Upload
others
View
6
Download
0
Embed Size (px)
Citation preview
ASHGInteractiveWorkshop:OverviewandInterpretationofGTEx Resources:eQTLs andGeneExpression
NoRelevantConflictstoDisclose:KristinG.ArdlieFrançoisAguetAyelletV.SegrèJaredL.NedzelStephenMontgomery
Disclosurefor:
Overview and Interpretation of GTEx Resources: eQTLs and Gene Expression
ASHG 2017 Annual Meeting10/18/2017
• Overview of study and data• Portal demonstration• Jupyter notebook• GWAS-eQTL challenges
GTEx WorkshopAgenda
Association of common DNA variants with diseases and traits
ACGGGCAATCACGTACGGGCAAACACGTACGGGCAATCACGTACGGGCAAACACGTACGGACAATCAAGTACGGACAAACAAGT
ACGGGCAATCACGTACGGACAAACAAGTACGGACAAACAAGTACGGACAATCAAGTACGGACAATCAAGTACGGACAAACAAGT
https://www.ebi.ac.uk/gwas
Controls Cases
Genome-wide association studies (GWAS) led to discovery of >10,000 common DNA variants associated with >600 diseases/traits.
~95% GWAS SNPs locatedinnon-coding regions
eQTLs: expression quantitative trait loci
T
A
T
A
AA AT TT
Expression
GenotypeAA AT TT
Expression
Genotype
Hypothesis: the functional effect of most (non-coding) GWAS variants is modification of gene expression
Regulatory variation is measured as expression quantitative trait loci (eQTLs)
Measured in a population:
Regulation of gene expression: multi-tissue and multi-individual
Across a population(e.g., eQTL studies in blood)
Across tissues or cell typesFunctional genomic maps(e.g., ENCODE, Roadmap Epigenomics)
Assessing role of genetic variation on gene function requires both dimensions
The Genotype Tissue-Expression project
Breast - Mammary Tissue
Artery - Coronary
Heart - Left Ventricle
Esophagus - Muscularis
Esophagus - Gastroesophageal Junction
Thyroid Esophagus - Mucosa
Heart - Atrial Appendage
Artery - Aorta
LungSpleen
Colon - Sigmoid
TestisSkin - Not Sun Exposed (Suprapubic)
OvaryColon - TransversePancreas
Adipose - Subcutaneous
Liver
Stomach
Pituitary
BrainAnterior cingulate cortex (BA24)
Caudate (basal ganglia)Cerebellar Hemisphere
CerebellumCortex
Frontal Cortex (BA9)HippocampusHypothalamus
Nucleus accumbens (basal ganglia)Putamen (basal ganglia)
Artery - Tibial
Nerve - Tibial
Adrenal Gland
Adipose - Visceral (Omentum)Small Intestine - Terminal Ileum
Prostate
Vagina
Whole Blood
Uterus
Muscle - Skeletal
Skin - Sun Exposed (Lower leg)
Cells - Transformed fibroblastsCells - EBV-transformed lymphocytes
Atlas of gene expression and eQTLs in non-diseased human tissues from up to 960 recently deceased donors
• 53 tissue sites• 11 distinct brain regions• 2 cell lines
• Core molecular assays:• WGS/WES (primarily whole blood)• RNA-seq• Small RNA-seq (future)
This workshop
eGTEx: the Enhancing GTEx projectCOMMENTARY
2 ADVANCE ONLINE PUBLICATION NATURE GENETICS
vary. The molecular phenotypes being studied are shown in Table 1 and described in the fol-lowing sections.
DNA accessibilitySystematic understanding of the impact of genetic variation on gene expression requires both comprehensive delineation of regulatory DNA and an understanding of the degree to which individual regulatory regions vary at the population level. DNA is tightly packaged into chromatin inside our cells, with 147-nucleo-tide segments of DNA wrapped around each histone octomer (themselves separated by ~50-nucleotide linkers). Displacement of nucleosomes through the binding of transcrip-tional regulators results in accessible regions of ‘open chromatin’, which can be mapped using endonucleases such as DNase I (refs. 27,28). Past work has shown that disease and trait associations are highly concentrated in acces-sible elements29 and that allelic variation in DNA accessibility can precisely map the effects of sequence variation on transcription factor activity3,30,31. In eGTEx, we will examine DNA accessibility using both the DNase I hypersen-sitivity assay and the higher-resolution DNase I footprinting assay to map transcription factor occupancy within regulatory DNA at nucleo-tide-level resolution. The footprints revealed by DNA accessibility are highly unbiased and cap-ture variation in diverse regulatory elements, including promoters, enhancers, silencers, insulators, and locus-control regions.
Histone modificationsEach histone protein in the chromatin fiber has a long amino acid tail that can be
tissue-specific mechanisms for disease-asso-ciated variants, there remains a need to obtain multi-omics reference data to study the effects of genetic variation across multiple tissues and multiple layers of molecular complexity. In addition to complementing studies of com-plex genetic diseases, expanding multitissue molecular data from ‘normal’ individuals can enhance cancer studies20,21 (which currently comprise 28% of all requests for GTEx data use), by distinguishing cancer-specific altera-tions and elucidating the tissue specificity of certain cancers and their mutations22,23.
Here we introduce the US National Institutes of Health (NIH) Common Fund’s Enhancing GTEx (eGTEx) project, which seeks to complement the gene expression phenotypes determined in the GTEx proj-ect with intermediate phenotypes across the same tissues and individuals (Fig. 1). These additional data types will provide a more complete reference of how genetic differences cascade through molecular and cellular phe-notypes to impact organismal phenotypes. To achieve this goal, eGTEx is applying diverse molecular assays to the GTEx sample col-lection, including DNase I hypersensitivity, ChIP–seq, DNA and RNA methylation, ASE, protein expression, somatic mutation, and telomere length assays. Together, the eGTEx reference aims to enable high-resolution identification of the mechanistic impacts of genetic variants and their role in human dis-eases, and it will serve as an enabling resource that will facilitate novel integrative and holis-tic computational methods development and biological insights.
The eGTEx project: study design and assaysThe goal of the GTEx project is to establish a national multitissue cohort for molecular phe-notypes. The current release of GTEx (data-base of Genotypes and Phenotypes (dbGaP) accession phs000424.v7.p2) provides 11,688 transcriptomes from 714 individuals and 53 tissues (median of 17 tissues per individual, 173 samples per tissue). The next release, v8, is expected to include 17,500 transcrip-tomes from ~850 individuals, and final data production for the project is targeted for late 2017. In addition to molecular data, GTEx includes pathology reports, histology images and reports, and donor characteris-tics, including ethnicity, age, and sex. Within GTEx, tissues are obtained from deceased donors with next-of-kin consent to the collec-tion and banking of anonymized samples for scientific research24. Two existing strengths of the GTEx project are the large number of tissues collected from each donor, facilitating characterization of gene expression across a
wide variety of tissues, and the relatively large size of the donor population, allowing one to evaluate the contribution of individual genetic variation. The first steps of assaying genetic variation and its impact on gene expression are the focus of two accompanying consor-tium papers25,26. However, fully understand-ing how a genetic variant regulates gene expression, such as through changes in DNA methylation or the binding affinity of a tran-scription factor, and subsequently connecting the downstream effects of differential gene expression through to protein abundance require additional molecular assays.
The goal of the eGTEx initiative is to enhance understanding of gene regulation by performing additional molecular analyses on the same tissues that underwent gene expres-sion analysis. Because of the large size of the GTEx tissue collection (over 25,000 samples), the variable quality across the samples col-lected, and the relatively small aliquot remain-ing for each sample, the eGTEx initiative will analyze a subset of the entire collection. The study design for eGTEx activities was allocated across two ‘dimensions’ of analysis: phase I, involving a relatively small number of donors (~15) analyzed for a large number of different tissues (>20); and phase II, involving a rela-tively small number of tissues (4–6) analyzed in a larger number of donors (150–200). eGTEx has planned to use the same tissues from the same individuals for as many assays as possible. However, because available aliquots are limited, some assays require frozen tissue as input, and the throughput differs by assay, the extent of overlap and the number of phenotypes that will be generated from each individual sample will
Telomere length
Histone modificationsDNA accessibility
Protein quantification
Translation
Transcription
Allele-specific expression
Somatic mutation
DNA methylation
RNA methylation
Figure 1 Quantifying layers of molecular and cellular phenotypes. The eGTEx project plans to study telomere length, DNA accessibility, histone modifications, DNA and RNA methylation, somatic mutation, allele-specific expression, and protein quantification across individuals and tissues.
eGTEx Project, Nat. Genet., 2017
eGTEx data types• Protein quantifications (x2)• Methylation (WGBS)• Histone modifications
(ChIP-seq)• Dnase-seq• mmPCR-seq (deep ASE)• Somatic DNA-seq
(deep exome seq)• Analysis of telomere
structure
Sample and data processing overview
DonorPathology
reviewTissues
Blood& skin
BrainU Miami
Brain Bank
9-11 sub-regions
(Liquid N2)
(PAXgene)
LCLsFibroblasts
RNADNA
RNA(DNA)
RNA(DNA)
RNA sequencing• QC: RIN ≥ 5.5• polyA+ (Illumina TruSeq)• 2x76bp, ≥ 50M reads
DNA Analysis• OMNI 2.5M/5M: 450 donors• WES (100x)• WGS (30x): HiSeq 2000, HiSeq X
Quality control
Data processing and quality control pipelinesGenotype QC: samples & variants
VCF
RNA-seq alignment, quantification & QC
Expression tables,Covariates
eQTL mapping
Genotype QC pipeline
RNA-seq pipeline: alignment, quantification, QC
https://github.com/broadinstitute/gtex-pipeline/tree/master/rnaseq
eQTL mapping pipeline
https://github.com/broadinstitute/gtex-pipeline/tree/master/qtl
RNA-seq and eQTL pipeline details
• Pipeline components selected and updated based on internal and published benchmarks (e.g., Teng et al., Genome Biology, 2016).
Release V6p V7 V8 V9
Genome build GRCh37 GRCh37 GRCh38 GRCh38GENCODE annotation v19 v19 v26 v26Aligner TopHat 1.4.1 STAR 2.4.2a STAR 2.5.3a STAR 2.5.3aGene expression RNA-SeQC 1.1.8 RNA-SeQC 1.1.9 RNA-SeQC 1.1.9 RNA-SeQC 1.1.9Transcript expression FluxCapacitor 1.6 RSEM 1.2.22 RSEM 1.3.0 RSEM 1.3.0Quality control metrics RNA-SeQC 1.1.8 RNA-SeQC 1.1.9 RNA-SeQC 1.1.9 RNA-SeQC 1.1.9QTL mapper FastQTL
Current public release
Overview of GTEx resources: open-access data
• Expression• Gene-level expression (TPM, counts)• Transcript-level expression (TPM, counts, isoform proportions)• Exon read counts
• QTLs• Single-tissue eQTLs (cis- and trans-)• Multi-tissue eQTLs• Future: splicing QTLs
• Histology images• De-identified public access sample and subject metadata
All open-access data is available at gtexportal.org
Overview of GTEx resources: protected data
• Sequence data:• RNA-seq (2x76 bp, unstranded, >50M reads/sample)• WGS (30x coverage) and WES (100x coverage)• Illumina Omni2.5/5 microarray genotypes (subset of 450 donors)
• Allele-specific expression (ASE)• Full sample and subject metadata• Future: eGTEx sequence data
• ChIP-seq• WGBS-seq
All protected-access data is available at dbGaP, under accession phs000424
GTEx data releases Release V6/V6p V7 V8 V9
RNA-seq 8,555 11,688 17,382 ~20,000WGS 148 635 838 ~960WES 520 603 ~960OMNI 450 450 450 450RNA-seq w/ GT 7333 10361 15253 ~20,000eQTL tissues 44 48 49 49
Analysis freezes
Midpoint publications: V6p• Full list available at https://gtexportal.org/home/publicationPage• Data remains available on GTEx PortalNo publication embargo on V7
Current public release
GTEx data production: samples per donor
Adipose - Subcutaneous
Adipose - Visceral (Omentum)
Adrenal GlandArtery - AortaArtery - Coronary
Artery - TibialBladderBrain - Amygdala
Brain - Anterior cingulate cortex (BA24)
Brain - Caudate (basal ganglia)
Brain - Cerebellar Hemisphere
Brain - Cerebellum
Brain - CortexBrain - Frontal Cortex (BA9)
Brain - Hippocampus
Brain - Hypothalamus
Brain - Nucleus accumbens (basal ganglia)
Brain - Putamen (basal ganglia)
Brain - Spinal cord (cervical c-1)
Brain - Substantia nigra
Breast - Mammary Tissue
Cells - Cultured fibroblasts
Cells - EBV-transformed lymphocytes
Cervix - Ectocervix
Cervix - Endocervix
Colon - Sigmoid
Colon - Transverse
Esophagus - Gastroesophageal Junction
Esophagus - Mucosa
Esophagus - Muscularis
Fallopian Tube
Heart - Atrial Appendage
Heart - Left Ventricle
Kidney - Cortex
Kidney - Medulla
LiverLungMinor Salivary Gland
Muscle - Skeletal
Nerve - TibialOvaryPancreasPituitaryProstateSkin - Not Sun Exposed (Suprapubic)
Skin - Sun Exposed (Lower leg)
Small Intestine - Terminal Ileum
SpleenStomachTestisThyroidUterusVaginaW
hole Blood1
200
400
600
800
948
Dono
rs
Expression data on GTEx PortalTranscript-level expression
• Based on full GENCODE annotation
• Quantified with RSEM• TPM• Expected read counts• No covariate correction
Gene-level expression• Based on collapsed GENCODE
annotation• Quantified with RNA-SeQC• TPM• Read counts• No covariate correction
eQTL inputs• Based on gene-level
quantifications• Additional normalization:
TMM of read counts; inverse normal transform
• Covariates (hidden + known) in separate file
Annotation used for gene-level expression quantification
• RNA-seq protocol:• polyA+• Unstranded
• Ambiguity in quantifying exondomains shared between sense andanti-sense transcripts
• Collapsing procedure:• Masks overlapping intervals• Mask ‘readthrough’ and ‘retained intron’ transcripts
Definition of cis-eQTLs in GTEx
• cis-eQTL: genome-wide significant association between ≥ 1 eVariant and eGene, with associations tested within ±1Mb cis-window around TSS. Does not imply evidence of allelic effects at each locus.
• eGene: gene with at least one significant eQTL (at 5% FDR).• eVariant: variant with a significant association to ≥1 eGene.• Effect allele: ALT allele (not necessarily the minor allele).
AA AT TT
Expression
Genotype
Data normalization for eQTL analyses
• Expression thresholds:• ≥6 counts in ≥ 20% of samples AND• ≥0.1 TPM in ≥ 20% of samples
• Normalization:• Between sample normalization: TMM (from edgeR)
• Corrects for library size differences and expression outlier effects• Within-gene normalization: inverse normal transform
• Attenuates outliers
Covariate correction in eQTL analyses
• Genotype: top 3 PCs, sex, sequencing platform (HiSeq 2000, HiSeq X)• Expression: significant technical confounders may be unknown; estimation of
hidden confounders is key (e.g., through PEER factors)
●●● ●●● ● ● ●●●●● ●● ● ●●●●●● ● ●●●● ●●● ●●●● ●●●● ●●●●● ●
End 1 Mismatch Rate
Cumulative Gap Length
Expression Profiling EfficiencyExonic Rate
Intronic RateRIN
Total Ischemic timemean coefficient of variation
5' 50−based normalization3' 50−base normalization
rRNA RateGenes Detected
Transcripts DetectedEstimated library size
Mapped Unique Rate of TotalUnique Rate of Mapped
Duplication Rate of MappedMapped Unique
Mean Coverage Per Base
End 1 Sense
End 1 AntisenseEnd 2 Antisense
End 2 SenseMapped Pairs
Mapped ReadsTotal reads
Time PAXgene fixativeBase Mismatch Rate
End 2 Mapping RateMapping Rate
End 1 Mapping RateEnd 2 Mismatch Rate
Failed Vendor QC CheckFragment Length StdDev
Fragment Length MeanEnd 1 % SenseEnd 2 % SenseAutolysis Score
Number of Gaps
Gap Percentagenucleic acid isolation batch
Intergenic RateIntragenic RateChimeric Pairs
Alternative AligmentsBSS collection site
Number Covered 5'rRNA
Split Reads
0 0.05 0.1 0.15 0.2 0.25
Nucleic acid isolationSample collectionSequencing Metrics
Supplementary Figure 8. Sample covariates associated with PEER factors in each tissue. For eachtissue, adjusted (R
2) reflecting the proportion of variance explained by each sample-specific covariate, for
the entire PEER component removed from the expression data. Each cell reflects variance explained for atissue/covariate pair, color scale at bottom. Grey cells represent pairs with insufficient data for estimation.
WWW.NATURE.COM/ NATURE | 31
Interval Of Onset To Death For First Underlying CauseCore Body Temperature
AgeGender
Manner Of DeathPneumonia_affectlung
Heart attack_etcRenal FailureLiver Disease
AscitesPneumonia
Tissue Recovery Time PointDeath Time Point Reference
Witnessed DeathHeight
BMIWeight
HypertensionChronic Respiratory Disease
HCV AbRace
Infected LinesHeroin Use
Bacterial InfectionsDocumented Sepsis
Long Term Steroid UseFungal Infections
Diabetes mellitus T2Cerebrovascular Disease
Prescription Pill AbuseResident Of State Run Group Home
CMV Total AbMen Sex With Men
Diabetes mellitus T1Heart Disease
Dialysis TreatmentMajor depression
Cancer Diagnosis 5yIschemic Heart Disease
Unexplained SeizuresAutopsy Performed By Coroner Or ME
Rheumatoid ArthritisBlood Donations Denied
Chronic Lower Respiratory DiseaseArthritis
Resided On Northern European Military BasePositive Blood CulturesUnexplained Weakness
Unexplained Weight LossCocaine Use In 5y
History Of Non Metastatic CancerReceived Tissue Organ Transplant
SchizophreniaAsthma
HCV 1 NATOpen Wounds
Exposure To ToxicsHIV 1 NAT
BodyTemperature − Units of measurementPrimary History Source
Abnormal WbcDeath Certificate Available
CohortIschemic Time
Donor On A Ventilator Immediately Prior To DeathPlace Of Death
Hardy ScaleICD−10 Code for cause of death
Classification of deathCategory of death
Death parameters
Demography
Medical history
Blood parameters
Collection
Tissue recovery
● ● ●● ●●● ●● ● ●●● ● ● ●●● ●● ●● ●● ● ●● ●●● ●● ●● ●●● ●● ●●● ●●
0 0.05 0.1 0.15 0.2 0.25
Supplementary Figure 9. Donor covariates associated with PEER factors in each tissue. For eachtissue, adjusted (R
2) reflecting the proportion of variance explained by each donor-specific covariate, for
the entire PEER component removed from the expression data. Each cell reflects variance explained for atissue/covariate pair, color scale at bottom. Grey cells represent pairs with insufficient data for estimation.
WWW.NATURE.COM/ NATURE | 32
eQTL mapping and eGene discovery
• Variants in cis-window (±1Mb from TSS) may be correlated due to linkage disequilibrium (LD)
• LD must be incorporated in multiple hypothesis testing correction when establishing genome-wide significance
• Empirical p-values from permutation of genotypes
Multiple hypothesis correction for eGene detection
0.0 0.2 0.4 0.6 0.8 1.0p-value
0
1000
2000
3000
4000
5000
6000
7000Genes
1 2 3 4 5 6 7-log10(min. p-value)
0.0
0.2
0.4
0.6
0.8
1.0
Freq
uenc
y
Beta distr.Nominal p-valuePermutation p-valuesEmpirical p-value
1 2 3 4 5 6-log10(min. p-value)
0.0
0.2
0.4
0.6
0.8
1.0
Freq
uenc
y
Beta distr.Nominal p-valuePermutation p-valuesEmpirical p-value
1 2 3 4 5 6 7 8-log10(min. p-value)
0.0
0.2
0.4
0.6
0.8
1.0
Freq
uenc
y
Beta distr.Nominal p-valuePermutation p-valuesEmpirical p-value
Gene A Gene B Gene C
Empirical p-valuedistribution
q-values (Storey)
eGenes at ≤ 0.05 FDR
Delaneau et al., Bioinformatics, 2016Storey & Tibshirani, PNAS, 2003
Threshold for significant variant-gene pairs
Nominal p-value threshold for each gene 𝑔:𝐹#$%(𝑝() where 𝐹#$% is the inverse cumulative Beta distribution of the gene.
1 2 3 4 5 6-log10(min. p-value)
0.0
0.2
0.4
0.6
0.8
1.0Fr
eque
ncyBeta distr.Nominal p-valuePermutation p-valuesEmpirical p-value
𝑝(: empirical p-value of gene closest to 0.05 FDR threshold
Example for portal demonstration
NDRG4,SETD6,CNOT1nearQTinterval-associatedvariant,rs37062GTEx Consortium, Science, 2015
jupyter notebook: overview of expression and eQTL data
• The interactive parts of the workshop will be conducted using a jupyter notebook, GTEx_ASHG17_workshop.ipynb
• On the GTEx Portal, go to https://gtexportal.org/workshop.html• Click on “Start the notebook” to begin. This will launch a cloud-
based instance of the notebook, with access to all data examples. Please note that the notebook is read-only.
• The notebook is also available for download at https://github.com/broadinstitute/gtex-ashg2017-workshop
Organization of GTEx data: common identifiers
• All sample attributes are indexed by Sample ID• All donor attributes are indexed by Donor ID• The donor-specific tissue collection ID is not a proxy for tissue type
GTEX-1117F-0226-SM-5GZZ7Sample ID:Donor ID Aliquot ID
Donor-specifictissue collection ID
ImplicationsofGTExforinterpretingGWASsignals
ManygenesinthesameregionhaveeQTLs
31
significance
geneA
geneAeQTLs
significance
geneB
geneBeQTLs
significance
geneC
geneCeQTLs
position
…withdifferenteffectsacrosstissues
32
significance
geneAeQTLs
geneBeQTLs
geneCeQTLs
position
…withdifferenteffectsacrosstissues
33
significance
geneAeQTLs
geneBeQTLs
geneCeQTLs
position
Whichone(s)explainthediseaserisk?
LotsofeQTLdatameansthatseeminglysignificantassociationsarethenorm
eQTL/GWASinterpretationneedstobeexaminedmorecautiously
~1/3ofallvariantscouldmeetthiscriterion
Co-localizationapproachescombineeQTLandGWASsignals
GWASsignaleQTLsignal
Giambartolomei etal,PLoS Genet,2014
iPython notebooktask• CorrelationofGWASandeQTLsummarystatisticsoveranassociatedhitforBMI.
Co-localizationofeQTLsandGWASinGTEx
• CorrelationofGWASandeQTLsummarystatisticsfortwoseparategenesoveranassociatedhitforBMI
BMIassociationrs2008514
-log10(eQ
TLP-value)
ToyexampleNotnecessarilythecausalgeneortissue
#tissues
#eG
enes
V6peQTLs,44tissues
Bimodaldistributionoftissue-specificityofcis-eQTLs
Multi-tissueeQTL meta-analysis:Metasoft (Han,BandEskin,E,AJHG2011)
NumberoftissuespereQTL inLDwithGWASvariantsincreaseswithincreasedpower(multi-tissueanalysis)
#tissuesperGWASvariant
#GW
ASvariants
Multi-tissueanalysisMedian=31tissues
Single-tissueanalysisMedian=5tissues
eQTL detectedonlywithmulti-tissueanalysis
Multi-tissueeQTL posteriorprobability
Single-tissue
eQTL
p-value
Co-localizationofeQTLsandGWASinGTEx
• CorrelationofGWASandeQTLsummarystatisticsfortwoseparatetissuesoveranassociatedhitforBMI
ToyexampleNotnecessarilythecausalgeneortissue
DetectingGWAS/eQTL overlapiseasyinprinciple
44
gene
eQTL
position
GWAS
GWASsignificance
significance
eQTL
significance
SamesignalinGWASandeQTL:colocalization!
Difficultinpractice
45
position
significance
GWASsignificance
eQTL
significance
Unclearifsamesignalinboth
eQTL
GWAS
Methodstodetectcolocalization
46
Method methodarchetype identifiescausalvariants?
multiplecausalvariants?
COLOC Bayesian No No
Sherlock Bayesian No Yes
eCAVIAR completelikelihood(exhaustivesearch) Yes Yes,but
intractable
FINEMAP completelikelihood(stochasticsearch) Yes Yes
SMR Mendelianrandomization No No
TWAS TWAS No Yes
MetaXcan TWAS No Yes
Furthercaveats:SomegeneshavemultipleindependenteQTLs
• CouldexplaincomplexityofGWAS/eQTLsignals
• ConditionaleQTLs notyettestedforcolocalizationwithGWAS
47
Zengetal.(2016)BioRXiv.
gene
primaryeQTL
significance
positionsig
nificance secondaryeQTL
regressoutprimaryeQTL signal
Anotherchallenge:IdentifyingcausalvariantsineQTLregions
• CAVIAR(Hormozdiari etal.Genetics2014)resultswillbeonGTEx Portalsoon!
Fine-mappingmethodsproposecrediblesetsofcausalvariantsforaneQTL
eQTLlimitedincapturingrarevarianteffectsGeneexpressionoutlierscanpointtorarevariantswithlargeeffects
Overexpressionoutlier
Underexpressionoutlier
Interpretingpersonalvariantsusinggeneticandfunctional
genomicsdata
Li,Kim,Tsang,Davis,Nature,2017
Using GTEx to help solve rare disease cases.
Patient muscle(n=63)
GTEx control muscle(n=184)
>""">""""" """" """">"">
Aberrant splicing Allele imbalance
AAAAT
AVariant Calling
RNA
WES
TTAA
Variant Calling
RN
AW
ES
TT
AA>""">""""" """" """">"">
Aberrant splicing Allele imbalance
AAAAT
AVariant Calling
RNA
WES
TTAA
Cummingsetal,ScienceTransMed,2017
SeeTalkbyBerylCummingsFriday10:45AM
Interpretinggeneticvariantsindisease
Geneticvariationinfluencegeneexpressionof~90%ofallknownprotein-codinggenes
AbundanceofeQTLdatarequirescarewhenconductingGWASfollow-up- Multipletestingcanleadtofalsediscoveries
- Co-localizationmethodsrequired- 40%ofallvariantsdonotco-localizewiththeirnearestgene
Geneexpressionoutlierscanidentifylarge-effectrarevariants- Canbeusedtointerpretindividualriskfactorsandidentifyrare
diseasegenesandvariants
GTEx pipelines
• Source code is available athttps://github.com/broadinstitute/gtex-pipeline
• Includes wrapper scripts, Dockerfiles
• Pipelines are available on FireCloud(http://firecloud.org)
• Namespace: broadinstitute_gtex
PipelinemodulesPipelinemodulesPipeline modulesPipeline
modulesPipelinemodulesPipeline modules
Docker image
WDLscript
WDLscript
…
Biobank
• The biobank from the GTEx project is hosted at the Broad Institute.• Samples can be searched and requested at
https://gtexportal.org/home/samplesPage.• Sample requests for research complementing the primary project
are welcome.
AcknowledgementsARTICLERESEARCH
GTEx ConsortiumLaboratory, Data Analysis & Coordinating Center (LDACC)—Analysis Working Group François Aguet1, Kristin G. Ardlie1, Beryl B. Cummings1,2, Ellen T. Gelfand1, Gad Getz1,3, Kane Hadley1, Robert E. Handsaker1,4, Katherine H. Huang1, Seva Kashin1,4, Konrad J. Karczewski1,2, Monkol Lek1,2, Xiao Li1, Daniel G. MacArthur1,2, Jared L. Nedzel1, Duyen T. Nguyen1, Michael S. Noble1, Ayellet V. Segrè1, Casandra A. Trowbridge1, Taru Tukiainen1,2
Statistical Methods groups—Analysis Working Group Nathan S. Abell5,6, Brunilda Balliu6, Ruth Barshir7, Omer Basha7, Alexis Battle8, Gireesh K. Bogu9,10, Andrew Brown11,12,13, Christopher D. Brown14, Stephane E. Castel15,16, Lin S. Chen17, Colby Chiang18, Donald F. Conrad19,20, Nancy J. Cox21, Farhan N. Damani8, Joe R. Davis5,6, Olivier Delaneau11,12,13, Emmanouil T. Dermitzakis11,12,13, Barbara E. Engelhardt22, Eleazar Eskin23,24, Pedro G. Ferreira25,26, Laure Frésard5,6, Eric R. Gamazon21,27,28, Diego Garrido-Martín9,10, Ariel D.H. Gewirtz29, Genna Gliner30, Michael J. Gloudemans5,6,31, Roderic Guigo9,10,32, Ira M. Hall18,19,33, Buhm Han34, Yuan He35, Farhad Hormozdiari23, Cedric Howald11,12,13, Hae Kyung Im36, Brian Jo29, Eun Yong Kang23, Yungil Kim8, Sarah Kim-Hellmuth15,16, Tuuli Lappalainen15,16, Gen Li37, Xin Li6, Boxiang Liu5,6,38, Serghei Mangul23, Mark I. McCarthy39,40,41, Ian C. McDowell42, Pejman Mohammadi15,16, Jean Monlong9,10,43, Stephen B. Montgomery5,6, Manuel Muñoz-Aguirre9,10,44, Anne W. Ndungu39, Dan L. Nicolae36,45,46, Andrew B. Nobel47,48, Meritxell Oliva36,49, Halit Ongen11,12,13, John J. Palowitch47, Nikolaos Panousis11,12,13, Panagiotis Papasaikas9,10, YoSon Park14, Princy Parsana8, Anthony J. Payne39, Christine B. Peterson50, Jie Quan51, Ferran Reverter9,10,52, Chiara Sabatti53,54, Ashis Saha8, Michael Sammeth55, Alexandra J. Scott18, Andrey A. Shabalin56, Reza Sodaei9,10, Matthew Stephens45,46, Barbara E. Stranger36,49,57, Benjamin J. Strober35, Jae Hoon Sul58, Emily K. Tsang6,31, Sarah Urbut46, Martijn van de Bunt39,40, Gao Wang46, Xiaoquan Wen59, Fred A. Wright60, Hualin S. Xi51, Esti Yeger-Lotem7,61, Zachary Zappala5,6, Judith B. Zaugg62, Yi-Hui Zhou60
Enhancing GTEx (eGTEx) groups Joshua M. Akey29,63, Daniel Bates64, Joanne Chan5, Lin S. Chen17, Melina Claussnitzer1,65,66, Kathryn Demanelis17, Morgan Diegel64, Jennifer A. Doherty67, Andrew P. Feinberg35,68,69,70, Marian S. Fernando36,49, Jessica Halow64, Kasper D. Hansen68,71,72, Eric Haugen64, Peter F. Hickey72, Lei Hou1,73, Farzana Jasmine17, Ruiqi Jian5, Lihua Jiang5, Audra Johnson64, Rajinder Kaul64, Manolis Kellis1,73, Muhammad G. Kibriya17, Kristen Lee64, Jin Billy Li5, Qin Li5, Xiao Li5, Jessica Lin5,74, Shin Lin5,75, Sandra Linder5,6, Caroline Linke36,49, Yaping Liu1,73, Matthew T. Maurano76, Benoit Molinie1, Stephen B. Montgomery5,6, Jemma Nelson64, Fidencio J. Neri64, Meritxell Oliva36,49, Yongjin Park1,73, Brandon L. Pierce17, Nicola J. Rinaldi1,73, Lindsay F. Rizzardi68, Richard Sandstrom64, Andrew Skol36,49,57, Kevin S. Smith5,6, Michael P. Snyder5, John Stamatoyannopoulos64,74,77, Barbara E. Stranger36,49,57, Hua Tang5, Emily K. Tsang6,31, Li Wang1, Meng Wang5, Nicholas Van Wittenberghe1, Fan Wu36,49, Rui Zhang5
NIH Common Fund Concepcion R. Nierras78
NIH/NCI Philip A. Branton79, Latarsha J. Carithers79,80, Ping Guan79, Helen M. Moore79, Abhi Rao79, Jimmie B. Vaught79
NIH/NHGRI Sarah E. Gould81, Nicole C. Lockart81, Casey Martin81, Jeffery P. Struewing81, Simona Volpi81
NIH/NIMH Anjene M. Addington82, Susan E. Koester82
NIH/NIDA A. Roger Little83
Biospecimen Collection Source Site—NDRI Lori E. Brigham84, Richard Hasz85, Marcus Hunter86, Christopher Johns87, Mark Johnson88, Gene Kopen89, William F. Leinweber89, John T. Lonsdale89, Alisa McDonald89, Bernadette Mestichelli89, Kevin Myer86, Brian Roe86, Michael Salvatore89, Saboor Shad89, Jeffrey A. Thomas89, Gary Walters88, Michael Washington88, Joseph Wheeler87
Biospecimen Collection Source Site—RPCI Jason Bridge90, Barbara A. Foster91, Bryan M. Gillard91, Ellen Karasik91, Rachna Kumar91, Mark Miklos90, Michael T. Moser91
Biospecimen Core Resource—VARI Scott D. Jewell92, Robert G. Montroy92, Daniel C. Rohrer92, Dana R. Valley92
Brain Bank Repository—University of Miami Brain Endowment Bank David A. Davis93, Deborah C. Mash93
Leidos Biomedical—Project Management Anita H. Undale94, Anna M. Smith95, David E. Tabor95, Nancy V. Roche95, Jeffrey A. McLean95, Negin Vatanian95, Karna L. Robinson95, Leslie Sobin95, Mary E. Barcus96, Kimberly M. Valentino95, Liqun Qi95, Steven Hunter95, Pushpa Hariharan95, Shilpi Singh95, Ki Sung Um95, Takunda Matose95, Maria M. Tomaszewski95
ELSI Study Laura K. Barker97, Maghboeba Mosavel98, Laura A. Siminoff97, Heather M. Traino97
Genome Browser Data Integration & Visualization—EBI Paul Flicek99, Thomas Juettemann99, Magali Ruffier99, Dan Sheppard99, Kieron Taylor99, Stephen J. Trevanion99, Daniel R. Zerbino99
Genome Browser Data Integration & Visualization—UCSC Genomics Institute, University of California Santa Cruz Brian Craft100, Mary Goldman100, Maximilian Haeussler100, W. James Kent100, Christopher M. Lee100, Benedict Paten100, Kate R. Rosenbloom100, John Vivian100, Jingchun Zhu100
1The Broad Institute of Massachusetts Institute of Technology and Harvard University, Cambridge, Massachusetts 02142, USA. 2Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 3Massachusetts General Hospital Cancer Center and Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 4Department of Genetics, Harvard Medical School, Boston, Massachusetts 02114, USA. 5Department of Genetics, Stanford University, Stanford, California 94305, USA. 6Department of Pathology, Stanford University, Stanford, California 94305, USA. 7Department of Clinical Biochemistry and Pharmacology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel. 8Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA. 9Centre for Genomic Regulation (CRG), The Barcelona Institute for Science and Technology, 08003 Barcelona, Spain. 10Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain. 11Department of Genetic Medicine and Development, University of Geneva Medical School, 1211 Geneva, Switzerland. 12Institute for Genetics and Genomics in Geneva (iG3), University of Geneva, 1211 Geneva, Switzerland. 13Swiss Institute of Bioinformatics, 1211 Geneva, Switzerland. 14Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 15New York Genome Center, New York, New York 10013, USA. 16Department of Systems Biology, Columbia University Medical Center, New York, New York 10032, USA. 17Department of Public Health Sciences, The University of Chicago, Chicago, Illinois 60637, USA. 18McDonnell Genome Institute, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 19Department of Genetics, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 20Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 21Division of Genetic Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee 37232, USA. 22Department of Computer Science, Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA. 23Department of Computer Science, University of California, Los Angeles, California 90095, USA. 24Department of Human Genetics, University of California, Los Angeles, California 90095, USA. 25Instituto de Investigação e Inovação em Saúde (i3S), Universidade do Porto, 4200-135 Porto, Portugal. 26Institute of Molecular Pathology and Immunology (IPATIMUP), University of Porto, 4200-625 Porto, Portugal. 27Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 28Department of Psychiatry, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 29Lewis Sigler Institute, Princeton University, Princeton, New Jersey 08540, USA. 30Department of Operations Research and Financial Engineering, Princeton University, Princeton, New Jersey 08540, USA. 31Biomedical Informatics Program, Stanford University, Stanford, California 94305, USA. 32Institut Hospital del Mar d’Investigacions Mèdiques (IMIM), 08003 Barcelona, Spain. 33Department of Medicine, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 34Department of Convergence Medicine, University of Ulsan College of Medicine, Asan Medical Center, Seoul 138-736, South Korea. 35Department of Biomedical Engineering, Johns Hopkins University, Baltimore, Maryland 21218, USA. 36Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, Illinois 60637, USA. 37Department of Biostatistics, Mailman School of Public Health, Columbia University, New York, New York 10032, USA. 38Department of Biology, Stanford University, Stanford, California 94305, USA. 39Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of Oxford, Oxford OX3 7BN, UK. 40Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Churchill Hospital, Oxford OX3 7LE, UK. 41Oxford NIHR Biomedical Research Centre, Churchill Hospital, Oxford OX3 7LJ, UK. 42Computational Biology & Bioinformatics Graduate Program, Duke University, Durham, North Carolina 27708, USA. 43Human Genetics Department, McGill University, Montreal, Quebec H3A 0G1, Canada. 44Departament d’Estadística i Investigació Operativa, Universitat Politècnica de Catalunya, 08034 Barcelona, Spain. 45Department of Statistics, The University of Chicago, Chicago, Illinois 60637, USA. 46Department of Human Genetics, The University of Chicago, Chicago, Illinois 60637, USA. 47Department of Statistics and Operations Research, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 48Department of Biostatistics, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 49Institute for Genomics and Systems Biology, The University of Chicago, Chicago, Illinois 60637, USA. 50Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA. 51Computational Sciences, Pfizer Inc, Cambridge, Massachusetts 02139, USA. 52Universitat de Barcelona, 08028 Barcelona, Spain. 53Department of Biomedical Data Science, Stanford University, Stanford, California 94305, USA. 54Department of Statistics, Stanford University, Stanford, California 94305, USA. 55Institute of Biophysics Carlos Chagas Filho (IBCCF), Federal University of Rio de Janeiro (UFRJ), 21941902 Rio de Janeiro, Brazil. 56Department of Psychiatry, University of Utah, Salt Lake City, Utah 84108, USA. 57Center for Data Intensive Science, The University of Chicago, Chicago, Illinois 60637, USA. 58Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, California 90095, USA. 59Department of Biostatistics, University of Michigan, Ann Arbor, Michigan 48109, USA. 60Bioinformatics Research Center and Departments of Statistics and Biological Sciences, North Carolina State University, Raleigh, North Carolina 27695, USA. 61National Institute for Biotechnology in the Negev, Beer-Sheva 84105, Israel. 62European Molecular Biology Laboratory, 69117 Heidelberg, Germany. 63Department of Ecology and Evolutionary Biology, Princeton University, Princeton, New Jersey 08540, USA. 64Altius Institute for Biomedical Sciences, Seattle, Washington 98121, USA. 65Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215, USA. 66University of Hohenheim, 70599 Stuttgart, Germany. 67Huntsman Cancer Institute, Department of Population Health Sciences, University of Utah, Salt Lake City, Utah 84112, USA. 68Center for Epigenetics, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 69Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 70Department of Mental Health, Johns Hopkins University School of Public Health, Baltimore, Maryland 21205, USA. 71McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland 21205, USA. 72Department of Biostatistics, Johns Hopkins
© 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLERESEARCH
GTEx ConsortiumLaboratory, Data Analysis & Coordinating Center (LDACC)—Analysis Working Group François Aguet1, Kristin G. Ardlie1, Beryl B. Cummings1,2, Ellen T. Gelfand1, Gad Getz1,3, Kane Hadley1, Robert E. Handsaker1,4, Katherine H. Huang1, Seva Kashin1,4, Konrad J. Karczewski1,2, Monkol Lek1,2, Xiao Li1, Daniel G. MacArthur1,2, Jared L. Nedzel1, Duyen T. Nguyen1, Michael S. Noble1, Ayellet V. Segrè1, Casandra A. Trowbridge1, Taru Tukiainen1,2
Statistical Methods groups—Analysis Working Group Nathan S. Abell5,6, Brunilda Balliu6, Ruth Barshir7, Omer Basha7, Alexis Battle8, Gireesh K. Bogu9,10, Andrew Brown11,12,13, Christopher D. Brown14, Stephane E. Castel15,16, Lin S. Chen17, Colby Chiang18, Donald F. Conrad19,20, Nancy J. Cox21, Farhan N. Damani8, Joe R. Davis5,6, Olivier Delaneau11,12,13, Emmanouil T. Dermitzakis11,12,13, Barbara E. Engelhardt22, Eleazar Eskin23,24, Pedro G. Ferreira25,26, Laure Frésard5,6, Eric R. Gamazon21,27,28, Diego Garrido-Martín9,10, Ariel D.H. Gewirtz29, Genna Gliner30, Michael J. Gloudemans5,6,31, Roderic Guigo9,10,32, Ira M. Hall18,19,33, Buhm Han34, Yuan He35, Farhad Hormozdiari23, Cedric Howald11,12,13, Hae Kyung Im36, Brian Jo29, Eun Yong Kang23, Yungil Kim8, Sarah Kim-Hellmuth15,16, Tuuli Lappalainen15,16, Gen Li37, Xin Li6, Boxiang Liu5,6,38, Serghei Mangul23, Mark I. McCarthy39,40,41, Ian C. McDowell42, Pejman Mohammadi15,16, Jean Monlong9,10,43, Stephen B. Montgomery5,6, Manuel Muñoz-Aguirre9,10,44, Anne W. Ndungu39, Dan L. Nicolae36,45,46, Andrew B. Nobel47,48, Meritxell Oliva36,49, Halit Ongen11,12,13, John J. Palowitch47, Nikolaos Panousis11,12,13, Panagiotis Papasaikas9,10, YoSon Park14, Princy Parsana8, Anthony J. Payne39, Christine B. Peterson50, Jie Quan51, Ferran Reverter9,10,52, Chiara Sabatti53,54, Ashis Saha8, Michael Sammeth55, Alexandra J. Scott18, Andrey A. Shabalin56, Reza Sodaei9,10, Matthew Stephens45,46, Barbara E. Stranger36,49,57, Benjamin J. Strober35, Jae Hoon Sul58, Emily K. Tsang6,31, Sarah Urbut46, Martijn van de Bunt39,40, Gao Wang46, Xiaoquan Wen59, Fred A. Wright60, Hualin S. Xi51, Esti Yeger-Lotem7,61, Zachary Zappala5,6, Judith B. Zaugg62, Yi-Hui Zhou60
Enhancing GTEx (eGTEx) groups Joshua M. Akey29,63, Daniel Bates64, Joanne Chan5, Lin S. Chen17, Melina Claussnitzer1,65,66, Kathryn Demanelis17, Morgan Diegel64, Jennifer A. Doherty67, Andrew P. Feinberg35,68,69,70, Marian S. Fernando36,49, Jessica Halow64, Kasper D. Hansen68,71,72, Eric Haugen64, Peter F. Hickey72, Lei Hou1,73, Farzana Jasmine17, Ruiqi Jian5, Lihua Jiang5, Audra Johnson64, Rajinder Kaul64, Manolis Kellis1,73, Muhammad G. Kibriya17, Kristen Lee64, Jin Billy Li5, Qin Li5, Xiao Li5, Jessica Lin5,74, Shin Lin5,75, Sandra Linder5,6, Caroline Linke36,49, Yaping Liu1,73, Matthew T. Maurano76, Benoit Molinie1, Stephen B. Montgomery5,6, Jemma Nelson64, Fidencio J. Neri64, Meritxell Oliva36,49, Yongjin Park1,73, Brandon L. Pierce17, Nicola J. Rinaldi1,73, Lindsay F. Rizzardi68, Richard Sandstrom64, Andrew Skol36,49,57, Kevin S. Smith5,6, Michael P. Snyder5, John Stamatoyannopoulos64,74,77, Barbara E. Stranger36,49,57, Hua Tang5, Emily K. Tsang6,31, Li Wang1, Meng Wang5, Nicholas Van Wittenberghe1, Fan Wu36,49, Rui Zhang5
NIH Common Fund Concepcion R. Nierras78
NIH/NCI Philip A. Branton79, Latarsha J. Carithers79,80, Ping Guan79, Helen M. Moore79, Abhi Rao79, Jimmie B. Vaught79
NIH/NHGRI Sarah E. Gould81, Nicole C. Lockart81, Casey Martin81, Jeffery P. Struewing81, Simona Volpi81
NIH/NIMH Anjene M. Addington82, Susan E. Koester82
NIH/NIDA A. Roger Little83
Biospecimen Collection Source Site—NDRI Lori E. Brigham84, Richard Hasz85, Marcus Hunter86, Christopher Johns87, Mark Johnson88, Gene Kopen89, William F. Leinweber89, John T. Lonsdale89, Alisa McDonald89, Bernadette Mestichelli89, Kevin Myer86, Brian Roe86, Michael Salvatore89, Saboor Shad89, Jeffrey A. Thomas89, Gary Walters88, Michael Washington88, Joseph Wheeler87
Biospecimen Collection Source Site—RPCI Jason Bridge90, Barbara A. Foster91, Bryan M. Gillard91, Ellen Karasik91, Rachna Kumar91, Mark Miklos90, Michael T. Moser91
Biospecimen Core Resource—VARI Scott D. Jewell92, Robert G. Montroy92, Daniel C. Rohrer92, Dana R. Valley92
Brain Bank Repository—University of Miami Brain Endowment Bank David A. Davis93, Deborah C. Mash93
Leidos Biomedical—Project Management Anita H. Undale94, Anna M. Smith95, David E. Tabor95, Nancy V. Roche95, Jeffrey A. McLean95, Negin Vatanian95, Karna L. Robinson95, Leslie Sobin95, Mary E. Barcus96, Kimberly M. Valentino95, Liqun Qi95, Steven Hunter95, Pushpa Hariharan95, Shilpi Singh95, Ki Sung Um95, Takunda Matose95, Maria M. Tomaszewski95
ELSI Study Laura K. Barker97, Maghboeba Mosavel98, Laura A. Siminoff97, Heather M. Traino97
Genome Browser Data Integration & Visualization—EBI Paul Flicek99, Thomas Juettemann99, Magali Ruffier99, Dan Sheppard99, Kieron Taylor99, Stephen J. Trevanion99, Daniel R. Zerbino99
Genome Browser Data Integration & Visualization—UCSC Genomics Institute, University of California Santa Cruz Brian Craft100, Mary Goldman100, Maximilian Haeussler100, W. James Kent100, Christopher M. Lee100, Benedict Paten100, Kate R. Rosenbloom100, John Vivian100, Jingchun Zhu100
1The Broad Institute of Massachusetts Institute of Technology and Harvard University, Cambridge, Massachusetts 02142, USA. 2Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 3Massachusetts General Hospital Cancer Center and Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 4Department of Genetics, Harvard Medical School, Boston, Massachusetts 02114, USA. 5Department of Genetics, Stanford University, Stanford, California 94305, USA. 6Department of Pathology, Stanford University, Stanford, California 94305, USA. 7Department of Clinical Biochemistry and Pharmacology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel. 8Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA. 9Centre for Genomic Regulation (CRG), The Barcelona Institute for Science and Technology, 08003 Barcelona, Spain. 10Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain. 11Department of Genetic Medicine and Development, University of Geneva Medical School, 1211 Geneva, Switzerland. 12Institute for Genetics and Genomics in Geneva (iG3), University of Geneva, 1211 Geneva, Switzerland. 13Swiss Institute of Bioinformatics, 1211 Geneva, Switzerland. 14Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 15New York Genome Center, New York, New York 10013, USA. 16Department of Systems Biology, Columbia University Medical Center, New York, New York 10032, USA. 17Department of Public Health Sciences, The University of Chicago, Chicago, Illinois 60637, USA. 18McDonnell Genome Institute, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 19Department of Genetics, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 20Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 21Division of Genetic Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee 37232, USA. 22Department of Computer Science, Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA. 23Department of Computer Science, University of California, Los Angeles, California 90095, USA. 24Department of Human Genetics, University of California, Los Angeles, California 90095, USA. 25Instituto de Investigação e Inovação em Saúde (i3S), Universidade do Porto, 4200-135 Porto, Portugal. 26Institute of Molecular Pathology and Immunology (IPATIMUP), University of Porto, 4200-625 Porto, Portugal. 27Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 28Department of Psychiatry, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 29Lewis Sigler Institute, Princeton University, Princeton, New Jersey 08540, USA. 30Department of Operations Research and Financial Engineering, Princeton University, Princeton, New Jersey 08540, USA. 31Biomedical Informatics Program, Stanford University, Stanford, California 94305, USA. 32Institut Hospital del Mar d’Investigacions Mèdiques (IMIM), 08003 Barcelona, Spain. 33Department of Medicine, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 34Department of Convergence Medicine, University of Ulsan College of Medicine, Asan Medical Center, Seoul 138-736, South Korea. 35Department of Biomedical Engineering, Johns Hopkins University, Baltimore, Maryland 21218, USA. 36Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, Illinois 60637, USA. 37Department of Biostatistics, Mailman School of Public Health, Columbia University, New York, New York 10032, USA. 38Department of Biology, Stanford University, Stanford, California 94305, USA. 39Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of Oxford, Oxford OX3 7BN, UK. 40Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Churchill Hospital, Oxford OX3 7LE, UK. 41Oxford NIHR Biomedical Research Centre, Churchill Hospital, Oxford OX3 7LJ, UK. 42Computational Biology & Bioinformatics Graduate Program, Duke University, Durham, North Carolina 27708, USA. 43Human Genetics Department, McGill University, Montreal, Quebec H3A 0G1, Canada. 44Departament d’Estadística i Investigació Operativa, Universitat Politècnica de Catalunya, 08034 Barcelona, Spain. 45Department of Statistics, The University of Chicago, Chicago, Illinois 60637, USA. 46Department of Human Genetics, The University of Chicago, Chicago, Illinois 60637, USA. 47Department of Statistics and Operations Research, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 48Department of Biostatistics, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 49Institute for Genomics and Systems Biology, The University of Chicago, Chicago, Illinois 60637, USA. 50Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA. 51Computational Sciences, Pfizer Inc, Cambridge, Massachusetts 02139, USA. 52Universitat de Barcelona, 08028 Barcelona, Spain. 53Department of Biomedical Data Science, Stanford University, Stanford, California 94305, USA. 54Department of Statistics, Stanford University, Stanford, California 94305, USA. 55Institute of Biophysics Carlos Chagas Filho (IBCCF), Federal University of Rio de Janeiro (UFRJ), 21941902 Rio de Janeiro, Brazil. 56Department of Psychiatry, University of Utah, Salt Lake City, Utah 84108, USA. 57Center for Data Intensive Science, The University of Chicago, Chicago, Illinois 60637, USA. 58Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, California 90095, USA. 59Department of Biostatistics, University of Michigan, Ann Arbor, Michigan 48109, USA. 60Bioinformatics Research Center and Departments of Statistics and Biological Sciences, North Carolina State University, Raleigh, North Carolina 27695, USA. 61National Institute for Biotechnology in the Negev, Beer-Sheva 84105, Israel. 62European Molecular Biology Laboratory, 69117 Heidelberg, Germany. 63Department of Ecology and Evolutionary Biology, Princeton University, Princeton, New Jersey 08540, USA. 64Altius Institute for Biomedical Sciences, Seattle, Washington 98121, USA. 65Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215, USA. 66University of Hohenheim, 70599 Stuttgart, Germany. 67Huntsman Cancer Institute, Department of Population Health Sciences, University of Utah, Salt Lake City, Utah 84112, USA. 68Center for Epigenetics, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 69Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 70Department of Mental Health, Johns Hopkins University School of Public Health, Baltimore, Maryland 21205, USA. 71McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland 21205, USA. 72Department of Biostatistics, Johns Hopkins
© 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.
ARTICLERESEARCH
GTEx ConsortiumLaboratory, Data Analysis & Coordinating Center (LDACC)—Analysis Working Group François Aguet1, Kristin G. Ardlie1, Beryl B. Cummings1,2, Ellen T. Gelfand1, Gad Getz1,3, Kane Hadley1, Robert E. Handsaker1,4, Katherine H. Huang1, Seva Kashin1,4, Konrad J. Karczewski1,2, Monkol Lek1,2, Xiao Li1, Daniel G. MacArthur1,2, Jared L. Nedzel1, Duyen T. Nguyen1, Michael S. Noble1, Ayellet V. Segrè1, Casandra A. Trowbridge1, Taru Tukiainen1,2
Statistical Methods groups—Analysis Working Group Nathan S. Abell5,6, Brunilda Balliu6, Ruth Barshir7, Omer Basha7, Alexis Battle8, Gireesh K. Bogu9,10, Andrew Brown11,12,13, Christopher D. Brown14, Stephane E. Castel15,16, Lin S. Chen17, Colby Chiang18, Donald F. Conrad19,20, Nancy J. Cox21, Farhan N. Damani8, Joe R. Davis5,6, Olivier Delaneau11,12,13, Emmanouil T. Dermitzakis11,12,13, Barbara E. Engelhardt22, Eleazar Eskin23,24, Pedro G. Ferreira25,26, Laure Frésard5,6, Eric R. Gamazon21,27,28, Diego Garrido-Martín9,10, Ariel D.H. Gewirtz29, Genna Gliner30, Michael J. Gloudemans5,6,31, Roderic Guigo9,10,32, Ira M. Hall18,19,33, Buhm Han34, Yuan He35, Farhad Hormozdiari23, Cedric Howald11,12,13, Hae Kyung Im36, Brian Jo29, Eun Yong Kang23, Yungil Kim8, Sarah Kim-Hellmuth15,16, Tuuli Lappalainen15,16, Gen Li37, Xin Li6, Boxiang Liu5,6,38, Serghei Mangul23, Mark I. McCarthy39,40,41, Ian C. McDowell42, Pejman Mohammadi15,16, Jean Monlong9,10,43, Stephen B. Montgomery5,6, Manuel Muñoz-Aguirre9,10,44, Anne W. Ndungu39, Dan L. Nicolae36,45,46, Andrew B. Nobel47,48, Meritxell Oliva36,49, Halit Ongen11,12,13, John J. Palowitch47, Nikolaos Panousis11,12,13, Panagiotis Papasaikas9,10, YoSon Park14, Princy Parsana8, Anthony J. Payne39, Christine B. Peterson50, Jie Quan51, Ferran Reverter9,10,52, Chiara Sabatti53,54, Ashis Saha8, Michael Sammeth55, Alexandra J. Scott18, Andrey A. Shabalin56, Reza Sodaei9,10, Matthew Stephens45,46, Barbara E. Stranger36,49,57, Benjamin J. Strober35, Jae Hoon Sul58, Emily K. Tsang6,31, Sarah Urbut46, Martijn van de Bunt39,40, Gao Wang46, Xiaoquan Wen59, Fred A. Wright60, Hualin S. Xi51, Esti Yeger-Lotem7,61, Zachary Zappala5,6, Judith B. Zaugg62, Yi-Hui Zhou60
Enhancing GTEx (eGTEx) groups Joshua M. Akey29,63, Daniel Bates64, Joanne Chan5, Lin S. Chen17, Melina Claussnitzer1,65,66, Kathryn Demanelis17, Morgan Diegel64, Jennifer A. Doherty67, Andrew P. Feinberg35,68,69,70, Marian S. Fernando36,49, Jessica Halow64, Kasper D. Hansen68,71,72, Eric Haugen64, Peter F. Hickey72, Lei Hou1,73, Farzana Jasmine17, Ruiqi Jian5, Lihua Jiang5, Audra Johnson64, Rajinder Kaul64, Manolis Kellis1,73, Muhammad G. Kibriya17, Kristen Lee64, Jin Billy Li5, Qin Li5, Xiao Li5, Jessica Lin5,74, Shin Lin5,75, Sandra Linder5,6, Caroline Linke36,49, Yaping Liu1,73, Matthew T. Maurano76, Benoit Molinie1, Stephen B. Montgomery5,6, Jemma Nelson64, Fidencio J. Neri64, Meritxell Oliva36,49, Yongjin Park1,73, Brandon L. Pierce17, Nicola J. Rinaldi1,73, Lindsay F. Rizzardi68, Richard Sandstrom64, Andrew Skol36,49,57, Kevin S. Smith5,6, Michael P. Snyder5, John Stamatoyannopoulos64,74,77, Barbara E. Stranger36,49,57, Hua Tang5, Emily K. Tsang6,31, Li Wang1, Meng Wang5, Nicholas Van Wittenberghe1, Fan Wu36,49, Rui Zhang5
NIH Common Fund Concepcion R. Nierras78
NIH/NCI Philip A. Branton79, Latarsha J. Carithers79,80, Ping Guan79, Helen M. Moore79, Abhi Rao79, Jimmie B. Vaught79
NIH/NHGRI Sarah E. Gould81, Nicole C. Lockart81, Casey Martin81, Jeffery P. Struewing81, Simona Volpi81
NIH/NIMH Anjene M. Addington82, Susan E. Koester82
NIH/NIDA A. Roger Little83
Biospecimen Collection Source Site—NDRI Lori E. Brigham84, Richard Hasz85, Marcus Hunter86, Christopher Johns87, Mark Johnson88, Gene Kopen89, William F. Leinweber89, John T. Lonsdale89, Alisa McDonald89, Bernadette Mestichelli89, Kevin Myer86, Brian Roe86, Michael Salvatore89, Saboor Shad89, Jeffrey A. Thomas89, Gary Walters88, Michael Washington88, Joseph Wheeler87
Biospecimen Collection Source Site—RPCI Jason Bridge90, Barbara A. Foster91, Bryan M. Gillard91, Ellen Karasik91, Rachna Kumar91, Mark Miklos90, Michael T. Moser91
Biospecimen Core Resource—VARI Scott D. Jewell92, Robert G. Montroy92, Daniel C. Rohrer92, Dana R. Valley92
Brain Bank Repository—University of Miami Brain Endowment Bank David A. Davis93, Deborah C. Mash93
Leidos Biomedical—Project Management Anita H. Undale94, Anna M. Smith95, David E. Tabor95, Nancy V. Roche95, Jeffrey A. McLean95, Negin Vatanian95, Karna L. Robinson95, Leslie Sobin95, Mary E. Barcus96, Kimberly M. Valentino95, Liqun Qi95, Steven Hunter95, Pushpa Hariharan95, Shilpi Singh95, Ki Sung Um95, Takunda Matose95, Maria M. Tomaszewski95
ELSI Study Laura K. Barker97, Maghboeba Mosavel98, Laura A. Siminoff97, Heather M. Traino97
Genome Browser Data Integration & Visualization—EBI Paul Flicek99, Thomas Juettemann99, Magali Ruffier99, Dan Sheppard99, Kieron Taylor99, Stephen J. Trevanion99, Daniel R. Zerbino99
Genome Browser Data Integration & Visualization—UCSC Genomics Institute, University of California Santa Cruz Brian Craft100, Mary Goldman100, Maximilian Haeussler100, W. James Kent100, Christopher M. Lee100, Benedict Paten100, Kate R. Rosenbloom100, John Vivian100, Jingchun Zhu100
1The Broad Institute of Massachusetts Institute of Technology and Harvard University, Cambridge, Massachusetts 02142, USA. 2Analytic and Translational Genetics Unit, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 3Massachusetts General Hospital Cancer Center and Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts 02114, USA. 4Department of Genetics, Harvard Medical School, Boston, Massachusetts 02114, USA. 5Department of Genetics, Stanford University, Stanford, California 94305, USA. 6Department of Pathology, Stanford University, Stanford, California 94305, USA. 7Department of Clinical Biochemistry and Pharmacology, Faculty of Health Sciences, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel. 8Department of Computer Science, Johns Hopkins University, Baltimore, Maryland 21218, USA. 9Centre for Genomic Regulation (CRG), The Barcelona Institute for Science and Technology, 08003 Barcelona, Spain. 10Universitat Pompeu Fabra (UPF), 08002 Barcelona, Spain. 11Department of Genetic Medicine and Development, University of Geneva Medical School, 1211 Geneva, Switzerland. 12Institute for Genetics and Genomics in Geneva (iG3), University of Geneva, 1211 Geneva, Switzerland. 13Swiss Institute of Bioinformatics, 1211 Geneva, Switzerland. 14Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, Pennsylvania 19104, USA. 15New York Genome Center, New York, New York 10013, USA. 16Department of Systems Biology, Columbia University Medical Center, New York, New York 10032, USA. 17Department of Public Health Sciences, The University of Chicago, Chicago, Illinois 60637, USA. 18McDonnell Genome Institute, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 19Department of Genetics, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 20Department of Pathology & Immunology, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 21Division of Genetic Medicine, Department of Medicine, Vanderbilt University Medical Center, Nashville, Tennessee 37232, USA. 22Department of Computer Science, Center for Statistics and Machine Learning, Princeton University, Princeton, New Jersey 08540, USA. 23Department of Computer Science, University of California, Los Angeles, California 90095, USA. 24Department of Human Genetics, University of California, Los Angeles, California 90095, USA. 25Instituto de Investigação e Inovação em Saúde (i3S), Universidade do Porto, 4200-135 Porto, Portugal. 26Institute of Molecular Pathology and Immunology (IPATIMUP), University of Porto, 4200-625 Porto, Portugal. 27Department of Clinical Epidemiology, Biostatistics and Bioinformatics, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 28Department of Psychiatry, Academic Medical Center, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands. 29Lewis Sigler Institute, Princeton University, Princeton, New Jersey 08540, USA. 30Department of Operations Research and Financial Engineering, Princeton University, Princeton, New Jersey 08540, USA. 31Biomedical Informatics Program, Stanford University, Stanford, California 94305, USA. 32Institut Hospital del Mar d’Investigacions Mèdiques (IMIM), 08003 Barcelona, Spain. 33Department of Medicine, Washington University School of Medicine, St. Louis, Missouri 63108, USA. 34Department of Convergence Medicine, University of Ulsan College of Medicine, Asan Medical Center, Seoul 138-736, South Korea. 35Department of Biomedical Engineering, Johns Hopkins University, Baltimore, Maryland 21218, USA. 36Section of Genetic Medicine, Department of Medicine, The University of Chicago, Chicago, Illinois 60637, USA. 37Department of Biostatistics, Mailman School of Public Health, Columbia University, New York, New York 10032, USA. 38Department of Biology, Stanford University, Stanford, California 94305, USA. 39Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of Oxford, Oxford OX3 7BN, UK. 40Oxford Centre for Diabetes, Endocrinology and Metabolism, University of Oxford, Churchill Hospital, Oxford OX3 7LE, UK. 41Oxford NIHR Biomedical Research Centre, Churchill Hospital, Oxford OX3 7LJ, UK. 42Computational Biology & Bioinformatics Graduate Program, Duke University, Durham, North Carolina 27708, USA. 43Human Genetics Department, McGill University, Montreal, Quebec H3A 0G1, Canada. 44Departament d’Estadística i Investigació Operativa, Universitat Politècnica de Catalunya, 08034 Barcelona, Spain. 45Department of Statistics, The University of Chicago, Chicago, Illinois 60637, USA. 46Department of Human Genetics, The University of Chicago, Chicago, Illinois 60637, USA. 47Department of Statistics and Operations Research, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 48Department of Biostatistics, University of North Carolina, Chapel Hill, North Carolina 27599, USA. 49Institute for Genomics and Systems Biology, The University of Chicago, Chicago, Illinois 60637, USA. 50Department of Biostatistics, The University of Texas MD Anderson Cancer Center, Houston, Texas 77030, USA. 51Computational Sciences, Pfizer Inc, Cambridge, Massachusetts 02139, USA. 52Universitat de Barcelona, 08028 Barcelona, Spain. 53Department of Biomedical Data Science, Stanford University, Stanford, California 94305, USA. 54Department of Statistics, Stanford University, Stanford, California 94305, USA. 55Institute of Biophysics Carlos Chagas Filho (IBCCF), Federal University of Rio de Janeiro (UFRJ), 21941902 Rio de Janeiro, Brazil. 56Department of Psychiatry, University of Utah, Salt Lake City, Utah 84108, USA. 57Center for Data Intensive Science, The University of Chicago, Chicago, Illinois 60637, USA. 58Department of Psychiatry and Biobehavioral Sciences, University of California, Los Angeles, California 90095, USA. 59Department of Biostatistics, University of Michigan, Ann Arbor, Michigan 48109, USA. 60Bioinformatics Research Center and Departments of Statistics and Biological Sciences, North Carolina State University, Raleigh, North Carolina 27695, USA. 61National Institute for Biotechnology in the Negev, Beer-Sheva 84105, Israel. 62European Molecular Biology Laboratory, 69117 Heidelberg, Germany. 63Department of Ecology and Evolutionary Biology, Princeton University, Princeton, New Jersey 08540, USA. 64Altius Institute for Biomedical Sciences, Seattle, Washington 98121, USA. 65Beth Israel Deaconess Medical Center, Harvard Medical School, Boston, Massachusetts 02215, USA. 66University of Hohenheim, 70599 Stuttgart, Germany. 67Huntsman Cancer Institute, Department of Population Health Sciences, University of Utah, Salt Lake City, Utah 84112, USA. 68Center for Epigenetics, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 69Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205, USA. 70Department of Mental Health, Johns Hopkins University School of Public Health, Baltimore, Maryland 21205, USA. 71McKusick-Nathans Institute of Genetic Medicine, Johns Hopkins School of Medicine, Baltimore, Maryland 21205, USA. 72Department of Biostatistics, Johns Hopkins
© 2017 Macmillan Publishers Limited, part of Springer Nature. All rights reserved.Donors andtheir families