Upload
others
View
5
Download
0
Embed Size (px)
Citation preview
Cloning Arabidopsis STY46
1
Haishan Gao
Cloning and Preliminary Characterization of STY46 from
Arabidopsis thaliana, a Candidate Protein Kinase Involved in
the Plant Sugar Starvation Response
Haishan Gao, Shaoyun Dong*, Diane M. Beckles
Department of Plant Sciences, University of California—Davis, California, U.S.A.
*Corresponding Author
Shaoyun Dong
Department of Plant Sciences,
University of California—Davis,
Davis, California, U.S.A.
Tel: 530 752 8821
Email: [email protected]
Cloning Arabidopsis STY46
2
Haishan Gao
Abstract
To study how plants respond to conditions under which the carbohydrates needed for growth
and development are exhausted, this project focuses on cloning and functional characterization
of a cytosolic protein kinase, STY46 that may potentially be involved in the sugar starvation
response (SSR). Generating A. thaliana STY46 knockout (-KO) and overexpression (-OE) lines
is the main method in this project to determine the function of the protein. A SALK line
(SALK_116340) was confirmed to contain a T-DNA insert in the STY46 gene and the aim was
to prove that this reduced the expression of this gene. Highly intact RNA was isolated and
reverse transcription PCR performed to determine the level of transcript of STY46 in STY46-KO.
However the results were inconclusive. This may be due to not enough amount of RNA use for
the cDNA reverse transcription. To develop an overexpression line, STY46 was cloned from
wild type Arabidopsis genotype. Primers were designed to flank the open read frame of the
STY46. They also contained restriction enzyme recognition sites and a myc-tag engineered at
their 5’ ends to facilitate subsequent synthesis of a plant transformation construct. A cDNA
fragment of the expected size was successfully amplified by PCR.
Keyword: sugar starvation response, gene cloning, protein kinase, Arabidopsis
1. Introduction
Understanding how plants respond to sugar starvation conditions is important for agriculture.
It is known that plants activate a SSR for survival when the content of cellular sugar goes down
under non-ideal conditions (Geigenberger, 2011). However, the proteins and genes that modulate
this response are not well known. Identifying proteins that regulate plant response to “famine”
Cloning Arabidopsis STY46
3
Haishan Gao
conditions can contribute to our understanding of how plants adapt to maintain normal growth
and development under adverse environments.
According to a recent report, STY46 is a protein kinase involved in chloroplast
differentiation in Arabidopsis (Lamberti et al, 2011). It facilitates pre-protein import into
chloroplast by transit peptide phosphorylation. This implies a regulatory or kinetic function
during chloroplast development and that this kinase might be important in developmental stages
that require the massive influx of nuclear encoded chloroplast proteins (Lamberti et al., 2011).
Previous research (Arias MC, 2014) aimed at identifying novel genes involved in the SSR,
showed that STY46 co-expresses with almost all of the genes within a SSR network structure
including genes involved in amino acid, lipid, and cell wall metabolism, sugar signaling and
transcription regulation. This suggests a central role for STY46 in the SSR. Furthermore,
bioinformatics analysis shows that STY46 gene expression is up-regulated under varying
conditions that leads to low sugars and nitrogen (unpublished data), consistent with a role in SSR.
It is then reasonable to assume that STY46 is a positive regulator in the SSR via affecting the
level of metabolism-related and other proteins in chloroplasts. The function of STY46 has been
hypothesized but no research has been conducted to determine its potential relation with SS.
Our goal is to test if STY46 has a critical role in the SSR. To achieve this, the project will
focus on generating and characterizing STY46-KO and STY46-OE lines. If STY46 is a positive
regulator in the SSR, then plants with lower or higher levels of protein STY46 would be
expected to show defected or better responses to SS conditions respectively, compared with
control. These changes could be examined at multiple levels, including examining (1) levels of
Cloning Arabidopsis STY46
4
Haishan Gao
SS marker metabolites, (2) carbon fluxes through primary metabolism pathways in source and
sink organ, and (3) growth parameters under ‘feast’ and ‘famine’ conditions in these genotypes.
The propose of the project is to generate STY46-KO and STY46-OE lines used for further
physiological and biochemical study, which is the fundamental step of the whole project. The
suppressed and overexpressed lines will be generated in different ways. STY46-KO Arabidopsis
lines were selected from the TAIR database (https://www.arabidopsis.org). Two lines with T-
DNA inserted in different exons of STY46 were chosen. Genetic screening was conducted to
produce T-DNA homozygous lines. Conversely, the purpose of generating an overexpression
line is to produce a line with higher STY46 protein level than wild type. STY46- KO and -OE
lines could be used to study how plants with altered level of STY46 respond to SS differently.
The long-term goal of this project is to perform a detailed physiological and biochemical
analysis of Arabidopsis lines with altered levels of this gene, which will contribute to our
understanding of the role of STY46 in plants. Furthermore, it will better illustrate the multiple
biological events that occur during SSR and its specific effects on plant productivity. The result
of the research could be extended to design better engineering strategies for agriculturally
important crops, which show more robust growth to non-ideal conditions.
2. Materials and Methods
2.1 PCR amplification of the full-length modified STY46 cDNA for cloning
2.1.1 Primer design
The sequence of the STY46 gene (gene identifier number AT4g38740) was obtained from
National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov). The left and right
Cloning Arabidopsis STY46
5
Haishan Gao
primers were designed using two websites: Primer3Plus (http://www.bioinformatics.nl/cgi-
bin/primer3plus/primer3plus.cgi) and Oligoevaluator (http://www.oligoevaluator.com/). First,
the cDNA full length gene sequence was placed into the Primer 3 Plus program with settings as
following: Primer size: Min of 18, Opt of 22 and Max of 25. Primer Tm: Min of 65, Opt of 72
and Max of 80. Primer GC%: Min. 40, Opt. 60, Max. 80. Then the given pairs of primers were
than pasted into Oligoevaluator to check for presence of primer dimers and secondary structure,
both of which should be absent ideally. The primers chosen ranged from Tm difference within
5°C, and the %GC was between 40-60%, with no or very weak secondary structure or primer
dimers.
Restriction sites (LP BamH1- CGCGGATCC, RP- PstI CTGCAGTTTT) were added to the
left primers (LP) and right primer (RP) respectively, in order to facilitate the insertion of STY46
into the expression plasmid that will be transformed into the plant using the bacterium
Agrobacterium tumefasciens. A MYC-tag (GAACAAAAACTTATTTCTGAAGAAGATCTG)
was added to the RP to facilitate Co-Immunoprecipitation of proteins in plant tissues that may
interact with STY46 in vitro in subsequent experiments. The modified primers were also checked
on Oligoevaluator. (Figure 3)
2.1.2 PCR amplification of the full-length modified STY46 cDNA for cloning
Wild type Arabidopsis cDNA was used as template to amplify STY46 gene fragment with
the designed primer LP (CCCAAGCTTATGGTGATGGAGGACAACGAGAGT) and RP
(GAGGAGAAGCACCACACATCATGAACAAAAACTTATTTCTGAAGAAGATCTG
TAGCTGCAGTTTT) (Figure 2) The PCR conditions are as follows; an initial hot start at 98°C
Cloning Arabidopsis STY46
6
Haishan Gao
for 1 min, annealing at 98°C for 20s and extension at 65°C for 2 min, subsequent denaturation at
72°C for 3 min, 35cycles, and a final extension at 72°C for 10 min. the volume of reaction
mixtures was 20 μL which contained 5 μL cDNA, 1 μL of each primer (10μM), 0.5 μL of dNTP
mix (10mM), 4 μL HF PCR buffer, 0.2 Phusion DNA polymerase (New England Biolabs) and
8.3 μL nuclease-free water.
2.1.3 Agarose Gel Electrophoresis
For every 5 μL of DNA, 1 μL loading dye was added prior to electrophoresis. The agarose
gel was made to a final concentration of 0.8% gel (w/v) (SeaKem®
LE Agarose). Ethidium
bromide was added to a final concentration of (0.1 mg/ mL) to the molten agarose to visualize
DNA on the gel. In the first lane of each gel, 5 μL of a DNA ladder (Lambda HindIII) was used
for comparison of the size of unknown DNA fragments. The gel was electrophoresed for 35 min
at 83 Volts.
2.1.4 DNA extraction from Agarose Gel
The 1.8 kb DNA fragment amplified using STY46 primers was excised from the gel and the
DNA extracted. The gel was placed into a 1.5 mL tube with a melting buffer that was three
times the volume of the gel and put into water bath at 50 °C for 10 min. The gel was incubated
for an additional 5 min and pipetted into a column. It was then centrifuged at 12000 g for 1 min.
After the flow-through was discarded, 600 uL of reagent W1 was added into the column and
centrifuged at 12000 g for 1 min. The flow-through was discarded and the sample was
centrifuged at the max speed for 3 min. The column was then placed into a recovery tube.
Cloning Arabidopsis STY46
7
Haishan Gao
Approximately 50 uL of E5 buffer was pipetted onto the column. After incubation for 1 min at
room temperature, it was then centrifuged at 12000 g for 1 min, and the DNA was collected in
the recovery tube.
2.1.5 Adenine-tailing of the PCR product
Fresh adenines are added to the ends of the DNA fragment to ensure the ligation to the
thymines on the plasmid. To 4 uL of DNA sample, the following were added: 1 μL 10x PCR
buffer, 0.3 μL 50mM MgCl2, 2 μL 1mM dATP, 1 μL AmpliTaq polymerase and 1.7 μL water.
The mixture was incubated at room temperature for 20 min.
2.1.6 Subcloning reaction
To obtain enough PCR products for STY46 sequencing, the PCR fragment was subcloned
into one of the two plasmid vectors, the TOPO pCR4.0 plasmid (Invitrogen, Carlsbad, CA)
and the pGEM-T plasmid vector described below (Promega, Madison, WC).
2.1.6.1 Ligation with TOPO®
Cloning Reaction. Here, 1 μL of PCR®4-TOPO
® vector was mixed
with 4 μL fresh PCR product and 1 μL of salt solution, and enough water to make a final volume
6 μL. Then, the sample was mixed gently and incubated for 30 min at room temperature.
2.1.6.2 Ligation with pGEM®
-T easy plasmid vector. Approximately 3 μL PCR product was
added to a solution containing 0.35 μL pGEM®-T easy vector (50 ng), 5 μL 2X raid ligation
buffer, 1 μL T4 DNA ligase (3 Weiss units/ μL) and 0.65 μL nuclease-free water to a final
volume of 10 μL. The sample was incubated at room temperature for 1 h.
Cloning Arabidopsis STY46
8
Haishan Gao
2.1.6.3 Transformation into Chemically Competent E. coli. The ligation reaction was then left on
ice and 4 μL of this mixture was added to a vial of 25 uL Chemically Competent E. coli (JM109),
mixed together and incubated on ice for 20 min. It was then heat shocked for 50 seconds at 42 °C,
and then put on ice immediately for 2 min. Approximately 950 μL of room temperature S.O.C.
medium was added and the entire tube was shaken at 37 °C for 1.5 hour at 20 rph. Finally, the
solution was spread on pre-warmed selective plates containing 20 mL Agar mixed with
Ampicillin (100 ng/ mL) and X-gal for selection. The plates were then incubated at 37 °C
overnight. The next day, clear and single white cell colonies were selected and inoculated into 5
mL LB broth with Ampicillin(100 ng/ mL) and incubated at 37 °C in shaker for at least 12 hours
for the growth.
2.1.6.4 Plasmid isolation. The QIAprep Spin Miniprep Kit (QIAGEN) was used to isolate
plasmid from overnight bacterial growth. Approximately 5 mL LB broth was pipetted into a 1.5
mL tube, centrifuged 30 s and the supernatant removed. Then, 250 μL buffer P1was added to the
tube and vortexed. Next, 250 μL buffer P2 was added and the tube was inverted gently for 4-6
times to mix. This was followed by the addition of, 350 μL N3 buffer after which the samples
were centrifuged for 10 min and then the supernatant formed was pipetted to a spin column. The
column was centrifuged for 60s and the flow-through was discarded. Next, 750 μL PE buffer was
added and the column was centrifuged for 60s to discard the flow-through. Additional 60s
centrifuge was conducted to ensure that all the liquid was discarded. Finally, the QIA columns
were put into sterile 1.5 mL tubes and added 50 μL EB buffer. After 60 s incubation at room
temperature and 60s centrifuge, the flow-through EB buffer in the 1.5 mL tubes contain the
plasmid. Then, the concentration of the plasmid samples was determined by using Nanodrop.
Cloning Arabidopsis STY46
9
Haishan Gao
2.1.6.5 Plasmid digestion. The isolated plasmid DNA was digested with either EcoRI or PstI
(Promega, Madison, WC). Approximately 2 μL plasmid DNA (~250 ng) sample was mixed
with 16.3 μL nuclease-free water, 2 μL 10×buffer 0.2 μL Acetylated BSA (10 μg/ μL). The
mixture was pipetted several times to mix completely. Then, 0.5 μL EcoRI restriction enzyme
(10 μg/ μL) was added and the solution was incubated at 37°C for 3 hours.
2.2 Characterization of Arabidopsis STY46 KO-lines.
2.2.1 Sampling plant tissues for RNA extraction
When the seedlings were 3 weeks old, young leaves were harvested into liquid nitrogen
from the Col (control) and STY46-KO lines for RNA extraction. Total RNA was isolated from
each seedling. Approximately 100 mg of tissue was finely ground in liquid nitrogen. The tissue
powder was then transferred into a 2 mL eppendorf tube, and 1 mL TRIzol reagent (Invitrogen)
was added. The sample was then shaken and incubated at room temperature for 5 min, after
which 200 μL of chloroform: isoamyl alcohol (chloroform: IAA=24:1) was added. After
vortexing and incubation at room temperature for 3 min, the sample was centrifuged at 12000 g
for 10 min at 4 °C. Next, the upper phase of the sample was transferred to a new sterile
eppendorf tube and 500 μL Isopropanol was added and incubated at room temperature for 10 min.
The solution was centrifuged at 12000 g for 10 min at 4 °C, and the supernatant t discarded.
Approximately 500 μL 4M LiCl was then added into the sample and inverted to mix.
Centrifuged at 12000g for 10 min at 4°C, the supernatant that formed was then discarded. The
sample was then resuspended in 500 μL 1×TE (pH=8.0) and added 500 μL chloroform: IAA and
inverted. Centrifuged at 12000 g for 10 min, the upper phase that formed will be taken and added
500 μL Isopropanol, 66 μL 3M Sodium Acetate (pH=5.2) and inverted to make sure the
Cloning Arabidopsis STY46
10
Haishan Gao
complete mixture. The solution was centrifuged at 12000 g for 10 min at 4 °C, and the
supernatant was discarded. Then 1 mL 75% (v/v) ethanol was added and the sample was then
centrifuged at 7500 g for 5 min at 4 °C. Finally, the pellet was dried briefly and re-dissolved in
50 μL RNA-free double distilled water and the concentration of the solution was measured by
Nanodrop Spectrophotometer. In order to check the integrity of the RNA, an Electrophoresis was
done. Extracted RNA was loaded in the well within 0.8% gel (w/v) (SeaKem® LE Agarose) with
the HindIII Lambda DNA marker.
2.2.2 Reverse Transcription Polymerase Chain Reaction (RT-PCR).
After treating the resulting RNA with a DNase I (Invitrogen, Carlsbad, CA), the RNA
concentration was measured using a Nanodrop Spectrophotometer. The RNA samples were then
transferred to sterile tubes. A master mix containing 10 μL 2xRT master mix (containing 2.0 μL
RT Buffer, 0.8 μL 100nM 25x dNTP mix, 2.0 μL10x RT Random Primer, 1.0 μL MultiScribe
Reverse Transcriptase and 4.2 μL Nuclease-free water) was added into 10 μL RNA, and the
tubes were placed in the PCR machine at 25 °C for 10 min, 37 °C for 120 min and 85 °C for 5
min. The resulting cDNA product was kept on ice.
The cDNA synthesized from the RNA samples were used to conduct the following PCR to
examine the effectiveness of the STY46-KO lines. The PCR cycling parameters were as follows;
an initial hot start at 95 °C for 10 min, annealing at 95 °C for 45s and extension at 55 °C for 45s,
subsequent denaturation at 72 °C for 1min, 28 cycles, and a final extension at 72 °C for 10 min.
The volume of reaction mixtures was 25 μL which contained 5 μL cDNA, 2 μL of each primer
(STY46-s, STY46-as, Actin-s and Actin-as (Table 2)), 1 μL MgCl2 solution, 0.5 μL of dNTP mix
Cloning Arabidopsis STY46
11
Haishan Gao
Figure 1. STY46 cDNA sequence with
the position of the primers to amplify
the full-length cDNA highlighted in
yellow.
(10mM), 2.5 μL 10xPCR buffer, 0.5 μL Taq polymerase and 7.5 μL nuclease-free water. PCR
amplified products were analyzed by using 2% (w/v) agarose gel (SeaKem® LE Agarose) with
ethidium bromide.
3. Results & Discussion
3.1 Amplification of the full-length STY46 to engineer a construct for STY46-OE lines
3.1.1 PCR amplification of cDNA
According to the reference from the website Oligoevaluator, the complementary nuclear
acids of the first 24 and the last 22 (ending code not included) base pairs (Figure 1) from the
CDS full length STY46 DNA sequence were picked as basic part of the primers for the following
amplification while requirements such as no secondary structure or dimers are considered.
Cloning Arabidopsis STY46
12
Haishan Gao
The primers designed to the sequence were modified by adding a restriction site and a myc-
tag sequence. The additional restriction site enables the gene to be digested more easily and the
myc-tag will facilitate the STY46 protein to Co-immunoprecipitation assay later (Figure 2):
Modified Sense primer:
CGCGGATCCATGGTGATGGAGGACAACGAGAGT
Modified Antisense primer:
AAAACTGCAGCTACAGATCTTCTTCAGAAATAAGTTTTTGTTCTCAATGATGTGTGG
TGCTTCTCCTC
Figure 2. The sequence of the primers including the modified ends. The BamHI site is shown in
red, the PstI site in green and the myc-tag in blue.
The modified primers were examined on Oligoevaluator (Figure 3) to ensure that the
amplification could continue successfully.
Figure 3. The result of the modified primers on Oligoevaluator
Cloning Arabidopsis STY46
13
Haishan Gao
Primers were designed to the cDNA sequence and used in a PCR reaction with a proof-
reading DNA polymerase called Phusion High Fidelity Taq. This would ensure that the cDNA
is synthesized accurately, and that the sequence of the open reading frame (ORF) would be
translated into the correct polypeptide when transformed into the plants. A band of ~1800 bp in
the first lane is in accordance with the expected size of the STY46 full-length ORF (Figure 4).
Therefore, it was cut and purified from the gel for further experimentation.
3.1.2 Subcloning the PCR product to generate enough DNA for sequencing and construct
synthesis.
DNA extracted from the agarose gel was purified and then ligated into the pCR4.0 TOPO
plasmid vector (Figure 5), and transformed into E.coli competent cells. After isolating the
plasmid DNA from the cells, we conducted a diagnostic test with restriction enzyme EcoRI to
determine whether the recombination was successful. If the STY46 full-length cDNA fragment
was cloned into the plasmid and the recombinant plasmid digested with EcoRI, there should be 3
DNA fragments of sizes: 3.9 kb, 1.1 kb, 0.7 kb.
Figure 4 Gel electrophoresis of PCR
product amplified from wild type
Arabidopsis thaliana cDNA using
primers designed to STY46
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 40 minutes at 83 volt.
Lambda HindIII marker was used to
estimate the sizes of the DNA amplified.
Cloning Arabidopsis STY46
14
Haishan Gao
Figure 5. pCR4-TOPO vector map
These bands would be generated because there is an EcoRI site inside STY46 gene at the
location of 1.1 kb and two EcoRI sites in the multiple cloning site in the vector (Figure 5). If not,
it means there is no effective recombination.
The result of the diagnostic test shows three bands, whose lengths are 3.9 kb, 2.3 kb, 1.8 kb,
which does not correspond to that expected (Figure 6).
Figure 6 Gel electrophoresis of diagnostic test:
restriction digest with EcoRI within pCR4-TOPO
vector
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 35 minutes at 83 volt. Lambda
HindIII marker was used to estimate the sizes of
the DNA amplified.
Cloning Arabidopsis STY46
15
Haishan Gao
In the 2nd
lane (P1), there are faint bands of 2.3 kb and 1.8 kb length and a clear band of 3.9
kb (the length of the vector). These results were inconclusive. There may be several reasons:
First, the sample might contain supercoiled DNA due to incomplete digestion of the plasmid
with EcoRI. Supercoiled DNA migrates faster on the gel than linear DNA leading to the
appearance of an insert that is smaller than the plasmid vector although both forms of DNA are
of identical size. The problem may have occurred during the digestion with EcoRI. Therefore,
PstI restriction enzyme was used to digest the plasmid to double check if there is an insert of the
correct size. If the ligation and transformation were successful, there should be two bands with
different lengths as 1.8 kb and 4.0 kb after digestion with PstI (See plasmid map in Figure 5).
The results showed that the sizes of bands on the gel did not comport with that if the plasmid was
recombinant. (Figure 7)
The results from both the EcoRI and PstI suggest that the settings of the PCR system might
not be the optimal for the amplification of enough DNA for efficient ligation into the vector.
Because the transformation efficiency is low, a more efficient vector, pGEM-T easy vector
(Figure 8), is used. The first test was to take the remaining PCR product and ligate it into pGEM-
Figure 7. Gel electrophoresis of diagnostic
test: restriction digest with PstI within
pCR4-TOPO vector
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 35 minutes at 83 volt.
Lambda HindIII marker was used to
estimate the sizes of the DNA amplified.
Cloning Arabidopsis STY46
16
Haishan Gao
T. The ligation protocol was followed exactly and the transformation was done using new JM109
competent bacterial cells which were purchased.
Figure 8. pGEM-T easy vector map
If the transformation of the PCR product into pGEM-T was successful, there should be three
bands- 3.0 kb, 1.1 kb, and 0.7 kb because there is a EcoRI site inside STY46 gene at the location
of 1.1 kb and two EcoRI sites inside the vector beside the insertion point.
The result did not show there is recombination because there is a faint band of about 1.5 kb
(Figure 9) in the second lane (W2) which was close to the length of STY46 gene. This fragment
was purified it and sent it to the sequence facility to determine if it is our expected gene.
However, the sequence amplified did not match any gene in Arabidopsis genome database (data
not shown).
Figure 9 Gel electrophoresis of diagnostic test:
restriction digest with EcoRI within pGEM-T easy
vector
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 35 minutes at 83 volt. Lambda
HindIII marker was used to estimate the sizes of
the DNA amplified.
Cloning Arabidopsis STY46
17
Haishan Gao
A second hypothesis is that adenine tailing of the PCR product may be inefficient. Therefore
the instead of using the high fidelity Phusion polymerase, a basic non-proofreading DNA
polymerase called AmpliTaq was used. AmpliTaq is not as precise but the PCR product would
be automatically adenylated at the end of the PCR avoiding the need to perform the adenine
tailing in a separate step.
However, the repeated PCR with AmpliTaq failed: nothing was amplified (Figure 10).
Overall, a gene fragment of the length expected has been successfully amplified by the
designed primers and purified from the gel. However, subcloning of the gene did not go well.
The longer than average length of the modified primers may have complicated the PCR. To
improve the experiment, it is suggested to amplify the STY46 ORF with gene-specific primers
(without the modified ends) in order to obtain enough for successful subcloning. Once the
sequence is verified, modified primers could be used to conduct PCR on the recombinant
plasmid to engineer the ends to STY46 DNA fragment. Such a PCR, on a pure DNA template
Figure 10 Gel electrophoresis of gene
amplification by using AmpliTaq DNA
polymerase
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 35 minutes at 83 volt. Lambda
HindIII marker was used to estimate the sizes of
the DNA amplified.
Cloning Arabidopsis STY46
18
Haishan Gao
may be more successful than using a cDNA library with 1000s of different sequences which we
attempted here.
3.2 Determining the level of STY46 transcript in STY46-KO lines.
Another important goal of this research was to determine if the STY46-KO lines were
reduced in STY46 transcript, using Reverse Transcriptase-PCR. STY46 primers were used to
amplify the cDNA of the wild type. The primers were successfully used in other experiments.
The expected outcome was that there would be reduced or no transcript in the KO-lines but a
band of ~ 370 bp amplified in the wild type. The results (Figure 11) show that there was no
product in the mutants (expected), but, surprisingly, also not in the wild type. Thus the results
were inconclusive.
We asked if the reverse transcription failed because of the degradation of the extracted RNA.
To determine this, the RNA used for the RT-PCR was examined by agarose gel electrophoresis.
The result showed that the RNA was intact, with the three ribosomal RNA bands of the expected
Figure 11. Gel electrophoresis of reverse
transcription of RNA: no suppression gene in the
STY46 line
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 45 minutes at 83 volt. Lambda
HindIII marker was used to estimate the sizes of
the DNA amplified.
Cloning Arabidopsis STY46
19
Haishan Gao
sizes (Figure 12). Therefore the lack of amplification of the expected product was not due to
degraded RNA.
A second hypothesis is that the RNA was extracted from plants that did not express STY46
at sufficiently high level to permit easy detection under the RT-PCR conditions we used.
Therefore we extracted fresh RNA from another set of KO-line plants and the Col-1 control. The
figure shows that intact RNA was isolated from these lines with the three ribosomal bands of
expected size and lightness, which shows they are intact (Figure 13).
Figure 12. Gel electrophoresis for RNA. Lanes of plants containing wild type DNA are labeled “col” while the T-
DNA mutants of STY46 were labeled k3-1 to k7-15
Shown is an agarose gel 0.8% (w/v) after electrophoresis for 45 minutes at 83 volt.
Figure 13. Electrophoresis for RNA extracted from
STY46-KO line: no degradation
Shown is an agarose gel 0.8% (w/v) after
electrophoresis for 40 minutes at 83 volt. Lambda
HindIII marker was used.
Cloning Arabidopsis STY46
20
Haishan Gao
Then, the concentration of the RNA was determined by Nanodrop Spectrophotometer (Table
1) which indicated that the concentrations were good. The 260/280 and 260/230 ratios also
indicated that the RNA was not contaminated by carbohydrates, proteins or organic compounds
used during purification (Table 1).
Table 1. The concentration of the extracted RNA from different STY46-KO Arabidopsis lines as
well as the Col-1 control
After the concentrations of the samples were diluted so that they were all of the same
concentration, the reverse transcription was conducted to synthesize cDNA from the samples.
The settings of the PCR were also optimized to promote greater synthesis of the target fragment.
Col-1 and Col-2 (cDNA synthesized from previous extracted wild type RNA) were used as
control groups to testify the effectiveness of the primer.
Cloning Arabidopsis STY46
21
Haishan Gao
Figure 14 showed that there are no bands amplified in the samples containing cDNA.
However, the last three lanes contained cDNA isolated from young seedlings of the wild-type
Arabidopsis amplified with other primers that were proven to work previously with the expected
length of 376 bp. The result shows the effectiveness of the primer.
The current hypothesis is that the amount of the cDNA synthesized was too little to be
detected during the RT-PCR because the plants from which RNA was extracted are not in the
ideal developmental state when STY46 is highly expressed. Far more RNA was needed (at least
2 micrograms) for each cDNA reaction from these older plants instead of the 700 ng we used
(Figure 14). Therefore, we may need to plant the KO line Arabidopsis seeds again to collect
leaves with highly expression of the protein.
4. Conclusion
The work started here acts as a good basis for continuing this project. Conditions for cloning
the STY46 ORF have been established and also the stage of development of the plants and the
Figure 14. Gel electrophoresis of PCR
amplification of STY46 using synthesized cDNA
from newly extracted RNA with previous
synthesized wild type cDNA as control group.
Lanes Col-1, Col-2 and N3 contained cDNA
extracted from another batch of wild type
Arabidopsis as a control.
Shown is an agarose gel 2.0% (w/v) after
electrophoresis for 45 minutes at 83 volt. Lambda
HindIII marker and 1kb marker were used to
estimate the sizes of the DNA amplified.
Cloning Arabidopsis STY46
22
Haishan Gao
amount of RNA needed to detect STY46 in the KO lines. Young seedlings harvested during
extended dark when the STY46 is highly expressed will be used to extract RNA in the future.
When generating the STY46 overexpressing lines, we add restriction site and myc-tag
directly to the primer designed to amplify the full-length of STY46 open reading frame. The
complex modified primers may lead to the unsatisfied result of PCR. To improve the experiment,
we will use simple primers (without the modified ends) to clone the STY46 into vector and use
modified primers to amplify STY46 from the vector.
After verification of the effectiveness of the KO line in the Arabidopsis thaliana and
successfully transform the overexpression gene to Arabidopsis line, the plants (KO, OE, Col-0
lines) will be grown in nutrient solution in growth chamber (12h light/ 12h dark) to characterize
the differential phenotypic and metabolic response to SS.
Because this study is focused on the function of one specific protein STY46, we didn’t
research its relationship with other protein kinases in the STY family. There may be a
compensatory function from other STY proteins in the STY46-KO lines which may complicate
the result and influence the conclusion as to role of STY46. Therefore, further study could focus
on testing the function of the whole group of the protein kinases within the knock-out line to
check if the compensation phenomenon really exists.
Cloning Arabidopsis STY46
23
Haishan Gao
References
Geigenberger P (2011) Regulation of Starch Biosynthesis in Response to a Fluctuating
Environment. Plant physiology 155 (4): 1566-1577.
Giorgia Lamberti (2011) The Cytosolic Kinases STY8, STY17, and STY46 Are Involved in
Chloroplast Differentiation in Arabidopsis. Plant Physiology, 157:70-85.
Arias MC, et al. (2014) From dusk till dawn: the Arabidopsis thaliana sugar starving responsive
network. Frontiers in plant science, 5:482.
Clough SJ & Bent AF (1998) Floral dip: a simplified method for Agrobacterium mediated
transformation of Arabidopsis thaliana. Plant Journal, 16(6): 735-743.
Acknowledgement
I would like to thank Janki Patel for her assistance in the lab.
Cloning Arabidopsis STY46
24
Haishan Gao
Appendix
Oligonucleotide name Oligonucleotide sequence Experiment
STY46-s AGGTTGCAGACTTTGGGGTG Quantitative RT PCR
STY46-as TCCCTCTTCTCCTACCTCCTTG Quantitative RT PCR
actin2-s GGTGATGGTGTGTCT Quantitative RT PCR
actin2-as ACTGAGCACAATGTTAC Quantitative RT PCR
STY46 cDNA for
CGCGGATCCATGGTGATGGAGGACAAC
GAGAGT
cloning in pCAMBIA 1300
vector
STY46 cDNA rev
AAAACTGCAGCTACAGATCTTCTTCAGA
AATAAGTTTTTGTTCATGATGTGTGGTG
CTTCTCCTC
cloning in pCAMBIA 1300
vector
Table 2: the oligonucleotides used in the experiments.