide; bearing two pairs o rudimentary horns; highest point o pars

cephalica (HPC) near middle o head (ratio o HPC to post-ocular length 0.57),carapace gently sloping posterior to HPC; head not strongly elevated dorsally (post-ocular ratio 0.23) (Fig. 7G). Chelicerae without accessory setae on anterior ace opaturon. Abdomen 1.90 long, 1.41 wide; with three pairs o dorsal hump-like tuber-cles (H 16). Internal genitalia with cluster o 10 variably shaped spermathecae oneither side o gonopore, clusters marginally separated near midline o genital plate (Fig.12G); innermost (anterior) spermathecae longest, sausage-shaped, bent laterally; otherspermathecae variably pyriorm, curved, directed laterally.

Variation: Females (n=2): total length 3.443.54; carapace length 1.381.41; cara-

pace height 2.973.10; CH/CL ratio 2.152.20.Distribution and habitat.Austrarchaea cunninghamiis known only rom rainor-est habitats in the Main Range National Park o extreme south-eastern Queensland(Fig. 30).


26/100


Conservation status. Tis species is a short-range endemic taxon (Harvey 2002b),which although restricted in distribution, is abundant within the World Heritage-listed Main Range National Park near Cunninghams Gap (M. Rix, pers. obs.). It is notconsidered to be o conservation concern.

Austrarchaea clyneaeRix & Harvey,sp. n.Mount Clunie Assassin Spiderurn:lsid:zoobank.org:act:3F559C8C-005F-442A-84D1-0676D6EB56A6http://species-id.net/wiki/Austrarchaea_clyneaeFigs 8F, 13, 31

ype material. Holotype male: Mount Clunie National Park, Mount Clunie, viaWoodenbong, Queensland, Australia, 19751976, G. & S. Monteith (QMB S20425).

Other material examined. AUSRALIA: New South Wales: Mount ClunieNational Park: Mount Clunie, via Woodenbong, pitall trap, 670 m, 8.V.15.VIII.1976, G. & S. Monteith, 2 juveniles (QMB S69811).

Additional material examined (o tentative identifcation).AUSRALIA:NewSouth Wales: ooloom National Park: Beaury State Forest", north along WallabyCreek, 2826'S, 15227'E, 830 m, 9.IV.1993, M. Gray, G. Cassis, 1 juvenile (AMSKS37854).

Etymology. Te specic epithet is a patronym in honour o Australian naturalist,zoologist, conservationist, author, wildlie photographer and documentary lm-makerDensey Clyne, or her landmark contributions to Australian natural history, and orhaving such a proound impact on the senior author during his ormative childhoodyears.

Diagnosis.Austrarchaea clyneaecan be distinguished rom all other Archaeidaerom mid-eastern Australia by the very long, spiniorm tegular sclerite 1 (S 1) (Fig.13E) combined with the unique shape o the conductor (Figs 13C-D), which is thin,gently-curved laterally and pointed distally.

Description.Holotype male: otal length 2.87; leg I emur 2.72; F1/CL ratio 2.62.Cephalothorax reddish-brown; legs tan-brown with darker annulations; abdomenmottled grey-brown and dark beige, with darker reddish-brown dorsal scute andsclerites (Fig. 13A). Carapace very tall (CH/CL ratio 2.22); 1.04 long, 2.31 high,0.99 wide; neck 0.51 wide; bearing two pairs o rudimentary horns; highest pointo pars cephalica (HPC) near posterior third o head (ratio o HPC to post-ocularlength 0.63), carapace with concave depression posterior to HPC; head not stronglyelevated dorsally (post-ocular ratio 0.23) (Fig. 8F). Chelicerae with short brush oaccessory setae on anterior ace o paturon (Fig. 13B). Abdomen 1.54 long, 1.18 wide;

with three pairs o dorsal hump-like tubercles (H 16); dorsal scute used anteriorlyto epigastric sclerites, extending posteriorly to rst pair o hump-like tubercles; H36 each covered by separate dorsal sclerites. Unexpanded pedipalp (Figs 13C-E) withthin, gently-curved, pointed conductor; tegular sclerite 1 (S 1) very long, spiniorm,
http://zoobank.org/?lsid=urn:lsid:zoobank.org:act:3F559C8C-005F-442A-84D1-0676D6EB56A6http://species-id.net/wiki/Austrarchaea_clyneaehttp://species-id.net/wiki/Austrarchaea_clyneaehttp://zoobank.org/?lsid=urn:lsid:zoobank.org:act:3F559C8C-005F-442A-84D1-0676D6EB56A6


27/100


reaching to near distal tip o conductor, visible in retrolateral view; S 2 spur-like,shorter than S 1; S 2a sinuous, largely obscured by S 2; S 3 indistinct, embeddedwithin distal haematodocha, barely visible beyond retro-distal rim o tegulum.

Female: Unknown.Distribution and habitat.Austrarchaea clyneae is known only rom rainorest

habitats in the Mount Clunie National Park o extreme north-eastern New SouthWales (Fig. 31). A juvenile specimen rom ooloom National Park (near Urbenville)may also belong to this species based on proximity.

Conservation status. Tis species appears to be a short-range endemic taxon(Harvey 2002b), which although potentially restricted in distribution, seems well-protected in at least one World Heritage-listed National Park. It is not considered tobe o conservation concern.

Austrarchaea raveniRix & Harvey, sp. n.DAguilar Range Assassin Spiderurn:lsid:zoobank.org:act:8EFF87A1-A86D-452C-8F69-0A4C5191CACAhttp://species-id.net/wiki/Austrarchaea_raveniFigs 1E-F, 7D, 8D, 14, 32

ype material. Holotype male: Mount Nebo, D'Aguilar Range, Queensland, Aus-tralia, 15.VIII.1990, [inside hollow log], M. Harvey, . Churchill (QMB S90193).

Paratype: Allotype emale, D'Aguilar National Park, Mount Glorious, Maialasection, track to Greene's Falls, Queensland, Australia, 2719'57"S, 15245'47"E,siting elevated lea litter, subtropical rainorest, 633 m, 4.V.2010, M. Rix, D. Harms(QMB S90192DNA: Ar73-83-F).

Other material examined. AUSRALIA: Queensland: D'Aguilar National Park:Mount Glorious, Maiala section, track to Greene's Falls, 2719'30"S, 15245'45"E,hand collected at night rom maternal web at base o allen log, 3.III.2001, M. &

A. Rix, 1, 1 juvenile (WAM 94092); Mount Glorious, Maiala section, track to

Greene's Falls, 2719'57"S, 15245'47"E, siting elevated lea litter, subtropicalrainorest, 633 m, 4.V.2010, M. Rix, D. Harms, 6 juveniles (WAM 112574DNA: Ar73-84-J/Ar73-85-J); Mount Glorious, Maiala section, ANIC Berlesate, ~635 m, 13.III.1973, R.aylor, 1 juvenile (ANIC). Mount Glorious: Mount Glorious", spraying logs withMortein, 26.IV.1988, P. Blus, V. Davies, 1 juvenile (QMB S30810); Hiller Family'sProperty, 20.I. 26.VI.1978, G. Monteith, 1 juvenile (QMB S30807). Mount MeeForest Reserve: Te Mill Rainorest Walk, 2704'57"S, 15242'39"E, siting elevatedlea litter, subtropical rainorest, 271 m, 1.V.2010, M. Rix, D. Harms, 1, 3 juveniles(WAM 112575DNA: Ar69-86-M/Ar69-87-J/Ar69-88-J).

Additional material (not examined).AUSRALIA: Queensland: Brisbane For-est Park: Mount Glorious, Lawton Road section o Westside rack, NW. o Maiala,2719'07"S, 15244'50"E, beating erns ~20 cm rom ground, rainorest, 1.I.2010, G.

Anderson, 1 juvenile (QMB).
http://zoobank.org/?lsid=urn:lsid:zoobank.org:act:8EFF87A1-A86D-452C-8F69-0A4C5191CACAhttp://species-id.net/wiki/Austrarchaea_ravenihttp://species-id.net/wiki/Austrarchaea_ravenihttp://zoobank.org/?lsid=urn:lsid:zoobank.org:act:8EFF87A1-A86D-452C-8F69-0A4C5191CACA


28/100


Etymology. Te specic epithet is a patronym in honour o Dr Robert Raven,or his extraordinary contributions to arachnology, and or his ongoing eortsdocumenting the diverse spider auna o south-eastern Queensland.

Diagnosis.Austrarchaea ravenican be distinguished rom all other Archaeidae rom

mid-eastern Australia by the very short, barely dierentiated comb o accessory setaeon the male chelicerae (Fig. 14C) combined with the unique shape o the conductor(Figs 14D-E), which is ear-shaped with a large proximal lobe.

Tis species can also be distinguished rom other genotyped taxa rom mid-easternAustralia (see Fig. 3B) by the ollowing three unique nucleotide substitutions or COIand COII (n = 6): G(9), G(843), (1408).

Description.Holotype male: otal length 2.90; leg I emur 3.10; F1/CL ratio 2.8

Documents

Assassin Spiders of Australia